WO2014045206A1 - Obtaining tomato plants resistant to tomato yellow leaf curl virus by using pelota gene - Google Patents

Abstract

The present invention relates to methods for developing of inbreds, hybrid, apomitic and genetically engineered tomato plant exhibiting resistance to Tomato yellow leaf curl virus and having commercially desired characteristics by using the SIPELOTA gene.

Description

OBTAINING TOMATO PLANTS RESISTANT TO TOMATO YELLOW LEAF CURL VIRUS BY USING PELOTA GENE

[0001] Incorporation of the Sequence Listing

[0002] A sequence listing is contained in the file named "818'54 seq list_ST25" was created on September 16, 2013. This electronic sequence listing is electronically filed herewith and is incorporated herein by reference.

[0003] Field of the Invention

[0004] The present invention relates to plant breeding and molecular biology. More specifically, the present invention relates to tomato plants that exhibit resistance to Tomato yellow leaf curl virus and methods for developing new inbred, hybrid, apomictic and genetically engineered tomato plants that possess resistance to Tomato yellow leaf curl virus and have commercially desirable characteristics.

[0005] Background of the invention

[0006] Tomato yellow leaf curl virus (TYLCV) is considered one of the most devastating viruses of cultivated tomatoes [Solanum (S.) lycopersicum] in tropical and subtropical regions. Although first identified in the eastern Mediterranean (Cohen and Harpaz 1964), it has spread and reached worldwide distribution (Czosnek and Laterrot 1997; Polston and Anderson 1997; Moriones and Navas-Castillo 2000). TYLCV induces a severe tomato disease characterized by yellowing and cupping of apex leaves as well as stunted plant growth coupled with significant yield losses. In many tomato-growing areas, TYLCV has become a major limiting factor in tomato production (Lapidot and Friedmann 2002).

[0007] TYLCV belongs to the family Geminiviridae, genus Begomovirus, and transmitted by the whitefly Bemisia tabaci in a circulative and persistent manner. The virus genome is composed of a single (monopartite) circular single-stranded DNA molecule of about 2,800 nucleotides. In the past, there has been some confusion regarding the taxonomy of TYLCV. Several begomo iruses, inducing similar symptoms in tomato, were all named TYLCV. Further analyses of these viruses showed that the tomato yellow leaf curl disease (TYLCD) is induced by a heterogeneous complex of begomoviruses (Moriones and Navas- Castillo 2000). Most of the isolates have a monopartite genome, and recently a TYLCV isolate containing a DNA-β satellite was identified (Khan et al. 2008).

[0008] The management of TYLCV is difficult because its whitefly vector populations can reach high numbers. Chemical control methods have been only partially effective, while raising concerns that the vector may develop insecticide resistance and that intense application of pesticides may have deleterious environmental consequences (Palumbo et al. 2001). Physical barriers such as fine-mesh screens and UV-absorbing plastic sheets or screens are used in the Mediterranean region to protect crops (Cohen and Antignus 1994; Antignus et al. 2001). However, such physical barriers add to production costs and may result in suboptimal light conditions, overheating, and increased humidity, which can hamper appropriate plant growth and development. Genetic resistance of the host plant, on the other hand, requires no chemical application or plant seclusion and is potentially stable and long lasting. Therefore, breeding crops which are resistant or tolerant to the virus is considered highly effective in reducing yield losses due to TYLCV (Morales 2001 ; Lapidot and Friedmann 2002).

[0009] There have been extensive efforts to breed tomato cultivars resistant to TYLCV.

Since all cultivated tomato accessions are considered susceptible to the disease, wild tomato species were screened to identify and introgress resistance genes (reviewed in Nakhla and Maxwell 1998; Lapidot and Friedmann 2002; Ji et al. 2007b). Loci controlling resistance to TYLCV have been identified and introgressed from several wild tomato species, including: Solanum pimpinellifolium, S. peruvianum, S. chilense, and S. habrochaites. The inheritance of genes controlling TYLCV resistance originating from nearly all of these wild species has been characterized using classical genetic methodologies. However, only a few were scrupulously characterized or mapped to the tomato genome using molecular DNA markers (Ji et al. 2007b).

[0010] Breeding for TYLCV resistance was initiated in Israel in the late 1960s

(Pilowsky and Cohen 1974). The first commercial resistant hybrid, TY20, was released in 1988 (Pilowsky et al. 1990). TY20 carries resistance derived from S. peruvianum (accession PI 126935) that is inherited as five recessive genes. The resistance in TY20 induces a delay in the development of disease symptoms following infection, and infected plants are able to produce an acceptable yield.

[0011] Resistance introgressed from S. chilense accession LAI 969 was found to be controlled by a major partially-dominant locus, termed Ty-1, and at least two additional modifier loci (Zamir et al. 1994), Ty-1 was mapped to the top of chromosome 6 at the vicinity of marker TG97, while the two modifiers were mapped to chromosomes 3 and 7 (Zamir et al. 1994). TYLCV resistance derived from S. pimpinellifolium Hirsute-INRA was found to be mediated by a single dominant gene (Kasrawi 1989). DNA marker analysis identified a quantitative trait locus (QTL), accounting for up to 27.7% of the variation in symptom severity, on chromosome 6. However, its map location is different from that of Ty-1 (between markers TGI 53 and CT83) (Chague et al. 1997).

[0012] Hanson et al. (2000) analyzed the resistant line H24, which contains resistance introgressed from accession B 6013 of S. habrochaites ( alloo and Banerjee, 1990). The authors screened resistant plants using what at the time they thought were three different isolates of TYLCV. However, it was later found that those viral isolates were in fact isolates of Tomato leaf curl virus (ToLCV), not TYLCV. This resistance was mapped to the short arm of chromosome 1 1, between the markers TG393 and TG36, and was found to be dominant (Hanson et al. 2000). In a recent study, it was shown that the resistance is located closer to marker TG36 and was termed Ty-2 (Hanson et al. 2006). H24 response to TYLCV inoculation varied, susceptibility depending upon the strain (Ji et ai. 2007b).

[0013] Three accessions from S. chilense, LA1932, LA2779 and LA1938, were found to be resistant to TYLCV as well as to Tomato mottle virus (ToMoV) (Agrama and Scott 2006). Introgression into susceptible lines, inheritance studies and QTL mapping revealed three regions on chromosome 6 which contribute to both TYLCV and ToMoV resistance (Agrama and Scott 2006). In a recent study, more markers were used to localize the introgression in an advanced breeding line derived from LA2779. A major partially dominant locus, termed Ty-3, was mapped to chromosome 6 between the markers cLEG-31-P-16 and T1079 (Ji and Scott 2006; Ji et al. 2007a). The introgression derived from LA2779 was found to contain Ty-1 as well, suggesting a genetic linkage between Ty-1 and Ty~3 ( Ji et al. 2007a). A recent study further indicates that that Ty-1 and Ty-3 may be allelic (Verlaan et al. 201 1), thus limiting the number of available genes for TYLCV resistance breeding.

[0014] Recently, using advanced breeding lines derived from the above three S. chilense accessions, a new TYLCV -resistance locus, termed Ty-4, was mapped between the markers C2__At4gl7300 and C2__At5g60610 on the long arm of chromosome 3 (Ji et al., 2008). While approximately 60% of the variance in the TYLCV resistance in a segregating population was explained by the Ty-3 locus, Ty-4 accounted for only 16%. It was therefore concluded that Ty-3 has a major effect on resistance, while Ty-4 - a lesser effect (Ji et al., 2008).

[0015] Resistance to TYLCV was also introgressed from two accessions of S. habrochaites (LA 1777 and LA0386). Two BC₁F₄ lines, termed 902 and 908, were derived from this introgression (Vidavsky and Czosnek 1998). Segregation analysis indicated that two to three additive recessive genes control resistance to TYLCV in line 902, while in Line 908 resistance is controlled by a single dominant major gene (Vidavsky and Czosnek 1998). Preliminary results indicate the presence of Ty-3 in line 902, however its effect on resistance in this line remains to be evaluated (Ji et al., 2007b). [0016] The line TY172 is highly resistant to TYLCV: it shows minimal symptoms following infection and contains low levels of viral DNA (Lapidot et al. 1997; Friedmann et al. 1998). Classical genetic studies have suggested that resistance in TY172 is controlled by three genes exerting a partially-dominant effect (Friedmann et al. 1998). TY172 exhibited the highest level of resistance in a field trial designed to compare yield components of various resistant accessions following inoculation with TYLCV (Lapidot et al. 1997). It was also found that TYI 72, probably due to its high level of TYLCV resistance, is a poor source for viral acquisition and transmission by whiteflies (Lapidot et al. 200 ).

[0017] Cumulatively these results underline the importance of TY172 for tomato breeding and suggest that its resistance is controlled by a different genetic mechanism than the previously characterized resistance sources.

[0018] A study designed to map genes controlling TYLCV resistance in TY172 showed that TYLCV resistance in TY172 is controlled by a previously unknown major QTL (Fig. 1), originating from the resistant line, and four additional minor QTLs (Anbinder et al. 2009). The major QTL, termed Ty-5, maps to chromosome 4 and accounts for 39.7-to-46.6% of the variation in symptom severity among segregating plants (LOD score: 33-to-35). The minor QTLs, originated either from the resistant or susceptible parents, were mapped to chromosomes 1, 7, 9 and 1 1 , and contributed only 12% to the variation in symptom severity in addition to Ty- 5. Anbinder et al. 2009 states that "it would be extremely interesting to analyze the general and specific combining ability of the five most major TYLCV resistance QTLs the inventors and others identified thus far (Ty-1, Ty-2, Ty-3, Ty-4 and Ty-5), at all possible combinations". Thus, according to Anbinder et al., the phenotypic trait of TYLCV resistance is polygenic. Anbinder motivates a person of ordinary skill in the art to continue and investigate TYLCV-resistance as a polygenic trait.

[0019] The gene encoding the S. lycopersicum NAC DOMAIN 1 protein (S7NAC1), have been stated by Anbinder et al. (2009), as an "excellent candidate gene" (pp.259, left Col.). The SINAC1 gene was mapped to the Ty-5 region and stated by Anbinder to have the highest association with the resistance phenotype (Fig. 1). This is in particular important because SINAC1, encoding a member of the NAC-domain protein family, was previously implicated in the replication of the tomato-infecting begomovirus, ToLCV, by interacting with the viral replication enhancer protein (REn) (Selth et al., 2005). Selth et al. (2005) further showed that ToLCV and TYLCSV induce SINAC1 expression specifically in infected susceptible cells, and that this up-regulation requires REn. Also, in a transient ToLCV replication system, over- expression of SINAC1 resulted in a substantial increase in viral DNA accumulation. Together, these results suggest that SINAC1 plays an important role in the process by which REn enhances replication of ToLCV and possibly other begomoviruses, including TYLCV. Indeed, one of the main events that was thus far clearly associated with TYLCV infection in resistant TY172 plants was reduced TYLCV ssDNA accumulation at the site of inoculation in comparison to their susceptible counterparts which can be attributed to SINAC1 (Segev et al., 2004). Moreover, sequence analysis of SINAC1 in TY172 and two susceptible lines, revealed a relatively conserved Tyrosine^{2 ,2}-to~Cysteine substitution in TY172 and also: three single nucleotide polymorphisms (SNPs) in the promoter region and two SNPs in the first intron of the gene (Fig. 2 and 3).

[0020] Anbinder et al, refers also to another QTL, based on SISUMO, a gene encoding

Solarium Small Ubiquitin-like Modifier. According to Anbinder, a member of the SUMO gene family from N. Benthamiana has been shown to interact with a begomovirus AC1 protein, the protein which is essential for viral replication. SISUMO is also stated by Anbinder et al. (2009), as an "excellent candidate gene" (pp.259, left Col.),

[0021] According to the above, there seem to have been no recognized reason for a skilled person to look for another unknown gene. Specifically, there was no recognized reason for a skilled person to invalidate the candidancy of both the SIN AC 1 gene and the SISUMO gene. More specifically, there was no recognized reason for a skilled person to set out and sequence the DNA region spanning the SINAC1 gene.

[0022] There is presently still a need in the art for new tomato varieties that possess resistance to TYLCV and which further exhibit desirable commercial characteristics.

SUMMARY OF THE INVENTION

[0023] The present invention relates to a method for producing tomato plant having resistance to Tomato yellow leaf curl virus, wherein the trait is genetically linked to a single nucleotide polymorphism (SNP) T⁴⁷-to-G in the first exon of the SIPELOTA gene, the method comprising the steps of identifying homozygosis for said SNP in said tomato plant and cultivating said tomato plant.

[0024] The present invention further relates to a method for producing tomato plant having resistance to Tomato yellow leaf curl virus, wherein the trait is genetically linked to a SNP T-to-G in the SIPELOTA gene, wherein said SNP results in Valine¹⁶-to-Glycine substitution in the amino acid sequence of said SIPELOTA gene, the method comprising the steps of identifying homozygosis for said SNP in said tomato plant and cultivating said tomato plant.

[0025] The present invention further relates to a method for producing tomato plant having resistance to Tomato yellow leaf curl virus, wherein the trait is genetically linked to a SNP in the SIPELOTA gene, wherein detection of said SNP is associated with a primer selected from the group consisting of: Forward- AAATTTGTTTCATTCAATATGAAGATTGT and Reverse- CGTTTTCTTCATCTGGGGT, the method comprising the steps of identifying homozygosis for said SNP in said tomato plant and cultivating said tomato plant.

[0026] In another embodiement, the present invention relates to a method of producing a tomato plant that exhibits resistance to Tomato yellow leaf curl virus comprising the steps of: (a) identifying a tomato donor plant, said donor plant is resistant to Tomato yellow leaf curl virus; (b) crossing said resistant donor plant with a recipient tomato plant that is susceptible to said virus and possesses commercially desirable characteristics;

(c) planting seed obtained from the cross in step b and growing said seed into plants; (d) selfing the plants of step c; (e) planting seed obtained from the selfmg in step d and growing into plants; (f) identifying plant homozygous for SNP T⁴⁷-to-G in the first exon of the SIPELOTA gene; and (g) cultivating the plant of step (f).

[0027] In a still another embodiement, the present invention relates to a method of producing a tomato plant that exhibits resistance to Tomato yellow leaf curl virus comprising the steps of:

(a) identifying a tomato donor plant, said donor plant is resistant to Tomato yellow leaf curl virus; (b) crossing said resistant, donor plant with a recipient tomato plant that is susceptible to said virus and possesses commercially desirable characteristics; (c) planting seed obtained from the cross in step b and growing said seed into plants; (d) selfmg the plants of step c; (e) planting seed obtained from the selfmg in step d and growing into plants; (f) identifying plant homozygous for SNP T-to-G in the SIPELOTA gene, wherein said SNP results in Valine^t6~to- Glycine substitution in the amino acid sequence of said SIPELOTA gene; and (g) cultivating the plant of step (f).

[0028] In a still another embodiement, the present invention relates to a method of producing a tomato plant that exhibits resistance to Tomato yellow leaf curl virus comprising the steps of:

(a) identifying a tomato donor plant, said donor plant is resistant to Tomato yellow leaf curl virus; (b) crossing said resistant donor plant with a recipient tomato plant that is susceptible to said virus and possesses commercially desirable characteristics; (c) planting seed obtained from the cross in step b and growing said seed into plants; (d) selfmg the plants of step c; (e) planting seed obtained from the selling in step d and growing into plants; (f) identifying plant homozygous for SNP in the SIPELOTA gene, wherein identification of said SNP is associated with a primer selected from the group consisting of: Forward-

AAATTTGTTTCATTCAATATGAAGATTGT and Reverse- GTTTTCTTCATCTGGGGT; and (g) cultivating the plant of step (f).

[0029] In a more preferred embodiment, steps (b)-(g) are repeated until an inbred tomato plant is produced which exhibits resistance to Tomato yellow leaf curl virus and possesses commercially desirable characteristics.

[0030] In a still preferred embodiement, the present invention relates to methods described hereinabove, wherein said virus is selected from the group consisting of: Tomato yellow leaf curl virus (TYLCV-Israel), Tomato yellow leaf curl Sardinia virus (TYLCSV), and Mild strain of TYLCV (TYLCV-Mld).

[0031] The present invention further relates to an isolated nucleic acid molecule selected from the group consisting of: (a) an isolated nucleic acid molecule comprising SEQ ID NO. 7; (b) an isolated nucleic acid molecule comprising SEQ ID NO. 11; an isolated nucleic acid molecule that encodes the amino acid sequence of SEQ ID NO. 9; and (c) the complement of any of the foregoing.

[0032] In another embodiment, the present invention relates to a vector comprising an isolated nucleic acid molecule OF SEQ ID NO. 1 1.

[0033] In another embodiment, the present invention relates to a host cell transformed to contain the nucleic acid molecule OF SEQ ID NO. 1 1.

[0034] In yet another embodiment, the present invention relates to a hybrid tomato plant that exhibits resistance to Tomato yellow leaf curl virus. Such a hybrid tomato plant can be produced by crossing an inbred tomato plant produced by one of the above-described methods with an inbred tomato plant that exhibits commercially desirable characteristics.

[0035] In yet another embodiment, the present invention relates to a Tomato yellow leaf curl virus resistant tomato plant that contains within its genome a SIPELOTA gene from chromosome 4 associated with Tomato yellow leaf curl virus resistance. Such a Tomato yellow leaf curl virus resistant tomato plant is selected from the group consisting of: Solarium lycopersicum, Solarium pimpinellifolium, Solarium cheesmaniae, Solarium neorickii, Solanum chemielewskii, Solanum habrochaites, Solanum pennellii, Solanum peruvianum Solanum chilense and Solanum lycopersicoides .

BRIEF DESCRIPTION OF THE FIGURES [0036] FIG. 1 shows mapping and interval analysis of Ty-5 (A. Map distance in cM among the markers analyzed on chromosome 4, B. Interval analysis displaying LOD scores along chromosome 4 for disease severity index (DSI) obtained in each of two inoculations separately as well as average DSI of the two inoculations).

[0037] FIG. 2 shows genomic nucleotide sequence of the Nacl gene in the resistant TY172 line (GenBank accession No. C447282) compared with susceptible lines M- 82 (GenBank accession No. C447283) and LAI 589 (GenBank accession No. KC447284). Start (ATG) and stop (TAA) codons of the Nacl gene are highlighted with cyan and underlined. Transcribed regions of the Nacl gene, including the 5' and 3' untranslated regions are highlighted with gray. Nucleotide polymorphisms that differentiate between TY172 and both susceptible lines are in red letters highlighted with yellow. The single-nucleotide polymorphism in the coding region of the Nacl gene that results in the Tyrosine²¹²-to-Cysteine substitution of TY172 is highlighted with magenta.

[0038] FIG. 3 shows Amino acid sequence of the Nacl gene in the resistant line TY 172 (GenBank accession No. C447279) compared with the susceptible lines M- 82 (GenBank accession No. C447280) and LAI 589 (GenBank accession No. KC447281) (the Tyrosine212-to-Cysteine substitution of TY172 is highlighted with magenta).

[0039] FIG. 4 shows genomic nucleotide sequence of the Pelo gene in the resistant TY 172 line (GenBank accession No. C447287) compared with the susceptible line M-82 (GenBank accession No. KC447288). Start (ATG) and stop (TAA) codons of the Pelo gene are highlighted with cyan and underlined. Transcribed regions of the Pelo gene, including the 5' and 3' untranslated regions are highlighted with gray. Nucleotide polymorphisms that differentiate between TY172 and both susceptible lines are in red letters highlighted with yellow. The single-nucleotide polymorphism in the coding region of the Pelo gene that results in the substitution of Valine 16 (susceptible lines) to a Glycine (resistant TY172 line) is highlighted with magenta.

[0040] FIG. 5 shows amino acid sequence of the Pelo gene in the resistant TY172 line (GenBank accession No. C447285) compared with the susceptible line M-82 (GenBank accession No. KC447286). The substitution of Valine¹⁶ (susceptible lines) to a Glycine (resistant TY172 line) is highlighted with magenta).

[0041] FIG. 6 shows TYLCV accumulation in apex leaves of TY172, PRT-630, R13 and M-82 7, 14, 21 and 28 days post inoculation (different letters indicate statistically significant differences, P< 0.05, between means based on the Tukey-Kramer honestly significant difference (HSD) test (Kramer 1956); bars represent the standard error, SE, of the mean).

[0042] FIG. 7 shows c-DNA and amino-acid sequence of the Pelo gene in the resistant TY172 line (Both appear in GenBank accession No. KC447285).

[0043] FIG. 8 shows c-DNA sequence of the Pelo gene in the resistant TY 172 line (appears in GenBank accession No. KC447285).

[0044] FIG. 9 shows schematic diagram of the silencing vector pHANNIBAL.

[0045] FIG. 10 shows analyses of association between DNA markers spanning the Ty-5 locus and TYLCV disease severity index (DSI) in 32 representative segregating populations.

[0046] Definitions

[0047] The headings provided herein are not limitations of the various aspects or embodiments of the invention that can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0048] As used herein, the term "allele(s)" means any of one or more alternative forms of a gene, all of which alleles relate to one trait or characteristic. In a diploid cell or organism, the two alleles of a given gene occupy corresponding loci on a pair of homologous chromosomes.

[0049] As used herein, the term "TYLCV" means Tomato yellow leaf curl virus.

[0050] As used herein, the term "heterozygous" means a genetic condition existing when different alleles reside at corresponding loci on homologous chromosomes.

[0051] As used herein, the term "homozygous" means a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.

[0052] As used herein, the term "hybrid" means any offspring of a cross between two genetically unlike individuals (Rieger, R.₅ A Michaelis and M. M. Green, 1968, A Glossary of

Genetics and Cytogenetics, Springer-Verlag, N.Y.).

[0053] The abbreviations "Fj ", "BQ" and higher numerical values of each alone and in combination (e.g. "BQFi") represent "first filial generation", "first backcross generation", respectively, etc.

[0054] The designation G⁴⁷ represents Guanin nucleic acid base at position 47.

[0055] As used herein, the term "inbred" means a substantially homozygous individual or variety.

[0056] As used herein, the term "introgressed" means the entry or introduction of a gene from one plant into another. As used herein, the term "introgressing" means entering or introducing a gene from one plant into another.

[0057] As used herein, the term "susceptible" means a plant that is a host for the virus, upon infection the susceptible host will support normal vims multiplication and spread and consequently will express disease symptoms.

[0058] As used herein, the term "molecular marker" means a restriction fragment length polymorphism, (RFLP), amplified fragment length polymorphism (AFLP), single nucleotide polymorphism (SNP), microsatellite, a sequence characterized amplified repeats (SCAR) or an isozyme marker or combinations of the markers described herein which defines a specific genetic and chromosomal location.

[0059] As used herein, the term "plant" includes plant cells, plant protoplasts, plant cell tissue cultures from which tomato plants can be regenerated, plant calli, plant cell clumps, and plant cells that are intact in plants, or parts of plants, such as embryos, pollen, ovules, flowers, leaves, seeds, roots, root tips and the like,

[0060] As used herein, the term "population" means a genetically heterogeneous collection of plants sharing a common genetic derivation.

[0061] As used herein, the term "tomato" means any variety, cultivar, or population of

Solarium lycopersicum, Solarium pimpinellifolium, Solarium cheesmaniae, Solanum neorickii, Solanum chemielewskii, Solarium habrochaites, Solanum pennellu, Solanum peruvianum Solanum chilense and Solanum lycopersicoides.

[0062] As used herein, the term "variety" or "cultivar" means a group of similar plants that by structural features and performance can be identified from other varieties within the same species.

BRIEF DESCRIPTION OF NUCLEIC ACID SEQUENCES

[0063] SEQ ID NO: 1 is a genomic sequence of the TY 172 SlNACl gene.

[0064] SEQ ID NO: 2 is a genomic sequence of the M-82 SlNACl gene.

[0065] SEQ ID NO: 3 is a genomic sequence of the LAI 589 SlNACl gene.

[0066] SEQ ID NO: 4 is an amino acids sequence of the TY172 SlNACl protein.

[0067] SEQ ID NO: 5 is an amino acids sequence of the M-82 SlNACl protein.

[0068] SEQ ID NO: 6 is an amino acids sequence of the LA1589 SlNACl protein.

[0069] SEQ ID NO: 7 is a genomic sequence of the TY172 SIPELOTA gene.

[0070] SEQ ID NO: 8 is a genomic sequence of the M-82 SIPELOTA gene.

[0071 ] SEQ ID NO: 9 is an amino acids sequence of the TY 172 SIPELOTA protein. [0072] SEQ ID NO: 10 is an amino acids sequence of the M-82 SIPELOTA protein.

[0073] SEQ ID NO: 1 1 is a TY172 SIPELOTA cDNA.

[0074] SEQ ID NO: 12 is a forward PCR primer for the amplification of SEQ ID NO: 7.

[0075] SEQ ID NO: 13 is a reverse PCR primer for the amplification of SEQ ID NO: 7.

DETAILED DESCRIPTION OF THE INVENTION

[0076] It has been surprisingly been found that tomato TYLCV-resistant lines may be designed by the use of a single gene rather than several genes. It has also been found that the trait for TYLCV resistance is directly inherited with the SIPELOTA gene.

[0077] In one embodiment, the present invention relates to producing novel TYLCV resistant tomato plants and tomato lines, and utilizing the molecular markers and genes described herein in selective breeding techniques. These tomato plants contain one or more alleles of the SIPELOTA gene that encodes for TYLCV resistance. Tomato plants that do not contain these alleles are susceptible to infection by TYLCV.

[0078] Molecular markers located on Ty-5 locus on chromosome 4 linked to at least one allele that encodes for TYLCV resistance can be identified using marker-assisted selection, the techniques for which are well known in the art. An example of some markers on Ty-5 that are linked to at least one alleles that encode for TYLCV resistance include T⁴⁷-to-G transversion in the first exon of the SIPELOTA gene or T^23S4-to-G²³⁸⁶ as appearing in Fig. 4.

[0079] One source of a TYLCV resistant tomato plant that contains the hereinbefore described allele of the SIPELOTA gene is the line TY172. Presumably, line TY172 had been derived from four different accessions formerly assigned as S. peruvianum: PI 126926, PI 126930, PI 390681 and LA0441 (Friedmann et al. 1998). However, LA0441 was later sub- classified as S. arcanum (Peralta et al. 2005). These four accessions were crossed with S. fycopersicum, and the resulting interspecific hybrids were backcrossed to the susceptible parent until a BC3F3 generation was secured. At this stage, crosses were made between the four different lines, and F₂ and F₃ generations were produced and screened for resistance. A highly resistant F₃ line was selected, and its F₄ offspring were bulked and designated TY172 (Friedmann et al. 1 98). Progeny testing for two consecutive generations showed that this line is fixed for resistance and the resulting F₆ plants were used in the experiments described here.

[0080] The molecular markers identified as being associated with the SIPELOTA gene on chromosome 4 that encode for TYLCV resistance and that are located on the Ty~5 locus can be used to introgress the gene that encode for TYLCV resistance from a first donor plant into a recipient plant. By way of example, and not of limitation, Melting curve SNP genotyping method (McSNP) techniques can be used in said introgression. Tomato plants developed according to the present invention can advantageously derive a majority of their traits from a recipient plant, and derive TYLCV resistance from the first donor plant.

[0081] In another embodiment of the present invention, the present invention relates to methods for producing superior new TYLCV resistant tomato plants. In the method of the present invention, a gene encoding for TYLCV resistance is introgressed from a donor parental plant that is resistant to TYLCV into a recipient plant that is either non-resistant or a plant that has intermediate levels of resistance to infection by TYLCV. The TYLCV resistant tomato plants produced according to the methods of the present invention can be either inbred, hybrid, haploid, apomictic or genetically engineered tomato plants.

[0082] The introgression of one or more genes encoding for TYLCV resistance into a recipient tomato plant that is non-resistant or possesses intermediate levels of resistance to ^Γχ^* I ( ^'V can be accomplished using techniques known in the art. For example, a gene encoding for TYLCV resistance can be introgressed into a recipient tomato plant that is non-resistant or a plant that has intermediate levels of resistance to TYLCV using traditional breeding techniques, genetic engineering or protoplast fusion.

[0083] In one method, which is referred to as pedigree breeding, a first donor tomato plant that exhibits resistance to TYLCV and contains the gene encoding for TYLCV resistance is crossed with a second tomato plant that is non-resistant to TYLCV or possesses intermediate levels of resistance to TYLCV and that exhibits commercially desirable characteristics, such as, but not limited to, disease resistance, insect resistance, valuable fruit characteristics, etc. The resulting plant population (that is Fi hybrids) is then allowed to self-pollinate or cross-pollinate and set seeds (F₂ seeds). The F₂ plants grown from the F₂ seeds are then screened for resistance to TYLCV. The population can be screened in a number of different ways. First, the population can be screened using a traditional pathology disease screen. Such pathology disease screens are known in the art. Specifically, the individual plants or parts thereof can be challenged in an incubator or greenhouse with TYLCV and the resulting resistant or susceptible phenotypes of each plant scored.

[0084] Disease symptoms were evaluated according to the disease severity index (DSI) described in Friedmann et al. 1998; and Lapidot and Friedmann 2002: (0) no visible symptoms, inoculated plants show same growth and development as non-inoculated plants; (1) very slight yellowing of leaflet margins on apical leaf; (2) some yellowing and minor curling of leaflet ends; (3) a wide range of leaf yellowing, curling and cupping, with some reduction in size, yet plants continue to develop and (4) very severe plant stunting and yellowing, pronounced cupping and curling of leaves, plants growth is stopped.

[0085] In a preferred embodiment, TY172 plants should be crossed with susceptible plants as maternal or paternal plants. Usually five plants of each are sufficient to obtain an adequate amount of Fj seeds. Fj plants arising from the above Fi seeds should be grown. About ten such Fi plants should be sufficient to obtain adequate amount of F₂ seeds. These Fi plants can be genotyped utilizing but not restricted to the Melting curve SNP genotyping method (McSNP) with primers designated as McSNP F and R in Table 2 or any other similar method to verify that these Fi plants are true hybrids. The F₂ seeds may be obtained by self pollination (single flower), or by cross pollination. F₂ seeds should be collected from any of the above ten F[ plants. Two hundred seeds should be enough to obtain about 50 plants harboring the resistant allele of Ty-5 in a homozygous state. To obtain such plants, These 200 F₂ plants should be grown and genotyped utilizing the Melting curve SNP genotyping method (McSNP) with primers designated as McSNP F and R in Table 2 or any other similar method to obtain F₂ plants which are homozygous for the resistant allele of Ty-5. Elite plants can be selected among these homozygous plants. F₃ seeds extracted from such plants can be further selected for horticultural traits other than TYLCV resistance to obtain resistant lines.

[0086] The above procedure can be repeated by means of backcross breeding to introgress required traits from susceptible plants.

[0087] In another preferred embodiment, not only TY172 may be used as a first donor tomato plants. Any tomato plant that is homozygous for the gene encoding for TYLCV resistance may be used as a first donor tomato plant. For example, PRT-630 which is a BC₂F₄ line harboring the SIPELOTA resistant allele in homozygous state may be used as a first donor tomato plant.

[0088] Marker-assisted selection can be performed using one or more of the hereinbefore described molecular markers to identify those hybrid plants that contain a SIPELOTA gene that encode for TYLCV resistance. Alternatively, marker-assisted selection can be used to confirm the results obtained from the pathology screen.

[0089] F₂ hybrid plants exhibiting a TYLCV resistant phenotype contain the requisite genes encoding for TYLCV resistance, and possess commercially desirable characteristics, are then selected and selfed for a number of generations in order to allow for the tomato plant to become increasingly inbred. This process of continued selfing and selection can be performed for five or more generations. The result of such breeding and selection is the production of lines that are genetically homogenous for the genes associated with TYLCV resistance as well as 8630 other genes associated with traits of commercial interest.

[0090] Alternatively, a new and superior TYLCV resistant inbred tomato plant line can be developed using the techniques of recurrent selection and backcrossmg. in this method, TYLCV resistance can be introgressed into a target recipient plant (which is called the recurrent parent) by crossing the recurrent parent with a first donor plant (which is different from the recurrent parent and referred to herein as the "non-recurrent parent"). The recurrent parent is a plant that is non-resistant or has an intermediate level of resistance to TYLCV and possesses commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc. The non-recurrent parent exhibits TYLCV resistance and contains a gene that encode for TYLCV resistance. The non-recurrent parent can be any plant variety or inbred line that is cross-fertile with the recurrent parent. The progeny resulting from a cross between the recurrent parent and non-recurrent parent are backcrossed to the recurrent parent. The resulting plant population is then screened. The population can be screened in a number of different ways. The population can be screened using a traditional pathology screen as described previously herein and/or by using genetic markers.

[0091] Over the years, especially with the advent of sequencing as a routine procedure, it became apparent that the name TYLCV had been given to a heterogeneous group of more than 10 virus species and their strains, all of which induce very similar disease symptoms in tomato (Navas-Castillo et al., 2011). The most prevalent strains in the Mediterranean basin are TYLCV (or TYLCV-Israel or TYLCV-IL) (GenBank accession: XI 5656), TYLCV-Mld (GenBank accession: X76319), and TYLCSV (Tomato yellow leaf curl Sardinia virus; GenBank Accession: X61153). More preferably, the strains are TYLCV (or TYLCV-Israel or TYLCV-IL) (GenBank accession: X15656.1), TYLCV-Mld (GenBank accession: X76319.1), and TYLCSV (Tomato yellow leaf curl Sardinia virus; GenBank Accession: X 1 153.1). All GenBank Accession Numbers appearing in this application are in the latest version true to September 13, 2012.

[0092] Hence, in another embodiement of the present invention, the present invention relates to methods for producing superior new TYLCV-Mld or TYLCSV resistant tomato plants. In the method of the present invention, a gene encoding for TYLCV-Mld or TYLCSV resistance is introgressed from a donor parental plant that is resistant to TYLCV-Mld or TYLCSV into a recipient plant that is either non-resistant or a plant that has intermediate levels of resistance to infection by TYLCV-Mld or TYLCSV. The TYLCV-Mld or TYLCSV resistant tomato plants produced according to the methods of the present invention can be either inbred, hybrid, haploid, apomictic or genetically engineered tomato plants. [0093] The present invention further contemplates the insertion of such isolated and purified gene into tomato using techniques known in the ait in order to provide transgenic plants that exhibit resistance to TYLCV infection.

[0094] Plant transformation involves the construction of an expression vector that will function in plant cells. In the present invention, such a vector comprises DNA comprising a gene that encodes for TYLCV resistance that is under control of or operatively linked to a regulatory element, such as a promoter. The expression vector may contain one or more such operably linked gene/regulatory element combinations, provided that at least one of the genes contained in said combinations encodes for TYLCV resistance. The vector(s) may be in the form of a plasmid, and can be used, alone or in combination with other plasmids, to provide transgenic plants that are resistant to TYLCV, using transformation methods described below.

[0095] Expression vectors can include at least one genetic marker, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the genetic marker). Many commonly used selectable marker genes for plant transformation are known in the art, and include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide, or genes that encode an altered target which is insensitive to the inhibitor. Several positive selection methods are known in the art, such as mannose selection. Alternatively, markerless transformation can be used, the techniques for which are known in the art.

[0096] An example of a commonly used selectable marker gene for plant transformation is the neomycin phosphotransferase II (nptll) gene, isolated from transposon Tn5, which when placed under the control of a plant regulatory signal confers resistance to kanamycin (See, Fraley et al, Proc. Natl. Acad. Sci. U.S. A, 80:4803 (1983)). Another commonly used selectable marker gene is the hygromycin phosphotransferase gene that confers resistance to the antibiotic hygromycin (See, Vanden Elzen et al, Plant Mol. Biol., 5:299 (1985)). Examples of other selectable markers that can be used include beta-glucuronidase (GUS), beta-galactosidase, luciferase and chloramphenicol acetyltransferase.

[0097] Expression vectors must be driven by a nucleotide sequence comprising a regulatory element, such as a promoter. Several types of promoters are well known in the art, as are other regulatory elements that can be used alone or in combination with promoters. As used herein "promoter" includes reference to a region of DNA upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, seeds, fibers, xylem vessels, tracheids, or sclerenchyma. Such promoters are referred to as "tissue-preferred". Promoters that initiate transcription only in certain tissues are referred to as "tissue-specific". A "cell type" specific promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves. An "inducible" promoter is a promoter that is under environmental control. Examples of environmental conditions that may effect transcription by inducible promoters include anaerobic conditions or the presence of light. Tissue-specific, tissue-preferred, cell type specific, and inducible promoters constitute the class of "non-constitutive" promoters. A "constitutive" promoter is a promoter that is active under most environmental conditions.

[0098] An inducible promoter is operably linked to an isolated and purified gene that encodes for TYLCV resistance for expression in tomato. With an inducible promoter, the rate of transcription increases in response to an inducing agent. Any inducible promoter can be used in the present invention.

[0099] A constitutive promoter can be operably linked to an isolated and purified gene that encodes for TYLCV resistance for expression in tomato. Several different constitutive promoters are known in the art and can be used in the present invention. An example of a constitutive promoter that can be used in the present invention includes, but is not limited to, promoters from plant viruses such as the 19S or 35S promoter from CaMV (See, Odeil et al., Nature, 313:810-812 (1985)).

[00100] A tissue-specific promoter is operably linked to an isolated and purified gene that encodes for TYLCV resistance for expression in tomato. Plants transformed with an isolated and purified gene that encodes for TYLCV resistance operably linked to a tissue- specific promoter produce the protein product of the transgene exclusively, or preferentially, in a specific tissue.

[00101] Any tissue-specific or tissue-preferred promoter can be utilized in the instant invention. Exemplary tissue-specific or tissue-preferred promoters include, but are not limited to, a leaf-specific and light-induced promoter such as that from cab or rubisco (See, Simpson et al., E BO J., 4:2723-2729 (1985) and Timko et al, Nature, 318: 579-582 (1985)).

[00102] Numerous methods for plant transformation have been developed, including biological and physical, plant transformation protocols. See, for example, Miki et al., "Procedures for Introducing Foreign DNA into Plants" in Methods in Plant Molecular Biology and Biotechnology, Glick, B. R. and Thmpson, J. E. Eds. (CRC Press, Inc. Boca Raton, 1993) pages 67-88. In addition, expression vectors and in vitro culture methods for plant cell or tissue transformation and regeneration of plants are available (See, Gruber et al., "Vectors for Plant Transformation" in Methods in Plant Molecular Biology and Biotechnology, Glick, B, R. and Thompson, J. E. Eds. (CRC Press, Inc., Boca Raton, 1993) pages 89-119)).

[00103] One method for introducing an expression vector into a plant is based on the natural transformation system of Agrobacterium (See, Horsch et al., Science, 227: 1229 (1 85)). A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria that genetically transform plant cells. The Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectively, carry genes responsible for genetic transformation of the plant (See, Kado, C. I., Crit. Rev. Plant. Sci., 10:1 (1991)). Descriptions of Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer are provided by Gruber et al., supra, Miki et al., supra, and Moloney et al., Plant Cell Reports 8:238 (1989). See also, U.S. Pat. No. 5,591,616, issued Jan. 7, 1997.

[00104] Another reference that may be used using Agrobacterium is FRED A. van ENGELEN, et al., pBlNPLUS: an improved plant transformation vector based on pBIN19, Transgenic Research 4:288-290, 1995.

[00105] Another method for introducing an expression vector into a plant is based on microprojectile-mediated transformation wherein DNA is carried on the surface of microprojectiles. The expression vector is introduced into plant tissues with a biolistic device that accelerates the microprojectiles to speeds of 300 to 600 m/s which is sufficient to penetrate plant cell walls and membranes (See, Sanford et al., Part. Sci. Technol. 5: 27 (1987), Sanford, J. C, Trends Biotech., 6:299 (1988), Klein et al., Bio/Technology, 6:559-563 (1988). Sanford J. C, Physiol Plant, 79:206 (1990), Klein et al., Biotechnology, 10:268 (1992)).

[00106] Another method for introducing DNA to plants is via the sonication of target cells (See, Zhang et al., Bio/7'echnology, 9:996 (1991)). Alternatively, liposome or spheroplast fusion have been used to introduce expression vectors into plants (See, Deshayes et al, EMBO J., 4:2731 (1985), Christou et al, Proc Natl. Acad. Sci. U.S.A, 84:3962 (1987)). Direct uptake of DNA into protoplasts using CaCl.sub.2 precipitation, polyvinyl alcohol or poly-L-ornithine have also been reported (See, Hain et al, Mol. Gen. Genet., 199: 161 (1985) and Draper et al,, Plant Cell Physiol, 23: 451 (1982)). Electroporation of protoplasts and whole cells and tissues have also been described (Donn et al., In Abstracts of Vllth International Congress on Plant Cell and Tissue Culture IAPTC, A2-38, p 53(1990); D'Halluin et al., Plant cell, 4:1495-1505 (1992) and Spencer et al., Plant Mol Biol., 24:51-61 (1994)). [00107] Following transformation of tomato target tissues, expression of the above- described selectable marker genes allows for preferential selection of transformed cells, tissues and/or plants, using regeneration and selection methods now well known in the art.

[00108] This invention relates to the isolation of the SIPELOTA gene conferring resistance to TYLCV at the Ty~5 locus that was obtained by a comparative fine-tune mapping. To isolate the gene conferring resistance to TYLCV, inventors have sequenced DNA fragments on chromosome 4 using genomic DNA extracted from the resistant line TY172 and the susceptible counterpart M-82. These sequences were compared in order to identify appropriate polymorphisms between the resistant and susceptible lines. These polymorphisms were further used to design polymorphic DNA markers that were further analyzed for association with the resistance trait in segregating populations.

[00109] In another embodiment, protoplast fusion can be used to create superior new

TYLCV resistant plants. More specifically, a first protoplast can be obtained from a tomato plant or other plant line that exhibits resistance to infection by TYLCV and contains the gene described herein. For example, a protoplast from TY172 or PRT-630 can be used. A second protoplast can be obtained from a second tomato or other plant variety that contains commercially desirable characteristics, such as, but not limited to disease resistance, insect resistance, valuable fruit characteristics, etc. The protoplasts are then fused using traditional protoplast fusion procedures which are known in the art. For example, the protoplast fusion can be accomplished by employing a polyethylene glycol (PEG) solution to facilitate the fusion of the membranes. Such somatic hybridization may be effected under the conditions disclosed by Sundberg et al. (Plant Science, 43:155 (1986), for the production of interspecific hybrids or modifications thereof. However, one skilled in the art would recognize that the protoplast fusion can be accomplished in other ways other than using polyethylene glycol (PEG). For example, the protoplasts can be fused by using electric field-induced fusion techniques as described by Koop et al., "Electric Field-Induced Fusion and Cell Reconstruction-with Preselected Single Protoplasts and Subprotoplasts of Higher Plants" in Electroporation and Electrofusion in Cell Biology, Neuman et al., editors, pgs. 355-265 (1989). Additionally, protoplast fusion can be accomplished with dextran and polyvinyl alcohol as described by Hauptmann et al., "Carrot.times. Tobacco Somatic Cell Hybrids Selected by Amino Acid Analog Resistance Complementation", 6.sup.th International Protoplast Symposium, Basel, Switzerland, Aug. 12- 16, 1983.

[001 10] In another embodiment, the present invention provides methods for determining the presence or absence of TYLCV resistance in a tomato plant, or alternatively in a tomato seed. These methods comprise analyzing DNA from a plant or a seed for the presence of one or more molecular markers that are associated with Ty-5 locus that is linked to SIPELOTA allel that encodes for TYLCV resistance. Such markers include, at least one of the following: T⁴⁷-to- G transversion in the first exon of the SIPELOTA. gene or T -to-G as appearing in Fig. 4. According to this method, the analyzing comprises analyzing the tomato plants or seed by McSNP analysis.

[0011 1] Isolation of the gene conferring resistance to TYLCV was made thanks to narrowing down the resistant locus at first. Narrowing down the resistant locus was made possible by the establishment of 5,000 segragating plants population, which was reduced after selection to 50 plants. There was no recognized reason for any skilled person to make such a large invenstment.

EXAMPLES

[00112] In order to illustrate the invention, the following examples are included.

However, it is to be understood that these examples do not limit the invention and are only meant to suggest a method of practicing the invention.

[00113] Persons skilled in the art will recognize that bio-assays used to obtain results described herein may be readily applied on non-exemplified compounds of the invention.

[00114] Following are examples to such an application on non-exemplified methods of the invention. The following procedure examples are general practical routes that enable a person skilled in the art to make and use methods of the invention on any exemplified or non- exemplified compounds of the invention.

[001 15] Example 1 - Mapping the resistant locus and identification of the TYLCV resistance gene.

[001 16] Five thousand segregating F₂, F , F₄, BC|F₂, BCiF₃, BCip , BC]F₅, BC₂F₂, and

BC₂F₃ plants of the initial cross between TY172 and M-82 were inoculated with TYLCV and genotyped with the polymorphic markers obtained through sequencing of the DNA region spanning the SIN AC 1 gene. The inoculation procedure was as follows: whitefiy colonies (B. (abaci, biotype B) were reared on cotton plants (Gossypi m hirsutum L.) in muslin-covered cages held in a growth chamber at 23-30°C. Cultures of the Israeli isolate of TYLCV (Genbank Accession number XI 5656) (Navot et al. 1991) were maintained in susceptible tomato (cv. Rehovot 13) in an insect proof greenhouse. For TYLCV inoculation, the whitefiies were given a 48-hour acquisition access period on TYLCV-infected tomato source plants, followed by a 48- hour inoculation access period on the experimental tomato plants (first leaf stage) with about 50 whiteflies per plant as described previously (Lapidot et al. 1997). Thereafter, the plants were sprayed with the systemic pesticide Imidacloprid (Confidor, Bayer, Leverkusen, Germany) and held in an insect-proof greenhouse at 26-32 °C for 30 days until symptoms could be clearly scored. TYLCV-induced symptoms of each individual plant of the above segregating seedlings were evaluated 30 days following inoculation in a greenhouse and a month later in either the field or a greenhouse. Symptoms were evaluated according to the disease severity index (DSI) described above.

[00117] Nucleotide differences between the resistant and susceptible lines were, if possible, used as targets for restriction endonuclease to differentiate between the susceptible and resistant genotypes. In few cases length polymorphisms were already visible following the initial PCR amplification. In other few cases direct sequencing was used on individual recombinant plants in order to delimit the size of the resistant locus. Key PCR DNA markers that have been developed are listed in Table 2.

[001 18] Altogether, 50 plants displaying recombination events among the polymorphic markers developed were identified among the original 5,000 segregating plants. These plants were allowed to self-pollinate in order to produce either segregating or non-segregating populations which were again genotyped and inoculated. These 50 recombinant plants enabled the inventors to narrow down the resistant locus into a 23,250 bp fragment (in TY172) between marker 4.4 and marker 4.8 (Table 2) containing two genes: a CALMODULIN DEPENDENT PROTEIN KINASE (LeCDPK2; Kamiyoshihara et al., 2010) and a PELOTA gene homolog (SIPELOTA).

[001 19] It is undoubtly clear that establishing a vast population of five thousand segregating F₂, F₃, F₄, BC,F₂, BC,F₃₅ BC1F4, BC1F5, BC₂F₂, and BC₂F₃ paints, doing the inoculation procedure, and studying the nucleotide differences between the resistant and susceptible lines requires a greater expenditure of time, effort, or resources than the prior art teachings. It is undoubtly clear that no one of ordinary skill would have undertaken such effort without a recognized reason to do so. Table 1 provides summery of the mapping of these populations:

Table 1

F₃ 247 48 11,856

Total: 12,103

TY172 M82 F₂ 1 311 311

F₃ 6 48 288

F₄ 7 47 329

BC,F₂ 12 1 18 1416

BC,F₃ 8 93 744

BC|F₄ 9 99 891

BCiFs 1 1 1 777

BC₂F₂ 6 69 414

BC₂F₃ 6 82 492

Total: 5662

[00120] For further illustration of the complexity associated with finding the SIPELOTA, the reader is referred to FIG. 10. FIG. 10 shows analyses of association between DNA markers spanning the Ty-5 locus and TYLCV disease severity index (DSI) in 32 representative segregating populations originating from a single recombinant self-pollinated plant (in the ruler presented to the left of each analysis: "%" regions are heterozygous (SR), "$" regions are homozygous for the alleles originated from the susceptible line (SS) and "#" markers are homozygous (RR) for the alleles originated from the resistant line; the analysis of variance presented at the bottom of each population was carried out with different markers. The marker in red asterisks is the one that was used as an independent variable in each analysis; different superscript letters above means indicate statistically significant difference, O.05, between genotypes for each analysis separately; populations marked as susceptible are susceptible populations in which the marker used is not associated with DSI (no statistical difference was obtained between SS, SR and RR and thus the segregating regions do not contain the resistant gene), populations marked as resistant are resistant populations in which the marker used is also not associated with DSI (no statistical difference was obtained between SS, SR and RR and thus again the segregating regions do not contain the resistant gene), populations marked as associated segregating are populations in which the marker used is associated with DSI (statistical difference was obtained between RR and both SS and SR, thus the segregating regions do contain the resistant gene).

[00121] Further direct sequencing of the polymorphic region downstream of the SIPELOTA homolog in selected recombinants enabled the inventors to delimit the introgression into a polymorphic 2,386 bp region (in TY172) which displays one SNP (G^l-to-A transition) and two single nucleotide insertions (SNI, A¹⁵⁶⁵ and A¹⁹⁷³) in the promoter region of SIPELOTA of the resistant TY172 in comparison to the susceptible M-82 (Fig. 4). In addition, a T^-to-G transversion in the first exon of the SIPELOTA gene was observed in TY172 (T²³⁸⁴-to-G²³⁸⁶ in Fig. 4). Additional direct sequencing of the polymorphic region upstream to the SIPELOTA homolog in other selected recombinants allowed the inventors to finally delimit the resistance introgression to include only the T¹⁹⁶ⁱ-to-Aⁱ⁹⁶² transversion in the SIPELOTA promoter region and the T⁴⁷-to-G transversion in the first exon of the SIPELOTA gene (Fig. 4).

[00122] Table 2. DNA markers displaying polymorphisms between the resistant line

TY172 and the susceptible counterpart, M-82, on the tomato chromosome 4 (markers are displayed according to their approximate distance in Kb from SIN AC 1)

Marker Distance Forward (F) and Reverse (R) primers Restriction from enzyme SlNACl

(Kb)

SlNACl 0 F- TGCCTGGTTTCTGCTGTCA Taql

R- TAAAGCTGAAGAAGGACTTACCCT

31 6 F~ TTCCATTGACACTTGTCCTGAG Hinfi

R- CCGTTTGTATAACGATAAGGGC

22 6.7 F- CCCTTATCGTTATACAAACGGC Hinfl

R- TTTGTG CG AG AATTG ATG AGAG

41 7.6 F- ATCTAATTCCATCCGGTGGTC PmK

R- TCCATAAGCTTCCTTGTTGTTG

34 8.7 F- CAGTTGCTCGTGTGTTTTGTTC Az\l

R- GCGCTCTATAGCTACGGTTTTG

25 18.5 F- ATTGCTTCTAAAGTCTGGCAGG TspRl

R- TTTAGCTTTAAGGGGTCGTTTG

1.8 33.2 F- CCTTGACAATCAACAATGCTTC AM

R- TCACGTGTGTGATTTATGCTTG

RP5 184.3 F- ATTCCTCTTCAATAGGTCCACG Alul

R- GTCTCATCTGTTTCCGAGTTCC

RP3 186.5 F- CAAACTCTCCCATGCTTCTTTC Bgni

R- TCATTCGGGAAATTAACCTACG

7.4 218.7 F- GTGAATTATCATGGCACCATTC Earl

R~ TATGAAGCTACGATATTCCGGG

DJ 220.7 F- ATAGTTCAAGAAAAAGTCGAACC PCR

R- CGAATTAAAATCATGAAACAATG

RING 231.7 F- GTTCATGATGGAGTAGAAGAAGAAG Mnll

R- CTTAGTCAACCCTCTTTAGGTTGC

4.4 249.9 F- AAAATTTAAGGAATCCCATAGCG AflWl

R- TTTGAAATATCTTATGTTTGTTCGG

PELOTA 268.2 F- AAATTTGTTTCATTCAATATGAAGATTGT McSNP

R- CGTTTTCTTCATCTGGGGT 4.8 270.7 F- GGTTCTTTTGAGCTATAACTCTGC Rsal

R- ATATTGGGCCAACCATAACTTC

9.4 271.6 F- AATTAATGTGAGACGGAGCCAG Asel

R- CCAAGTCACATGGTAAATGCAG

5.4 273.9 F- CAAATATGTCAATGGATGGTGG Hphl

R- AAGGTGCGGTGGATTATTAAAG

3.1 291.6 F~ GTAAATAAAGCACAAATGCCCC CviKl

R- AATTGTTGTGCCACCACTAGAC

9.8 301.3 F- TAACGAACACCAACTGTTCGAC NfolV

R- ATCATTTCCCCTTACCATTCAC

0.1 316.2 F- CTAGCCTCTGTGTAAGATCGGG BsaAl

R- TCAAAACATCTCAAACGACCTC

0.3 333.3 F- CCAGTGATAATGATGGATGTGG Bed

R- ATGGAAAAATGATGGGACTACG

0.4 340.8 F- TGCTATTGACTTTTCCACTTGC Hinfi/CIdl

R- TTGAATTTCACGTCATTGGC

0.5 348.9 F- TTCATATTGATCACTTGCGGTC Avail

R- ATTTGGCTAATGGAATCTCCTG

5.8 351 F- CTTGTAAACCCATGTGGTAGGG Bgm

R- AACGTGTGAGTGAAGCAAAAAG

3.8 579.3 F- TTTTTACCTCGGGAGCTAGGAG Hphl

R- GCCGAGATAACATTAGTGGTGAC

4.9 693 F- AGTGCCACGTA AGCTA A AA AGG BstUl

R- AAGTTGATCCAATTCAAGCTGC

[00123] Example 2 - Sequencing of the resistance gene.

[00124] To sequence the SIPELOTA open reading frame, total RNA was extracted from apex leaves of resistant TY172 and susceptible M-82 plants using the TRIzol reagent system (invitrogen Corp., Carlsbad, CA). Possible genomic DNA contaminants were removed from the total RNA preparations with TURBO DNA-free DNAase treatment (Ambion Inc., Austin, TX, USA). The remaining RNA was then used as the template for complementary DNA (cDNA) synthesis using the Master script cDNA synthesis kit with random hexamer primers ( APA Biosystems, Woburn, MA, USA . The cDNA samples were then subjected to PCR with the following primers: F= 5'~AAGGACACAAACCGTTAAAACC-3' and R- 5'- AC AACAGGTG ACG ATGA AACTG-3 ' as well as F- 5 ' -GTTCTG ATGC A AGAAGG ATTGG- 3^! and R- 5'-CGAATATACAACACGCGATACG-3'. The resulting amplification fragments were visualized in an agarose gel and DNA fragments of the expected size were cut from the gel, extracted and directly sequenced with the primers used for each of the initial PCR amplifications. The SIPELOTA amino acid sequence in TY172 and in M-82 which is presented in Fig. 5 show that the T⁴⁷-to-G transversion mentioned herein above results in Valine^!6-to- Glycine substitution in TY172. [00125] Example 3 - Development of a DNA marker specific for the resistance gene.

[00126] The T⁴⁷-to-G transversion mentioned herein above (T²³⁸ ~to-G²³⁸⁶ in Fig. 4) was utilized to design a Melting curve SNP genotyping method (McSNP) with primers designated as McSNP F and R in Table 2. The McSNP genotyping reaction, described previously by Ye et ai. (2002), was carried out in DYN R@D Ltd, Caesarea industrial park, Israel.

[00127] Example 4 - Evidence that the reduced TYLCV DNA accumulation characterizing TY172 is inherited together with the SIPELOTA region.

[00128] TY172 has been characterized as a TYLCV resistant line because it displays reduced TYLCV DNA accumulation in comparison to their susceptible counterparts (Lapidot et al., 1997; Friedmann et al., 1998; Segev et al., 2004). To validate that the SIPELOTA region can also display reduced TYLCV DNA accumulation similarly to TY172 and in contrast to susceptible lines the inventors have inoculated two resistant lines (TY172 and PRT-630) and two susceptible lines (R13 and M-82). Noteworthy, PRT-630 is a resistant BC₂F₄ line developed from an initial cross between TY172 and M-82 using M-82 as a recurrent parent. The development of PRT-630 was carried out using the McSNP primers, specific to the SIPELOTA gene, and is thus homozygous for the G⁴⁷ nucleotide of this gene similarly to TY172.

[00129] The inculation was carried out using whitefiies as described above during

October 20 Π . Total DNA was extracted from 0.2 g fresh TYLCV -infected plants according to Dellaporta et al. (1983). DNA concentrations were determined using a Nanodrop spectrophotometer. Quantitation of viral DNA was carried out utilizing Quantitative Real-Time PCR (qPCR) according to Mason et al. (2008). TYLCV primers were designed using the Primer 3 software (http://frodo.wi.mit.edu/cgi~bin/primer3/primer3 yvww gi). The primers used for the quantitative Real-Time PCR (qPCR) reaction were: TYRT2F (nt 2254-2273) 5^!- GCTG ATCTGCC ATCG ATTTG-3 ' and TYRT2R (nt 2401-2383) 5'~ GGTTCTTCG AC CTGGT ATC- 3 ' forming a 147 bp amplicon. These primers were thoroughly tested for primer-dimmer and amplification of plant DNA. Target amplification was confirmed by cloning and sequencing of the PCR reaction products. The reaction was carried out in a Rotor-Gene Q Quantitative Real-Time PCR instrument (Qiagen Corbett Life Science, Duesseldorf, Germany), with the following profile: 95°C for 30 s for three cycles to calibrate background, 95°C for 10 min to begin amplification, followed by 40 cycles of 95°C for 15 s and 60°C for 30 s. qPCR reactions (12 μΐ volume) included 3 μΐ of the DNA plants, 6 μΐ of KAPA SYBR® FAST qPCR Universal Readymix Kit (Kapa Biosystems Inc., Wobum, MA, USA), 0.125 μΜ forward and reverse primer. [00130] DNA extracted from control, non-inoculated healthy tomato plants was used as a negative control. Other control reactions included water. Each qPCR reaction was run in duplicate, with 5 replications per treatment. DNA of each sample was extracted from 3 different infected plants. For standard curves, PCR amplicon was cloned into pGEM-T Easy (Promega Corporation, Madison, WI, USA) using the manufacturer's protocol and sequenced on both strands using the respective primers. The plasmids were extracted from the selected colonies using Qiagen Plasmid Miniprep kit and linearized by digesting with Pstl. The gel-extiacted fragments were quantified on Nanodrop and used to create stable standard curves. The dilution series was performed by copy number following methods recommended by Applied Biosystems (Foster City, CA, USA). The cycle threshold and copy number were determined using Corbett Rotor-Gene 6000 Series software. Amplification was followed by melt-curve analysis. Statistical analysis of the data was performed on JMP 7.0 software (SAS Institute, Cary, NC).

[00131] The results presented in Fig. 6 show that PRT-630 can also display reduced

TYLCV DNA accumulation similarly to TY172 and in contrast to susceptible lines. It can be thus concluded that this trait in inherited with SIPELOTA.

[00132] Example 5 - Obtaining resistant tomato plants carrying the Ty-S locus by hybridization.

[00133] 5000 plants have been screened in breeding generation outlined (F₂, F₃, F₄,

BCiF₂, BC_tF₃, BC1F4, BCjFs, BC₂F₂, and BC₂F₃), identifying recombinants along the Ty-5 locus, each recombinant was the basis of generating a segregating F₂ population of about 100 plants which was used to follow up the exact site of the resistant gene. Provided herewith are results of 2 synonymous F₂ populations. Characterization of the F₂ is described in Anbinder et al. 2009 (see Table 4 in Anbinder et al.).

[00134] Table 3. Number of plants (n) and DSI of F₂ plants inoculated with TYLCV-

Israel according to their SIPELOTA genotype

[00135]

Genotype n DSI

SS 44 2.0^A±0.1

SR 86 1.9^A±0.1

RR 29 0.4^B±0.1

n = number of plants; ± SEM = Standard error of the mean. Within columns, different letters denote means that significantly differ, P < 0.05

[00136] Table 4. Number of plants (n) and DSI of F₂ plants inoculated with both

TYLCV-Israel and TYLCV-Mld according to their SIPELOTA genotype Genotype n DSI

SS 27 2.9^Α±0. Ϊ

SR 65 2.6^A±0.1

RR 20 oAo.i

n = number of plants; ± SEM = Standard error of the mean. Within columns, different letters denote means that significantly differ, P < 0.05.

[00137] In both of the above tables: Results are displayed as mean±SE; DSI indicates disease severity index as described in the Materials and Methods and previously in Friedmann et al. (1998) and in Lapidot and Friedmann (2002); R and S denote alleles originating from the Ty-5 resistant and susceptible lines, respectively; different superscript letters represent statistically significant mean values ( O.05) based on Tukey- ramer HSD test (Kramer 1956).

[00138] Example 6 - Resistance to TYLCV-Mld.

[00139] 14-days old plants were inoculated with TYLCV-Mld using whiteflies, as described before (Lapidot et al. 1997). Whiteflies were allowed a 48-hr acquisition accesses period on TYLCV-Mld source tomato plants, followed by a 48-hr transmission accesses period on TY172, PRT-630 (a BC₂F₄ line containing Ty-5) and R-13 susceptible test plants, 15 plants from each line. Following inoculation whiteflies were removed by Imidacloprid application, and the plants were kept in an insect-proof greenhouse and monitored for disease symptoms. Four weeks after inoculation the plants were screened and the disease severity index (DSI) was determined (Table 5). As can be seen in Table 5, TY172 showed a high level of resistance, PRT-630 also showed a high level of TYLCV-Mld resistance, while the susceptible line R-13 indeed was susceptible, with a DSI higher than 3.

[00140] Table 5. Resistance of TY172, PRT-630 and Rl 3 to TYLCV-Mld.

Line n Average DSI ± (SEM)*

TY172 10 0.1^A ± 0.07

PRT-630 12 0.4^A ± 0.2

R-13 12 3.3^B ± 0.08 n = number of plants, *SBM = Standard error of means. Wi thin columns, different letters denote means that significantly differ, P < 0.05. [00 41 ] Example 7 - Resistance to TYLCSV.

[00142] The same procedure as in Example 6 was conducted with TYLCSV, and the results showed the same trend - TY172 expressed the highest level of resistance, followed by PRT-630 that expressed a higher level of resistance than the susceptible line, but somewhat lower than TY172, followed by the susceptible line R-13 that indeed was susceptible, with the highest DSI score.

[00143] Example 8 - Tomato transformation.

[00144] Seed sterilization:

[00145] Batch of about 100 dry seeds were placed in Miracloth bag and were inserted into 50ml plastic tube filled with sodium hypochloride containing 1.2% active material and incubated for 15 min. The tube was shacked on a rotatory shaker during the whole period of sterilization. After incubation in hypochloride the seeds were rinsed 3 times with sterile distilled water, and planted in Vitro Vent container (Duchefa, square vessels 9.6 cm in diameter and 9 cm height (100-120 seeds per container) or sterile magenta boxes 60-70 seeds per box) containing 1/2MS medium and 1.5% sucrose. The boxes with the sterile seeds were maintained in culture room for 9-12 days for seeds germination.

[00146] Cotyledons preparation :

[00147] Cotyledons were taken from 10-12 days old seedling when there are no or only small true leaves visible.

[00148] The young seedlings are placed in Petri dish (20-25 seedlings per dish) containing liquid MSO medium. The cotyledons were cut from the seedling and placed into liquid MSO media, than on sterile paper and were cut again at the proximal (wide) side of the blade, approximately 2-3 mm from the pedicle (to discard pre-existing meristem) and then cut 1- 2mm from the narrow side. The cut cotyledons were placed upside down in Petri dishes containing Dl or Reg. medium. The cotyledons (70-100 per dish) were placed very close together and incubate in culture room for 1-2 days.

[00149] Co-cultivation with Agrobacterium :

[00150] Agrobacteruim were culture in 20ml liquid LB medium containing the selective antibiotic Kanamycin 50mg Γ¹ at 27°C, 200 rpm over night in dark. At the transformation day the bacterial culture was dilute to attain 0.4-0.5 OD at 600 nm. The bacterial culture was centrifuged (4000 rpm) for 15 min. and the pellet was resuspend in the proper volume of liquid MSO medium and acetosyringone (3,5-dimethoxy-4-hydroxy-acetophene) was added to the bacterial culture to final concentration of ΙΟΟμΜ and were again grown at 27°C, 200 rpm for 2 hours in darkness before transformation. The OD was measured again. About 10-12 ml of the bacterial MSO culture were poured on the cotyledons which were pre-incubate for 2 days, the plates were cover with aluminum foil and incubated for 1-2 hours, depended on the OD. After incubation the remnants of the bacterial were drawn by 10 ml sterile tips, the Petri dishes were sealed by nylon film and incubated in culture room for 3 days in darkness.

[00151] Induction of regeneration:

[00152] After 2-3 days of co-cultivation, the cotyledons were remove to regeneration selection medium Dl or Reg. + 75 mg/L kanamycin (or other selective antibiotic) + 500 mg/L Carbeniciliin (to kill the bacteria). The plates were kept in culture room and every 14-20 days were moved to fresh medium.

[00153] Shoot development and rooting:

[00154] Shoot regeneration was detectable after about 30 days depended on the tomato line. While the shoots are small, the entire cotyledons removed, some time a mass of callus was develop with the shoots, it is preferable to remove the excess callus before transfer to fresh medium. When shoots contain at least 2-3 leaves and an apical meristem, it is time to separate the shoot from the cotyledon and place it in elongation medium plus the antibiotics (DL-An) in jars or vitro-vent containers. Well develop shoots are moved to rooting medium, callus beyond the shoots is removed. The rooting medium (DR.- An) contained the 2 antibiotics. Rooted shoot (the plant) are released gently from the medium to pots with soil mixture for the hardening process before transfer to the greenhouse.

[00155] Culture media and culture condition:

[00156] The basic medium used for tomato seed germination was standard half strength

MS (Murashige and Skoog, 1962) supplemented with 15 g Γ¹ sucrose and 8 g Γ¹ Agar.

[00157] MSO: MS salts including B5 vitamins 4.4 g/L; 20 g/L sucrose; 8 g L agar (for solid medium); pH adjust to 5.6-5.7 by KOH.

[00158] Regeneration medium: Dl; MS salts including B5 vitamins 4.4 g/L; 30 g/L glucose; Zeatin 1 mg/L; IAA 0.1-0.25 mg/L; 8 g/L agar; pH adjust to 5.6-5.7 by KOH.

[00159] REG: MS salts including B5 vitamins 4.4 g L; 30 g L glucose; Zeatin 1 mg/L;

Kinetin 2 mg/L; IAA 0.8 mg/L; 8 g/L agar (for solid medium MS salts including B5 vitamins; pH adjust to 5.6-5.7 by KOH.

[00160] DL: MS salts including B5 vitamins 4.4 g/L; 20 g/L Glucose; Zeatin 0.1 mg/L; 8 g/L agar (for solid medium); pH adjust to 5.6-5.7 by KOH MS salts including B5 vitamins.

[001 1] DR: MS salts including B5 vitamins 4.4g/L; 20 g/L Glucose; IB A 2 mg/L; 8 g/L agar (for solid medium); pH adjust to 5.6-5.7 by KOH. [00162] Selection media was the same with the addition of 75 mg 1^"' anamycin monosulphate and 500 mg Γ¹ Carbenicillin disodiun. Cultures were maintained in culture room at 23°C under 1 6hours light (cool white fluorescent lamps giving δθμηιοΐι ' ¹). LB medium for bacteria growth: 10 g Γ¹ tryptone, 5 g Γ¹ yeast extract and 10 g Γ¹ NaCl, pH 7.2.

[00163] Exarap!e 8.1 - Over-expression οϊ SIPELOTA

[00164] The inventors have over-expressed SIPELOTA as well as inhibited its expression in TYLCV-resistant (TY172) and in TYLCV- susceptible (R-13) plants. The over-expression experiments have been done with both SIPELOTA alleles - the SIPELOTA allele of a susceptible background ( -82) have been over-expressed in both TY172 (resistant line) and R- 13 (susceptible line) plants, and the SIPELOTA allele of the resistant line (TY172) have been over-expressed in both resistant and susceptible plants.

[00165] Construction of plant over-expression vector.

[00166] The gene SIPELOTA was cloned from the resistant plant TY172 as well as from the susceptible plant M-82, and inserted into a pBIN vector under the control of cauliflower mosaic virus (CaMV) 35S promoter. In order to create a ρΒΓ expression vector, the inventors first cloned into the HindlLL-EcoRI sites of pBI PLUS the cassette containing the 35S promoter of the CaMV, omega sequence enhancer, and the nitric oxide synthase transcriptional terminator.

[00167] To create the plasmids phINSlPELOTA-M-$2 and pB S/PEIO7¾-TY172, the

SIPELOTA gene was amplified by PCR using the forward primer SIPELOTA? (5' - CTA GGA TCC ATG AAG ATT GTT CGT AGA G - 3') that contains a ΒαπιΆΙ restriction endonuclease site and the reverse primer SIPELOTAR (5' - CTA GCG GCC GCA TCA CAT CTC AAT GTC TTC - 3') that contains a restriction endonuclease Not! site. The amplification product was restricted with both Bamtii and Notl and cloned into the unique BamHl and Notl sites present in the pBIN vector between the omega enhancer sequence and the nitric oxide synthase transcriptional terminator.

[00168] Results:

[00169] Two TY172 transgenic lines over-expressing the SIPELOTA allele from the susceptible M-82 plant have been created. The plants that came from tissue culture were grown in the greenhouse, and Tl generation seeds were collected. 24 Tl plants from both TYT-6 and TYT-10 transgenic lines were inoculated with TYLCV using whiteflies as described before. Following inoculation the plants were transplanted in a 50 -mesh insect proof screen-house, and monitored for disease symptoms. The plants were also sampled and total DNA extracted and virus copy number was established using quantitative real-time PCR. The inventors have also tested (using PCR) which of the Tl plants is transgenic and which one is not. As a control non- transgenic TY172 and R-13 were inoculated as well. Indeed, as shown in Table 6, the transgenic TY172 in both lines expressed clear disease symptoms as opposed to the non-transgenic plants (Table 6A). Moreover, when virus DNA level was measured, the transgenic plants contained about 4 times more viral DNA than the non-transgenic (Table 6B), clearly demonstrating that transgenic TY172 plants expressing the susceptible allele of SIPELOTA become partially susceptible.

[00170] Two R-13 transgenic lines over-expressing the SIPELOTA allele from the resistant TY172 plant have been created. As stated above, the plants that came from tissue culture were grown in the greenhouse, and Tl generation seeds were collected. 32 Tl plants of transgenic line TYT-2 and 20 from transgenic line TYT-1 1 were inoculated with TYLCV using whiteflies, as described above. The plants were transplanted in a 50-mesh insect proof screen- house, monitored for disease symptoms, and tested by PCR for presence or absence of the transgene. As can be seen in Table 7, the DSI of the transgenic plants was practically the same as the non-transgenic plants, and both behaved as susceptible to TYLCV, showing that expressing the resistant allele of SIPELOTA did not affect the plants susceptibility to the virus. Since the TYLCV -resistance displayed by SIPELOTA is recessive in nature, it is expected that expression of the recessive resistant allele in susceptible transgenic plants will not affect the plants susceptibility to the virus.

Table 6. Average DSI (A) and virus copy number (B) in transgenic TYI 72 plants over expressing the SIPELOTA allele from M-82 compared to their non-transgenic counterparts (plants were scored and sampled 22 DPI).

A

Average DSI ± SEM*

TYT-6 TYT-10 TY172 R-13

Transgenic 1.4^A ± 0.2 1.8^A± 0.1

Non-transgenic 0^B ± 0 0^B ± 0 0 ± 0 4 ± 0

B Average virus copy number ± (SEM)*

TYT-6 TYT-10 TY172 R-13

Transgenic 53,129^A± 4,714 58,803^A ± 6,400

Non-transgenic 15,113^B± 5,471 i6,612^B ± 2331 17,275 ± 3728 82,408 ± 7325

* SEM - Standard error of the mean. Within columns, different letters denote means gnificantly differ, P < 0.05.

Table 7. Average DSI R-13 plants over expressing the SIPELOTA allele from TY172 compared to their non-transgenic counterparts (plants were scored and sampled 22 DPI).

Line

TYT-2 TYT-11

Transgenic 2.8^A ± 0.2 4^A ± 0

Non-transgenic 2.2^A± 0.2 4^A ± 0

± SEM - Standard error of the mean. Within columns, different letters denote means that significantly differ, P < 0.05.

[00171 ] Example 8.2 - Construction of a plant silencing vector

[00172] To inhibit SIPELOTA expression, we have inserted two inverted repeats of 576 bp each of SIPELOTA cDNA into the plant silencing vector pHANNIBAL. The pHANNIBAL vector (Fig. 8) allows the encoding of self-complementary RNA's thanks to sense/antisense arms separated by an intron that efficiently induce gene silencing in plants (Wesley et al, 2001).

[00173] For the silencing of the SIPELOTA gene, the pHANNIBAL vector expressing a sense and an antisense fragments of the gene was constructed in two steps. In the first step, a 576 bp fragment of the SIPELOTA cDNA was amplified by PCR preformed with a forward primer (5' - AGA CTC GAG GAC AAT GTT CTA CAG GCC TTT - 3') containing the restriction endonuclease Xhoi site, and a reverse primer (5' - GAC GGT ACC CAT AAT GCT TTC CAG CTC - 3') containing the restriction endonuclease Kpnl site, and cloned into the unique Xhol and Kpnl sites present in the sense orientation arm of the pHANNIBAL plasmid.

[00174] In the second step, the same 576 bp fragment of the SIPELOTA was amplified by PCR preformed with a forward primer (5' ~ ATC TAG AGA CAA TGT TCT ACA GGC CTT TG -3') containing an Xhal restriction endonuclease site, and a reverse primer (5' - CAT CGA TCA TCT CAA TGT CTT CCA GCT C - 3') containing a CM restriction endonuclease site, and cloned into the unique Xbal and Clal sites present in the ant-sense oriented arm of the pHANNIBAL plasmid. [00175] To create a binary vector expressing the sense and anti-sense arras, we cloned the Xhol-Notl fragment of the pHANNIBAL expressing the 576 bp of the SIPELOTA gene in a sense and anti-sense orientation and the nitric oxide synthase transcriptional terminator into the SaR-Notl sites of the ρΒΓΝ vector described above.

[00176] Transformation was carried out on cotyledon cuttings with Agrobacteriwn lumefaciens strain EHA105 as we have previously carried out and described (Azari et al. 2010). Transgenic plants carrying each of the two constructs and their azygous counterparts will be inoculated with TYLCV and symptoms will be scored. If SIPELOTA. plays a major role in TYLCV symptom progression, we expect transgenic TY172 plants, carrying a 35S-SIPELOTA allele from M-82, to become partially or fully susceptible while the susceptible plants, carrying siKNA-SlPELOTA, to become partially or fully resistant in association with total SIPELOTA rnRNA levels and relative to their azygous controls.

[00177] All patents, patent publications, and non-patent publications recited in this application are incorporated by reference herein.

References

Anbinder I, Reuveni M, Azari R, Paran I, Nahon S, Shlomo H, Chen L, Lapidot M, Levin I (2009) Molecular dissection of Tomato leaf curl vims resistance in tomato line TY172 derived from Solanum perwianum. Theor Appl Genet 1 19:519-530

Agrama HA, Scott JW (2006) Quantitative trait loci for tomato yellow leaf curl virus and tomato mottle virus resistance in tomato. J Am Soc Hortic Sci 131 :267-272

Antignus Y, Lapidot M, Cohen S (2001) Interference with UV vision of insects: an IPM tool to impede epidemics of insect pests and insect associated virus diseases. In: Harris KF, Smith OP, Duffus JE (Eds) Virus-insect-plant interactions. Academic Press, New York, NY, pp 331-350

Chague V, Mercier JC, Guenard M, deCourcel A, Vedel F (1997) Identification of RAPD markers linked to a locus involved in quantitative resistance to TYLCV in tomato by bulked segregant analysis. Theor Appl Genet 95:671-677

Cohen S, Harpaz I (1964) Periodic rather than continual acquisition of a new tomato virus by its vector, the tobacco whitefiy (Bemisia tabaci Gennadius). Entomol Exp Appl 7:155-

166

Cohen S, Antignus Y (1994) Tomato yellow leaf curl virus, a whitefly-borne geminivirus of tomatoes. In: Harris KF (Ed) Advances in disease vector research, volume 10. Springer- Verlag, New York, NY, pp. 259-288

Czosnek H, Laterrot H (1997) A worldwide survey of tomato yellow leaf curl viruses. Arch virol 142:1391-1406

Dellaporta SL, Wood J, Hicks JB (1983). Maize DNA miniprep. Plant Mol Biol Rep 1 : 19-21 Friedmann M, Lapidot M, Cohen S, Pilowsky M (1.998) A novel source of resistance to tomato yellow leaf curl virus exhibiting a symptomless reaction to viral infection. J Am Soc

Hortic Sci 123:1004-1007 Fulton TM, Chunwongse J, Tanksley SD (1995) Microprep protocol for extraction of DNA from tomato and other herbaceous plants. Plant Mol Biol Rep 13:207-209

Hanson PM, Bemacchi D, Green S, Tanksley SD, Muniyappa V, Padmaja S, Chen HM, Kuo G, Fang D, Chen JT (2000) Mapping a wild tomato introgression associated with tomato yellow leaf curl virus resistance in a cultivated tomato line. J Am Soc Hortic Sci 125:15- 20

Hanson P, Green SK, Kuo G (2006) Ty-2, a gene on chromosome 1 1 conditioning geminivirus resistance in tomato. Tomato Genet Coop Rep 56:17-18

Ji Y, Scott JW (2006) Ty-3, a begomovirus resistance locus linked to Ty-1 on chromosome 6 of tomato. Tomato Genet Coop Rep 56:22-25

Ji Y, Schuster DJ, Scott JW (2007a) Ty-3 , a begomovirus resistance locus near the Tomato yellow leaf curl virus resistance locus Ty-1 on chromosome 6 of tomato. Mol Breeding

20:271-284

Ji Y, Scott JW, Hanson P, Graham E, Maxwell DP (2007b) Sources of resistance, inheritance, and location of genetic loci conferring resistance to members of the tomato-infecting begomoviruses. In: Czosnek, H. (Ed) Tomato yellow leaf curl virus disease. Springer, the

Netherlands, pp 343-362

Ji Y, Scott J W, Maxwell DP, Schuster DJ (2008) Ty-4, a tomato yellow leaf curl virus resistance gene on chromosome 3 of tomato. Tomato Genet Coop Rep 58:29-31

Kalloo G Banerjee MK (1990) Transfer of tomato leaf curl virus resistance from Lycopersicon hirsutum f. glabratum to L. esculentum. Plant Breed 105:156-159

Kamiyoshihara Y, Iwata M, Fuka a T, Tatsuki M, Mori H (2010) Turnover of LeACS2, a wound-inducible 1-aminocyclopropane-l-carboxylic acid synthase in tomato, is regulated by phosphorylation/dephosphorylation. Plant J 64: 140-50

Kasrawi MA (1989) Inheritance of resistance to tomato yellow leaf curl virus (TYLCV) in

Lycopersicon pimpinellifolium. Plant Dis 73:435-437

Khan AJ, Idris AM, Al-Saady NA, Al-Mahruki MS, Al-Subhi AM, Brown JK (2008) A divergent isolate of Tomato yellow leaf curl virus from Oman with an associated DNA β satellite: an evolutionary link between Asian and the Middle Eastern virus-satellite complexes. Virus Genes 36:169-176

Kramer CY (1956) Extension of multiple range tests to group means with unequal numbers of replications. Biometrics 12:309-310

Lapidot M, Friedmann M, Lachman O, Yehezkel A, Nahon S, Cohen S, Pilowsky M (1997)

Comparison of resistance level to tomato yellow leaf curl virus among commercial cultivars and breeding lines. Plant Dis 81 :1425-1428

Lapidot M, Friedmann M, Pilowsky M, Ben Joseph R, Cohen S (2001) Effect of host plant resistance to Tomato yellow leaf curl virus (TYLCV) on virus acquisition and transmission by its whitefly vector. Phytopathology 91 :1209-1213

Lapidot M, Friedmann M (2002) Breeding for resistance to whitefly-transmitted geminiviruses.

An Appl Biol 140:109-127

Mason G, Caciagli P, Accotto GP, Noris E (2008) Real-time PCR for the quantitation of

Tomato yellow leaf curl Sardinia virus in tomato plants and in Bemisia tabaci. J. Virol.

Methods 147: 282-289

Morales FJ (2001) Conventional breeding for resistance to Bemisia toiwcf-transmitted geminiviruses. Crop Prot 20:825-834

Moriones E, Navas-Castillo J (2000) Tomato yellow leaf curl virus, an emerging virus complex causing epidemics worldwide. Virus Res 71 :123-134

Nakhla MK, Maxwell DP (1998) Epidemiology and management of tomato yellow leaf curl disease. In: Hadidi A, Khetarpal RK, Koganezawa H (Eds) Plant Virus Disease Control.

APS Press, St. Paul, MN, pp 565-583 Navot N, Pichersky E, Zeidan M, Zamir D, Czosnek H (1991) Tomato yellow leaf curl virus: a whitefly-transmitted gemini virus with a single genomic component. Virology 185:131- 161

Palumbo JC, Horowitz AR, Prabhaker N (2001) Insecticidal control and resistance management for Bemisia (abaci. Crop Prot 20:739-766

Peralta IE, Knapp S, Spooner DM (2005) New species of wild tomatoes (Solarium Section

Lycopersicon: Solanaceae) from Northern Peru. Systematic Botany 30: 424-434

Pilowsky M, Cohen S (1974) Inheritance of resistance to tomato yellow leaf curl virus in tomatoes. Phytopathology 64:632-635

Pilowsky M, Cohen S (1990) Tolerance to tomato yellow leaf curl virus derived from

Lycopersicon peruvian m. Plant Dis 74:248-250

Polston JE, Anderson PK (1997) The emergence of whitefly-transmitted geminiviruses in tomato in the western hemisphere. Plant Dis 81:1358-1369

Segev L, Cohen L, Lapidot M (2004) A tomato yellow leaf curl virus-resistant tomato line, TY-

172, inhibits viral replication but not viral translocation. 4^th Intern. Geminivirus Symp.,

ABSTRACT Wl, Cape Town, South Africa

Selth LA, Dogra SC, Rasheed MS, Healy H, Randies JW, Rezaian MA (2005). A NAC domain protein interacts with tomato leaf curl virus replication accessory protein and enhances viral replication. Plant Cell 17:31 1-325

Verlaan MG, Szinay D, Button SF, de Jong H, Kormelink R, Visser RG, Scott JW, Bai Y

(201 1) Chromosomal rearrangements between tomato and Solarium chilense hamper mapping and breeding of the TYLCV resistance gene Ty-L Plant J. 68:1093-1 03 Vidavsky F, Czosnek H (1998) Tomato breeding lines resistant and tolerant to tomato yellow leaf curl virus issued from Lycopersicon hirsutum. Phytopathology 88:910-914

Ye J, Parra EJ, Sosnoski DM, Hiester , Underhill PA, Shriver MD (2002) Melting curve SNP

(McSNP) genotyping: a useful approach for diallelic genotyping in forensic science. J

Forensic Sci 47: 593-600

Zamir D, Ekstein-Michelson I, Zakay Y, Navot N, Zeidan M, Sarfatti M, Eshed Y, Harel E,

Pleban T, Oss Hv, edar N, Rabino witch HD, Czosnek H (1994) Mapping and introgression of a tomato yellow leaf curl virus tolerance gene, TY-L Theor Appl Genet

88:141-146

Navas-Castillo J, Fiallo-Olive E, Sanchez-Campos S (201 1) Emerging Virus Diseases

Transmitted by Whiteflies. Annu Rev Phytopathol 49:219-248.

Wesley SV, Helliwell CA, Smith NA, Wang MB, Rouse DT, Liu Q, Gooding PS, Singh SP,

Abbott D, Stoutjesdijk PA, Robinson SP, Gleave AP, Green AG, Waterhouse PM (2001)

Construct design for efficient, effective and high-throughput gene silencing in plants. Plant J

27:581-590.

Claims

1. An isolated tomato PELOTA nucleic acid, wherein the nucleic acid comprises a G in the first exon of the PELOTA gene.

2. The nucleic acid of claim 1, wherein said nucleic acid comprises a single nucleotide polymorphism (SNP) T⁴⁷-to-G in the first exon of the PELOTA gene.

3. The nucleic acid of claim 1, wherein the nucleic acid comprises a polynucleotide of SEQ ID NO:7.

4. The nucleic acid of claim 1, wherein the nucleic acid comprises a polynucleotide of SEQ ID NO:l l .

5. The nucleic acid of claim 1, wherein said nucleic acid molecule encodes the amino acid sequence of SEQ ID NO. 9.

6. A method of producing a tomato plant that exhibits resistance to Tomato yellow leaf curl virus comprising the steps of: A) providing a population of tomato plants; B) genotyping at least one tomato plant in the population with respect to position 47 in the first exon of the PELOTA gene; C) Selecting at least one tomato plant from the population which is homozygous for G⁴⁷ in the first exon of the PELOTA gene.

7. The method of claim 6, wherein said plant is homozygous for a single nucleotide polymorphism (SNP) T⁴⁷-to-G in the first exon of the PELOTA gene.

8. The method of claim 6, wherein said plant is homozygous for a polynucleotide of SEQ ID NO:7.

9. The method of claim 6, wherein step B) is associated with a primer selected from the group consisting of: SEQ ID NOS:12 and 13.

10. A method of producing a tomato plant that exhibits resistance to Tomato yellow leaf curl virus comprising the steps of:

(a) identifying a tomato donor plant, said donor plant is resistant to Tomato yellow leaf curl virus;

(b) crossing said resistant donor plant with a recipient tomato plant that is susceptible to said virus and possesses commercially desirable characteristics;

(c) planting seed obtained from the cross in step b and growing said seed into plants;

(d) selfing the plants of step c;

(e) planting seed obtained from the selfing in step d and growing into plants;

(f) identifying plant homozygous for G⁴⁷ in the first exon of the PELOTA gene; and

(g) cultivating the plant of step (f).

11. A method of producing a transgenic tomato plant with resistance to Tomato yellow leaf curl virus using a plasmid comprising a coding sequence for PELOTA protein having the amino acid sequence of SEQ ID NO: 9.

12. The method according to claim 11, wherein the coding sequence for the PELOTA protein has the nucleic acid sequence of SEQ ID NO: 1 1.

13. The method according to claim 11, wherein said plasmid is pBlNS/ EL<9I/i-TY172.

14. The method according to claim 1 1 comprising the steps of: (a) preparing an expression vector comprising a sequence encoding PELOTA protein having the amino acid sequence of SEQ ID NO: 9 operably linked to a plant-expressible regulatory sequence; and (b) introducing the expression vector into a plant cell or plant tissue to produce a transgenic plant cell or transgenic plant tissue.

15. The method according to claim 11, further comprising the step of regenerating a transgenic plant from the transgenic plant cell or transgenic plant tissue of step (b).

16. A transgenic plant, part thereof, or a transgenic plant cell, each transformed by the method according to any one of claims 1 1 to 15.