WO2014046051A1 - Novel dna, and method for producing carotenoid using same - Google Patents

Abstract

The present invention addresses the problem of providing: novel DNA; and a method for producing a carotenoid using the DNA. Provided are: novel DNA encoding a protein involved in the production of a carotenoid in Xanthophyllomyces dendrorhous; a vector carrying the DNA; a transformant produced by transforming a host cell with the vector; and a method for producing a carotenoid, comprising a step of culturing a cell which is so modified as to express the DNA at an increased level by a genetic engineering technique.

Description

Novel DNA and method for producing carotenoid using the same

The present invention relates to a novel DNA derived from an organism belonging to the genus Xanthophyllomyces, and a method for producing a carotenoid using the DNA.

Carotenoid is a general term for compounds having a basic structure of the chemical formula C40H56, which are pigments of yellow, red, purple, etc. possessed by plants, animals, microorganisms and the like. About 600 types of natural carotenoids are known, such as β-carotene, α-carotene, lycopene, lutein, zeaxanthin, and astaxanthin. Astaxanthin is widely used as an additive for feed for improving the color tone of cultured fish meat and skin, egg yolk of chicken eggs and the like, and has recently attracted attention as a functional food material.

Xanthophyllomyces dendrorous (former name: Phaffia rhodozyma) is known as a yeast that specifically produces astaxanthin, and has attracted attention as one of the means to industrially produce astaxanthin. ing. Against this background, many strain improvement studies have been carried out to obtain astaxanthin high-producing strains from Xanthophyllomyces dendrhaus, and initially random mutagenesis has been used exclusively for strain improvement. It was. However, acquisition of a high astaxanthin-producing strain by the random mutagenesis method requires a great deal of time and labor, and recently, strain improvement studies using genetic engineering techniques have been attempted.

For example, Non-Patent Document 1 discloses a transformation method in which a foreign gene is introduced into ribosomal DNA present in the chromosome of Xanthophyllomyces dendroth using homologous recombination.

Patent Document 1 discloses DNA encoding three types of enzymes that catalyze the reaction of geranylgeranyl pyrophosphate to β-carotene on the carotenoid biosynthetic pathway of Xanthophylomyces dendroas, and those DNAs. Disclosed is a transformant obtained by introducing an expression vector containing Xanthophyllomyces dendroth.

Further, Patent Document 2 discloses 3-hydroxy-3-methylglutaryl-coenzyme A synthase, 3-hydroxy-3-methylglutaryl-coenzyme A reduction on the mevalonate pathway of Xanthophylomyces dendroas. Production of carotenoids comprising culturing host cells transformed with enzymes, mevalonate kinase, DNA encoding mevalonate pyrophosphate decarboxylase, and farnesyl pyrophosphate synthase, respectively, and vectors containing these DNAs The law is disclosed.

International Publication No. 97/23633 Pamphlet JP 2000-50884 A

An object of the present invention is to provide a novel DNA and a method for producing a carotenoid using the DNA.

The present inventors have found a novel DNA encoding a protein involved in the production of carotenoids of Xanthophyllomyces dendroas. Furthermore, the present inventors have found that by enhancing the expression of the DNA in living cells, the carotenoid production ability of the living cells is improved, and the present invention has been completed.

That is, the present invention
The following (A) to (H):
(A) DNA containing the base sequence shown in SEQ ID NO: 1 in the sequence listing;
(B) a DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the Sequence Listing;
(C) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 1 in the Sequence Listing;
(D) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 1 in the Sequence Listing;
(E) a DNA comprising the base sequence shown in SEQ ID NO: 2 in the sequence listing;
(F) DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 2 in the Sequence Listing;
(G) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 2 in the Sequence Listing;
(H) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 2 in the Sequence Listing;
It relates to any one of DNA.

The present invention also provides the following (I) to (K):
(I) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing;
(J) a polypeptide comprising an amino acid sequence having 85% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing;
(K) a polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, inserted, substituted and / or added in the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing;
The present invention relates to a DNA encoding any of the polypeptides.

Furthermore, the present invention provides
The following (L) to (S):
(L) a DNA comprising the base sequence represented by SEQ ID NO: 20 in the sequence listing;
(M) a DNA that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 20 in the sequence listing;
(N) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 20 in the Sequence Listing;
(O) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 20 in the Sequence Listing;
(P) a DNA comprising the base sequence shown in SEQ ID NO: 21 in the sequence listing;
(Q) DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 21 in the Sequence Listing;
(R) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 21 in the Sequence Listing;
(S) DNA consisting of a base sequence obtained by deleting, inserting, substituting and / or adding one or more bases in the base sequence shown in SEQ ID NO: 21 in the Sequence Listing;
It relates to any one of DNA.

Furthermore, the present invention provides the following (T) to (V):
(T) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 22 of the Sequence Listing;
(U) a polypeptide comprising an amino acid sequence having 85% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22 in the Sequence Listing;
(V) a polypeptide comprising an amino acid sequence obtained by deleting, inserting, substituting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO: 22 in the Sequence Listing;
The present invention relates to a DNA encoding any of the polypeptides.

The DNA is preferably derived from an organism belonging to the genus Xanthophyllomyces.

It is preferable that the organism is Xanthophyllomyces dendroas.

The present invention also relates to a vector comprising one or more of the DNAs.

It is preferable that the vector further includes one or more DNAs including a part or all of the base sequence of the promoter of the actin gene, the promoter of the alcohol dehydrogenase IV gene, and / or the promoter of the triose phosphate isomerase gene.

The present invention also relates to a transformant obtained by transforming a host cell with the vector.

It is preferable that the transformant has a carotenoid producing ability.

The host cell is preferably a cell of an organism belonging to the genus Xanthophyllomyces.

It is preferable that the organism belonging to the genus Xanthophyllomyces is Xanthophyllomyces dendroas.

In addition, the present invention relates to a method for producing carotenoid, which includes a step of culturing a cell to which expression of the DNA is imparted and / or enhanced and has carotenoid-producing ability using a gene recombination technique.

The cell having the ability to produce carotenoids is preferably a cell of an organism belonging to the genus Xanthophyllomyces.

It is preferable that the organism belonging to the genus Xanthophyllomyces is Xanthophyllomyces dendroas.

INDUSTRIAL APPLICABILITY According to the present invention, there are provided a novel DNA encoding a protein involved in carotenoid production of Xanthophyllomyces dendroas, and an efficient method for producing carotenoid using the DNA.

It is a figure which shows the examination result of the promoter activity in Example 9.

Hereinafter, the present invention will be described in detail using embodiments. In addition, this invention is not limited by these.

The present invention is the DNA according to any of the following (A) to (D):
(A) DNA containing the base sequence shown in SEQ ID NO: 1 in the sequence listing;
(B) a DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the Sequence Listing;
(C) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 1 in the Sequence Listing;
(D) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 1 in the sequence listing.

Furthermore, the present invention is the DNA according to any one of the following (L) to (O):
(L) a DNA comprising the base sequence represented by SEQ ID NO: 20 in the sequence listing;
(M) a DNA that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 20 in the sequence listing;
(N) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 20 in the Sequence Listing;
(O) DNA consisting of a base sequence obtained by deleting, inserting, substituting and / or adding one or more bases in the base sequence shown in SEQ ID NO: 20 in the Sequence Listing.

Here, “DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the Sequence Listing” means the base sequence shown in SEQ ID NO: 1 in the Sequence Listing. It means DNA obtained by using colony hybridization method, plaque hybridization method, Southern hybridization method or the like under stringent conditions using DNA consisting of a complementary base sequence as a probe.

Further, “DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 20 in the sequence listing” is complementary to the base sequence shown in SEQ ID NO: 20 in the sequence listing. It means DNA obtained by using a colony hybridization method, plaque hybridization method, Southern hybridization method or the like under stringent conditions using a DNA having a typical nucleotide sequence as a probe.

Hybridization can be performed according to the method described in Molecular Cloning, A laboratory manual, second edition (Cold Spring Harbor Laboratory Press, 1989) and the like. Here, “DNA that hybridizes under stringent conditions” means, for example, using a filter on which colony or plaque-derived DNA is immobilized at 65 ° C. in the presence of 0.7 to 1.0 M NaCl. After hybridization, the filter was washed under conditions of 65 ° C. using a 2 × concentration SSC solution (composition of 1 × concentration SSC solution consisting of 150 mM sodium chloride and 15 mM sodium citrate). The DNA which can be acquired can be mentioned. It is preferably washed with an SSC solution of 0.5 times concentration at 65 ° C., more preferably washed with an SSC solution of 0.2 times concentration at 65 ° C., more preferably washed with an SSC solution of 0.1 times concentration at 65 ° C. DNA that can be obtained by

Although the hybridization conditions have been described as described above, the conditions are not particularly limited. A plurality of factors such as temperature and salt concentration can be considered as factors affecting the stringency of hybridization, and those skilled in the art can realize optimum stringency by appropriately selecting these factors.

Under the above conditions, DNA that can hybridize with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the sequence listing has a sequence identity of 70% or more with the DNA shown in SEQ ID NO: 1. And preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, still more preferably 95% or more, and most preferably 98% or more.

In addition, as a DNA that can hybridize with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 20 in the sequence listing under the above conditions, the sequence identity with the DNA shown in SEQ ID NO: 20 is 70. % Or more, preferably 80% or more, more preferably 85% or more, still more preferably 90% or more, still more preferably 95% or more, and most preferably 98% or more.

Here, “sequence identity (%)” means that the two DNAs to be compared are optimally aligned, and the nucleobases (eg, A, T, C, G, U, or I) match in both sequences. The number of positions is divided by the total number of comparison bases, and the result is expressed by a value obtained by multiplying by 100.

Sequence identity can be calculated using, for example, the following sequence analysis tools: GCG Wisconsin Package (Program Manual for The Wisconsin Package, Version 8, September 1994, Genetics Computer Group, ce. 53711; Rice, P. (1996) Program Manual for EGCG Package, Peter Ricé, The Sanger Center, Hinxton Hall, Cambridge, CB10 1Q, 1R, EnPl. Wide Web molecular biology for the server (Geneva University Hospital and University of Geneva, Geneva, Switzerland).

The “plurality of bases” described above is, for example, 600 or less, preferably 300 or less, more preferably 100 or less, still more preferably 50 or less, 20 or less, 10 or less, or 5 The following bases are meant.

The organism that is the origin of the DNA described in any of (A) to (D) and (L) to (O) is not particularly limited, but an organism that produces a carotenoid is preferable and belongs to the genus Xanthophyllomyces. More preferred are organisms, more preferred are organisms belonging to the species Xanthophyllomyces dendroas, and even more preferred is Xanthophyllomyces dendroas NBRC10129 strain. Xanthophyromyces Dendroas NBRC10129 strain is to be obtained from the Biotechnology Division, Biotechnology Headquarters, National Institute of Technology and Evaluation (NBRC: 2-5-8 Kazusa Kamashichi, Kisarazu City, Chiba Prefecture 292-0818) Can do.

The method for isolating the DNA from the organism that is the origin of the DNA is not particularly limited. For example, PCR (Polymerase Chain Reaction) is performed using the chromosomal DNA of the organism that is the origin of the DNA as a template and using primers. Thus, the DNA can be amplified. If the DNA can be amplified, those skilled in the art can isolate the DNA by a known method. For example, it can be isolated by ligating the amplified DNA to a suitable cloning vector and introducing it into a suitable host cell.

Examples of the primer include SEQ ID NO: 4 and SEQ ID NO: 5 for the DNA described in any of (A) to (D) above, and the DNA described in any of (L) to (O) above. Includes a primer combination consisting of the DNA sequences represented by SEQ ID NO: 23 and SEQ ID NO: 24. When the organism from which the DNA is derived is a eukaryote, the DNA thus obtained can contain an untranslated sequence such as an intron.

The present invention is also the DNA according to any one of the following (E) to (H):
(E) a DNA comprising the base sequence shown in SEQ ID NO: 2 in the sequence listing;
(F) DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 2 in the Sequence Listing;
(G) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 2 in the Sequence Listing;
(H) DNA consisting of a base sequence obtained by deleting, inserting, substituting and / or adding one or more bases in the base sequence shown in SEQ ID NO: 2 in the Sequence Listing.

The present invention is further a DNA according to any one of the following (P) to (S):
(P) a DNA comprising the base sequence shown in SEQ ID NO: 21 in the sequence listing;
(Q) DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 21 in the Sequence Listing;
(R) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 21 in the Sequence Listing;
(S) DNA consisting of a base sequence obtained by deleting, inserting, substituting and / or adding one or more bases in the base sequence shown in SEQ ID NO: 21 in the Sequence Listing.

The organism that is the origin of the DNA described in any of (E) to (H) and (P) to (S) is not particularly limited, but an organism that produces carotenoid is preferable, and belongs to the genus Xanthophyllomyces. More preferred are organisms, more preferred are organisms belonging to the species Xanthophyllomyces dendroas, and even more preferred is Xanthophyllomyces dendroas NBRC10129 strain. Xanthophyromyces Dendroas NBRC10129 strain is to be obtained from the Biotechnology Division, Biotechnology Headquarters, National Institute of Technology and Evaluation (NBRC: 2-5-8 Kazusa Kamashichi, Kisarazu City, Chiba Prefecture 292-0818) Can do.

The method for isolating the DNA from the organism that is the source of the DNA is not particularly limited. For example, PCR (Polymerase Chain Reaction) is performed using the cDNA of the organism that is the source of the DNA as a template and using primers. Thus, the DNA can be amplified. If the DNA can be amplified, those skilled in the art can isolate the DNA by a known method. For example, it can be isolated by ligating the amplified DNA to a suitable cloning vector and introducing it into a suitable host cell. Examples of the primer include SEQ ID NO: 4 and SEQ ID NO: 5 in the case of DNA described in any of (E) to (H) above, and the DNA described in any of (P) to (S) above. Includes a primer combination consisting of the DNA sequences represented by SEQ ID NO: 23 and SEQ ID NO: 24. Since the DNA thus obtained does not contain an intron sequence, analysis of the base sequence of the DNA reveals the amino acid sequence of the polypeptide encoded by the DNA. The polypeptide encoded by the DNA is not particularly limited. For example, in the case of the DNA described in any of (E) to (H) above, any of SEQ ID NO: 3 and any of (P) to (S) above In the case of the described DNA, a polypeptide having the amino acid sequence represented by SEQ ID NO: 22 is exemplified. In the above (E) to (H) and (P) to (S), DNA that hybridizes under stringent conditions, sequence identity, and base deletion, insertion, substitution, and / or addition are represented by (A ) To (D) and (L) to (O).

The present invention is also a DNA encoding the polypeptide according to any of the following (I) to (K):
(I) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing;
(J) a polypeptide comprising an amino acid sequence having 85% or more sequence identity to the amino acid sequence set forth in SEQ ID NO: 3 in the Sequence Listing;
(K) A polypeptide comprising an amino acid sequence obtained by deleting, inserting, substituting, and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing.

The present invention further relates to a DNA encoding the polypeptide according to any one of the following (T) to (V):
(T) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 22 of the Sequence Listing;
(U) a polypeptide comprising an amino acid sequence having 85% or more sequence identity with the amino acid sequence set forth in SEQ ID NO: 22 in the Sequence Listing;
(V) A polypeptide comprising an amino acid sequence obtained by deleting, inserting, substituting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO: 22 of the Sequence Listing.

DNA encoding the polypeptide described in (K) and (V) above can be prepared according to a known method described in Current Protocols in Molecular Biology (John Wiley and Sons, Inc, 1989).

In the amino acid sequences shown in SEQ ID NO: 3 and SEQ ID NO: 22 in the sequence listing, there are no particular restrictions on where amino acids are substituted, inserted, deleted and / or added, but it is preferable to avoid highly conserved regions. Here, the highly conserved region represents a position where amino acids are matched between a plurality of sequences when amino acid sequences are optimally aligned and compared for a plurality of enzymes having different origins. The highly conserved region can be confirmed by comparing the amino acid sequence shown in SEQ ID NO: 3 or 22 with the amino acid sequence of a known protein using a tool such as GENETYX.

The amino acid sequence modified by substitution, insertion, deletion and / or addition may include only one type of modification (for example, substitution), or two or more modifications (for example, substitution and substitution). Insertion).

In the case of substitution, the amino acid to be substituted is preferably an amino acid having a property similar to that of the amino acid before substitution (cognate amino acid). Here, amino acids within the same group of the following groups are considered homologous amino acids:
(Group 1: neutral nonpolar amino acids) Gly, Ala, Val, Leu, Ile, Met, Cys, Pro, Phe;
(Group 2: neutral polar amino acids) Ser, Thr, Gln, Asn, Trp, Tyr;
(Group 3: acidic amino acids) Glu, Asp;
(Group 4: basic amino acids) His, Lys, Arg.

The “plural amino acids” described above are, for example, 100 or less, preferably 50 or less, more preferably 20 or less, still more preferably 15 or less, and even more preferably 10 or less, 5 or less. It means 4 or less, 3 or less, or 2 or less amino acids.

Sequence identity between the polypeptide described in (J) above and the amino acid sequence of SEQ ID NO: 3 in the sequence listing, and sequence identity between the polypeptide described in (U) above and the amino acid sequence of SEQ ID NO: 22 are: Both are 85% or more, preferably 90% or more, more preferably 95% or more, still more preferably 98% or more, and most preferably 99% or more.

The sequence identity of amino acid sequences is determined by comparing the amino acid sequence shown in SEQ ID NO: 3 or 22 in the sequence listing with the amino acid sequence to be evaluated, and comparing the number of amino acid matches in both sequences. It is expressed by a value obtained by dividing by 100 and multiplying by 100.

The DNA of the present invention may be any DNA as long as it can participate in carotenoid production in a host cell introduced according to the method described below, and may contain any untranslated region.

The present invention also relates to a vector comprising the DNA of the present invention. The vector used in the present invention is not particularly limited as long as the DNA of the present invention can be introduced into a desired host cell. For example, it can be introduced into a plasmid vector, a phage vector, a cosmid vector, or a plurality of types of hosts. A simple shuttle vector can be used. The DNA of the present invention is preferably linked to a vector by adding an expression promoter, terminator and the like effective in a desired host cell. Vectors and promoters that can be used in various organisms are described in detail in "Basic Course of Microbiology 8 Genetic Engineering / Kyoritsu Shuppan".

Examples of promoters and terminators that can be used in the present invention include promoters and terminators of glyceraldehyde-3-phosphate dehydrogenase gene, actin gene, glutamate dehydrogenase gene, alcohol dehydrogenase IV gene, or triose phosphate isomerase gene.

The promoters and terminators listed above may contain part or all of the base sequence, and can be designed in a timely manner according to the purpose of those skilled in the art if they function as promoters and terminators in the host cell.

Specific examples of the actin gene promoter that can be used in the present invention include the DNAs described in any of (1-1) to (1-5) below.
(1-1) DNA comprising the base sequence shown in SEQ ID NO: 25 in the sequence listing;
(1-2) DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in SEQ ID NO: 25 in the Sequence Listing;
(1-3) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 25 in the sequence listing;
(1-4) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 25 in the Sequence Listing;
(1-5) A DNA comprising part or all of the DNA according to any one of (1-1) to (1-4) and having promoter activity in a host cell.

Furthermore, examples of the promoter of the alcohol dehydrogenase IV gene that can be used in the present invention include the DNAs described in any of the following (2-1) to (2-5).
(2-1) DNA comprising the base sequence shown in SEQ ID NO: 27 in the sequence listing;
(2-2) DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in SEQ ID NO: 27 of the Sequence Listing;
(2-3) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 27 of the Sequence Listing;
(2-4) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 27 in the Sequence Listing;
(2-5) A DNA comprising a part or all of the DNA according to any one of (2-1) to (2-4) and having promoter activity in a host cell.

Furthermore, examples of the promoter of the triose phosphate isomerase gene that can be used in the present invention include the DNAs described in any of (3-1) to (3-5) below.
(3-1) DNA comprising the base sequence shown in SEQ ID NO: 28 in the sequence listing;
(3-2) DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in SEQ ID NO: 28 in the Sequence Listing;
(3-3) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 28 of the Sequence Listing;
(3-4) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 28 in the Sequence Listing;
(3-5) DNA comprising a part or all of the DNA according to any one of (3-1) to (3-4) and having promoter activity in a host cell.

Here, in the promoter, DNA that hybridizes under stringent conditions, sequence identity, and base deletion, insertion, substitution, and / or addition are as described above in (A) to (D) and (L). The same as in (O).

Specific examples of the actin gene terminator that can be used in the present invention include the DNAs described in any of the following (4-1) to (4-5).
(4-1) DNA comprising the base sequence shown in SEQ ID NO: 26 in the sequence listing;
(4-2) DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in SEQ ID NO: 26 in the Sequence Listing;
(4-3) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 26 in the sequence listing;
(4-4) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 26 in the Sequence Listing;
(4-5) DNA comprising a part or all of the DNA according to any one of (4-1) to (4-4) and functioning as a terminator in the host cell.

Furthermore, examples of the terminator of the alcohol dehydrogenase IV gene that can be used in the present invention include the DNAs described in any of the following (5-1) to (5-5).
(5-1) DNA comprising the base sequence shown in SEQ ID NO: 29 in the sequence listing;
(5-2) DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in SEQ ID NO: 29 of the Sequence Listing;
(5-3) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 29 in the Sequence Listing;
(5-4) DNA consisting of a base sequence obtained by deleting, inserting, substituting, and / or adding one or more bases in the base sequence shown in SEQ ID NO: 29 of the Sequence Listing;
(5-5) DNA comprising a part or all of the DNA according to any one of (5-1) to (5-4) and functioning as a terminator in the host cell.

Furthermore, examples of the terminator of the triose phosphate isomerase gene that can be used in the present invention include the DNAs described in any of (6-1) to (6-5) below.
(6-1) DNA containing the base sequence shown in SEQ ID NO: 30 in the sequence listing;
(6-2) DNA that hybridizes under stringent conditions with a DNA having a base sequence complementary to the base sequence shown in SEQ ID NO: 30 in the Sequence Listing;
(6-3) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 30 in the sequence listing;
(6-4) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 30 in the Sequence Listing;
(6-5) DNA comprising a part or all of the DNA according to any one of (6-1) to (6-4) and functioning as a terminator in the host cell.

Here, in the terminator, DNA that hybridizes under stringent conditions, sequence identity, and base deletion, insertion, substitution, and / or addition are as described above in (A) to (D) and (L). The same as in (O).

Although the vector containing the DNA of the present invention is not particularly limited, an example is plasmid pUCRPKT-PT (see Example 2).

The present invention also relates to a transformant obtained by transforming a host cell with the vector. The host cell transformed with the vector containing the DNA of the present invention is not particularly limited, and examples thereof include, for example, the genus Escherichia, the genus Bacillus, the genus Pseudomonas, the genus Serratia, the genus Brevibacterium, and the like. (Brevibaterium), Corynebacterium, Streptococcus, Brevundimonas, Erythrobacter, Agrobacterium, and Agrobacterium Bacteria such as Lactobacillus genus, Rhodoco Actinomycetes such as the genus Rhodococcus and the genus Streptomyces, the genus Saccharomyces, the genus Kluyveromyces, the genus Schizosaccharomyces cerevisiae, Yarrowia genus, Trichosporon genus, Rhodosporidium genus, Pichia genus, Candida genus, and Xanthophylomyces genus, Neurospora genus, Aspergillus genus, Aspergillus Aspergillus), Cephalosporus (Cephalosporium) and molds such as Trichoderma, Algae such as Haematococcus, Chlamydomonas, and Monaphidium, In addition to the cells of Labyrinthula such as (Diplophyrys), plant cells and animal cells such as tobacco, lettuce and rapeseed may be used, but preferred host cells are cells of the genus Xanthophylomyces More preferably, it is a cell of Xanthophylomyces dendroas.

A method for introducing the vector containing the DNA of the present invention into a host cell is not particularly limited, and a known method can be used. For example, when Xanthophylomyces dendroasu cells are used as host cells, electroporation can be used (see Example 3). After the introduction of the vector, the DNA of the present invention may be maintained independently of the host cell chromosome or may be inserted into the host cell chromosome. Furthermore, since a plurality of rDNA sequences and the like are present in the chromosome, a plurality of rDNA sequences can be inserted into the host cell chromosome by placing the DNA of the present invention in the rDNA sequence.

The present invention also provides a method for producing carotenoids, comprising a step of culturing cells having the ability to express the DNA of the present invention and / or enhanced and having carotenoid-producing ability using a genetic recombination technique. is there.

Cells to which the ability to express the DNA of the present invention is imparted and / or enhanced using a gene recombination technique are not limited to transformants obtained by transforming host cells with a vector containing the DNA of the present invention. . For example, a genetic recombination technique using a cell that originally has the DNA of the present invention and that functions as an expression promoter for the gene and / or a DNA that functions to regulate the expression of the gene. A cell obtained by substituting, adding, destroying and / or deleting using a DNA can be obtained without transforming a host cell with a vector containing the DNA of the present invention, but is capable of expressing the DNA of the present invention. As long as is imparted and / or enhanced, the ability to express the DNA of the present invention using genetic recombination techniques is encompassed by the imparted and / or enhanced cells.

Cells having carotenoid production ability are not limited to cells originally having carotenoid production ability, and cells to which carotenoid production ability is imparted using a genetic recombination technique are also included.

Cells having the ability to express the DNA of the present invention using a gene recombination technique and / or enhanced, and having carotenoid-producing ability are not particularly limited, but preferably an organism belonging to the genus Xanthophyllomyces More preferably, it is a Xanthophyllomyces dendroas cell.

A method for culturing a cell having the ability to express the DNA of the present invention using a gene recombination technique and imparted and / or enhanced and having the ability to produce carotenoid is not particularly limited, and the cell grows to produce carotenoid. As long as it is possible, it may be cultured under any medium composition and culture conditions.

A method for obtaining carotenoids from a culture of cells that are imparted and / or enhanced with the ability to express the DNA of the present invention using a gene recombination technique and that has carotenoid production ability is not particularly limited, and is publicly known. It can be implemented using the techniques alone or in combination. For example, the carotenoid-containing dried product can be obtained by drying the culture using techniques such as spray drying, drum drying, freeze drying and the like. In addition, for example, a carotenoid-containing extract can be obtained by extracting the culture with an appropriate solvent and then distilling off the solvent. Furthermore, a carotenoid-containing extract can be purified to obtain a highly pure carotenoid.

In the present invention, the carotenoid is not particularly limited. For example, α-carotene, β-carotene, γ-carotene, δ-carotene, lycopene, β-cryptoxanthin, adonixanthin, phenicoxanthine, lutein, echinone, hydroxyexine Examples thereof include nenone, zeaxanthin, canthaxanthin, fucoxanthin, anthaxanthin, violaxanthin, and astaxanthin, and astaxanthin is particularly preferable.

EXAMPLES Hereinafter, although an Example demonstrates this invention in detail, this invention is not limited by these. Detailed operation methods relating to the recombinant DNA technology used in the following examples are described in the following documents:
Molecular Cloning 2nd Edition (Cold Spring Harbor Laboratory Press, 1989),
Current Protocols in Molecular Biology (Greene Publishing Associates and Wiley-Interscience).

Example 1 (Isolation of DNA (SEQ ID NOs: 1 and 2))
According to the following method, the DNA of the present invention was isolated from Xanthophyllomyces dendrhaus NBRC10129 strain.

(Preparation of PCR primers)
From the chromosomal DNA sequence information of Xanthophyllomyces dendrhaus NBRC10129 strain, primer 1 (5'-CTCGTCCGAGGCATCGCGGATCGCCGCGATAGCACCCCCCTATC, CCAGCGCTATC, CCACCGCTATC, CCACCGCTATC, CCACCGCTATC Primer 2 (5′-CTGCTTCGTGAGGCCTACGCGTACTAGTCCCCGGGCTACGACAATTCCCTCAAACCGGTG-3 ′) was designed and synthesized.

(Amplification of gene (SEQ ID NO: 1) by PCR)
Chromosomal DNA was extracted from the cells of Xanthophyllomyces dendrrous NBRC10129 strain using Gen Torukun ^TM (manufactured by Takara Bio Inc.) according to the instruction manual. Next, PCR was performed using the DNA primer prepared above and the obtained chromosomal DNA as a template. As a result, a DNA fragment of about 2.3 kbp that was considered to contain the target gene was amplified. PCR was performed using PrimeSTAR HS (manufactured by Takara Bio Inc.) as a DNA polymerase, and the reaction conditions were in accordance with the instruction manual. This DNA fragment was subjected to direct sequencing using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems Japan Co., Ltd.) and Applied Biosystems 3130xl Genetic Analyzer (Applied Biosystems Japan Co., Ltd.), and the base sequence was analyzed. The resulting chromosomal DNA sequence is shown in SEQ ID NO: 1 in the sequence listing.

(Determination of cDNA sequence (SEQ ID NO: 2) and amino acid sequence (SEQ ID NO: 3))
Total RNA was prepared from cells of Xanthophyllomyces dendrhaus NBRC10129 strain using RNeasy Plant Mini Kit (Qiagen) according to the instruction manual. From this total RNA, cDNA was prepared using RNA LA PCR KIT (manufactured by Takara Bio Inc.) according to the instruction manual, and PCR was performed using the DNA primer prepared above as a template. An approximately 1.6 kbp DNA fragment thought to contain the gene was amplified. This DNA fragment was subjected to direct sequencing using BigDye Terminator Cycle Sequencing Kit (Applied Biosystems Japan Co., Ltd.) and Applied Biosystems 3130xl Genetic Analyzer (Applied Biosystems Japan Co., Ltd.), and the base sequence was analyzed. The resulting cDNA sequence is shown in SEQ ID NO: 2 in the sequence listing. The amino acid sequence deduced from the cDNA sequence is shown in SEQ ID NO: 3 in the sequence listing.

(Example 2) (Construction of vector)
First, primer 3 (5′-CAGGAATTCCGGCAAGTCGAGGGAACCCGAGAG-3 ′) shown in SEQ ID NO: 6 and primer 4 shown in SEQ ID NO: 7 in the sequence listing, designed with reference to WO 97/23633 pamphlet. Using (5′-CACGAGCTCGATGGTAAGAGGTTAGAGAAGTAG-3 ′), PCR was performed using the chromosomal DNA of Xanthophyllomyces dendrhaus NBRC10129 strain as a template, and the promoter of glyceraldehyde-3-phosphate dehydrogenase Amplified. This was digested with restriction enzymes EcoRI and SacI and inserted into similarly digested plasmid pUC19 (manufactured by Takara Bio Inc.) to prepare plasmid pUC19P.

Next, primer 5 (5′-CAGCTGCAGACGGTTCTCCAAAACCCTTC-3 ′) shown in SEQ ID NO: 8 and primer shown in SEQ ID NO: 9 in the sequence listing, designed with reference to WO 97/23633 pamphlet 6 (5′-CACAAGCTTTGGAAGGGCTGCTGGATGGGACTGG-3 ′) was used to perform PCR using the chromosomal DNA of Xanthophyllomyces dendrhaus NBRC10129 strain as a template, and glyceraldehyde-3-phosphate dehydrogenase sequence Was amplified. This was digested with restriction enzymes PstI and HindIII and inserted into the similarly digested plasmid pUC19P to prepare plasmid pUC19PT.

Next, using the primer 7 (5′-CAGCCCGGGATGATTGAACAAGATGGGATTGCACG-3 ′) shown in the sequence listing and the primer 8 (5′-CACGTCGAACTCAGAAGAAACTCGTCCAAGAAGGCG-3 ′) shown in the sequence listing 11 in the sequence listing, the plasmid pHSG298 PCR was carried out using TAKARA BIO INC. As a template to amplify the kanamycin resistance gene. This was digested with restriction enzymes SmaI and SalI and inserted into the similarly digested plasmid pUC19PT to prepare plasmid pUC19PKT.

Next, Gene. 1997 Jan 3; 184 (1): 89-97, the primer 9 (5′-CAGCATATGTTCCGTAGGTGAACCTGCGGAAGG-3 ′) shown in the sequence listing and the primer shown in the sequence listing 13 in the sequence listing. PCR was carried out using 10 (5′-CACCATATGCTTTTCCTCCCGCTTATTGATATGC-3 ′) using the chromosomal DNA of Xanthophyllomyces dendrrous NBRC10129 strain as a template to amplify a part of the ribosomal DNA. This was digested with restriction enzyme NdeI and inserted into similarly digested plasmid pUC19 to prepare plasmid pUC19R.

Next, using the primer 11 (5′-CAGATCGATCCGGCAGAGTCGAGGGAACCCGAGAG-3 ′) shown in the sequence listing and the primer 12 (5′-CACATCGATTTGGAAGGCTGCTGATGGGACTGG-3 ′) shown in the sequence listing 15 in the sequence listing, the plasmid pUC19PKT Was used as a template to amplify DNA in which a kanamycin resistance gene was inserted between the promoter and terminator of the glyceraldehyde-3-phosphate dehydrogenase gene. This was digested with the restriction enzyme ClaI and inserted into the similarly digested plasmid pUC19R to prepare plasmid pUC19RPKT.

Next, using primer 13 (5′-GGTTCTCGCTTCGAACGGCAAGTCGAGGGG-3 ′) shown in SEQ ID NO: 16 in the sequence listing and primer 14 (5′-CTTGTTCAATCATCCCGCGGATATCGCTAGCGGATGGTATAAGAGGTpGA19TC) using the primers shown in SEQ ID NO: 17 in the sequence listing Was used as a template to amplify the promoter sequence of the glyceraldehyde-3-phosphate dehydrogenase gene. This was treated with restriction enzymes BstBI and SacII to prepare DNA fragment P for insertion into plasmid pUC19RPKT.

Next, primer 15 (5′-CGCCCTCTTGACCCCCGCGGATAGTACCGCGTAGGCTCTACGGGTTCTCTCCAAACCCTC-3G) used in the sequence listing, and primer 16 (5′-CCCCCCGCTGCGTCTGCTGGCATCGpTCTGCGTGTCTGCG) Was used as a template to amplify the terminator sequence of glyceraldehyde-3-phosphate dehydrogenase. This was treated with restriction enzymes ClaI and SacII to prepare DNA fragment T for insertion into plasmid pUC19RPKT.

Next, pUC19RPKT was treated with the restriction enzyme ClaI, further dephosphorylated with alkaline phosphatase, and then ligated with the DNA fragment P and DNA fragment T described above to produce the plasmid pUCRPKT-PT.

Next, using primer 1 (5′-CTCCGTCGCAGGCTCCGCGATGACCGCCGATAGCCCACCCGCTATACC-3C) and SEQ ID NO: 5 shown in SEQ ID NO: 5 in the sequence listing, primer 2 (5′-CTGCTTCGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCT PCR was performed using the chromosomal DNA of Xanthophyllomyces dendrhaus NBRC10129 strain as a template, and DNA with restriction enzyme SacII and SpeI recognition sequences added to both ends was amplified. This was digested with restriction enzymes SacII and SpeI and inserted into the similarly digested plasmid pUCRPKT-PT to produce plasmid pUCRPKT-PMK. The plasmid pUCRPKT-PMK has a structure in which the DNA of the present invention is inserted between the promoter and terminator of the glyceraldehyde-3-phosphate dehydrogenase gene, and functions as an expression vector for the DNA of the present invention. The plasmid pUCRPKT-PMK thus prepared was digested with the restriction enzyme NdeI to obtain a linear DNA, which was used as a transformation vector.

(Example 3) (Acquisition of transformant)
The transformation vector prepared in Example 2 was introduced into cells of the Xanthophyllomyces dendrohaus NBRC10129 strain by electroporation (Biotechnology techniques 1997 10: 929-932), and antibiotic G418 was introduced. On a plate of YM agar medium (peptone 0.5%, yeast extract 0.3%, malt extract 0.3%, glucose 1.0%, agar 2.0%, pH 6.2) supplemented with 40 mg / L, Transformed cells were selected, transplanted onto a slant of YM agar medium supplemented with 40 mg / L of antibiotic G418 and stored. The resulting transformed cells were named Xanthophyllomyces dendrhaus NBRC10129 (pUCRPKT-PMK) strain.

(Example 4) (Production of astaxanthin by transformant)
Autoclave a test tube containing 5 mL of YM medium (0.5% peptone, 0.3% yeast extract, 0.3% malt extract, 1.0% glucose, pH 6.2) supplemented with 40 mg / L of antibiotic G418 Sterilized and inoculated with the strain Xanthophyllomyces dendrhaus NBRC10129 (pUCRPKT-PMK). This was cultured with shaking at 22 ° C. for 2 days to obtain a preculture solution. Next, a shake flask containing 80 mL of YM medium supplemented with 40 mg / L of antibiotic G418 was autoclaved and inoculated with 0.8 mL of the above preculture solution. This was cultured with shaking at 22 ° C. for 3 days, and the astaxanthin content and cell dry matter content of the obtained culture broth were measured. The astaxanthin content was divided by the cell dry matter content to calculate the astaxanthin content in the cell dry matter. As a result, the astaxanthin content in the cell dried product was 0.28 mg / g.

(Comparative Example 1)
Ki which is a transformed cell obtained by introducing pUCRPKT-PT, a plasmid obtained by removing only the DNA of the present invention from the plasmid pUCRPKT-PMK, into cells of the Xanthophyllomyces dendrrous strain NBRC10129 strain. The Santophilomyces dendrohaus NBRC10129 (pUCRPKT-PT) strain was cultured in the same manner as in Example 4, and the astaxanthin content in the cell dried product was calculated. As a result, the astaxanthin content in the dried cell product was 0.25 mg / g.

From the results of Example 4 and Comparative Example 1, it is considered that the amount of astaxanthin produced by the cells is increased by introducing the DNA of the present invention.

In addition, the astaxanthin content of the culture solution was measured as follows. 1 mL of the culture solution is dispensed into a 1.5-ml polypropylene container that can be sealed and centrifuged at about 15000 × G for 5 minutes, and then the supernatant is removed. About 1 g of glass beads (diameter 0.5 mm) and 1 ml of acetone are added thereto, and the mixture is crushed at 4 ° C. for 3 minutes using a multi-bead shocker (manufactured by Yasui Kikai Co., Ltd.). The crushed material is filtered (Cosmonis filter S, 0.45 μm; manufactured by Millipore) to remove solids and glass beads, and the astaxanthin content is measured using HPLC. Quantification of astaxanthin using HPLC is carried out under the following conditions. Column: Develosil ODS-HG-5 φ4.6 × 250 mm (manufactured by Nomura Chemical Co., Ltd.), column temperature: 25 ° C., mobile phase: acetonitrile / methanol / isopropanol = 85/10/5 (volume ratio), flow rate: 0. 8 mL / min, detection wavelength: 471 nm.

The cell dry matter content of the culture solution was measured as follows. 5 mL of the culture solution is dispensed into a test tube whose tare weight has been measured in advance, and the supernatant is removed after centrifugation at about 5000 × G for 10 minutes. To this, 5 mL of water is added to resuspend the cells, and after centrifugation in the same manner, the supernatant is removed. After drying this at 110 ° C. for 12 hours, the weight is measured, and the content weight is calculated from the difference from the tare weight. Further, the cell weight is calculated by dividing the weight of the content by the amount of the first collected culture solution.

(Example 5) (Isolation of DNA (SEQ ID NOs: 20 and 21))
(Preparation of PCR primers)
From the chromosomal DNA sequence information of Xanthophyllomyces dendrhaus NBRC10129 strain, primer 17 (5′-TCCCCGCGGATGCACACACGACTGCTCTCTT-3 ′) shown in SEQ ID NO: 23 and SEQ ID NO: 24 shown in SEQ ID NO: 24 Primer 18 (5′-GACTAGTTTAGAGCCCTCTGATGACGAC-3 ′) was designed and synthesized.

(Amplification of gene (SEQ ID NO: 20) by PCR)
In the same manner as in Example 1, chromosomal DNA was extracted from the cells of Xanthophyllomyces dendrrous NBRC10129 strain. Next, PCR was performed in the same manner as in Example 1 using the DNA primer prepared above and the obtained chromosomal DNA as a template. As a result, a DNA fragment of about 1.9 kbp, which is considered to contain the target gene, was amplified. It was. The base sequence of this DNA fragment was analyzed in the same manner as in Example 1. The resulting chromosomal DNA sequence is shown in SEQ ID NO: 20.

(Determination of cDNA sequence (SEQ ID NO: 21))
PCR was performed using the DNA primer prepared as described above using the Xanthophyllomyces dendrhaus NBRC10129 strain template prepared in the same manner as in Example 1, and it is considered that the target gene was included. About 1.3 kbp of DNA fragment D was amplified. The base sequence of this DNA fragment was analyzed in the same manner as in Example 1, and the found cDNA sequence was shown in SEQ ID NO: 21 in the Sequence Listing. The amino acid sequence deduced from the cDNA sequence is shown in SEQ ID NO: 22 in the sequence listing.

(Example 6) (Construction of vector)
PCR was carried out using primer 17 (5′-TCCCCGCGGATGCACACAGAACTGGCTCCTTTT-3 ′) shown in SEQ ID NO: 23 and primer 18 (5′-GACTAGTTTAGAGCCCTCTGATGGACGAC-3 ′) shown in SEQ ID NO: 24 in the sequence listing, and both ends were restricted. A DNA fragment added with recognition sequences for the enzymes SacII and SpeI was amplified. This was digested with restriction enzymes SacII and SpeI and inserted into the similarly digested plasmid pUCRPKT-PT (see Example 2) to prepare plasmid pUCRPKT-AACT. The plasmid pUCRPKT-AACT has a structure in which the DNA of the present invention is inserted between the promoter and terminator of the glyceraldehyde-3-phosphate dehydrogenase gene, and functions as an expression vector for the DNA of the present invention. The plasmid pUCRPKT-AACT thus prepared was digested with the restriction enzyme NdeI to obtain a linear DNA, which was used as a transformation vector.

(Example 7) (Acquisition of transformant)
In the same manner as in Example 3, the transformation vector prepared in Example 6 was introduced into cells of Xanthophyllomyces dendrhaus NBRC10129 strain, and the resulting transformed cells were transformed into Xanthophyllomyces. -It was named the strain Xanthophyllomyces dendrorous NBRC10129 (pUCRPKT-AACT).

(Example 8) (Production of astaxanthin by transformant)
The Xanthophyllomyces dendrhaus NBRC10129 (pUCRPKT-AACT) strain obtained in Example 7 was cultured in the same manner as in Example 4, and the astaxanthin content and cell dry matter content of the obtained culture broth were measured. . The astaxanthin content was divided by the cell dry matter content to calculate the astaxanthin content in the cell dry matter. As a result, the astaxanthin content in the dried cell product was 0.30 mg / g.

From the results of Example 8 and Comparative Example 1, it is considered that the amount of astaxanthin produced by the cells is increased by introducing the DNA of the present invention.

(Example 9) (Production of astaxanthin using various promoters)
(Preparation of vector containing GFP gene and introduction of glyceraldehyde-3-phosphate dehydrogenase gene promoter into the vector)
Primer Pgdh-fw (5′-ATTAATTTAAGCGGCCCACACCGTGATATATGGCTGTACG-3 ′) shown in SEQ ID NO: 43 and primer Pgdh-rv (5′-GGGATATCGCTAGCATGCATTGGGTGTGTGGAG PCR was performed using the chromosomal DNA of Xanthophyllomyces dendrhaus NBRC10129 strain as a template to amplify the promoter sequence of the glutamate dehydrogenase gene. This promoter was inserted into plasmid pKF-G418 digested with restriction enzymes NotI and NsiI using In-Fusion HD cloning Kit (manufactured by Takara Bio Inc.) to prepare plasmid pGDH.

Next, a primer GFP-fw (5′-TATCCCCGCGGATAGTAGATGGTGGACAAGGGCGCCGAG-3 ′) shown in the sequence listing 41 and a primer GFP-rv (5′-GTTGATCAATTGAGGCCCTTCACTTGTACAG-3CT) shown in the sequence listing 42 are used. The GFP gene was amplified using pAcGFP1 (Takara Bio Inc.) as a template. This was digested with restriction enzymes SpeI and StuI and inserted into similarly digested plasmid pGDH to prepare plasmid pGDH-GFP. In addition, the primer MS1-GFP (5′-CGACTCTAGAGGATCCCGCTAGCGATATCCCCGCGGATGGGTGAGCAAGGGCGCCGAGCTCGCTGCTGCTGCTGCTGCTGCTGCTGCTGTCGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTCGTCTGCG The GFP gene was amplified using pAcGFP1 (Takara Bio Inc.) as a template. This was digested with restriction enzymes EcoRV and MluI and inserted into the similarly digested plasmid pUCRPK-PT to prepare plasmid pGPD-GFP.

(Acquisition of actin gene promoter and introduction of the promoter into a vector containing the GFP gene)
Primer Pactin-fw (5′-CAGCCCTTCGCTGCTGCTGCTGCTGCTGTCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG PCR was performed using the chromosomal DNA of Xanthophyllomyces dendrhaus NBRC10129 strain as a template to amplify the promoter sequence of the actin gene. Further, the primer Tactin-fw (5′-CCCGCGGATAGTAGTACCGCGTAGGCTCCAATTTGATCAACAAAGTCTCTGGCTGCGTCTGCGTCTGCGTCTGCGTCTGCGTCTGCG PCR was performed using the chromosomal DNA of Xanthophyllomyces dendrhaus NBRC10129 strain as a template to amplify the actin terminator sequence. The promoter and terminator of these actin genes were inserted into plasmid pKF-G418 digested with restriction enzyme CiaI using In-Fusion HD cloning Kit (manufactured by Takara Bio Inc.) to prepare plasmid pACT. Then, a GFP gene fragment obtained by digesting pGPD-GFP with the restriction enzyme SacII was inserted into a similarly digested plasmid pACT to prepare plasmid pACT-GFP.

(Acquisition of promoter of alcohol dehydrogenase IV gene and introduction of the promoter into a vector containing the GFP gene)
Using the primer PadhIV-fw (5′-ATTAATTTAAGCGGCCGCGGTAAAGAAAAGAAAAGTCGAC-3 ′) shown in SEQ ID NO: 35 in the sequence listing and the primer PadhIV-rv (5′-GCGGGATATCGCTGCTGTGGATKITGTGTGG) in the sequence listing 36 shown in the sequence listing PCR was performed using the chromosomal DNA of Xanthophyllomyces dendrhaus NBRC10129 strain as a template to amplify the promoter sequence of the alcohol dehydrogenase IV gene. This was inserted into plasmid pGDH-GFP digested with restriction enzymes NotI and NheI using In-Fusion HD cloning Kit (manufactured by Takara Bio Inc.) to prepare plasmid pADH-GFP.

(Acquisition of promoter of triose phosphate isomerase gene and introduction of the promoter into a vector containing GFP gene)
Using primer Ptpi-fw (5′-ATTAATTTAAGCGGCCGCATGCCTGTTGCACATTGTAG-3 ′) shown in SEQ ID NO: 37 in the sequence listing and primer Ptpi-rv (5′-GCGGGATATCGCTAGCGATGAATAGTATGAGAGTGT) shown in SEQ ID NO: 38 in the sequence listing PCR was performed using the chromosomal DNA of Xanthophyllomyces dendrhaus NBRC10129 strain as a template to amplify the promoter sequence of the triose phosphate isomerase gene. This was inserted into plasmid pGDH-GFP digested with restriction enzymes NotI and NheI using In-Fusion HD cloning Kit (manufactured by Takara Bio Inc.) to prepare plasmid pTPI-GFP.

(Acquisition of transformant)
The transformation vectors pGPD-GFP, pACT-GFP, pADH-GFP, or pTPI-GFP were obtained by electroporation (BioTeChronoGy TeChiques 1997 10: 929-932) by Xanthophyllomyces Dendroas 29D YM agar medium containing 40 mg / L of antibiotic G418 (peptone 0.5%, yeast extract 0.3%, malt extract 0.3%, glucose 1.0%, agar 2.0% , PH 6.2), transformed cells were selected, transplanted onto a slant of YM agar medium supplemented with 40 mg / L of antibiotic G418, and stored. The resulting transformed cells were transformed into Xanthophyllomyces dendrhaus NBRC10129 (pGPD-GFP) strain, Xanthophyllomyces dendrrous strain NBCTGF129P (NBPTGF129P), respectively. The strain Xanthophyllomyces dendrrous NBRC10129 (pADH-GFP) and the strain Xanthophyllomyces dendrrous NBRC10129 (pTPI-GFP).

(Measurement of GFP intensity in transformants)
Autoclave a test tube containing 5 mL of YM medium (0.5% peptone, 0.3% yeast extract, 0.3% malt extract, 1.0% glucose, pH 6.2) supplemented with 40 mg / L of antibiotic G418 Sterilized, Xanthophyllomyces dendrorous NBRC10129 (pGPD-GFP) strain, Xanthophyllomyces dendrorous NBRC10129 (pACT-GFP dendrohaus) dendrhouse) NBRC10129 (pADH-GFP) strain, or Xanthophyllo They were inoculated with yces dendrorhous) NBRC10129 (pTPI-GFP) strain. This was cultured with shaking at 22 ° C. for 1 day to obtain a preculture solution. Next, a shake flask containing 80 mL of YM medium supplemented with 40 mg / L of antibiotic G418 was autoclaved, and the above-mentioned preculture was inoculated so that the absorbance at 600 nm was 0.03. This was cultured with shaking at 22 ° C. for 72 hours, and 1 mL of the culture solution was collected every 24 hours. 1 mL of the obtained culture solution was dispensed into a 1.5-ml polypropylene container capable of being sealed and centrifuged at about 8000 × g for 3 minutes, and the supernatant was removed. 1 mL of sterilized water was added and mixed. The intensity of GFP was measured using a microplate reader. The GFP intensity per cell dry substance weight was calculated by dividing the GFP intensity by the cell dry substance weight (0.3786 × absorbance). The result is shown in FIG. From FIG. 1, it is considered that the actin, alcohol dehydrogenase IV, and triose phosphate isomerase gene promoters have higher transcriptional activity than the glyceraldehyde-3-phosphate dehydrogenase gene promoter.

The DNA described in SEQ ID NO: 2 or 21 was placed downstream of the actin gene promoter, alcohol dehydrogenase IV gene promoter, or triose phosphate isomerase gene promoter by the method described in Examples 2 and 6, and the vector was prepared. It was constructed. A transformant was obtained by the method described in Example 3, astaxanthin was produced by the method described in Example 4, and the production amount was measured. Using actin gene promoter, alcohol dehydrogenase IV gene promoter, or triose phosphate isomerase gene promoter increases the production of astaxanthin compared to using glyceraldehyde-3-phosphate dehydrogenase gene promoter did.

Claims (15)

1. The following (A) to (H):
   (A) DNA containing the base sequence shown in SEQ ID NO: 1 in the sequence listing;
   (B) a DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 1 in the Sequence Listing;
   (C) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 1 in the Sequence Listing;
   (D) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 1 in the Sequence Listing;
   (E) a DNA comprising the base sequence shown in SEQ ID NO: 2 in the sequence listing;
   (F) DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 2 in the Sequence Listing;
   (G) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 2 in the Sequence Listing;
   (H) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 2 in the Sequence Listing;
   DNA of any one of.
2. The following (I) to (K):
   (I) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing;
   (J) a polypeptide comprising an amino acid sequence having 85% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 3 in the Sequence Listing;
   (K) a polypeptide comprising an amino acid sequence in which one or more amino acids are deleted, inserted, substituted and / or added in the amino acid sequence shown in SEQ ID NO: 3 in the sequence listing;
   DNA encoding any of the polypeptides.
3. The following (L) to (S):
   (L) a DNA comprising the base sequence represented by SEQ ID NO: 20 in the sequence listing;
   (M) a DNA that hybridizes under stringent conditions with a DNA comprising a base sequence complementary to the base sequence shown in SEQ ID NO: 20 in the sequence listing;
   (N) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 20 in the Sequence Listing;
   (O) DNA consisting of a base sequence in which one or more bases are deleted, inserted, substituted and / or added in the base sequence shown in SEQ ID NO: 20 in the Sequence Listing;
   (P) a DNA comprising the base sequence shown in SEQ ID NO: 21 in the sequence listing;
   (Q) DNA that hybridizes under stringent conditions with a DNA containing a base sequence complementary to the base sequence shown in SEQ ID NO: 21 in the Sequence Listing;
   (R) DNA having a sequence identity of 85% or more with the base sequence shown in SEQ ID NO: 21 in the Sequence Listing;
   (S) DNA consisting of a base sequence obtained by deleting, inserting, substituting and / or adding one or more bases in the base sequence shown in SEQ ID NO: 21 in the Sequence Listing;
   DNA of any one of.
4. The following (T) to (V):
   (T) a polypeptide comprising the amino acid sequence shown in SEQ ID NO: 22 of the Sequence Listing;
   (U) a polypeptide comprising an amino acid sequence having 85% or more sequence identity to the amino acid sequence shown in SEQ ID NO: 22 in the Sequence Listing;
   (V) a polypeptide comprising an amino acid sequence obtained by deleting, inserting, substituting and / or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO: 22 in the Sequence Listing;
   DNA encoding any of the polypeptides.
5. The DNA according to any one of claims 1 to 4, which is derived from an organism belonging to the genus Xanthophyllomyces.
6. The DNA according to claim 5, wherein the organism belonging to the genus Xanthophyllomyces is Xanthophyllomyces dendroas.
7. A vector comprising one or more DNAs according to any one of claims 1 to 6.
8. The vector according to claim 7, further comprising one or more DNAs comprising a part or all of a base sequence of an actin gene promoter, an alcohol dehydrogenase IV gene promoter, and / or a triose phosphate isomerase gene promoter.
9. A transformant obtained by transforming a host cell with the vector according to claim 7 or 8.
10. The transformant according to claim 9, which has a carotenoid production ability.
11. The transformant according to claim 9 or 10, wherein the host cell is a cell of an organism belonging to the genus Xanthophyllomyces.
12. The transformant according to claim 11, wherein the organism belonging to the genus Xanthophyllomyces is Xanthophyllomyces dendroas.
13. A method for producing a carotenoid, comprising a step of culturing a cell to which the expression of the DNA according to any one of claims 1 to 6 is imparted and / or enhanced and has a carotenoid producing ability using a gene recombination technique. .
14. The production method according to claim 13, wherein the cell having the ability to produce carotenoid is a cell of an organism belonging to the genus Xanthophyllomyces.
15. The production method according to claim 14, wherein the organism belonging to the genus Xanthophyllomyces is Xanthophyllomyces Dendroas.

Images