WO2014037592A1 - Recombinant protein ofhaemonchus contortus and use thereof for the production of a vaccine against haemonchosis - Google Patents

Recombinant protein ofhaemonchus contortus and use thereof for the production of a vaccine against haemonchosis Download PDF

Info

Publication number
WO2014037592A1
WO2014037592A1 PCT/ES2013/000197 ES2013000197W WO2014037592A1 WO 2014037592 A1 WO2014037592 A1 WO 2014037592A1 ES 2013000197 W ES2013000197 W ES 2013000197W WO 2014037592 A1 WO2014037592 A1 WO 2014037592A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
contortus
seq
identity
recombinant
Prior art date
Application number
PCT/ES2013/000197
Other languages
Spanish (es)
French (fr)
Inventor
José María ALUNDA RODRÍGUEZ
Montserrat CUQUERELLA AYENSA
Elshaima MOHAMED FAWZI
Original Assignee
Universidad Complutense De Madrid
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidad Complutense De Madrid filed Critical Universidad Complutense De Madrid
Publication of WO2014037592A1 publication Critical patent/WO2014037592A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43536—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms
    • C07K14/4354—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from worms from nematodes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0003—Invertebrate antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P33/00—Antiparasitic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55583—Polysaccharides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55588—Adjuvants of undefined constitution
    • A61K2039/55594—Adjuvants of undefined constitution from bacteria

Abstract

A recombinant protein (rHc23) of H. contortus was produced after establishing that the native protein Hc23, with a molecular weight of 23kDa, originating from a soluble extract from the adult haematophagous nematode H. contortus demonstrated an immunoprotective ability in young sheep of 5 months of age against the most significant trichostrongylidosis (haemonchosis) from an economic and pathological point of view. Protein Hc23 was characterised, obtaining genome and amino acid sequences of same, which, using molecular biology techniques, recombinant DNA, can be used to produce a stable protein, rHc23. The use thereof in immunogenic compositions that include, as an adjuvant, the combination of inactivated Propionibacterium acnes + lipopolysaccharide of E. coli has demonstrated a high degree of protection in animals (protection >85%).

Description

TÍTULO DE LA INVENCIÓN  TITLE OF THE INVENTION
Proteína recombinante de Haemonchus contortus y su aplicación para la producción de una vacuna frente a la hemoncosis. Recombinant Haemonchus contortus protein and its application for the production of a vaccine against hemoncosis.
SECTOR DE LA TÉCNICA SECTOR OF THE TECHNIQUE
La presente invención se encuadra dentro del campo de la Sanidad Animal. De forma más concreta, se refiere a la elaboración de composiciones inmunogénicas que incluyen la proteína Hc23 o la proteína recombinante rHc23 de Haemonchus contortus para su uso en la elaboración de vacunas frente a las infestaciones por Haemonchus. También se refiere al uso de adyuvantes para mejorar la protección otorgada por las composiciones inmunogénicas. The present invention falls within the field of Animal Health. More specifically, it refers to the preparation of immunogenic compositions that include the Hc23 protein or the recombinant Haemonchus contortus rHc23 protein for use in the preparation of vaccines against Haemonchus infestations. It also refers to the use of adjuvants to improve the protection granted by immunogenic compositions.
ESTADO DE LA TÉCNICA Las nematodosis gastrointestinales ovinas, entre ellas la hemoncosis, producida por Haemonchus contortus, representan una de las patologías más relevantes desde un punto de vista económico a nivel mundial. H. contortus es un nematodo que se localiza en el abomaso de los rumiantes, muestra una gran fertilidad y tanto los adultos como las fases larvarias (L4) se alimentan de sangre, provocando pérdida sanguínea, llegando a producir anemia, anorexia, depresión, e incluso la muerte. STATE OF THE TECHNIQUE Ovine gastrointestinal nematodoses, including hemoncosis, produced by Haemonchus contortus, represent one of the most relevant pathologies from an economic point of view worldwide. H. contortus is a nematode that is located in the ruminant abomasum, shows great fertility and both adults and larval stages (L4) feed on blood, causing blood loss, leading to anemia, anorexia, depression, and including death.
Esta parasitosis puede presentarse - en dependencia del número de vermes presentes en los hospedadores, edad de éstos, factores medioambientales, estado inmunitario - como un proceso agudo o con carácter crónico, constituyendo en ambos casos una enfermedad importante de rumiantes. This parasitosis can occur - depending on the number of vermes present in the hosts, their age, environmental factors, immune status - as an acute or chronic process, constituting in both cases an important ruminant disease.
Según la FAO- (http://www.fao.org.) - la hemoncosis representa el 15 % de las gastroenteritis parasitarias en pequeños rumiantes y causa las mayores pérdidas económicas de todas las trichostrongilidosis. La introducción de sistemas de explotación más intensivos, en praderas de regadío, conlleva un incremento de la carga ganadera y ciclos de aprovechamiento herbáceo muy cortos. Estas condiciones, junto con la incapacidad aparente de los individuos jóvenes (de menos de 6 meses de edad) para responder eficazmente a las infestaciones, suponen un incremento de los riesgos de procesos de significación clínica. According to FAO- (http://www.fao.org.) - hemoncosis accounts for 15% of parasitic gastroenteritis in small ruminants and causes the greatest economic losses of all trichostrongilidosis. The introduction of more intensive exploitation systems, in irrigated meadows, entails an increase in livestock load and very short herbaceous use cycles. These conditions, together with the apparent inability of young individuals (less than 6 months of age) to respond effectively to infestations, represent an increased risk of clinical significance processes.
El control de esta parasitosis se basa esencialmente en el empleo de tratamientos antihelmínticos y, pese a que los antihelmínticos han sido útiles durante décadas, su utilización indiscriminada ha provocado la aparición de resistencias farmacológicas en todo el mundo (Waller PJ. (1997). Anthelmintic resistance. Veterinary Parasitol., 72: 391-412). Existe, además, una creciente preocupación sobre la posible presencia de residuos tanto en los alimentos como en el medio ambiente. The control of this parasitosis is essentially based on the use of anthelmintic treatments and, although anthelmintics have been useful for decades, their indiscriminate use has caused the emergence of drug resistance worldwide (Waller PJ. (1997). Anthelmintic resistance, Veterinary Parasitol., 72: 391-412). There is also a growing concern about the possible presence of residues both in food and in the environment.
El coste de los tratamientos antihelmínticos (fármacos + mano de obra) ha experimentado una notable elevación. Los costes asociados al desarrollo y comercialización de nuevos compuestos antihelmínticos han provocado que el número de nuevos fármacos sea muy reducido. En estas condiciones la inmunoprofilaxis puede ser una alternativa para el control de la hemoncosis. The cost of anthelmintic treatments (drugs + labor) has experienced a remarkable rise. The costs associated with the development and commercialization of new anthelmintic compounds have caused the number of new drugs to be very small. Under these conditions, immunoprophylaxis may be an alternative for the control of hemoncosis.
Las infestaciones por H.contortus, naturales o experimentales, provocan una protección parcial frente a las reinfestaciones. La aparición de la respuesta protectora es dependiente de la edad y raza de los animales, estimándose que hasta los 6 meses de edad no logran esta capacidad. Ello determina que los animales, en particular corderos, sean receptivos al parásito tras el destete sin que exista la posibilidad de inmunoprotección natural. A lo largo de los años se han realizado numerosos estudios dirigidos a provocar respuestas inmunitarias protectoras en el ganado ovino frente a las infestaciones por H.contortus, utilizando infestaciones con L3 viables, L3 atenuadas, extractos antigénicos, antígenos individuales. La menor eficacia de las vacunaciones frente a helmintos está relacionada con las variaciones antigénicas asociadas a los cambios de desarrollo que experimentan a lo largo de su ciclo vital (diversos estadios parasitarios hasta alcanzar la etapa adulta); además realizan migraciones intraorgánicas como un mecanismo de evasión de la respuesta inmunitaria y en ocasiones, como es el caso que nos ocupa, se localizan en determinadas zonas del hospedador que no son especialmente sensibles (estómago) frente a los agentes externos lo que dificulta la generación de una respuesta adecuada; sin entrar en la diversidad genética que pueden presentar tanto las poblaciones parásitas como los hospedadores. H.contortus infestations, natural or experimental, cause partial protection against reinfestations. The appearance of the protective response is dependent on the age and race of the animals, it is estimated that up to 6 months of age do not achieve this capacity. This determines that animals, particularly lambs, are receptive to the parasite after weaning without the possibility of natural immunoprotection. Over the years, numerous studies have been conducted aimed at provoking protective immune responses in sheep against H.contortus infestations, using viable L3 infestations, attenuated L3, antigen extracts, individual antigens. The lower efficacy of helminth vaccinations is related to the antigenic variations associated with the developmental changes they experience. along its life cycle (various parasitic stages until reaching adulthood); They also perform intraorganic migrations as a mechanism to evade the immune response and sometimes, as is the case at hand, they are located in certain areas of the host that are not especially sensitive (stomach) against external agents, which makes generation difficult of an adequate response; without entering into the genetic diversity that both parasitic and host populations can present.
Los intentos de desarrollo de una vacuna frente a la hemoncosis han sido muy numerosos utilizando diversos componentes parasitarios (Smith, W.D. and Zarlenga D.S. (2006). Developments and hurdles in generating vaccines for controlling helminth parasites of grazing ruminants. Veterinary Parasitology, 139: 347-359) desde aquellos que se encuentran en el nematodo cuando inicia su vida parásita (L3) (US5525508; Goud, G. N.; Zhan, B.; Ghosh, K.; Loukas, A.; Hawdon, J.; Dobardzic, A.; Deumic, V.; Liu, S.; Dobardzic, R.; Zook, R. C; Qun, J.; Liu, Y. Y.; Hoffman, L; Chung- Debose, D.; Patel, R.; Méndez, S. and Hotez, P. J. (2004). Cloning, yeast expression, isolation and vaccine testing of recombinant Ancylostoma secreted protein 1 (ASP-1) and ASP-2 from Ancylostoma ceylanicum. Journal of lnfectious Diseases 189: 919-929, Goud, G. N.; Bottazzi, M. E.; Zhan, B.; Méndez, S.; Deumic, V.; Plieskatt, J.; Liu, S.; Wang, Y.; Bueno, L.; Fujiwara, R.; Samuel, A.; Ahn, S. Y.; Solanki, M.; Asojo, O. A.; Wang, J.; Bethony, J. M.; Loukas, A.; Roy, M. and Hotez, P. J. (2005). Expression of the Necator americanus hookworm larval antigen Na-ASP-2 in Pichia pastoris and purification of the recombinant protein for use in human clinical triáis. Vaccine 23: 4754-4764; Bethony, J. M.; Loukas, A.; Smout, M. J.; Méndez, S.; Wang, Y.; Bottazzi, M. E.; Zhan, B., Williamson, A. L.; Lustigman, S.; Correa-Oliveira, R.; Xiao, S. H. and Hotez, P. J. (2005). Antibodies against a secreted protein from hookworm larvae reduce the intensity of infection in humans and vaccinated laboratory animáis. FASEB Journal 19: 1743-1755; Méndez et al., 2005) hasta componentes de la fase adulta del parásito, proteasas derivadas de su intestino, incluyendo aspartil-, cisteinil- y metaloproteasas (Knox, D.P. and Smith, W.D. (2001). Vaccination against gastrointestinal nematode parasites of ruminants using gut-expressed antigens. Veterinary Parasitology, 100: 21-32; Loukas, A.; Bethony, J. M.; Williamson, A. L; Goud, G. N.; Méndez, S.; Zhan, B.; Hawdon, J. M.; Bottazzi, M. E.; Brindley, P. J. and Hotez, P. J. (2004). Vaccination of dogs with a recombinant cysteine protease from the intestine of canine hookworms diminishes the fecundity and growth of worms. Journal of Infectious Diseases 189: 1952-1961 ; Loukas, A.; Bethony, J. M.; Méndez, S.; Fujiwara, R. T.; Goud, G. N.; Ranjit, N.; Zhan, B.; Jones, K.; Bottazzi, M. E. and Hotez, P. J. (2005). Vaccination with recombinant aspartic hemoglobinase reduces parasite load and blood loss after hookworm infection in dogs. PLoS Medicine 2: e295; Williamson, A. L; Lecchi, P.; Turk, B. E.; Choe, Y.; Hotez, P. J.; McKerrow, J. H.; Cantley, L. C; Sajid, M. and Loukas, A. (2004). A multi-enzyme cascade of hemoglobin proteolysis in the intestine of blood-feeding hookworms. Journal of Biológica! Chemistry 279: 3560-3567). La utilización de larvas irradiadas es capaz de inducir una inmunidad protectora en animales adultos aunque no protege a los animales jóvenes. El uso de extractos larvarios purificados (70-83 kDa de L3 desenvainada- Newton, S.E. and Munn, E.A. (1999). The development of vaccines against gastrointestinal nematode parasites, particularly Haemonchus contortus. Parasitology Today, 15: 1 16-122) ha mostrado cierta protección, dependiente del adyuvante utilizado, superior con hidróxido de aluminio respecto a QuilA. Se ha logrado una protección parcial en animales mayores con antígenos de excreción y secreción de L4 y adultos del parásito (Hc15/4- Schallig, H.D.F.H.; Van Leeuwen, M.A.W. y Cornelissen, A.W.C.A. (1997). Protective immunity induced by vaccination with two Haemonchus contortus excretory secretory proteins in sheep. Parasite Immunology, 19: 447-453; Bakker, N.; Vervelde, L; Kanobana, K.; Knox. D.P.; Cornelissen, A.W.C.A.; de Vries, E. y Yatsuda, A.P. (2004). Vaccination against the nematode Haemonchus contortus with a thiol-binding fraction from the excretory/ secretory producís (ES). Vaccine, 22: 618-628). Las inmunizaciones con fracciones de bajo peso molecular procedentes del extracto soluble de adultos del parásito provocaron reduciones inferiores al 60% (Domínguez-Toraño, I.A.; Cuquerella, M.; Gómez-Muñoz, M.T.; Méndez, S.; Fernández-Pérez, F.J. y Alunda, J.M. (2000). Vaccination of manchego lambs against Haemonchus contortus with a somatic fraction (p26/23) of adult parasites. Parasite Immunology, 22: 131-138) en corderos de menos de 5 meses de edad. Valores menores se han logrado con 3 fracciones de bajo peso molecular del helminto (Alunda J.M.; Angulo-Cubillán, F. y Cuquerella, M. (2003). Immunization against ovine haemonchosis with three low molecular weight somatic antigens of adult Haemonchus contortus. Journal of Veterínary Medicine, B 50: 70-74). La utilización de la glicoproteína H11 (110kDa) procedente de las microvellosidades intestinales de L4, preadulto y adultos de H. contortus aparentemente redujeron la eliminación de huevos en un 90% y la carga de helmintos adultos en un 75% (Munn, E.A. (1997). Rational design of nematode vaccines: hidden antigens. International Journal for Parasitology, 27: 359-366). Los resultados fueron superiores empleando como adyuvante Quil A (Newton, S.E. and Munn, E.A. (1999). The development of vaccines against gastrointestinal nematode parasites, particularly Haemonchus contortus. Parasitology Today, 15: 116-122). Se han empleado antígenos procedentes de la superficie intestinal del nematodo (complejo de glicoproteínas que contiene galactosa, H-gal-GP), este complejo además, presenta otros componentes como aspartin-cisteinil-metalo-proteasas, proteínas similares a la trombospondina, cistatina y galactina, por lo que no queda claro cuál de todas ellas es la responsable de su actividad protectora. La utilización como adyuvante de QuilA intensificó su papel protector (Knox , D.P.; Redmond, D.L.; Newlands, G.F.; Skuce, P.J.; Pettit, D. y Smith, W.D. (2003). The nature and prospects for gut membrane proteins as vaccine candidates for Haemonchus contortus and other ruminant trichostrongyloids. International Journal for Parasitology, 33: 1129-1137). Se han utilizado vacunaciones con cisteín-proteasas con el fin de alterar la alimentación hematófaga del parásito, un complejo de degradación del fibrinógeno (35-55 kDa) con reducciones considerables (93% de reducción de huevos, 87% de adultos) (Boisvenue, R.J.; Stiff, M.I.; Tonkinson, L.V.; Cox, G.N. y Hageman, R. (1992). Fibrinogen-degrading proteins from Haemonchus contortus used to vaccinate sheep. American Journal of Veterinary Research, 53: 1263-1265) y proteínas de unión a tioles (TSBP) similares a la catepsina B que han conferido una elevada protección (Newton, S.E. and Munn, E.A. (1999). The development of vaccines against gastrointestinal nematode parasites, particularly Haemonchus contortus. Parasitology Today, 15: 116-122). Ultimamente se ha propuesto el empleo de glicoconjugados en pruebas de vacunación (van Stijn, C. M.W.; van den Broek, M.; Vervelde, L; Alvarez, R.A.; Cummings, R.D.; Tefsen, B.; Van Die, I. (2010). Vaccination-induced IgG response to Gala1-3GalNAc glycan epitopes in lambs protected against Haemonchus contortus challenge infection. Int. J. Parasitol. 40 (2010) 215- 222). Attempts to develop a vaccine against hemoncosis have been very numerous using various parasitic components (Smith, WD and Zarlenga DS (2006). Developments and hurdles in generating vaccines for controlling helminth parasites of grazing ruminants. Veterinary Parasitology, 139: 347 -359) from those found in the nematode when it begins its parasitic life (L3) (US5525508; Goud, GN; Zhan, B .; Ghosh, K .; Loukas, A .; Hawdon, J .; Dobardzic, A. ; Deumic, V .; Liu, S .; Dobardzic, R .; Zook, R. C; Qun, J .; Liu, YY; Hoffman, L; Chung-Debose, D .; Patel, R .; Méndez, S . and Hotez, PJ (2004). Cloning, yeast expression, isolation and vaccine testing of recombinant Ancylostoma secreted protein 1 (ASP-1) and ASP-2 from Ancylostoma ceylanicum. Journal of lnfectious Diseases 189: 919-929, Goud, GN ; Bottazzi, ME; Zhan, B .; Méndez, S .; Deumic, V .; Plieskatt, J .; Liu, S .; Wang, Y .; Well, L .; Fujiwara, R .; Samuel, A .; Ahn, SY; Solanki, M .; Asojo, OA; Wang, J .; Bethony, JM; Loukas, A .; Roy, M. and Hotez, PJ (2005). Expression of the Necator americanus hookworm larval antigen Na-ASP-2 in Pichia pastoris and purification of the recombinant protein for use in human clinical triáis. Vaccine 23: 4754-4764; Bethony, JM; Loukas, A .; Smout, MJ; Méndez, S .; Wang, Y .; Bottazzi, ME; Zhan, B., Williamson, AL; Lustigman, S .; Correa-Oliveira, R .; Xiao, SH and Hotez, PJ (2005). Antibodies against a secreted protein from hookworm larvae reduce the intensity of infection in humans and vaccinated laboratory animáis. FASEB Journal 19: 1743-1755; Méndez et al., 2005) to components of the adult phase of the parasite, proteases derived from its intestine, including aspartyl-, cysteinyl- and metalloproteases (Knox, DP and Smith, WD (2001). Vaccination against gastrointestinal nematode parasites of ruminants using gut-expressed antigens. Veterinary Parasitology, 100: 21-32; Loukas, A .; Bethony, JM; Williamson, A. L; Goud, GN; Méndez, S .; Zhan, B .; Hawdon, JM; Bottazzi, ME; Brindley, PJ and Hotez, PJ (2004). Vaccination of dogs with a recombinant cysteine protease from the intestine of canine hookworms diminishes the fecundity and growth of worms. Journal of Infectious Diseases 189: 1952-1961; Loukas, A .; Bethony, JM; Méndez, S .; Fujiwara, RT; Goud, GN; Ranjit, N .; Zhan, B .; Jones, K .; Bottazzi, ME and Hotez, PJ (2005). Vaccination with recombinant aspartic hemoglobinase reduces parasite load and blood loss after hookworm infection in dogs. PLoS Medicine 2: e295; Williamson, A. L; Lecchi, P .; Turk, BE; Choe, Y .; Hotez, PJ; McKerrow, JH; Cantley, L. C; Sajid, M. and Loukas, A. (2004). A multi-enzyme cascade of hemoglobin proteolysis in the intestine of blood-feeding hookworms. Journal of Biological! Chemistry 279: 3560-3567). The use of irradiated larvae is capable of inducing protective immunity in adult animals although it does not protect young animals. The use of purified larval extracts (70-83 kDa of unsheathed L3- Newton, SE and Munn, EA (1999). The development of vaccines against gastrointestinal nematode parasites, particularly Haemonchus contortus. Parasitology Today, 15: 1 16-122) has shown some protection, dependent on the adjuvant used, superior with aluminum hydroxide over QuilA. Partial protection has been achieved in older animals with L4 excretion and secretion antigens and parasite adults (Hc15 / 4- Schallig, HDFH; Van Leeuwen, MAW and Cornelissen, AWCA (1997). Protective immunity induced by vaccination with two Haemonchus contortus excretory secretory proteins in sheep Parasite Immunology, 19: 447-453; Bakker, N .; Vervelde, L; Kanobana, K .; Knox. DP; Cornelissen, AWCA; de Vries, E. and Yatsuda, AP (2004) Vaccination against the nematode Haemonchus contortus with a thiol-binding fraction from the excretory / secretory producís (ES). Vaccine, 22: 618-628). Immunizations with low molecular weight fractions from the soluble adult extract of the parasite caused lower reductions than 60% (Domínguez-Toraño, IA; Cuquerella, M .; Gómez-Muñoz, MT; Méndez, S .; Fernández-Pérez, FJ and Alunda, JM (2000). Vaccination of manchego lambs against Haemonchus contortus with a somatic fraction ( p26 / 23) of adult parasites, Parasite Immunology, 22: 131-138) in lambs less than 5 months old. Lower values have been achieved with 3 low molecular weight fractions of the helminth (Alunda JM; Angulo-Cubillán, F. and Cuquerella, M. (2003). Immunization against ovine haemonchosis with three low molecular weight somatic antigens of adult Haemonchus contortus. Journal of Veterinary Medicine, B 50: 70-74). The use of H11 glycoprotein (110kDa) from the intestinal microvilli of L4, preadult and adults of H. contortus apparently reduced egg elimination by 90% and adult helminth load by 75% (Munn, EA (1997 ) Rational design of nematode vaccines: hidden antigens. International Journal for Parasitology, 27: 359-366). The results were superior using Quil A as an adjuvant (Newton, SE and Munn, EA (1999). The development of vaccines against gastrointestinal nematode parasites, particularly Haemonchus contortus. Parasitology Today, 15: 116-122). Antigens from the intestinal surface of the nematode (galactose-containing glycoprotein complex, H-gal-GP) have been used, this complex also has other components such as aspartin-cysteinyl-metallo-proteases, thrombospondin-like proteins, cystatin and galactin, so it is not clear which of them is responsible for its protective activity. The use as an adjuvant of QuilA intensified its protective role (Knox, DP; Redmond, DL; Newlands, GF; Skuce, PJ; Pettit, D. and Smith, WD (2003). The nature and prospects for gut membrane proteins as vaccine candidates for Haemonchus contortus and other ruminant trichostrongyloids. International Journal for Parasitology, 33: 1129-1137). Vaccines with cysteine proteases have been used to alter the blood supply of the parasite, a fibrinogen degradation complex (35-55 kDa) with considerable reductions (93% egg reduction, 87% adults) (Boisvenue, RJ; Stiff, MI; Tonkinson, LV; Cox, GN and Hageman, R. (1992). Fibrinogen-degrading proteins from Haemonchus contortus used to vaccinate sheep. American Journal of Veterinary Research, 53: 1263-1265) and thiol binding proteins (TSBP) similar to cathepsin B that have conferred high protection (Newton, SE and Munn, EA (1999). The development of vaccines against gastrointestinal Nematode parasites, particularly Haemonchus contortus, Parasitology Today, 15: 116-122). Lately, the use of glycoconjugates in vaccination tests has been proposed (van Stijn, CMW; van den Broek, M .; Vervelde, L; Alvarez, RA; Cummings, RD; Tefsen, B .; Van Die, I. (2010) Vaccination-induced IgG response to Gala1-3GalNAc glycan epitopes in lambs protected against Haemonchus contortus challenge infection Int. J. Parasitol 40 (2010) 215-222).
A pesar de los éxitos parciales con los componentes del helminto en su forma nativa, los antígenos que han sido clonados y expresados no han inducido protección frente a la hemoncosis (Newton, S.E. and Meeusen, E.N.T. (2003). Progress and new technologies for developing vaccines against gastrointestinal nematode parasites of sheep. Parasite Immunology., 25: 283- 296; Knox, D.P. (2010). Parasite Vaccines: Recent Progress in, and Problems Associated with their Development. Open Infect. Dis. J., 4: 63-73). El empleo de He 15/24 recombinante solo provocó una protección parcial (próxima al 50%) en animales mayores de 9 meses (Vervelde, L; Van Leewen, M.A.W.; Kruidenier, M.; Kooyman, F.N.J.; Huntley, J.F.; Van Die, I. y Cornelissen, A.W.C.A. (2002). Protection studies with recombinant excretory/secretory proteins of Haemonchus contortus. Parasite Immunology, 24: 189-201). Las proteínas recombinantes H11 , H-gal-GP y la TSBP fueron incapaces de conferir protección frente a la hemoncosis, con independencia de los adyuvantes empleados. La inmunización con una proteína recombinante defectiva de 21.4 kDa (p26/23) con adyuvante completo e incompleto de Freund no indujo ninguna protección en corderos de menos de 6 meses de edad frente a un reto con H. contortus aunque existieron niveles de anticuerpos muy elevados (García Coiradas, L.; Angulo-Cubillán, F.; Valladares, B.; Martínez, E.; de la Fuente, C; Alunda, JM.; and Cuquerella, M. (2010). Immunization against lamb Haemonchosis with a Recombinant Somatic Antigen of Haemonchus contortus (rHcp26/23). Veterínary Medicine International, pp. 1-8). Despite partial successes with the components of the helminth in its native form, antigens that have been cloned and expressed have not induced protection against hemoncosis (Newton, SE and Meeusen, ENT (2003). Progress and new technologies for developing vaccines against gastrointestinal nematode parasites of sheep. Parasite Immunology., 25: 283-296; Knox, DP (2010). Parasite Vaccines: Recent Progress in, and Problems Associated with their Development. Open Infect. Dis. J., 4: 63 -73). The use of recombinant He 15/24 only caused partial protection (close to 50%) in animals older than 9 months (Vervelde, L; Van Leewen, MAW; Kruidenier, M .; Kooyman, FNJ; Huntley, JF; Van Die , I. and Cornelissen, AWCA (2002). Protection studies with recombinant excretory / secretory proteins of Haemonchus contortus. Parasite Immunology, 24: 189-201). Recombinant proteins H11, H-gal-GP and TSBP were unable to confer protection against hemoncosis, regardless of the adjuvants used. Immunization with a 21.4 kDa defective recombinant protein (p26 / 23) with Freund's complete and incomplete adjuvant did not induce any protection in lambs less than 6 months of age against a challenge with H. contortus although there were very high antibody levels (García Coiradas, L .; Angulo-Cubillán, F .; Valladares, B .; Martínez, E .; de la Fuente, C; Alunda, JM .; and Cuquerella, M. (2010). Immunization against lamb Haemonchosis with a Recombinant Somatic Antigen of Haemonchus contortus (rHcp26 / 23). Veterinary Medicine International, pp. 1-8).
Dada la baja eficacia de las proteínas recombinantes empleadas hasta ahora frente a las infestaciones por H. contortus, la importancia económica de la hemoncosis, la resistencia antihelmíntica detectada frente a todos los grupos farmacológicos de antihelmínticos, y la imposibilidad práctica de inmunizaciones con proteínas nativas del helminto, existe la necesidad de encontrar proteínas, nativas y especialmente recombinantes, así como formulaciones que sean eficaces frente al parásito citado. Given the low efficacy of the recombinant proteins used so far against H. contortus infestations, the economic importance of hemoncosis, the anthelmintic resistance detected against all pharmacological groups of anthelmintics, and the practical impossibility of immunizations with native proteins of the helminth, there is a need to find proteins, native and especially recombinant, as well as formulations that are effective against the parasite cited.
EXPLICACIÓN DE LA INVENCIÓN EXPLANATION OF THE INVENTION
Un aspecto de esta invención se refiere a una proteína de adultos de Haemonchus contortus, Hc23, caracterizada por SEQ ID NO: 2, a la proteína recombinante rHc23 y a polipéptidos con, al menos, un 80% de identidad con SEQ ID NO: 2 que mantienen las propiedades antigénicas de Hc23. Cualquiera de estas proteínas o polipéptidos puede incluirse en una composición inmunogénica que permite la producción de una vacuna frente a H. contortus. El uso de la vacuna así elaborada logra protecciones superiores al 85% de la carga parasitaria y eliminación fecal de huevos del helminto. La invención también se refiere al gen que codifica la proteína Hc23 de H. contortus, caracterizado por SEQ ID NO:1 y a secuencias con un porcentaje de identidad con SEQ ID NO:1 de, al menos, el 70%. One aspect of this invention relates to an adult Haemonchus contortus protein, Hc23, characterized by SEQ ID NO: 2, to the recombinant rHc23 protein and to polypeptides with at least 80% identity with SEQ ID NO: 2 which maintain the antigenic properties of Hc23. Any of these proteins or polypeptides can be included in an immunogenic composition that allows the production of a vaccine against H. contortus. The use of the vaccine thus produced achieves protections greater than 85% of the parasitic load and fecal elimination of eggs from the helminth. The invention also relates to the gene encoding the H. contortus Hc23 protein, characterized by SEQ ID NO: 1 and to sequences with a percent identity with SEQ ID NO: 1 of at least 70%.
En esta memoria descriptiva se entiende por porcentaje de identidad de la secuencia aminoacídica el porcentaje de coincidencias de los mismos aminoácidos entre las dos secuencias alineadas, a lo largo de la longitud completa de ambas secuencias. Además, los polipéptidos con, al menos, un 80% de identidad con SEQ ID NO:2 a los que se refiere la presente memoria son aquellos que mantienen las características antigénicas de la proteína Hc23. Asimismo, se entiende por porcentaje de identidad de la secuencia nucleotídica el porcentaje de coincidencias de los mismos nucleótidos entre dos secuencias alineadas, a lo largo de toda la longitud de ambas secuencias. In this specification, the percentage of amino acid sequence identity is understood as the percentage of coincidences of the same amino acids between the two aligned sequences, along the entire length of both sequences. In addition, polypeptides with at least 80% identity with SEQ ID NO: 2 referred to herein are those that maintain the antigenic characteristics of the Hc23 protein. Likewise, it is understood by percentage of sequence identity nucleotide the percentage of coincidences of the same nucleotides between two aligned sequences, along the entire length of both sequences.
Otro aspecto de la invención se refiere a la secuencia del gen de Hc23, o a secuencias con, al menos, un 70% de identidad con dicha secuencias, clonadas en un vector que, asimismo, es susceptible de incluirse en células procariotas o eucariotas hospedadoras en las que se expresan las moléculas nucleotídicas. Another aspect of the invention relates to the sequence of the Hc23 gene, or to sequences with at least 70% identity with said sequences, cloned into a vector that is also susceptible to be included in prokaryotic or eukaryotic host cells in which are expressed nucleotide molecules.
La invención también se refiere a a una composición inmunogénica que incluye: la proteína Hc23, la proteína recombinante rHc23 o polipéptidos con, al menos, un 80% de identidad con la proteína Hc23; la molécula nucleotídica del gen de Hc23, o secuencias con, al menos, un 70% de identidad con dicha secuencia; vectores que contienen cualquiera de estas secuencias nucleotídicas o células procariotas o eucariotas portadoras de vectores que incluyen la molécula nucleotídica del gen de Hc23, o secuencias con, al menos, un 70% de identidad con dicha secuencia nucleotídica. The invention also relates to an immunogenic composition that includes: the Hc23 protein, the rHc23 recombinant protein or polypeptides with at least 80% identity with the Hc23 protein; the nucleotide molecule of the Hc23 gene, or sequences with at least 70% identity with said sequence; vectors containing any of these nucleotide sequences or prokaryotic or eukaryotic vector-bearing cells that include the nucleotide molecule of the Hc23 gene, or sequences with at least 70% identity with said nucleotide sequence.
Esta composición inmunogénica se puede utilizar en la elaboración de una vacuna para su administración al ganado ovino con el fin de conferirle protección frente a enfermedades causadas por H. contortus. Además, la composición inmunogénica puede incluir adyuvantes para mejorar la respuesta inmune. Los adyuvantes de elección son el hidróxido de aluminio y la combinación de Propionibacteríum acnés inactivado + lipopolisacáridos de E. coli. La vacuna elaborada con la composición inmunogénica que incluye la combinación de Propionibacteríum acnés inactivado + lipopolisacáridos de E. coli como adyuvante frente a la hemoncosis en corderos jóvenes, con valores de protección muy superiores a los logrados hasta ahora con otras vacunas. La vacunación con la composición inmunogénica que hidróxido de aluminio como adyuvante induce una protección parcial frente a la hemoncosis en corderos. Por otro lado, la invención también se refiere al método para elaborar una composición inmunogénica que comprende la formulación de, al menos, uno de los siguientes productos: la proteína Hc23, caracterizada por SEQ ID NO:2, la proteína recombinante rHc23 o polipéptidos con, al menos, un 80% de identidad con SEQ ID NO:2; el gen que codifica la proteína Hc23 de H. contortus, caracterizado por SEQ ID NO:1 , o secuencias con un porcentaje de identidad con SEQ ID NO:1 de, al menos, el 70%; un vector recombinante que incluye una de estas secuencias nucleotídicas; una célula procariota transformada, o una célula eucariota transfectada, con un vector recombinante como el descrito aquí; un adyuvante que, a su vez, se puede seleccionar entre hidróxido de aluminio y Propionibacterium acnés inactivado + lipopolisacáridos de E. coli. This immunogenic composition can be used in the preparation of a vaccine for administration to sheep in order to confer protection against diseases caused by H. contortus. In addition, the immunogenic composition may include adjuvants to improve the immune response. The adjuvants of choice are aluminum hydroxide and the combination of inactivated propionibacterium acne + E. coli lipopolysaccharides. The vaccine made with the immunogenic composition that includes the combination of inactivated propionibacterium acne + lipopolysaccharides of E. coli as an adjuvant against hemoncosis in young lambs, with protection values far superior to those achieved so far with other vaccines. Vaccination with the immunogenic composition that aluminum hydroxide as an adjuvant induces partial protection against hemoncosis in lambs. On the other hand, the invention also relates to the method for preparing an immunogenic composition comprising the formulation of at least one of the following products: the Hc23 protein, characterized by SEQ ID NO: 2, the recombinant rHc23 protein or polypeptides with At least 80% identity with SEQ ID NO: 2; the gene encoding the H. contortus Hc23 protein, characterized by SEQ ID NO: 1, or sequences with a percent identity with SEQ ID NO: 1 of at least 70%; a recombinant vector that includes one of these nucleotide sequences; a transformed prokaryotic cell, or a transfected eukaryotic cell, with a recombinant vector as described herein; an adjuvant which, in turn, can be selected from inactivated propionibacterium aluminum hydroxide and propionibacterium acne + lipopolysaccharides from E. coli.
Hasta ahora, la utilización de vacunas recombinantes frente a la hemoncosis no ha mostrado la eficacia esperada, de hecho se recogen en la bibliografía múltiples fracasos. Until now, the use of recombinant vaccines against hemoncosis has not shown the expected efficacy, in fact multiple failures are recorded in the literature.
La composición inmunogénica de la invención permite la obtención de un grado de protección elevado en los animales, además de una considerable disminución de la contaminación parasitaria del entorno, muestra asimismo la ventaja de ser eficaz en animales jóvenes, sin necesidad de esperar al año de vida (como sostiene la mayoría de la comunidad científica) para que los animales alcancen la madurez inmunitaria y sean capaces de responder frente a la hemoncosis. The immunogenic composition of the invention allows obtaining a high degree of protection in animals, in addition to a considerable decrease in parasitic contamination of the environment, it also shows the advantage of being effective in young animals, without the need to wait a year of life (as the majority of the scientific community maintains) so that animals reach immune maturity and are able to respond to hemoncosis.
La composición inmunogénica que incluye una proteína o un polipéptido recombinantes, evita los problemas asociados a la utilización de vacunas poco caracterizadas procedentes de extractos brutos de parásitos que pueden contener componentes tanto inmunomoduladores como inmunosupresores. Asimismo, el hecho de poder obtener sintéticamente la proteína o los polipéptidos, que se pueden sintetizar fácilmente mediante técnicas de biología molecular, evita la necesidad "cuestionable socialmente" del empleo de animales de experimentación (rumiantes) como donadores permanentes para la obtención del extracto o la proteína nativa del parásito que integra la unidad vacunal. The immunogenic composition that includes a recombinant protein or polypeptide avoids the problems associated with the use of poorly characterized vaccines from crude parasite extracts that may contain both immunomodulatory and immunosuppressive components. Likewise, the fact that the protein or polypeptides can be synthetically obtained, which can be easily synthesized by molecular biology techniques, avoids the "socially questionable" need for the use of experimental animals (ruminants) as donors. permanent to obtain the extract or the native protein of the parasite that integrates the vaccine unit.
BREVE DESCRIPCIÓN DE LOS DIBUJOS Figura 1. Fragmento de alrededor de 600 pb obtenido mediante PCR de los halos positivos de Southern blot a partir de la genoteca de cDNA de H. contortus generada en el vector Uni-ZAP XR. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1. Fragment of about 600 bp obtained by PCR of the positive halos of Southern blot from the H. contortus cDNA library generated in the Uni-ZAP XR vector.
Figura 2. Banda de 23 KDa resultado de la purificación de la proteína Hc23. Figure 2. 23 KDa band resulting from the purification of the Hc23 protein.
Figura 3. Eliminación fecal de huevos (hpg) de H. contortus durante el ensayo de vacunación descrito en el ejemplo 3. Figure 3. Fecal removal of eggs (hpg) from H. contortus during the vaccination test described in example 3.
Figura 4. Recuento de adultos en el abomaso de los animales del ensayo de vacunación descrito en el ejemplo 3. Figure 4. Adult count in the abomasum of the animals of the vaccination test described in example 3.
Figura 5. Valor de hematocrito a lo largo del ensayo de vacunación descrito en el ejemplo 3. Marcado con una flecha el momento de la infestación. Figura 6. Recuento de eosinófilos a lo largo del ensayo de vacunación descrito en el ejemplo 3. Marcado con una flecha el momento de la infestación. Figure 5. Hematocrit value throughout the vaccination test described in example 3. Arrow marked the time of infestation. Figure 6. Eosinophil count throughout the vaccination test described in example 3. Arrow marked the time of infestation.
MODO DE REALIZACIÓN DE LA INVENCIÓN Ejemplo 1. Producción de la proteína recombinante de Hc23 (rHc23). EMBODIMENT OF THE INVENTION Example 1. Production of the recombinant Hc23 protein (rHc23).
Con el fin de obtener el gen completo que codifica la proteína Hc23, se partió del antígeno somático de H. contortus p26/23 parcialmente clonado y expresado en E. coli (García Coiradas, L.; Angulo-Cubillán, F.; Valladares, B.; Martínez, E.; de la Fuente, C; Alunda, JM.; and Cuquerella, M. (2010). Immunization against lamb Haemonchosis with a Recombinant Somatic Antigen of Haemonchus contortus (rHcp26/23). Veterinary Medicine International, pp. 1-8). In order to obtain the complete gene encoding the Hc23 protein, it was split from the somatic antigen of H. contortus p26 / 23 partially cloned and expressed in E. coli (García Coiradas, L .; Angulo-Cubillán, F .; Valladares, B .; Martínez, E .; de la Fuente, C; Alunda, JM .; and Cuquerella, M. (2010). Immunization against lamb Haemonchosis with a Recombinant Somatic Antigen of Haemonchus contortus (rHcp26 / 23). Veterinary Medicine International, pp. 1-8).
A partir de los clones positivos que portaban el gen incompleto de p26/23, conservado en el plásmido PGEM-T a -80°C, se realizó una PCR colonia. Se utilizaron los cebadores del plásmido: From the positive clones that carried the incomplete p26 / 23 gene, conserved in the PGEM-T plasmid at -80 ° C, a colony PCR was performed. Plasmid primers were used:
SP6: 5' ATTTAGGTGACACTATAGAA 3', caracterizado por SEQ ID NO:3 SP6: 5 ' ATTTAGGTGACACTATAGAA 3 ' , characterized by SEQ ID NO: 3
T7: 5' TAATACGACTCACTATAGGG 3', caracterizado por SEQ ID NO:4 T7: 5 ' TAATACGACTCACTATAGGG 3 ' , characterized by SEQ ID NO: 4
Ello permitió la amplificación de un fragmento de 757 pb. Se seleccionaron las 3 colonias que en la electroforesis habían mostrado una mayor pureza. Se procedió a la purificaron de las 3 bandas (una por colonia) mediante «gel extraction kit» (QIAGEN) y se secuenciaron. El resultado fue coincidente con la secuencia inicial (incompleta) del gen que codifica p26/23, con lo cual se usaron los cebadores del inserto F y R: This allowed the amplification of a 757 bp fragment. The 3 colonies were selected that had shown greater purity in electrophoresis. The 3 bands (one per colony) were purified by "gel extraction kit" (QIAGEN) and sequenced. The result was consistent with the initial (incomplete) sequence of the gene encoding p26 / 23, which used the primers of the insert F and R:
F: 5' GCAGGACTGTTCGCACAT 3', caracterizado por SEQ ID NO:5 R: 5' TCAGTCTTTCGCGGACTTG 3', caracterizado por SEQ ID NO:6 que permitían la amplificación de un fragmento de 580 pb. Posteriormente se eligieron 2 colonias que presentaron la mayor pureza en amplificación y se procedió a la purificación de las dos bandas (una por colonia) a partir del gel de agarosa «gel extraction kit» (Qiagen). Una vez obtenida la secuencia se procedió a su mareaje, para ello realizamos una PCR con estas 2 colonias usando los mismos cebadores y añadiendo «DIG-DNA labeling mix» como marcador. F: 5 ' GCAGGACTGTTCGCACAT 3 ' , characterized by SEQ ID NO: 5 R: 5 ' TCAGTCTTTCGCGGACTTG 3 ' , characterized by SEQ ID NO: 6 that allowed the amplification of a 580 bp fragment. Subsequently, 2 colonies were chosen that presented the highest purity in amplification and the two bands (one per colony) were purified from the "gel extraction kit" agarose gel (Qiagen). Once the sequence was obtained, its marking was carried out, for this we performed a PCR with these 2 colonies using the same primers and adding «DIG-DNA labeling mix» as a marker.
Tras la construcción de una biblioteca genómica de cADN de H. contortus utilizando el vector Lambda Uni ZAP XR (Stratagene) utilizamos diluciones de 10"4 de la genoteca de cADN, que hicieron un total de 1 ,2 x 104 unidades formadoras de colonias (ufe) escrutadas; se pusieron en contacto con la sonda previamente construida a una concentración de 25 ng/μΙ, bajo condiciones altamente astringentes (68°C). Se seleccionaron 8 halos positivos. After the construction of an H. contortus cDNA genomic library using the Lambda Uni ZAP XR vector (Stratagene) we used 10 "4 dilutions of the cDNA library, which made a total of 1, 2 x 10 4 colony forming units (ufe) scrutinized; they contacted the previously constructed probe at a concentration of 25 ng / μΙ, under highly astringent conditions (68 ° C). 8 positive halos were selected.
Se comprobó la presencia del gen de la p26/23 en los 8 fagos aislados mediante una reacción de PCR utilizando los cebadores F y R. Los 8 fagos aislados generaron una amplicón de 580 pb (Fig. 1), lo que confirmaba su presencia en los fagos, sin embargo quedaba por determinar si éste estaba completo. The presence of the p26 / 23 gene in the 8 isolated phages was checked by a PCR reaction using primers F and R. The 8 isolated phages generated a 580 bp amplicon (Fig. 1), confirming their presence in the phages, however, it remained to be determined if it was complete.
Se procedió a la purificación del fragmento, utilizando el sistema QiaEX II (Qiagen) siguiendo las indicaciones del fabricante. Las muestras purificadas fueron sometidas a amplificación por PCR utilizando los cebadores T3 del fago y R final de la secuencia para conseguir la secuencia completa del gen: The fragment was purified, using the QiaEX II system (Qiagen) following the manufacturer's instructions. The purified samples were subjected to PCR amplification using phage T3 primers and final R sequence to achieve the complete gene sequence:
T3: 5' AATTAACCCTCACTAAAGGG 3', caracterizado por SEQ ID NO:7 R: 5' TCAGTCTTTCGCGGACTTG 3', caracterizado por SEQ ID NO:6 Se obtuvo un amplicón de 612 pb, que denominamos Hc23. T3: 5 ' AATTAACCCTCACTAAAGGG 3 ' , characterized by SEQ ID NO: 7 R: 5 ' TCAGTCTTTCGCGGACTTG 3 ' , characterized by SEQ ID NO: 6 A 612 bp amplicon was obtained, which we call Hc23.
Una vez conseguida la secuencia completa del gen que codifica Hc23, se procedió a la obtención de la proteína recombinante rHc23. Los productos amplificados por PCR fueron ligados a pGEM®-T Easy Vector (Promega) para asegurar la posición correcta y permitir la purificación de una copia completa del gen correspondiente a Hc23. Como células competentes se utilizaron E. coli XL2-Blue strain. Se seleccionaron las colonias positivas y el vector de expresión fue digerido con Ndel y Xhol. El inserto fue ligado al vector pET-29b(+) (Novagen); como células competentes empleamos E. coli BL21. Las bacterias fueron cultivadas durante la noche a 37 °C, en medio LB con kanamicina. La inducción de la proteína recombinante se obtuvo con 0,5 mM isopropil-1-tio-b-D-galactopiranosido (IPTG) (Roche) durante 2 h. La proteína se solubilizó en tampón [20 mM Tris-HCI pH 8, 0,5 M NaCI, 5 mM ¡midazol, β-ΜΕ 10 mM e inhibidores de proteasas (Roche)]. La solubilización fue óptima con sarcosil al 0,15%. Once the complete sequence of the gene encoding Hc23 was achieved, the recombinant rHc23 protein was obtained. The PCR amplified products were linked to pGEM®-T Easy Vector (Promega) to ensure the correct position and allow the purification of a complete copy of the gene corresponding to Hc23. Competent cells were used E. coli XL2-Blue strain. Positive colonies were selected and the expression vector was digested with Ndel and Xhol. The insert was linked to the vector pET-29b (+) (Novagen); as competent cells we use E. coli BL21. The bacteria were grown overnight at 37 ° C, in LB medium with kanamycin. Induction of the recombinant protein was obtained with 0.5 mM isopropyl-1-thio-bD-galactopyranoside (IPTG) (Roche) for 2 h. The protein was solubilized in buffer [20 mM Tris-HCI pH 8, 0.5 M NaCI, 5 mM midazole, 10 mM β-e and protease inhibitors (Roche)]. The solubilization was optimal with 0.15% sarcosil.
La proteína recombinante (rHc23) llevaba asociada una cola de 6 histidinas, lo que permitió su purificación en una columna de niquel-ácido -nitrilitriacético (Ni-TNA) (Qiagen) mediante elución con 100 y 250 mM imidazol. Las fracciones obtenidas fueron sometidas a electroforesis SDS-PAGE. La proteína purificada fue analizada mediante electroforesis y Western blotting, detectándose 2 bandas, una 23 kDa (rHc23) y la otra 46 KDa (dímero). La secuencia de nucleótidos de los productos de PCR y los clones de bacterias positivas en E. coli XL2- blue y BL 21 fueron determinados en la sección de Genética del Departamento de Producción Animal de la Facultad de Veterinaria de la UCM y en el Servicio de Genómica, Servicios Generales de Apoyo a la Investigación, Universidad de La Laguna, La Laguna, Tenerife. Ejemplo 2. Purificación de la proteína nativa Hc23 The recombinant protein (rHc23) was associated with a tail of 6 histidines, which allowed its purification on a nickel-nitrilitriacetic acid (Ni-TNA) column (Qiagen) by elution with 100 and 250 mM imidazole. The fractions obtained were subjected to SDS-PAGE electrophoresis. The purified protein was analyzed by electrophoresis and Western blotting, detecting 2 bands, one 23 kDa (rHc23) and the other 46 KDa (dimer). The nucleotide sequence of the PCR products and the positive bacterial clones in E. coli XL2-blue and BL 21 were determined in the Genetics section of the Animal Production Department of the Veterinary Faculty of the UCM and in the Department of Veterinary Medicine. Genomics, General Research Support Services, University of La Laguna, La Laguna, Tenerife. Example 2. Purification of the native Hc23 protein
La proteína nativa Hc23 pudo obtenerse mediante 2 cromatografías de afinidad seriadas. Para ello previamente se obtuvieron sueros hiperinmunes anti rHc23 mediante inoculaciones en conejo (raza Nueva Zelanda, blanco) con 150 g de rHc23 (intramuscular) -3 veces la primera con 1 mL de adyuvante completo de Freund y la segunda y la tercera con adyuvante incompleto de Freund. The native Hc23 protein could be obtained by means of 2 serial affinity chromatographs. To this end, anti-rHc23 hyperimmune sera were previously obtained by inoculations in rabbit (New Zealand breed, white) with 150 g of rHc23 (intramuscular) -3 times the first with 1 mL of Freund's complete adjuvant and the second and third with incomplete adjuvant from Freund.
Se analizó la especificidad de estos sueros mediante electroforesis y Western blotting, siendo capaces de reconocer la proteína rHc23. Mediante ELISA se apreciaron títulos de anticuerpos muy elevados. En una primera cromatografía de afinidad utilizamos una columna de agarosa con proteína A (Roche), siguiendo las recomendaciones del fabricante, y suero hiperinmune, lo que nos permitió la obtención de los anticuerpos policlonales purificados. Para determinar la fracción que contenía las inmunoglobulinas se midieron las fracciones mediante espectrofotometría a 280 nm y las inmunoglobulinas purificadas se dializaron en PBS. Los anticuerpos policlonales se concentraron tras la determinación de su concentración, utilizando el método de Bradford (Bradford, M.M. (1973). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principie of protein-dye binding. Ann Biochem., 72: 248- 254). The specificity of these sera was analyzed by electrophoresis and Western blotting, being able to recognize the rHc23 protein. ELISA showed very high antibody titers. In a first affinity chromatography we used an agarose column with protein A (Roche), following the manufacturer's recommendations, and hyperimmune serum, which allowed us to obtain purified polyclonal antibodies. To determine the fraction containing the immunoglobulins, the fractions were measured by spectrophotometry at 280 nm and the purified immunoglobulins were dialyzed in PBS. Polyclonal antibodies were concentrated after determination of their concentration, using the Bradford method (Bradford, MM (1973). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principie of protein-dye binding. Ann Biochem. , 72: 248-254).
A continuación se realizó una cromatografía de inmunoafinidad (columna con "CNBr activated Sepharose 4 B beads" + los anticuerpos purificados) con extracto soluble de adultos de H. contortus obtenido mediante homogenización de adultos del parásito y posterior centrifugación a 30000xg, durante 30 minutos, para obtener el sobrenadante. La columna se mantuvo a 4°C durante toda la noche, permitiendo a los anticuerpos de la columna acoplarse al extracto soluble de adultos del parásito. Se recogió el flujo que pasó a través de la columna y se lavó la columna con tampón de equilibrado hasta que la lectura de espectrofotómetro a 280nm fue el basal. La proteína fijada se eluyó mediante el tampón de elución y recogida en tampón de neutralización. Las fracciones que contenían proteína (medido a 280nm) fueron purificadas y dializadas con PBS permitiendo la purificación de la Hc23 nativa (Fig. 2). Ejemplo 3. Pruebas de vacunación frente a la hemoncosis ovina con las proteínas Hc23 v rHc23 An immunoaffinity chromatography was then performed (column with "CNBr activated Sepharose 4 B beads" + purified antibodies) with soluble extract of adults of H. contortus obtained by homogenization of adults of the parasite and subsequent centrifugation at 30000xg, for 30 minutes, to get the supernatant. The column was maintained at 4 ° C overnight, allowing the antibodies in the column to attach to the soluble adult extract of the parasite. The flow that passed through the column was collected and the column was washed with equilibration buffer until the spectrophotometer reading at 280 nm was the baseline. The fixed protein was eluted by elution buffer and collected in neutralization buffer. Fractions containing protein (measured at 280 nm) were purified and dialyzed with PBS allowing purification of native Hc23 (Fig. 2). Example 3. Vaccination tests against sheep hemoncosis with Hc23 v rHc23 proteins
Parásitos Parasites
Para nuestro estudio empleamos L-3 de un aislado de H. contortus, gentilmente cedido por Merck, Sharp and Dohme (Madrid, España) y mantenido en nuestro laboratorio durante más de 2 décadas mediante pases seriados en animales donadores. Las larvas 3 fueron obtenidas mediante la técnica de la migración larvaria [método Baerman, Ministry of Agriculture, Fisheries and Food (MAFF (Ministry of Agriculture, Fisheries and Food) (1971). Manual of Veterinary Parasitológica! Laboratory Techniques. HMSO, London)]. Animales y Diseño experimental For our study we used L-3 of an isolate of H. contortus, kindly provided by Merck, Sharp and Dohme (Madrid, Spain) and maintained in our laboratory for more than 2 decades by serial passes on donor animals. The larvae 3 were obtained by the larval migration technique [Baerman method, Ministry of Agriculture, Fisheries and Food (MAFF (Ministry of Agriculture, Fisheries and Food) (1971). Manual of Veterinary Parasitological! Laboratory Techniques. HMSO, London) ]. Animals and Experimental Design
48 corderos de raza Assaf de 4 meses de edad fueron alojados en las instalaciones del Departamento de Sanidad Animal. Se mantuvieron durante los 15 primeros días en observación, a la vez se les pesó y se tomaron muestras de sangre y fecales para determinar su estado parasitológico. Al mes de su llegada, los animales fueron separados al azar en 6 lotes de 7 corderos, los cuales serían sometidos a diversos tratamientos y 1 lote de 6 animales que actuarían como testigos del experimento. 48 lambs of the 4 month old Assaf breed were housed in the facilities of the Department of Animal Health. They were kept for the first 15 days under observation, at the same time they were weighed and blood and fecal samples were taken to determine their parasitological status. One month after their arrival, the animals were randomly separated into 6 lots of 7 lambs, which would be subjected to various treatments and 1 lot of 6 animals that would act as witnesses to the experiment.
El grupo I fue inmunizado con la proteína nativa Hc23 de H. contortus (100pg) en Hidróxido de aluminio [13 mg/ml (SIGMA A-8222)] (900μΙ), 3 veces, cada 2 semanas y 2 semanas después de la última dosis fue sometido a una infestación (reto) con 15000 L3 del parásito. El grupo II siguió el mismo protocolo de inmunización e infestación pero utilizando la proteína recombinante rHc23 (concentración y dosis infestante similares). El grupo III recibió una primera dosis de la proteína nativa (100pg) en una solución adyuvante que contenía 2mg de lipopolisacáridos de E. coli y 25mg de Propionibacterium sp (Infervac de Laboratorios Calier, S.A.) (1mL/10kg de peso vivo); 2 días después se repitió la misma inoculación y se procedió a la infestación de los animales; para finalizar, una semana más tarde recibieron una dosis inmunizante de recuerdo que se repitió a la semana siguiente. En el grupo IV se realizó el mismo protocolo de inmunización e infestación del grupo III, pero empleando proteína recombinante, a la misma concentración. El grupo V fue el testigo total de la inmunización e infestación. El grupo VI fue el testigo positivo de la infestación, los animales fueron sometidos exclusivamente al reto parasitario. El grupo VII (con 4 meses y medio de edad) fue primoinfestado con 10000 L3 de H. contortus, dicha infestación se terminó el día 35 postinfestación tras un tratamiento antihelmíntico con Valbazen ® 10% Albendazol (Pfizer), 2 semanas más tarde se llevó a cabo la reinfestación (reto) de los animales. El reto parasitario se mantuvo en todos los grupos durante 45 días, para finalmente proceder al sacrificio de los animales. Determinaciones parasitológicas Group I was immunized with the native Hc23 protein of H. contortus (100pg) in Aluminum hydroxide [13 mg / ml (SIGMA A-8222)] (900μΙ), 3 times, every 2 weeks and 2 weeks after the last dose was subjected to an infestation (challenge) with 15000 L3 of the parasite. Group II followed the same immunization and infestation protocol but using the rHc23 recombinant protein (similar concentration and infestant dose). Group III received a first dose of the native protein (100pg) in an adjuvant solution containing 2mg of E. coli lipopolysaccharides and 25mg of Propionibacterium sp (Infervac de Laboratorios Calier, SA) (1mL / 10kg live weight); 2 days later the same inoculation was repeated and the animals were infested; Finally, one week later they received a booster immunization dose that was repeated the following week. In group IV the same immunization and infestation protocol of group III was performed, but using recombinant protein, at the same concentration. Group V was the total witness of immunization and infestation. Group VI was the positive witness of the infestation, the animals were subjected exclusively to the parasitic challenge. Group VII (with 4 and a half months of age) was primoinfested with 10,000 L3 of H. contortus, said infestation was terminated on day 35 post-infestation after an anthelmintic treatment with Valbazen ® 10% Albendazole (Pfizer), 2 weeks later it was taken out the reinfestation (challenge) of the animals. The parasitic challenge remained in all groups for 45 days, to finally proceed to the sacrifice of the animals. Parasitological determinations
Se realizaron análisis coprológicos semanales para determinar la eliminación fecal de huevos a lo largo del experimento. No obstante, durante el final de la prepatencia y hasta el inicio de la patencia, se llevaron a cabo análisis cada 2 días. Para las determinaciones coprológicas utilizamos el método de McMaster modificado (MAFF (Ministry of Agriculture, Fisheries and Food) (1971). Manual of Veterínary Parasitológica! Laboratory Techniques. HMSO, London). Weekly coprological analyzes were performed to determine fecal removal of eggs throughout the experiment. However, during the end of the prepatence and until the beginning of the patent, analyzes were carried out every 2 days. For coprological determinations we use the modified McMaster method (MAFF (Ministry of Agriculture, Fisheries and Food) (1971). Manual of Veterinary Parasitological! Laboratory Techniques. HMSO, London).
Tras la necropsia de los animales se procedió al estudio de la población adulta existente. Se abrieron los abomasos por la curvatura menor, situando el contenido gástrico en geles de agarosa al 2% e incubándolo en solución fisiológica salina a 37°C durante toda la noche. Se procedió a la determinación de la carga total de los adultos. After the necropsy of the animals, the existing adult population was studied. The abomasums were opened by the lesser curvature, placing the gastric content in 2% agarose gels and incubating it in physiological saline solution at 37 ° C overnight. The total load of adults was determined.
Resultados Todos los grupos vacunados mostraron una reducción estadísticamente significativa en la eliminación fecal de huevos, de un 57% en G I, 74% en G II y 79% en G III y GIV respecto al grupo que solo recibió el reto parasitario (GVI). Dicha disminución fue significativa en los días 21 , 24, 28, 35 y 42 postinfestación, con valores de p<0,001 para todos los grupos vacunados en los días 24 y 28, en el día 35 se apreció una p< 0,05 para el Gl y <0,001 para el resto de grupos vacunados; asimismo encontramos significación en el día 42 en los grupos Gil (con un valor de p<0,05) y en Olí I y GIV de p<0,001 ; además los grupos Gil y GIV mostraron reducción significativa (p<0,05) en el día 21 postinfestación. El grado de contaminación parasitaria del medio, que se estimó como el sumatorio de huevos eliminados (hpg) a lo largo del experimento, fue inferior en todos los grupos vacunados (Gl: 75.250, Gil: 42.365, Glll: 36.830 y GIV: 37.575 hpg), con disminuciones que oscilaron entre un 4,5% y un 9% menos que el generado por el grupo primoinfestado (GVI) que eliminó un total de 323.942hpg (Fig. 3). El establecimiento de la población adulta (n° de adultos en abomaso) mostró una disminución significativa en los grupos vacunados, desde el 69% para el Gl hasta más del 85% para los otros 3 grupos (Gil, Glll y GIV), con cargas parasitarias de 318±385 (Gl), 147± 203 (Gil), 127± 127 (Glll), 131± 190 (GIV) respecto al grupo primoinfestado (GVI 1030 ± 383). (Fig. 4) Results All vaccinated groups showed a statistically significant reduction in fecal removal of eggs, 57% in GI, 74% in G II and 79% in G III and GIV compared to the group that only received the parasitic challenge (GVI). This decrease was significant on days 21, 24, 28, 35 and 42 post-infestation, with values of p <0.001 for all groups vaccinated on days 24 and 28, on day 35 a p <0.05 was observed for the Gl and <0.001 for the rest of vaccinated groups; We also found significance on day 42 in the Gil groups (with a value of p <0.05) and in Olí I and IVG of p <0.001; In addition, the Gil and GIV groups showed significant reduction (p <0.05) on day 21 post-infestation. The degree of parasitic contamination of the medium, which was estimated as the sum of eliminated eggs (hpg) throughout the experiment, was lower in all vaccinated groups (Gl: 75.250, Gil: 42.365, Glll: 36.830 and GIV: 37.575 hpg ), with decreases that ranged between 4.5% and 9% less than that generated by the primary group (GVI) that eliminated a total of 323,942hpg (Fig. 3). The establishment of the adult population (number of adults in abomasum) showed a significant decrease in vaccinated groups, from 69% for Gl to more than 85% for the other 3 groups (Gil, Glll and GIV), with loads parasitic of 318 ± 385 (Gl), 147 ± 203 (Gil), 127 ± 127 (Glll), 131 ± 190 (GIV) with respect to the primary group (GVI 1030 ± 383). (Fig. 4)
Se observó correlación positiva entre la eliminación fecal de huevos y el establecimiento parasitario (r = 0,85, p<0,0001). A positive correlation was observed between fecal elimination of eggs and parasitic establishment (r = 0.85, p <0.0001).
Los valores de los parámetros hemáticos determinados (hematocrito y eosinófilos entre otros) guardaron relación con el momento de la infestación y con la capacidad de respuesta de los animales. Los animales vacunados evidenciaron pérdidas sanguíneas inferiores, con valores del hematocrito superiores a los determinados en el grupo primoinfestado, con significación de p<0,001 a lo largo del experimento y de p<0,01 en los días 63, 77 y 88 postvacunación (Fig. 5). Se observó una correlación negativa entre la eliminación fecal de huevos y el valor hematocrito (r = - 0,82, p<0,0001). The values of the determined blood parameters (hematocrit and eosinophils among others) were related to the time of the infestation and the response capacity of the animals. The vaccinated animals showed lower blood losses, with hematocrit values higher than those determined in the primary group, with significance of p <0.001 throughout the experiment and p <0.01 on days 63, 77 and 88 postvaccination (Fig . 5). A negative correlation was observed between the fecal elimination of eggs and the hematocrit value (r = - 0.82, p <0.0001).
El modelo de la respuesta eosinofílica detectada guardó relación con el protocolo de inmunización empleado. Los grupos Gl y II mostraron un comportamiento similar a lo largo del ensayo, con incremento de sus valores desde el día 28 postvacunación, con un pico en el día 7 postinfestación (valores medios de 0,87 X 103 eosinófilos/pL y de 0,93 X 103 eosinófilos/ L, para Gl y Gil respectivamente. The model of the eosinophilic response detected was related to the immunization protocol used. The Gl and II groups showed a similar behavior throughout the trial, with an increase in their values from day 28 post-vaccination, with a peak on day 7 post-infestation (mean values of 0.87 X 10 3 eosinophils / pL and 0 , 93 X 10 3 eosinophils / L, for Gl and Gil respectively.
Por su parte, los grupos Glll y IV mostraron un comportamiento similar a lo largo del ensayo, con un incremento en el número de eosinófilos desde el día 7 postinfestación, con un pico en el día 21 (1 ,04 X 103 eosinófilos/ L y 0,61 X 103 eosinófilos/ L, para Glll y GIV respectivamente. For their part, the Glll and IV groups showed a similar behavior throughout the trial, with an increase in the number of eosinophils from day 7 post-confestation, with a peak on day 21 (1, 04 X 10 3 eosinophils / L and 0.61 X 10 3 eosinophils / L, for Glll and GIV respectively.
El análisis estadístico determinó diferencias significativas en los días 49, 63, 77 y 88 entre los grupos vacunados (con elevación en el n° de eosinófilos) y el grupo VI primoinfestado, con valores desde p <0,05 hasta p<0,001 (Fig. 6). El grupo GVII sometido a una infestación y al reto parasitario se comportó durante la primoinfestación del mismo modo que el grupo VI (solo primoinfestado) con recuentos de la eliminación de huevos elevados. Tras el reto, los animales mostraron una reducción de los recuentos de huevos y de la carga parasitaria respecto al grupo GVI (estadísticamente significativa); sin embargo, no se apreciaron diferencias significativas con los grupos vacunados. The statistical analysis determined significant differences on days 49, 63, 77 and 88 between the vaccinated groups (with elevation in the number of eosinophils) and the primary infosted group VI, with values from p <0.05 to p <0.001 (Fig 6). The GVII group subjected to an infestation and parasitic challenge behaved during primoinfestation in the same way as group VI (primary only) with counts of the elimination of raised eggs. After the challenge, the animals showed a reduction in egg counts and parasite load compared to the GVI group (statistically significant); however, no significant differences were observed with the vaccinated groups.
A pesar de que este grupo primoinfestado y reinfestado tras el reto mostrara una buena protección, hay que considerar que la infestación previa (imprescindible para alcanzar ese grado de protección) provocó una elevada eliminación de huevos del parásito, con la consiguiente contaminación del medio y una merma inicial en sus condiciones físicas debido a la pérdida sanguínea. Although this primary and reinfrested group after the challenge showed good protection, it must be considered that the previous infestation (essential to achieve that degree of protection) caused a high elimination of eggs from the parasite, with the consequent contamination of the environment and a initial decline in physical conditions due to blood loss.
APLICACIÓN INDUSTRIAL INDUSTRIAL APPLICATION
El sector veterinario y los productos destinados a la salud animal se enfrentan a la necesidad de aumentar la calidad de los productos empleados para poder hacer frente a una tecnificación del sector y exigencias mayores por parte de los consumidores. El desarrollo de productos eficientes, puros, baratos, seguros y respetuosos con el medio ambiente, representa un salto cualitativo de gran importancia para el futuro del sector veterinario. The veterinary sector and products intended for animal health face the need to increase the quality of the products used in order to meet the technification of the sector and higher demands by consumers. The development of efficient, pure, cheap, safe and environmentally friendly products represents a qualitative leap of great importance for the future of the veterinary sector.
Además el desarrollo de productos obtenidos por vía biotecnológica como los de la invención pueden representar la consolidación de la prevención, como alternativa al tratamiento, para patologías tan extendidas en el ganado como las trichostrongilidosis, permitiendo pensar en mejoras significativas en la seguridad y la competitividad de la producción animal. In addition, the development of products obtained by biotechnology such as those of the invention may represent the consolidation of prevention, as an alternative to treatment, for diseases as widespread in cattle as trichostrongilidosis, allowing us to think about significant improvements in the safety and competitiveness of Animal production
La incorporación de la proteína recombinante rHc23, o derivados de la misma, a composiciones inmunogénicas para la elaboración de vacunas es capaz de reducir de forma significativa (hasta >80%) la carga parasitaria y eliminación de huevos al medio de H. contortus, en dependencia del adyuvante empleado. The incorporation of the recombinant rHc23 protein, or derivatives thereof, into immunogenic compositions for vaccine production is capable of significantly reducing (up to> 80%) the parasitic load and elimination of eggs in the medium of H. contortus, depending on the adjuvant used.
TEXTO LIBRE DE LA LISTA DE SECUENCIAS El texto libre utilizado en la lista de secuencias se corresponde en español a las siguientes características: FREE TEXT OF THE SEQUENCE LIST The free text used in the sequence list corresponds in Spanish to the following characteristics:
SEQ ID NO: 3. Cebador SP6 del plásmido PGEM-T; SEQ ID NO: 3. Primer SP6 of plasmid PGEM-T;
SEQ ID NO: 4. Cebador T7 del plásmido PGEM-T; SEQ ID NO: 4. Primer T7 of the plasmid PGEM-T;
SEQ ID NO: 7. Cebador T3 del plásmido lambda ZAP CMV XR. SEQ ID NO: 7. Primer T3 of the lambda plasmid ZAP CMV XR.

Claims

REIVINDICACIONES
1. Molécula aislada de ácidos nucleicos, caracterizada por SEQ ID NO:1 o con, al menos, un 70% de identidad con SEQ ID NO:1 , que contiene la secuencia de nucleótidos que codifica la proteína Hc23 de H. contortus, caracterizada por SEQ ID NO:2, o un polipéptido con, al menos, un 80% de identidad con SEQ ID NO:2 que mantiene las propiedades antigénicas de Hc23. 1. Isolated nucleic acid molecule, characterized by SEQ ID NO: 1 or with at least 70% identity with SEQ ID NO: 1, which contains the nucleotide sequence encoding the H. contortus Hc23 protein, characterized by SEQ ID NO: 2, or a polypeptide with at least 80% identity with SEQ ID NO: 2 that maintains the antigenic properties of Hc23.
2. Molécula aminoacídica purificada que comprende la secuencia de Hc23 de H. contortus, caracterizada por SEQ ID NO: 2, o una secuencia con, al menos, un 80% de identidad con SEQ ID NO: 2 que mantiene las características antigénicas de Hc23. 2. Purified amino acid molecule comprising the Hc23 sequence of H. contortus, characterized by SEQ ID NO: 2, or a sequence with at least 80% identity with SEQ ID NO: 2 that maintains the antigenic characteristics of Hc23 .
3. Vector recombinante que incluye una secuencia comprendida en la reivindicación 1. 3. Recombinant vector including a sequence comprised in claim 1.
4. Célula hospedadora procariota transformada con los vectores recombinantes de la reivindicación 3. 4. Prokaryotic host cell transformed with the recombinant vectors of claim 3.
5. Célula hospedadora eucariota transfectada con los vectores recombinantes de la reivindicación 3. 5. Eukaryotic host cell transfected with the recombinant vectors of claim 3.
6. Composición inmunogénica que incluye: la proteína Hc23, la proteína recombinante rHc23 o polipéptidos con, al menos, un 80% de identidad con la proteína Hc23; la molécula nucleotídica del gen de Hc23, o secuencias con, al menos, un 70% de identidad con dicha secuencia; vectores que contienen cualquiera de estas secuencias nucleotídicas; células procariotas portadoras de vectores que incluyen la molécula nucleotídica del gen de Hc23, o secuencias con, al menos, un 70% de identidad con dicha secuencia nucleotídica; o células eucariotas portadoras de vectores que incluyen la molécula nucleotídica del gen de Hc23, o secuencias con, al menos, un 70% de identidad con dicha secuencia nucleotídica. 6. Immunogenic composition that includes: the Hc23 protein, the rHc23 recombinant protein or polypeptides with at least 80% identity with the Hc23 protein; the nucleotide molecule of the Hc23 gene, or sequences with at least 70% identity with said sequence; vectors containing any of these nucleotide sequences; vector-bearing prokaryotic cells that include the nucleotide molecule of the Hc23 gene, or sequences with at least 70% identity with said nucleotide sequence; or eukaryotic vector-bearing cells that include the nucleotide molecule of the Hc23 gene, or sequences with at least 70% identity with said nucleotide sequence.
7. Composición inmunogénica según la reivindicación 6 que incluye un adyuvante. 7. Immunogenic composition according to claim 6 including an adjuvant.
8. Composición inmunogénica según la reivindicación 7 en la que el adyuvante es hidróxido de aluminio. 8. Immunogenic composition according to claim 7 wherein the adjuvant is aluminum hydroxide.
9. Composición inmunogénica según la reivindicación 7 en la que el adyuvante es una combinación de Propionibacteríum acnés inactivado + lipopolisacáridos de E. coli. 9. Immunogenic composition according to claim 7 wherein the adjuvant is a combination of inactivated propionibacterium acne + lipopolysaccharides of E. coli.
10. Uso de la composición de cualquiera de las reivindicaciones 6-9 en la elaboración de una vacuna frente a la hemoncosis en rumiantes. 10. Use of the composition of any of claims 6-9 in the preparation of a vaccine against hemoncosis in ruminants.
11. Uso según la reivindicación 10 en que los rumiantes son ovejas. 11. Use according to claim 10 wherein the ruminants are sheep.
12. Uso según la reivindicación 11 en que las ovejas tienen entre 4 y 12 meses de vida. 12. Use according to claim 11 wherein the sheep are between 4 and 12 months old.
PCT/ES2013/000197 2012-09-05 2013-09-04 Recombinant protein ofhaemonchus contortus and use thereof for the production of a vaccine against haemonchosis WO2014037592A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ES201200865A ES2453391B2 (en) 2012-09-05 2012-09-05 Recombinant Haemonchus contortus protein and its application for the production of a vaccine against hemoncosis.
ESP201200865 2012-09-05

Publications (1)

Publication Number Publication Date
WO2014037592A1 true WO2014037592A1 (en) 2014-03-13

Family

ID=50236572

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2013/000197 WO2014037592A1 (en) 2012-09-05 2013-09-04 Recombinant protein ofhaemonchus contortus and use thereof for the production of a vaccine against haemonchosis

Country Status (2)

Country Link
ES (1) ES2453391B2 (en)
WO (1) WO2014037592A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110221060A (en) * 2019-06-23 2019-09-10 南京农业大学 A kind of antigen and its application for early diagnosing haemonchus contortus infection

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
ES2081097T3 (en) * 1991-02-06 1996-02-16 Biotech Australia Pty Ltd VACCINE AGAINST NEMATODES.
US5747046A (en) * 1989-03-17 1998-05-05 Munn; Edward Albert Vaccine containing a protein complex form Haemonchus contortus
WO2008032073A2 (en) * 2006-09-13 2008-03-20 Moredun Research Institute Novel nematode protein and its use in producing anthelminthic agents and vaccines
WO2010023452A2 (en) * 2008-08-28 2010-03-04 Moredun Research Institute Nematode vaccine

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5747046A (en) * 1989-03-17 1998-05-05 Munn; Edward Albert Vaccine containing a protein complex form Haemonchus contortus
ES2081097T3 (en) * 1991-02-06 1996-02-16 Biotech Australia Pty Ltd VACCINE AGAINST NEMATODES.
WO2008032073A2 (en) * 2006-09-13 2008-03-20 Moredun Research Institute Novel nematode protein and its use in producing anthelminthic agents and vaccines
WO2010023452A2 (en) * 2008-08-28 2010-03-04 Moredun Research Institute Nematode vaccine

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
GARCIA-COIRADAS L. ET AL.: "Immunization against Lamb Haemonchosis with a Recombinant Somatic Antigen of Haemonchus contortus (rHcp26/23).", VETERINARY MEDICINE INTERNATIONAL., vol. 2010, 2010, pages 1 - 8 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110221060A (en) * 2019-06-23 2019-09-10 南京农业大学 A kind of antigen and its application for early diagnosing haemonchus contortus infection
CN110221060B (en) * 2019-06-23 2021-04-13 南京农业大学 Antigen for early diagnosis of haemonchus contortus infection and application thereof

Also Published As

Publication number Publication date
ES2453391A1 (en) 2014-04-07
ES2453391B2 (en) 2014-08-14

Similar Documents

Publication Publication Date Title
Nisbet et al. Immunity to Haemonchus contortus and vaccine development
ES2867375T3 (en) Polypeptide isolated from C. difficile toxin A and toxin B proteins and their uses
Ortega-Pierres et al. Induction of protection in murine experimental models against Trichinella spiralis: an up-to-date review
Yan et al. Vaccination of goats with DNA vaccine encoding Dim-1 induced partial protection against Haemonchus contortus: A preliminary experimental study
Fawzi et al. Vaccination of lambs with the recombinant protein rHc23 elicits significant protection against Haemonchus contortus challenge
Askari et al. Evaluation of recombinant P23 protein as a vaccine for passive immunization of newborn calves against Cryptosporidium parvum
Fawzi et al. Vaccination of lambs against Haemonchus contortus infection with a somatic protein (Hc23) from adult helminths
Casey et al. Identification of an OmpW homologue in Burkholderia pseudomallei, a protective vaccine antigen against melioidosis
Fereig et al. Neospora GRA6 possesses immune-stimulating activity and confers efficient protection against Neospora caninum infection in mice
WO2012041260A1 (en) .vaccine composition for controlling ectoparasite infestations
Matthews et al. Immunisation of cattle with recombinant acetylcholinesterase from Dictyocaulus viviparus and with adult worm ES products
Leal et al. Promiscuous T cell epitopes boosts specific IgM immune response against a P0 peptide antigen from sea lice in different teleost species
JP2018512152A (en) Avian vaccine
Wiedmer et al. Passive immunization with Eimeria tenella gametocyte antigen 56 (EtGAM56) specific antibodies and active immunization trial with the epitope containing peptide
WO2014037592A1 (en) Recombinant protein ofhaemonchus contortus and use thereof for the production of a vaccine against haemonchosis
ES2717441T3 (en) Vaccine against Cooperia
ArunKumar et al. A comparative analysis on serum antibody levels of sheep immunized with crude and thiol-purified excretory/secretory antigen of Haemonchus contortus.
Mahana et al. Fasciola gigantica enolase is a major component of worm tegumental fraction protective against sheep fasciolosis
WO2013171548A2 (en) Peptides inducing an immune response against copepods and/or the development of a mucous shield in fish; vaccines, uses and methods for modulating the fish immune response and/or for inducing development of a mucous shield in fish
Saimo et al. Recombinant Rhipicephalus appendiculatus gut (ra86) and salivary gland cement (trp64) proteins as candidate antigens for inclusion in tick vaccines: Protective effects of ra86 on infestation with adult R. appendiculatus
García-Coiradas et al. Isolation and immunolocalization of a putative protective antigen (p26/23) from adult Haemonchus contortus
US20220096613A1 (en) Novel trypanosomal vaccine
Zhou et al. Expression of Caenorhabditis elegans-expressed Trans-HPS, partial aminopeptidase H11 from Haemonchus contortus
Liu et al. Progress and Challenges for Developing Vaccines against Gastrointestinal Nematodes of Ruminants
US20240050545A1 (en) Novel trypanosomal vaccine

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13835667

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13835667

Country of ref document: EP

Kind code of ref document: A1