WO2014035457A1 - Dna plasmids with improved expression - Google Patents

Dna plasmids with improved expression Download PDF

Info

Publication number
WO2014035457A1
WO2014035457A1 PCT/US2013/000068 US2013000068W WO2014035457A1 WO 2014035457 A1 WO2014035457 A1 WO 2014035457A1 US 2013000068 W US2013000068 W US 2013000068W WO 2014035457 A1 WO2014035457 A1 WO 2014035457A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
rna
cole2
vector
plasmid
Prior art date
Application number
PCT/US2013/000068
Other languages
French (fr)
Inventor
James A. Williams
Original Assignee
Nature Technology Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nature Technology Corporation filed Critical Nature Technology Corporation
Priority to US14/422,865 priority Critical patent/US9550998B2/en
Priority to AU2013309488A priority patent/AU2013309488A1/en
Priority to CA2883227A priority patent/CA2883227A1/en
Priority to EP13727671.3A priority patent/EP2890404B1/en
Priority to US14/432,693 priority patent/US10047365B2/en
Priority to EP13836246.2A priority patent/EP2920309B1/en
Priority to CA2883943A priority patent/CA2883943C/en
Priority to PCT/US2013/000259 priority patent/WO2014077866A1/en
Priority to AU2013345428A priority patent/AU2013345428B2/en
Publication of WO2014035457A1 publication Critical patent/WO2014035457A1/en
Priority to US15/096,517 priority patent/US10167478B2/en
Priority to US15/375,215 priority patent/US10144935B2/en
Priority to US16/016,229 priority patent/US10844388B2/en
Priority to US16/022,881 priority patent/US11098313B2/en
Priority to US17/031,791 priority patent/US11851665B2/en
Priority to US17/112,918 priority patent/USRE49423E1/en
Priority to US18/067,035 priority patent/US20230242924A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/635—Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2820/00—Vectors comprising a special origin of replication system
    • C12N2820/55—Vectors comprising a special origin of replication system from bacteria

Definitions

  • the present invention relates to a family of eukaryotic expression plasmids useful for gene therapy, obtaining improved genetic immunization, natural interferon production, and more particularly, for improving the expression of plasmid encoded antigens, therapeutic proteins and RNAs.
  • the present invention also relates to the production of covalently closed circular (ccc) recombinant DNA molecules such as plasmids, cosmids, bacterial artificial chromosomes (BACs), bacteriophages, viral vectors and hybrids thereof, and more particularly to strain modifications that improve production yield of said DNA molecules in fermentation culture.
  • ccc covalently closed circular
  • Such recombinant DNA molecules are useful in biotechnology, transgenic organisms, gene therapy, therapeutic vaccination, agriculture and DNA vaccines.
  • E. coli plasmids have long been an important source of recombinant DNA molecules used by researchers and by industry.
  • Plasmid DNA vaccines may find application as preventive vaccines for viral, bacterial, or parasitic diseases; immunizing agents for the preparation of hyper immune globulin products; therapeutic vaccines for infectious diseases; or as cancer vaccines. Plasmids are also utilized in gene therapy or gene replacement applications, wherein the desired gene product is expressed from the plasmid after administration to the patient.
  • Therapeutic plasmids often contain a pMBl, ColEl or pBR322 derived replication origin.
  • Common high copy number derivatives have mutations affecting copy number regulation, such as ROP (Repressor of primer gene) deletion, with a second site mutation that increases copy number (e.g. pMBl pUC G to A point mutation, or ColEl pMMl).
  • ROP Repressor of primer gene
  • pMBl pUC G to A point mutation
  • ColEl pMMl ColEl pMMl
  • Higher temperature 42°C can be employed to induce selective plasmid amplification with pUC and pMMl replication origins.
  • US Patent 7943377 (Carnes, AE and Williams, JA, 2011) disclose methods for fed-batch fermentation, in which plasmid-containing E. coli cells were grown at a reduced temperature during part of the fed-batch phase, during which growth rate was restricted, followed by a temperature upshift and continued growth at elevated temperature in order to accumulate plasmid; the temperature shift at restricted growth rate improved yield and purity of plasmid.
  • Other fermentation processes for plasmid production are described in Carnes A.E. 2005 BioProcess Intl; 3:36-44, which is incorporated herein by reference in its entirety.
  • plasmid therapies and plasmid vaccines are regulatory agency (e.g. Food and Drug Administration, EMEC) safety concerns regarding 1) plasmid transfer and replication in endogenous bacterial flora, or 2) plasmid encoded selection marker expression in human cells, or endogenous bacterial flora. Additionally, regulatory agency guidances recommend removal of all non essential sequences in a vector. Plasmids containing a pMB 1 , ColEl or pBR322 derived replication origin can replicate promiscuously in E. coli hosts. This presents a safety concern that a plasmid therapeutic gene or antigen will be transferred and replicated to a patient's endogenous flora.
  • regulatory agency e.g. Food and Drug Administration, EMEC
  • EMEC Food and Drug Administration
  • a therapeutic or vaccine plasmid would be replication incompetent in endogenous E. coli strains. This requires replacement of the pMBl, ColEl or pBR322 derived replication origin with a conditional replication origin that requires a specialized cell line for propagation.
  • regulatory agencies such as the EMEA and FDA are concerned with utilization of antibiotic resistance or alternative protein markers in gene therapy and gene vaccine vectors, due to concerns that the gene (antibiotic resistance marker or protein marker) may be expressed in a patients cells.
  • plasmid therapies and plasmid vaccines would be 1) replication incompetent in endogenous E. coli strains, 2) would not encode a protein based selection marker and 3) be minimalized to eliminate all non essential sequences.
  • antigen expression is generally very low.
  • Vector modifications that improve antigen expression e.g. codon optimization of the gene, inclusion of an intron, use of the strong constitutive CMV or CAGG promoters versus weaker or cell line specific promoter
  • are highly correlative with improved in vivo expression and, where applicable, immune responses are highly correlative with improved in vivo expression and, where applicable, immune responses (reviewed in Manoj S, Babiuk LA, van Drunen Little-van den Hurk S. 2004 Crit Rev Clin Lab Sci 41 : 1-39).
  • CMV R hybrid CMV promoter
  • a plasmid containing the woodchuck hepatitis virus posttranscriptional regulatory element (a 600 bp element that increases stability and extranuclear transport of RNA resulting in enhanced levels of mRNA for translation) enhanced antigen expression and protective immunity to influenza hemagglutinin (HA) in mice (Garg S, Oran AE, Hon H, Jacob J. 2004 J Immunol. 173: 550-558).
  • HA hemagglutinin
  • the present invention relates to a family of minimalized eukaryotic expression plasmids that are replication incompetent in endogenous flora and have dramatically improved in vivo expression. These vectors are useful for gene therapy, genetic immunization and or interferon therapy.
  • the present invention also relates generally to methods of increasing production yield of covalently closed super-coiled plasmid DNA.
  • One object of the invention is to provide improved expression plasmid vectors. Yet another object of the invention is to provide methods for improving plasmid copy number.
  • a method of increasing expression from an expression plasmid vector comprises modifying the plasmid DNA to replace the pMB 1 , ColE 1 or pBR322 derived replication origin and selectable marker with an alternative replication origin selected from the group consisting of an minimal pUC origin, a R6K gamma replication origin, a ColE2-P9 replication origin, and a ColE2-P9 related replication origin and an RNA selectable marker; transforming the modified plasmid DNA into a bacterial cell line rendered competent for transformation; and isolating the resultant transformed bacterial cells.
  • the resultant plasmid surprisingly has higher in vivo expression levels than the parent pMB 1 , ColEl or pBR322 derived replication origin expression plasmid vector.
  • a composition for construction of a eukaryotic expression vector comprises an R6K origin with at least 90% sequence identity to the sequence set forth as SEQ ID NO: 1 , and a RNA selectable marker, wherein said R6K origin is operably linked to said RNA selectable marker and a eukaryotic region.
  • said R6 origin-RNA selectable marker improves said vector expression in vivo compared to a corresponding vector containing a pMBl, ColEl orpBR322 derived replication origin.
  • said vector has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:41.
  • a composition for construction of a eukaryotic expression vector comprises a ColE2-P9 origin with at least 90% sequence identity to the sequence set forth as SEQ ID NO: 4, 5, 6, or 7, and a a RNA selectable marker, wherein said ColE2-P9 origin- a RNA selectable marker is operably linked to a eukaryotic region.
  • said ColE2-P9 origin-RNA selectable marker improves said vector expression in vivo compared to a corresponding vector containing a pMB 1 , Co IE 1 or pBR322 derived replication origin.
  • said vector has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 8, SEQ ID NO: 9.
  • a primosomal assembly site is optionally incorporated into the vector adjacent to the ColE2-P9 origin.
  • production cell lines are disclosed that improve plasmid yield in shake flask and or fermentation culture with said R6 gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication origin plasmid vectors of the current invention.
  • production cell lines providing heat inducible induction of R6K gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication origin plasmid vectors for DNA production are disclosed. These cell lines contain one or more copies of the corresponding R6K gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication protein integrated into the genome and expressed from the group consisting of: the heat inducible P L promoter (SEQ ID NO: 10), the heat inducible P L promoter incorporating the OLl-G deletion (SEQ ID NO: 11), the heat inducible P L promoter incorporating the OLl-G to T subsitution (SEQ ID NO: 12).
  • mutant R6 replication proteins that improve heat inducible induction of R6K gamma replication origin vectors are disclosed.
  • These cell lines contain one or more copies of the mutant R6K gamma replication origin replication protein integrated into the genome and expressed from the group consisting of: the heat inducible P L promoter (SEQ ID NO: 10), the heat inducible P L promoter incorporating the OLl-G deletion (SEQ ID NO: 11), the heat inducible P L promoter incorporating the OLl-G to T subsitution (SEQ ID NO: 12).
  • the mutant R6K gamma replication origin replication protein are selected from the group consisting of: P42L-P113S (SEQ ID NO: 13), P42L-P106L-F107S (SEQ ID NO: 14).
  • a mutant ColE2-P9 replication protein that improve heat inducible induction of ColE2-P9 replication origin vectors.
  • These cell lines contain one or more copies of the mutant ColE2-P9 replication origin replication protein integrated into the genome and expressed from the group consisting of: the heat inducible P L promoter (SEQ ID NO: 10), the heat inducible P L promoter incorporating the OLl-G deletion (SEQ ID NO: 11), the heat inducible P L promoter incorporating the OLl-G to T subsitution (SEQ ID NO: 12).
  • the mutant ColE2-P9 replication origin replication protein is ColE2-P9 Rep mut G194D (SEQ ID NO: 16).
  • FIG. 1 depicts the NTC8685 pUC origin expression vector
  • FIG. 2 depicts the NTC9685C ColE2 origin expression vector
  • FIG. 3 depicts the NTC9685R R6K origin expression vector
  • FIG. 4 depicts the NTC9385C ColE2 origin expression vector
  • FIG. 5 depicts the NTC9385R R6K origin expression vector
  • FIG. 6 depicts the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector
  • FIG. 7 depicts the P L promoter with OL1 mutations OL1-G and OL1-G to T;
  • FIG. 8 depicts the pINT pR pL ColE2 Rep protein integration vector
  • FIG. 9 shows Nanoplasmid expression in vitro after lipofectamine transfection of HEK293 cell line
  • FIG. 10 shows Nanoplasmid expression in vivo after intramuscular injection with EP
  • FIG. 11 depicts a ColE2 origin Nanoplasmid shRNA expression vector
  • FIG. 12 depicts an IncB RNAI based RNA selectable marker.
  • Table 2 NTC9385R-EGFP LB media shake flask production yields in R6K production strains
  • Table 3 NTC9385C-Luc plasmid performance in different processes and production cell lines
  • Table 4 ColE2 Origin EGFP vector production in NTC701131 ColE2 production cell line
  • Table 7 SR vector expression in vitro and in vivo
  • SEQ ID NO:2 NTC9385R vector backbone
  • SEQ ID NO:3 NTC9685R vector backbone
  • SEQ ID NO:5 ColE2 Origin (+7, CpG free)
  • SEQ ID NO:6 ColE2 Origin (Min)
  • SEQ ID NO:7 ColE2 Origin (+16)
  • SEQ ID NO:8 NTC9385C vector backbone
  • SEQ ID NO:20 NTC9385C and NTC9685C Bacterial region. [Nhel site-ssiA-ColE2 Origin (+7)- RNA-OUT-Kpnl site]
  • SEQ ID NO:23 RNA-OUT selectable marker from NTC9385C, NTC9685C, NTC9385R, and NTC9685R
  • SEQ ID NO:24 RNA-OUT Sense strand RNA from NTC9385C, NTC9685C, NTC9385R,
  • SEQ ID NO:25 TPA secretion sequence
  • SEQ ID NO:26 PCR primer 15061101
  • SEQ ID NO:27 PCR primer 15061102
  • SEQ ID NO:28 ColE2 core replication origin
  • SEQ ID NO:29 +7(CpG free)-ssiA ColE2 origin
  • SEQ ID NO:30 HTLV- IR-Rabbit ⁇ globin hybrid intron
  • SEQ ID NO:31 pMBl RNAI antisense repressor RNA (origin antisense partner of RNAII)
  • SEQ ID NO:32 pMBl RNAI selectable Marker, RNAI RNA (Sense strand)
  • SEQ ID NO:36 CpG free RNA-OUT selection marker - flanked by Kpnl and Bglll- EcoRI sites
  • SEQ ID NO:37 CpG free R6 gamma - RNA-OUT bacterial region (CpG free R6K origin-CpG free RNA-OUT selection marker) ⁇ flanked by EcoRI-SphI and Bglll-EcoRI sites
  • SEQ ID NO:38 CpG free ColE2 bacterial region (CpG free ssiA-CpG free ColE2 origin-CpG free RNA-OUT selection marker)- flanked by EcoRI-SphI and BgUI-EcoRI sites
  • SEQ ID NO:39 NTC9385Ra-02 vector backbone
  • SEQ ID NO:40 NTC9385Ra-01 vector backbone
  • SEQ ID NO:42 P min minimal pUC replication origin
  • SEQ ID NO:43 pUC (0.85) Bacterial region [Nhel site- trpA terminator-P min pUC replication origin (minimal)-RNA-OUT-Kpnl site]
  • A405 Absorbance at 405 nanometers
  • APC Antigen Processing Cell, for example, langerhans cells, plasmacytoid or conventional dendritic cells
  • BAC Bacterial artificial chromosome
  • Bacterial region Region of a plasmid vector required for propagation and selection in the bacterial host
  • BE Boundary element: Eukaryotic sequence that that blocks the interaction between enhancers and promoters. Also referred to as insulator element. An example is the AT-rich unique region upstream of the CMV enhancer Spel site that can function as an
  • cITs857 Lambda repressor further incorporating a C to T (Ala to Thr) mutation that confers temperature sensitivity.
  • cITs857 is a functional repressor at 28-30°C, but is mostly inactive at 37- 42°C. Also called cI857
  • CMV promoter boundary element AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early ( ⁇ ) enhancer. Also referred to as unique region (Angulo et al.. Supra, 2000)
  • ColE2-P9 replication origin a region which is specifically recognized by the plasmid-specified Rep protein to initiate DNA replication. Includes but not limited to ColE2-P9 replication origin sequences disclosed in SEQ ID NO:4: ColE2 Origin (+7), SEQ ID NO:5: ColE2 Origin (+7, CpG free), SEQ ID NO:6: ColE2 Origin (Min) and SEQ ID NO:7: ColE2 Origin (+16) and replication functional mutations as disclosed in Yagura et al 2006, JBacteriol 188:999-1010 included herein by reference ColE2 related replication origin: The ColE2-P9 origin is highly conserved across the ColE2-related plasmid family.
  • ColE2 related plasmid members including ColE3 are compared in Hiraga et al 1994, J Bacteriol. 176:7233 and 53 ColE2 related plasmid members including ColE3 are compared in Yagura et al Supra, 2006. These sequences are included herein by reference
  • ColE2-P9 plasmid a circular duplex DNA molecule of about 7 kb that is maintained at about 10 to 15 copies per host chromosome.
  • the plasmid encodes an initiator protein (Rep protein), which is the only plasmid-specified /raws-acting factor essential for ColE2-P9 plasmid replication
  • RNA-OUT bacterial region Contains a ColE2-P9 replication origin for propagation and the RNA-OUT selection marker.
  • RNA-OUT selection marker optionally includes a PAS, for example, the R6K plasmid CpG free ssiA primosomal assembly site (SEQ ID NO:21) or alternative 0X174 type or ABC type primosomal assembly sites, such as those disclosed in Nomura et al 1991 Gene 108:15 ColE2 plasmid: NTC9385C and NTC9685C vectors disclosed herein, as well as modifications and alternative vectors containing a ColE2-P9 replication origin
  • Methods to deliver gene vectors e.g. poly(lactide-co-glycolide) (PLGA), ISCOMs, liposomes, niosomes, virosomes, chitosan, and other biodegradable polymers,
  • DNA replicon A genetic element that can replicate under its own control; examples include plasmids, cosmids, bacterial artificial chromosomes (BACs), bacteriophages, viral vectors and hybrids thereof
  • E. coli Escherichia coli, a gram negative bacteria
  • EGFP Enhanced green fluorescent protein
  • Eukaryotic expression vector A vector for expression of mRNA, protein antigens, protein therapeutics, shRNA, RNA or microRNA genes in a target organism
  • Eukaryotic region The region of a plasmid that encodes eukaryotic sequences and/or sequences required for plasmid function in the target organism. This includes the region of a plasmid vector required for expression of one or more transgenes in the target organism including RNA Pol II enhancers, promoters, transgenes and polyA sequences.
  • a eukaryotic region may express protein or RNA genes using one or more RNA Pol II promoters, or express RNA genes using one or more RNA Pol III promoters or encode both RNA Pol ⁇ and RNA Pol ⁇ expressed genes.
  • RNA Pol I or RNA Pol III promoters RNA Pol I or RNA Pol III expressed transgenes or RNAs, transcriptional terminators, S MARs, boundary elements, etc FU: Fluorescence units
  • HTLV-I R HTLV-I R 5' untranslated region (UTR). Sequences and compositions were disclosed in Williams, J A 2008 World Patent Application WO2008153733 and included herein by reference
  • Antigen reactive cellular e.g. antigen reactive T cells
  • antibody e.g. antigen reactive IgG
  • RNAI plasmid pMU720 origin encoded RNAI (SEQ ID NO: 33) that represses RNA II regulated targets (Wilson IW, Siemering KR, Praszkier J, Pittard AJ. 1997. J Bacteriol 179:742) kan: Kanamycin
  • kanR Kanamycin Resistance gene
  • a Sail site (GTCGAC) immediately upstream of the ATG start codon (GTCGACATG) is an effective Kozak sequence
  • mSEAP Murine secreted alkaline phosphatase
  • Nanoplasmid vector Vector combining an RNA selection marker with a R6K or ColE2 related replication origin.
  • NTC7382 promoter A chimeric promoter comprising the CMV enhancer-CMV promoter-HTLV R -synthetic rabbit ⁇ globin 3' intron acceptor -exon 2-SRF protein binding site-kozak sequence, with or without an upstream SV40 enhancer.
  • the creation and application of this chimeric promoter is disclosed in Williams JA Supra, 2008 and included herein by reference
  • NTC8385 and NTC8685 plasmids are antibiotic-free vectors that contain a short RNA (RNA-OUT) selection marker in place of the antibiotic resistance marker (kanR).
  • RNA-OUT short RNA
  • kanR antibiotic resistance marker
  • OL1 Lambda repressor binding site in the P L promoter (FIG. 7). Repressor binding to OL1 is altered by mutations in OL1, such as OL1-G (FIG. 7; this is a single base deletion that also reduces the distance between the P L promoter -35 and -10 boxes from optimal 17 bp to 16 bp) and OL1-G to T (FIG. 7; this is a G to T substitution that maintains the distance between the P L promoter -35 and -10 boxes at the optimal 17 bp; this is the V2 mutation described by Bailone A and Galibert F, 1980. Nucleic Acids Research 8:2147)
  • ODM O optical density at 600 nm
  • PAS Primosomal assembly site. Priming of DNA synthesis on a single stranded DNA ssi site. 0X174 type PAS: DNA hairpin sequence that binds priA, which, in turn, recruits the remaining proteins to form the preprimosome [priB, dnaT, recruits dnaB (delivered by dnaC)], which then also recruits primase (dnaG), which then, finally, makes a short RNA substrate for DNA polymerase I.
  • PAS-BH Primosomal assembly site on the heavy (leading) strand
  • PAS-BH region pBR322 origin region between ROP and PAS-BL (approximately pBR322 2067- 2351)
  • PAS-BL Primosomal assembly site on the light (lagging) strand
  • PBS Phosphate buffered Saline
  • pINT pR pL vector The pINT pR pL integration expression vector is disclosed in Luke et al 2011 Mol Biotechnol 47:43 and included herein by reference.
  • the target gene to be expressed is cloned downstream of the pLl promoter (FIG. 7).
  • the vector encodes the temperature inducible cI857 repressor, allowing heat inducible target gene expression.
  • P L promoter Lambda promoter left (FIG. 7).
  • P L is a strong promoter that is repressed by the cl repressor binding to OL1, OL2 and OL3 repressor binding sites.
  • the temperature sensitive cI857 repressor allows control of gene expression by heat induction since at 30°C the cI857 repressor is functional and it represses gene expression, but at 37-42 °C the repressor is inactivated so expression of the gene ensues
  • Plasmid An extra chromosomal DNA molecule separate from the chromosomal DNA which is capable of replicating independently from the chromosomal DNA
  • pMBl RNAI pMBl plasmid origin encoded RNAI that represses RNAII regulated targets (SEQ ID NO: 31 ; SEQ ID NO:32) that represses RNAII regulated targets such as those described iii Grabherr R, Pfaffenzeller I. 2006 US patent application US20060063232 and Cranenburgh RM. 2009; US Patent 7,611,883
  • P min Minimal 678 bp pUC replication origin SEQ ID NO:42 and functional variants with base substitutions and/or base deletions.
  • Vectors described herein incorporating P min include NTC8385- Min and NTC8885MP-U6
  • polyA Polyadenylation signal or site. Polyadenylation is the addition of a poly(A) tail to an RNA molecule.
  • the polyadenylation signal is the sequence motif recognized by the RNA cleavage complex. Most human polyadenylation sites contain an AAUAAA motif and conserved sequences 5' and 3' to it. Commonly utilized polyA sites are derived from the rabbit ⁇ globin (NTC8685; FIG. 1), bovine growth hormone (gWIZ; pVAXl), SV40 early, or SV40 late polyA signals
  • pUC replication origin pBR322-derived replication origin, with G to A transition that increases copy number at elevated temperature and deletion of the ROP negative regulator
  • R6K plasmid NTC9385R, NTC9685R, NTC9385Ra-01 and RNA9385Ra-02 vectors disclosed herein, as well as modifications, and alternative R6K vectors known in the art including but not limited to pCOR vectors (Gencell), pCpGfree vectors (Invivogen), and CpG free University of Oxford vectors including pGM 169
  • R6K replication origin a region which is specifically recognized by the plasmid-specified Rep protein to initiate DNA replication. Includes but not limited to R6K replication origin sequence disclosed as SEQ ID NO:l : R6K Origin, and CpG free versions (SEQ ID NO:22) as disclosed in Drocourt et al United States Patent 7244609 and incorporated herein by reference
  • R6K replication origin-RNA-OUT bacterial region Contains a R6 replication origin for propagation and the RNA-OUT selection marker
  • Rep protein dependent plasmid A plasmid in which replication is dependent on a replication (Rep) protein provided in Trans.
  • Rep replication
  • R6 replication origin For example, R6 replication origin, ColE2-P9 replication origin and ColE2 related replication origin plasmids in which the Rep protein is expressed from the host strain genome.
  • Numerous additional Rep protein dependent plasmids are known in the art, many of which are summarized in del Solar et al 1998 Microbiol. Mol. Biol. Rev 62:434-464 which is included herein by reference
  • RNA-EN Insertion sequence 10 (IS 10) encoded RNA-IN, an RNA complementary and antisense to RNA-OUT.
  • RNA-IN regulated selection marker A genomically expressed RNA-IN regulated selectable marker. In the presence of plasmid borne RNA-OUT, expression of a protein encoded downstream of RNA-IN is repressed.
  • An RNA- ⁇ regulated selection marker is configured such that RNA-IN regulates either 1) a protein that is lethal or toxic to said cell per se or by generating a toxic substance (e.g. SacB), or 2) a repressor protein that is lethal or toxic to said bacterial cell by repressing the transcription of a gene that is essential for growth of said cell (e.g. murA essential gene regulated by RNA- ⁇ tetR repressor gene).
  • RNA-IN-SacB cell lines for RNA-OUT plasmid propagation are disclosed in Williams, JA Supra, 2008 (SEQ ID NO:23) and included herein by reference.
  • Alternative selection markers described in the art may be substituted for SacB
  • RNA-OUT Insertion sequence 10 (IS10) encoded RNA-OUT (SEQ ID NO:24), an antisense RNA that hybridizes to, and reduces translation of, the transposon gene expressed downstream of RNA-IN.
  • the sequence of the core RNA-OUT sequence (SEQ ID NO:24) and complementary RNA-IN SacB genomically expressed RNA-IN-SacB cell lines can be modified to incorporate alternative functional RNA-IN/RNA-OUT binding pairs such as those disclosed in Mutalik et al.
  • RNA-OUT A08/RNA-IN S49 pair including, but not limited to, the RNA-OUT A08/RNA-IN S49 pair, the RNA-OUT A08/RNA- IN S08 pair, and CpG free modifications of RNA-OUT A08 that modify the CG in the RNA-OUT 5' TTCGCT sequence to a non-CpG sequence
  • RNA-OUT Selectable marker An RNA-OUT selectable marker DNA fragment including E. coli transcription promoter and terminator sequences flanking an RNA-OUT RNA.
  • An RNA-OUT selectable marker utilizing the RNA-OUT promoter and terminator sequences, that is flanked by Dralll and Kpnl restriction enzyme sites, and designer genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation, are disclosed in Williams, JA Supra, 2008 (SEQ ID NO:23) and included herein by reference.
  • the RNA-OUT promoter and terminator sequences flanking the RNA-OUT RNA may be replaced with heterologous promoter and terminator sequences.
  • RNA-OUT promoter may be substituted with a CpG free promoter known in the art, for example the I-EC2K promoter or the P5/6 5/6 or P5/6 6/6 promoters disclosed in Williams, JA Supra, 2008 and included herein by reference
  • RNA selectable marker also RNA selection marker.
  • An RNA selectable marker is a plasmid borne expressed non translated RNA that regulates a chromosomally expressed target gene to afford selection. This may be a plasmid borne nonsense suppressing tRNA that regulates a nonsense suppressible selectable chromosomal target as described by Crouzet J and Soubrier F 2005 US Patent 6,977,174 included herein by reference.
  • This may also be a plasmid borne antisense repressor RNA, a non limiting list included herein by reference includes RNA-OUT that represses RNA- ⁇ regulated targets, pMBl plasmid origin encoded RNAI that represses RNAII regulated targets (SEQ ID NO: 31 ; SEQ ID NO:32; Grabherr and, Pfaffenzeller Supra,. 2006; Cranenburgh RM.
  • IncB plasmid pMU720 origin encoded RNAI that represses RNA II regulated targets (SEQ ID NO: 33; SEQ ID NO:34; Wilson et al Supra, 1997), ParB locus Sok of plasmid Rl that represses Hok regulated targets, Flm locus FlmB of F plasmid that represses flmA regulated targets (Morsey MA, 1999 US patent US5922583).
  • An RNA selectable marker may be another natural antisense repressor RNAs known in the art such as those described in Wagner EGH, Altuvia S, Romby P. 2002. Adv Genet 46:361 and Franch T, and Gerdes K. 2000.
  • RNA selectable marker may also be an engineered repressor RNAs such as synthetic small RNAs expressed SgrS, MicC or MicF scaffolds as described in Na D, Yoo SM, Chung H, Park H, Park JH, Lee SY. 2013. Nat Biotechnol 31 : n0
  • sacB Structural gene encoding Bacillus subtilis levansucrase. Expression of sacB in gram negative bacteria is toxic in the presence of sucrose
  • SEAP Secreted alkaline phosphatase
  • shRNA Short hairpin RNA
  • spacer region is the region linking the 5' and 3' ends of the eukaryotic region sequences.
  • the eukaryotic region 5' and 3' ends are typically separated by the replication origin and selection marker.
  • this will be between the RNA Pol II promoter region (5' to a promoter, enhancer, boundary element, S/MAR) and the RNA Pol II polyA region (3' to a polyA sequence, eukaryotic transcriptional terminator sequence, boundary element, S/MAR).
  • the spacer region is region between Nhel site at 1663 and Kpnl site at 460.
  • the eukaryotic sequences separated by the spacer will depend on the orientation of the two transcription elements.
  • the spacer region may separate two polyA sequences or two enhancers respectively.
  • the spacer region may separate an RNA Pol ⁇ enhancer and a RNA Pol ⁇ promoter.
  • the spacer region may encode bacterial or eukaryotic selectable markers, bacterial transcription terminators, eukaryotic transcription terminators, boundary elements, S/MARs, RNA Pol I or RNA Pol ⁇ expressed sequences or other functionalities
  • SV40 enhancer Region containing the 72 bp and optionally the 21 bp repeats
  • target antigen Immunogenic protein or peptide epitope, or combination of proteins and epitopes, against which an immune response can be mounted.
  • Target antigens may by derived from a pathogen for infectious disease applications, or derived from a host organism for applications such as cancer, allergy, or autoimmune diseases.
  • Target antigens are well defined in the art. Some examples are disclosed in Williams, Supra, 2008 and are included herein by reference TE buffer: A solution containing approximately lOmM Tris pH 8 and 1 mM EDTA
  • Transcription terminator Bacterial: A DNA sequence that marks the end of a gene or operon for transcription. This may be an intrinsic transcription terminator or a Rho-dependent transcriptional terminator. For an intrinsic terminator, such as the trpA terminator, a hairpin structure forms within the transcript that disrupts the mRNA-DNA-RNA polymerase ternary complex. Alternatively, Rho- dependent transcriptional terminators require Rho factor, an RNA helicase protein complex, to disrupt the nascent mRNA-DNA-RNA polymerase ternary complex.
  • Eukarvotic PolyA sites are not 'terminators', instead internal cleavage at PolyA sites leaves an uncapped 5'end on the 3'UTR RNA for nuclease digestion. Nuclease catches up to RNA Pol ⁇ and causes termination. Termination can be promoted within a short region of the poly A site by introduction of RNA Pol ⁇ pause sites
  • RNA Pol II eukaryotic transcription terminator
  • C2x4 terminator Ashfield R, Patel AJ, Bossone SA, Brown H, Campbell RD, Marcu KB, Proudfoot NJ. 1994. EMBO J 13:5656
  • gastrin terminator Sato K, Ito R, Baek KH, Agarwal K, 1986. Mol. Cell. Biol. 6: 1032.
  • Terminator element may stabilize mRNA by enhancing proper 3'-end processing of mRNA (Kim D, Kim JD, Baek K, Yoon Y, Yoon J. 2003. Biotechnol Prog 19:1620)
  • Transgene Target antigen or protein or RNA gene that is cloned into a vector
  • UTR Untranslated region of a mRNA (5' or 3' to the coding region)
  • VARNA Adenoviral virus associated RNA, including VARNAI (VAI or VA1) and or VARNAII (VAII or VA2) from any Adenovirus serotype, for example, serotype 2, serotype 5 or hybrids thereof
  • VARNAI Adenoviral virus associated RNAI, also referred to as VAI, or VAI , from any Adenovirus serotype, for example, serotype 2, serotype 5 or hybrids thereof
  • a gene delivery vehicle including viral (e.g. alphavirus, poxvirus, lentivirus, retrovirus, adenovirus, adenovirus related virus, etc) and nonviral (e.g. plasmid, midge, transcriptionally active PCR fragment, minicircles, bacteriophage, etc) vectors.
  • viral e.g. alphavirus, poxvirus, lentivirus, retrovirus, adenovirus, adenovirus related virus, etc
  • nonviral e.g. plasmid, midge, transcriptionally active PCR fragment, minicircles, bacteriophage, etc
  • Vector backbone Eukaryotic region and bacterial region of a vector, without the transgene or target antigen coding region
  • the invention relates generally to plasmid DNA compositions and methods to improve plasmid expression and plasmid production.
  • the invention can be practiced to improve
  • vectors such as eukaryotic expression plasmids usefiil for gene therapy, genetic immunization and or interferon therapy.
  • the invention can be practiced to improve the copy number of vectors such as eukaryotic expression plasmids useful for gene therapy, genetic immunization and or interferon therapy. It is to be understood that all references cited herein are incorporated by reference in their entirety.
  • the present invention provides for method of increasing in vivo expression of transgene from covalently closed super-coiled plasmid DNA, which comprises modifying the plasmid DNA to replace the pMB 1 , ColEl or pBR322 derived replication origin and selectable marker with a replication origin selected from the group consisting of an P min minimal pUC replication origin, ColE2-P9 replication origin, ColE2 related replication origin, and R6 replication origin and a RNA selectable marker; transforming the modified plasmid DNA into a Rep protein producing bacterial cell line rendered competent for transformation; and isolating the resultant transformed bacterial cells.
  • the modified plasmid produced from these cells has increased transgene expression in the target organism.
  • the spacer region encoded pMBl, ColEl or pBR322 derived replication origin is replaced with a CpG free ColE2 origin.
  • a primosome assembly site is incorporated into a ColE2 plasmid DNA backbone to improve plasmid copy number.
  • the pMBl, ColEl or pBR322 derived replication origin is replaced with a CpG free R6K origin.
  • Increased expression vectors may find application to improve the magnitude of DNA vaccination mediated antigen reactive B or T cell responses for preventative or therapeutic vaccination, increase RNA and or protein transgene levels to improve gene replacement therapy or gene knockdown therapy, increase plasmid based expression levels of DNA vector expressed therapeutic antibodies that neutralize infectious diseases such as influenza, HIV, malaria, hepatitis C virus, tuberculosis, etc.
  • Plasmid encoded transgene expression in the target organism is preferably increased by employing specific constructs or compositions incorporated in a vector.
  • the present invention provides a composition for construction of a vector, comprising a ColE2 origin with at least 90% sequence identity to the sequences set forth as SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and a RNA selectable marker and a eukaryotic region, wherein the ColE2 origin is operably linked to the RNA selectable marker and eukaryotic region. It has been surprisingly found that this ColE2 origin-RNA selectable marker improves plasmid encoded transgene expression in the target organism.
  • the resultant vector of the invention has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 8, SEQ ID NO: 9.
  • the present invention provides a composition for construction of a vector, comprising an R6K origin with at least 90% sequence identity to the sequences set forth as SEQ ID NO: 1, SEQ ID NO: 22, and a RNA selectable marker and a eukaryotic region, wherein the R6K origin is operably linked to the RNA selectable marker and eukaryotic region. It has been surprisingly found that this R6K origin-RNA selectable marker improves plasmid encoded transgene expression in the target organism.
  • the resultant vector of the invention has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41.
  • sequence identity refers to the degree of identity between any given query sequence, e.g., SEQ ID NO: 2, and a subject sequence.
  • a subject sequence may, for example, have at least 90 percent, at least 95 percent, or at least 99 percent sequence identity to a given query sequence.
  • a query sequence e.g., a nucleic acid sequence
  • ClustalW version 1.83, default parameters
  • the sequence alignment program calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities, and differences can be determined. Gaps of one or more nucleotides can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments. For fast pair-wise alignments of nucleic acid sequences, suitable default parameters can be selected that are appropriate for the particular alignment program.
  • the output is a sequence alignment that reflects the relationship between sequences.
  • the sequences are aligned using the alignment program, the number of identical matches in the alignment is divided by the length of the query sequence, and the result is multiplied by 100. It is noted that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and
  • 78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2.
  • the present invention provides methods and compositions for production of a Rep protein dependent plasmid vector.
  • Production cell lines providing improved heat inducible P L promoter expression of a Rep protein integrated into the genome and expressed from the heat inducible P L promoter incorporating the OL1-G deletion (SEQ ID NO: 11), or the heat inducible P L promoter incorporating the OL1-G to T subsitution (SEQ ID NO: 12). It has been surprisingly found that these promoter modifications improves Rep protein dependent plasmid vector copy number in shake flask and fermentation cultures.
  • FIG. 1. shows an annotated map of the antibiotic free
  • NTC8685 pUC origin expression vector with the locations of the pUC origin, PAS-BH primosomal assembly site, SV40 enhancer and other key elements indicated.
  • the replication origin (PAS-BH and pUC origin) is from the Agel (230) site to the Dram (1548) site (1318 bp total).
  • the antibiotic free RNA-OUT selection marker is between the Dralll (1548) and Kpnl (1695) sites (147 bp total).
  • the spacer region encoded bacterial region (replication and selection) of this vector is 1465 bp.
  • FIG. 2 shows an annotated map of the antibiotic-free NTC9685C ColE2 origin expression vector with the locations of the primosomal assembly site, ColE2 Replication origin (Replication origin) and other key elements indicated.
  • the spacer region encoded bacterial region (replication and selection) of this vector is 281 bp [Nhel site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site] (SEQ ID NO:20).
  • FIG. 3 shows an annotated map of the antibiotic-free NTC9685R R6K origin expression vector with the locations of the primosomal assembly site, R6K Replication origin (R6K mini-origin) and other key elements indicated.
  • the spacer region encoded bacterial region (replication and selection) of this vector is 466 bp [Nhel site-trpA terminator-R6K Origin-RNA-OUT-Kpnl site] (SEQ ID NO: 19).
  • FIG. 4 shows an annotated map of the antibiotic-free NTC9385C ColE2 origin expression vector with the locations of the primosomal assembly site, ColE2 Replication origin (Replication origin) and other key elements indicated.
  • the spacer region encoded bacterial region (replication and selection) of this vector is 281 bp [Nhel site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site] (SEQ ID NO:20).
  • This vector differs from NTC9685C in that the VA1 RNA and SV40 enhancer are not present.
  • FIG. 5 shows an annotated map of the antibiotic- free NTC9385R R6K origin expression vector with the locations of the primosomal assembly site, R6K Replication origin (R6K mini-origin) and other key elements indicated.
  • the spacer region encoded bacterial region (replication and selection) of this vector is 466 bp [Nhel site-trpA terminator-R6K Origin-RNA-OUT-Kpnl site] (SEQ ID NO:19).
  • This vector differs from NTC9685R in that the VA1 RNA and SV40 enhancer are not present.
  • FIG. 6 shows an annotated map of the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector; key features such as the cI857 ts repressor, P L promoter, R6K Rep protein, HK022 phage attachment site for site specific integration into the E. coli genome, R6K replication origin and spectinomycin/streptomycin resistance marker (SpecR StrepR) are shown.
  • FIG. 7 show an annotated sequence of the P L promoter with locations of the P L promoter OL1 , OL2 and OL3 repressor binding sites, -10 and -35 promoter elements for P L 1 and P L 2 promoters.
  • the OL1 mutations OL1-G and OL1-G to T alterations are shown.
  • FIG. 8 shows an annotated map of the pINT pR pL ColE2 Rep protein integration vector; key features such as the cI857 ts repressor, P L promoter, ColE2 Rep protein, HK022 phage attachment site for site specific integration into the E, coli genome, R6K replication origin and
  • FIG. 9 shows Nanoplasmid expression in vitro after lipofectamine transfection of HEK293 cell line of various EGFP transgene encoding vectors.
  • FIG. 10 shows Nanoplasmid expression in vivo after intramuscular injection with EP of various muSEAP transgene encoding vectors.
  • FIG. 11 shows a ColE2 origin Nanoplasmid shRNA expression vector.
  • a 22 bp shRNA is expressed from the RNA Polymerase ⁇ HI promoter, with a TTTTTT terminator.
  • the bacterial region is the NTC9385C and NTC9685C Bacterial region (SEQ ID NO:20).
  • FIG. 12 shows an IncB RNAI based RNA selection marker.
  • the invention also relates to compositions and methods for producing high expression level plasmids.
  • the present invention provides sequences that, when introduced into a vector backbone, increase plasmid expression.
  • ColE2 replication origin-RNA selection marker or R6K replication origin -RNA selection marker can be utilized as a plasmid expression enhancer.
  • plasmid expression is increased by replacement of the pMB 1 , ColEl or pBR322 derived origin-selection marker bacterial region with an R6K origin-RNA selection marker in the plasmid backbone.
  • the R6K origin is CpG free.
  • the R6K origin is included with an RNA-OUT selection marker.
  • the R6K origin is included with an pMBl RNAI selection marker.
  • the R6K origin is included with an IncB RNAI selection marker.
  • plasmid expression is increased by replacement of the pMBl, ColEl or BR322 derived origin-selection marker bacterial region with a ColE2 origin-RNA selection marker in the plasmid backbone.
  • the ColE2 origin is CpG free.
  • the ColE2 origin is included with an RNA-OUT selection marker.
  • the ColE2 origin is included with an pMBl RNAI selection marker.
  • the ColE2 origin is included with an IncB RNAI selection marker.
  • the ColE2 origin is included with a primosome assembly site.
  • plasmid expression is increased by replacement of the pMB 1 , ColEl or pBR322 derived origin-selection marker with a P min minimal pUC, ColE2 or a R6K origin in the plasmid backbone spacer region and an RNA selection marker in an intron.
  • the R6 or ColE2 origin is CpG free.
  • the RNA selection marker is the RNA-OUT selection marker.
  • the RNA selection marker is the pMBl RNAI selection marker.
  • the RNA selection marker is the IncB RNAI selection marker.
  • Example 1 Heat inducible R6K replication origin plasmid production
  • Fermentation Fermentations were performed using proprietary fed-batch media (NTC3019, HyperGRO media) in New Brunswick BioFlo 110 bioreactors as described (Carnes and Williams, Supra, 2011). The seed cultures were started from glycerol stocks or colonies and streaked onto LB medium agar plates containing 6% sucrose. The plates were grown at 30-32°C; cells were resuspended in media, and used to provide approximately 0.1% inoculums for the fermentations that contained 0.5% sucrose to select for RNA-OUT plasmids.
  • RNA-OUT plasmid fermentations were performed in E. coli strain XLlBlue [recAJ endAl gyrA96 thi-1 hsdRl 7 supE44 relAl lac [F' proAB ladqZAMJ5 Tn70 (Tef)] (Stratagene, La JoUa, CA)] or GT115 [F- mcrA A(mrr-hsdRMS-mcrBC) (p801acZAM15 AlacX74 recAl rspL (StrA) endAl Adcm uidA(AMluI)::pir-l 16 AsbcC-sbcD (Invivogen, San Diego)] strains containing chromosomally integrated pCAH63-CAT RNA-IN-SacB (P5/6 6/6) at the phage lambda integration site as disclosed in Williams, JA Supra, 2008. SacB ⁇ Bacillus subtilis levans
  • SacB from the RNA-IN-SacB transcript is inhibited by plasmid encoded RNA-OUT. This facilitates plasmid selection in the presence of sucrose, by inhibition of SacB mediated lethality.
  • Plasmid yield was determined by quantification of plasmid obtained from Qiagen Spin Miniprep Kit preparations as described (Carnes and Williams, Supra, 2011). Briefly, cells were alkaline lysed, clarified, plasmid was column purified, and eluted prior to quantification. Agarose gel electrophoresis analysis (AGE) was performed on 0.8-1% Tris/acetate/EDTA (TAE) gels as described in Carnes and Williams J A, Supra, 2011.
  • AGE Agarose gel electrophoresis analysis
  • R6K background The R6K gamma plasmid replication origin requires a single plasmid replication protein n that binds as a monomer to multiple repeated 'iteron' sites (seven core repeats containing TGAGNG consensus) and as a dimer to repressive sites [TGAGNG (dimer repress) as well as to iterons with reduced affinity].
  • Various host factors are used including IHF, DnaA, and primosomal assembly proteins DnaB, DnaC, DnaG (Abhyankar et al 2003 J Biol Chem 278:45476-45484).
  • the R6K core origin contains binding sites for DnaA and IHF that affect plasmid replication (n, IHF and DnaA interact to initiate replication).
  • R6 gamma replication origin Different versions of the R6 gamma replication origin have been utilized in various eukaryotic expression vectors, for example pCOR vectors (Soubrier et al 1999, Gene Therapy 6:l482) and a CpG free version in pCpGfree vectors (Invivogen, San Diego CA), and pGMl 69 (University of Oxford). Incorporation of the R6K replication origin does not improve expression levels compared to an optimized pUC origin vector (Soubrier et al Supra, 1999). However, use of a conditional replication origin such as R6K gamma that requires a specialized cell line for propagation adds a safety margin since the vector will not replicate if transferred to a patients endogenous flora.
  • conditional replication origin such as R6K gamma that requires a specialized cell line for propagation adds a safety margin since the vector will not replicate if transferred to a patients endogenous flora.
  • R6K gamma derived replication origin that contains core sequences required for replication (including the DnaA box and stb 1-3 sites; Wu et al, 1995. J Bacteriol. 177: 6338- 6345), but with the upstream ⁇ dimer repressor binding sites and downstream ⁇ promoter deleted (by removing one copy of the iterons, as with pCpG; see map below) was designed (SEQ ID NO: 1 ) and NTC9685R and NTC9385R expression vectors incorporating it constructed (see Example 3).
  • Typical R6K production strains incorporate the ⁇ protein derivative PIR116 that contains a P106L substitution that increases copy number (by reducing ⁇ dimerization; ⁇ monomers activate while ⁇ dimers repress). Fermentation results with pCOR (Soubrier et al., Supra, 1999) and pCpG plasmids (Hebel HL, Cai Y, Davies LA, Hyde SC, Pringle IA, Gill DR. 2008. Mol Ther 16: SI 10) were low ; around 100 mg/L in PIR116 cell lines.
  • the TEX2pir42 strain contains a combination of P106L and P42L.
  • the P42L mutation interferes with DNA looping replication repression.
  • the TEX2pir42 cell line improved copy number and fermentation yields with pCOR plasmids with reported yields of 205 mg/L (Soubrier F. 2004. World Patent Application WO2004033664). Methods to improve R6K origin yields are needed.
  • Two cell lines using the endogenous ⁇ gene P3 promoter to express ⁇ mutants 'P42L and PI 13S' (SEQ ID NO:13) (NTC640722 cell line) and 'P42L, P106L and F107S' (SEQ ID NO:14) were constructed and tested for copy number improvement with NTC9685R-EGFP.
  • Two additional cell lines using the P L promoter in addition to the endogenous ⁇ gene P3 promoter to express ⁇ mutants 'P42L and PI 13S' (NTC641981 cell line) and 'P42L, P106L and F107S' (NTC641053 cell line) were made and tested for copy number improvement with NTC9685R-EGFP.
  • R6 production cell lines were made in XLl-Blue SacB (XLl-Blue atU:P5/6 6/6-RNAIN-5ac5, CmR).
  • R6K replication proteins ⁇ were cloned into the pINT pR pL integration vectors as described in Luke et al Supra, 2011 and included herein by reference.
  • Constructed R6K Rep protein vectors were integrated into the genome at the HK022 phage attachment site as described in Luke et al, Supra, 2011. Briefly the pINT pINT pR pL R6 Rep vectors were amplified by PCR to delete the R6K replication origin, ligated to form a circle, and integrated into the HK022 attachment site using the pAH69 helper plasmid as described.
  • NTC54208 XLlBhie, SacB, dcm-
  • NTC641053 NTC5402-pR pL P42L-P 106L-F107S 1 1
  • NTC641981 NTC5402-pR pL P42L-P 113S b
  • NTC661135 NTC54208-pR pL P42L-P 106L-F107S (P3-)
  • NTC661135-MUT NTC54208-pR pL (OLl-G) P42L-P 106L-F107S (P3-)
  • NTC661134 NTC5402-pR pL P42L-P113S (P3-)
  • NTC711055 NTC54208-pR pL (OLl-G) P42L-P 106L-F107S (P3-)
  • NTC711231 NTC54208-pR pL (OLl-G to T) P42L-P 106L-F107S (P3-) Heat inducible versions were then made by deletion of the P3 promoter to determine if P L promoter mediated replication protein induction in a temperature shift improved R6K plasmid production yields and quality by reduction of plasmid copy number and metabolic burden during the reduced temperature growth phase.
  • SEQ ID NO: 17 constructed as described above dramatically reduced copy number during the reduced temperature growth phase with copy number induction after temperature upshift (Table 1; RF351). However, the yield (128 mg L) was overall lower than with the P3 promoter (567, 558 mg/L).
  • NTC661135-MUT contains a mutation in the OL1 lambda repressor binding site in the P L promoter (FIG. 7; OLl-G this is a single base deletion that also reduces the distance between the P L 1 promoter -35 and -10 boxes from optimal 17 bp to 16 bp).
  • This mutation was introduced into the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector by PCR mutagenesis and a sequence verified clone incorporating the OLl-G mutation integrated into the genome (NTC71 1055) as described above. Fermentation evaluation of this cell line with the NTC9685R-EGFP plasmid (Table 1; RF358) demonstrated similar dramatic 6 fold heat inducible plasmid copy number induction, resulting in excellent final plasmid yields of 690 mg/L. Repressor binding to OL1 is altered by mutations in OL1 , such as OLl-G (FIG.
  • V2 V2 (OLl-G to T; FIG. 7; SEQ ID NO: 12; this is a G to T substitution that maintains the distance between the P L promoter -35 and -10 boxes at the optimal 17 bp; this is the V2 mutation described by Bailone and Galibert, Supra, 1980).
  • the OLl-G to T (V2) mutation was introduced into the ⁇ pR pL R6 Rep pi P42L-P106L-F107S (P3-) integration vector by PCR mutagenesis and a sequence verified clone incorporating the OLl-G mutation integrated into the genome as described above to create NTC711231.
  • the pENT pR pL R6K Rep plasmids can be integrated into alternative E. coli strains to create production hosts. Any strain that is acceptable for plasmid production, such as JM108, BL21 , DH5, DH1, DH5a, GT1 15, GT1 16, DH10B, EC 100, can be converted to a high yield temperature inducible R6K plasmid production host by integration of a ⁇ pR pL R6K Rep plasmid into the genome.
  • the pR pL R6K Rep expression cassette may alternatively be removed from the pENT vector backbone and directly integrated into the chromosome, for example, using Red Gam recombination cloning (for example, using the methods described in Datsenko and Wanner 2000 Proc Natl Acad Sci USA
  • the pR pL R6K Rep expression cassette may alternatively be transferred to a different vector backbone, such as integration vectors that target different phage attachment sites, for example, those described by Haldimann and Wanner 2001, J Bacteriol 183:6384-6393.
  • OL1-G and OL1-G to T The application of two independent OL1 mutations (OL1-G and OL1-G to T) to create cell lines for high yield R6K plasmid production demonstrates the general utility of P L promoters incorporating OL1 mutations to improve heat inducible chromosomal expression of a target protein.
  • Any OL1 mutation is contemplated for use in the current invention.
  • New OL1 mutations can be defined by standard methods known in the art, for example error prone mutagenesis of the OL1 region, with subsequent selection of beneficial OL1 mutations by screening for heat inducible target protein production.
  • the target protein can be a Rep protein as described herein, or a fluorescent marker, or any target protein or RNA.
  • P L promoters incorporating OL1 mutations is contemplated generally as a platform for improved heat inducible chromosomal expression of any recombinant protein or RNA. This can be applied to improve heat inducible chromosomal expression of any recombinant protein or RNA using either shake flask (Table 2) or fermentation (Table 1) culture.
  • These cell lines may also be used to produce alternative R6K plasmids, such as CpGfree vectors, pCOR vectors, pGM169, etc.
  • P L promoter vectors with the OL1 mutations may be used to improve expression of alternative target proteins or mRNAs from the genome.
  • Rep protein dependent plasmids such as ColE2-P9 replication origin plasmids (Examples 2 and 3), ColE2 related replication origin plasmids, etc.
  • Numerous additional Rep protein dependent plasmids known in the art may also be produced using the cell lines of the invention. Many Rep protein dependent plasmids are described in del Solar et al Supra, 1998 which is included herein by reference.
  • Heat inducible target protein production may be further improved, by further mutating OL1-G and OL1-G to T or an alternative OL1 mutation to incorporate a mutation in the P L -10 GATACT sequence to make it more closely match the consensus TATAAT (-35 is already consensus TTGACA (FIG. 7).
  • ts lambda repressors may be substituted for the cITs857 mutation utilized in the pINT vectors.
  • Multiple alternative ts lambda repressors have been defined (for example, see Lieb M. 1979 J Virol 32:162 included herein by reference) or new ts lambda repressors may be isolated by screening for temperature sensitive cl function.
  • Alternative integration methods rather than the described pINT pR pL integration vectors may be utilized such as integration of the pR pL expression cassette into the genome at defined sites using Red Gam recombination cloning (for example, using the methods described in Datsenko and Wanner Supra, 2000).
  • Example 2 ColE2-P9 replication origin plasmid production
  • ColE2 replication origin Similar to plasmid R6K, the ColE2 replication origin is separate from the replication protein, so the ColE2 replication origin theoretically may be utilized to construct Rep protein dependent plasmids.
  • ColE2 replication origin using ColE2-P9 as an example, to produce ColE2 Rep protein dependent plasmids is demonstrated (Example 3).
  • ColE2 background The ColE2 replication origin (for example, ColE2-P9) is highly conserved across the ColE2-related plasmid family (15 members are compared in Hiraga et al Supra, 1994, and 53 ColE2 related plasmid members including ColE3 are compared in Yagura et al Supra, 2006, both references are included herein by reference). Plasmids containing this origin are normally 10 copies/cell (low copy #). For application in gene therapy or DNA vaccination vectors, the copy number of ColE2 replication origin vectors needs to be improved dramatically.
  • RNAI antisense RNA
  • the Rep internal RNAI -35 box (Yasueda et al 1994 Mol Gen Genet 244:41 - 48) was mutagenized (from (opposite strand) TTGAAG to CTGAAG) to lower the consensus.
  • a high copy mutation in the Rep coding region (C139T; Nagase et al 2008 Plasmid 59:36-44) was also incorporated.
  • the ColE2 Rep gene was PCR amplified from CGSC Strain # 8203 with following primers
  • the 920 bp PCR product was digested with BamHI EcoRI and cloned into BamHI EcoRI digested pINT pR pL BamHI/EcoRI (3766, polylinker). Recombinant clones were selected by restriction digestion and sequence verified. The map of the resultant pINT pR pL CoE2 Rep integration vector is shown in FIG. 8.
  • the integration plasmid was integrated into NTC54208 (XLlBlue-sacB [dcm-]) to create cell line NTC641711 as described in Example 1.
  • a kanR ColE2-P9 replication origin fluorescent reporter plasmid (pDNAVACCUltra5-C2-P5/6,4/6- T7RBS EGFP) was constructed to select for copy number improving mutations.
  • the 1067 bp pUC replication origin was removed from the kanR pDNAVACCUltra5 -P5/6,4/6-T7RBS EGFP vector (the pDNAV ACCUltra5 -EGFP vector disclosed in Williams JA, 2006 World patent application WO06078979, modified to express the EGFP reporter in E. coli utilizing the weak constitutive P5/6,4/6 promoter disclosed in Lissemore JL, Jankowski JT, Thomas CB, Mascotti DP, deHaseth PL.
  • R6K Rep protein mutations such as P106L (PIR116) utilized in Example 1 that interfere with dimer formation dramatically increase copy number (Abhyankar et al Supra, 2004). It was hypothesized that ColE2 plasmid copy number can also be increased with a dimerization deficient Rep mutation.
  • This EGFP reporter plasmid allows 1 ) visual selection of plasmid copy number improvement using a Dark Reader for agar plate illumination; and 2) quantitative copy number evaluation (fluorescence is linear with copy number) in liquid culture using a fluorometer (BioTek FLx800 microplate fluorescence reader).
  • the lambda repressor- P L -ColE2 Rep regions from genomic DNA from these two cell lines were amplified by PCR and sequenced to determine the basis for improvement.
  • One colony had a mutation in the lambda repressor which presumably reduces the activity of the repressor leading to Rep protein overexpression. This demonstrates that alternations to the vector backbone that increase P L promoter activity improve ColE2 plasmid copy number.
  • ColE2 copy number like R6K plasmids, will be improved by making a cell line with the ColE2 Rep protein (or Rep protein copy number improving mutations) expressed from pINT pR pL vectors incorporating the lambda repressor binding site OL1 mutations (OL1-G and OL1-G to T) identified in Example 1.
  • the second colony had a mutation in the Rep protein (G194D; SEQ ID NO:16). This mutation was introduced back into the pINT pR pL ColE2 Rep vector to create the pINT pR pL ColE2 Rep protein mutant (G194D) (SEQ ID NO: 18).
  • the integration plasmid was integrated into NTC54208 (XLlBlue- sacB [dcm-]) to create cell line NTC701131 as described in Example 1.
  • ColE2 plasmid production yields were improved in the ColE2 Rep protein mutant cell line NTC701131, compared to the parental ColE2 Rep protein cell line NTC641711 in both shake flask and fermentation culture (Table 3).
  • ColE2 Rep protein like the R6K Rep protein, can be mutagenized to create copy number improving variants.
  • Table 3 NTC9385C-Luc plasmid performance in different processes and production cell lines 9
  • ColE2 origin vectors The following vectors containing the minimal ColE2-P9 origin (Y agura and Itoh 2006 Biochem Biophys Res Commun 345:872-877) and various origin region modifications were constructed.
  • -f7-ssiA This combines the ColE2 origin (+7) (SEQ ID NO:4) with ssiA from plasmid R6K (SEQ ID NO:21).
  • ssiA vectors contain, in addition to the ColE2-P9 origin, a downstream primosome assembly site.
  • the ColE2 origin contains a primosomal assembly site about 100 bp downstream of the origin (Nomura et al Supra, 1991). This site primes lagging strand DNA replication (Masai et al 1990 J Biol Chem 265:15124-15133) which may improve plasmid copy number or plasmid quality.
  • a CpG free PAS (ssiA from R6K; Nomura et al Supra, 1991 ; SEQ ID NO:21) that acts as a dnaA, dnaB dnaC (ABC) primosome on a dnaA box hairpin sequence (Masai et al 1990 J Biol Chem 265:15134-15144) was selected for inclusion in the +7-ssiA vectors.
  • +7 (no ssiA) This deletes the ssiA sequence from +7-ssiA while retaining the ColE2 origin (+7) (SEQ ID NO:4).
  • the ssiA sequence was removed by Nhel-Mfel digestion, the sites blunted with Klenow and the vector religated to delete the 64 bp ssiA region. Plasmids were transformed into ColE2 plasmid production host NTC64171 1. The correct ColE2 vector was identified by restriction digestion and sequence verified.
  • +7 CpG-ssiA This combines the ColE2 replication origin (+7 CpG) (SEQ ID NO:5) with ssiA from plasmid R6K (SEQ ID NO:21).
  • the single CpG in the ColE2 replication origin (Table 4) was removed from the vector by site directed mutagenesis. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
  • + 16-ssiA This combines the ColE2 replication origin (+16) (SEQ ID NO: 7) with ssiA from plasmid R6K (SEQ ID NO:21).
  • a 16 bp region of homology downstream of the ColE2-P9 replication origin is conserved with the ColE3 replication origin. This 16 bp region was added to the vector by site directed mutagenesis. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
  • Min-ssiA This combines the ColE2 Min replication origin (SEQ ID NO:6) with ssiA from plasmid R6K (SEQ ID NO:21). This is the minimal 32 bp ColE2 sequence sufficient for replication defined by Yasueda et al 1989 Mol Gen Genet 215:209) (SEQ ID NO:28), extended by an additional 6 bp (Table 4). This vector was created by site directed mutagenesis of the +7-ssiA clone. Plasmids were transformed into ColE2 plasmid production host NTC64171 1. The correct ColE2 vector was identified by restriction digestion and sequence verified.
  • the series of plasmids were transformed into ColE2 plasmid production host NTC701 131 (Rep mutant).
  • the resultant cell lines were then used determine plasmid copy number and quality (Table 4).
  • Two different backbones were evaluated with the +7-ssiA and +16-ssiA ColE2 replication origins to determine the effect of plasmid sequence alterations.
  • CpG free ColE2 origins may be utilized to construct CpG free plasmid vectors, or to retrofit the replication origin in existing vectors with a CpG free alternative replication origin.
  • Combinations of a CpG free ColE2 or R6 replication origin with a CpG free RNA-OUT selection marker may be utilized to construct antibiotic free CpG free plasmid vectors, or to retrofit the selection marker- replication origin region in existing vectors with an antibiotic free-CpG free alternative selection marker- replication origin;
  • NTC9382C , NTC9385C (FIG. 4), NTC9382R , NTC9385R (FIG. 5) are versions without the SV40 enhancer or VARNAI sequences.
  • NTC9682C, NTC9682R, NTC9382C, and NTC9382R all express the secreted transgene product as TPA fusion proteins while NTC9685C, NTC9685R, NTC9385C, and NTC9385R all express the native transgene product from a vector encoded ATG start codon.
  • the remainder of the vector sequences is identical between the different vectors, with the exception that the two R vectors NTC9682R and NTC9382R (FIG. 3, FIG. 5) contain the trpA bacterial terminator, which is absent in the two C vectors NTC9682C and NTC9382C (FIG. 2, FIG. 4).
  • R6 gamma origin vector was constructed by swapping in the R6K gamma origin (SEQ ID NO:l) in a Notl-DralTI R6 origin synthetic gene for the corresponding Notl-Dralll pUC origin region in NTC8685.
  • the NTC9682R , NTC9685R NTC9382R , NTC9385R vectors were made by standard restriction digestion mediated fragment swaps.
  • the ColE2 origin vectors were constructed in a similar fashion, by swapping in the +7 ssiA ColE2 origin in a Nhel-Dralll synthetic gene for the corresponding Nhel-Dralll pUC origin region.
  • NTC9385C vectors were made by standard restriction digestion mediated fragment swaps.
  • the 466 bp Bacterial region [Nhel site-trpA terminator-R6K Origin-RNA-OUT-Kpnl site] for NTC9385R and NTC9685R is shown in SEQ ID NO: 19.
  • the 281 bp Bacterial region [Nhel site-ssiA-ColE2 Origin (+7)-RNA-OUT- pnI site] for NTC9385C and NTC9685C is shown in SEQ ID NO:20.
  • High fermentation yields in HyperGRO media are obtained with these vectors. For example 695 mg mL with NTC9685R-EGFP in R6K production cell line NTC711231 (Table 1) and 672 mg/L with NTC9385C-EGFP in ColE2 production cell line NTC710351.
  • the ATG start codon (double underlined) is immediately preceded by a unique Sail site.
  • the Sail site is an effective ozak sequence for translational initiation.
  • the Sail site is downstream in frame with the optimized TPA secretion sequence (SEQ ID NO:25).
  • the TPA ATG start codon is double underlined and the Sail site single underlined.
  • SEQ ID NO:25 TPA secretion sequence
  • genes are copied by PCR amplification from clones, cDNA, or genomic DNA using primers with Sail (5' end) and Bglll (3' end) sites.
  • genes are synthesized chemically to be compatible with the unique Sail I Bglll cloning sites in these vectors.
  • the start codon ATG may immediately follow the Sail site fGTCGACATGt since the Sail site is a high function ozak sequence.
  • one or two stop codons may be included after the open reading frame, prior to the BgHl site.
  • a PCR product or synthetic gene designed for NTC9385C, NTC9685C, NTC9385R, and NTC9685R is compatible with, and can also be cloned into, the NTC9382C, NTC9682C, NTC9382R, and NTC9682R vectors.
  • EGFP and muSEAP transgene versions NTC9385C, NTC9685C, NTC9385R, and NTC9685R were constructed by standard restriction fragment swaps.
  • the muSEAP gene is secreted using its endogenous secretion signal, while EGFP is cell associated. Expression levels in vitro were determined using EGFP, while expression levels in vivo were determined using muSEAP. Expression levels were compared to the NTC8685 parent vector, the gWIZ vector, and a minicircle comparator.
  • Adherent HEK293 human embryonic kidney
  • A549 human lung carcinoma
  • Cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA). Cell lines were propagated in Dulbecco's modified Eagle's medium/F12 containing 10% fetal bovine serum and split (0.25% trypsin-EDTA) using Invitrogen (Carlsbad, CA, USA) reagents and conventional methodologies. For transfections, cells were plated on 24-well tissue culture dishes, plasmids were transfected into cell lines using Lipofectamine 2000 following the manufacturer's instructions (Invitrogen).
  • Total cellular lysates for EGFP determination were prepared by resuspending cells in cell lysis buffer (BD Biosciences Pharmingen, San Diego, CA, USA), lysing cells by incubating for 30 min at 37°C, followed by a freeze-thaw cycle at -80 °C. Lysed cells were clarified by centrifugation and the supernatants assayed for EGFP by FLX800 microplate fluorescence reader (Bio-Tek, Winooski, VT, USA). The results are summarized in FIG. 9 and Table 6.
  • mice Groups of five mice were injected with plasmid DNA in an IACUC-approved study.
  • SEAP levels in serum were determined using the Phospha-light SEAP Reporter Gene Assay System from Applied Biosystems (Foster City.CA) according to the manufacturer's instructions. The results are summarized in FIG. 10 and Table 6.
  • NTC9385C, NTC9685C, NTC9385R, and NTC9685R vectors had similar expression to the parent NTC8685 vector in vitro, and higher expression than the gWIZ comparator (FIG. 9).
  • substitution of the R6 or ColE2 replication origin for the pUC origin was not detrimental for eukaryotic cell expression.
  • in vivo expression was dramatically improved compared to NTC8685 or gWIZ with the ColE2 and R6K origin vectors (FIG. 10).
  • the NTC9385C vector was unexpectedly improved 1.5 to 3.8x that of NTC8385 (Table 6) or NTC8685 (not shown) after IM delivery with EP.
  • NTC9385C or NTC9385R Minicircle equivalent to NTC9385C or NTC9385R, with Nhel-Kpnl region containing the replication origin and RNA-OUT selection marker (bacterial region) removed from NTC8385- muSEAP by Spel/Nhel digestion, gel purification of the eukaryotic region, in vitro ligation and supercoiling with DNA gyrase.
  • the Spel site is the same site used to truncate the CMV promoter to make NTC8685 and the NTC9385C-muSEAP vector so the minicircle eukaryotic region is the same as NTC9385C-muSEAP, the difference being the C2 and RNA-OUT region including the Kpnl site is deleted in the minicircle.
  • NA Not assayed This improved in vivo expression was not specific to the CMV promoter. Versions of
  • NTC8685-muSEAP and NTC9385C-muSEAP were constructed in which the murine creatine kinase (MCK) promoter (3 copies of the MCK Enhancer upstream of the MCK promoter and 50 bp of the MCK exon 1 leader sequence; Wang B, Li J, Fu FH, Chen C, Zhu X, Zhou L, Jiang X, Xiao X. 2008. Gene Ther 15:1489) was substituted for the CMV promoter. The swaps replaced the entire CMV enhancer CMV promoter-exon 1 leader (NTC8685: from a Xbal site immediately after the SV40 enhancer to a SacII site in the CMV derived exon 1 leader sequence FIG.
  • MCK murine creatine kinase
  • NTC9385C from the Kpnl site to a SacII site in the CMV derived exon 1 leader sequence FIG. 4) with the MCK enhancer, MCK promoter-exon 1 leader retaining the HTLV-I R portion of exon 1.
  • Purified plasmid DNA from the resultant vectors, NTC8685-MCK-muSEAP (4847 bp) and NTC9385C-MCK- muSEAP (3203 bp) was injected ⁇ into one anterior tibialis muscle of 8-10 week old BALB/c female mice (5 mice/group), 5 ⁇ g dose in 50 ⁇ -, followed by Ichor TriGrid electroporation as described in Table 6.
  • NTC9385C-MCK-muSEAP vector (98.4 ⁇ 55.8) had 4.5x higher average expression than NTC8685- muSEAP (22.0 ⁇ 10.9). All 5 NTC9385C-MCK-muSEAP injected mice had higher muSEAP levels than any of the NTC8685-muSEAP mice. This demonstrates that improved in vivo expression with the Nanoplasmid vectors of the invention is not specific to the CMV promoter.
  • Reduction of the vector spacer region size as described herein by replacement of the spacer region replication origin and selection marker with the R6K, ColE2 origin-RNA selection marker vectors of the invention will also increase the duration of in vivo expression since expression duration is improved with plasmid vectors in which the bacterial region is removed (minicircle) or replaced with a spacer region of up to at least 500 bp (Lu J, Zhang F, Xu S, Fire AZ, Kay MA. 2012. Mol Ther. 20:2111-9).
  • replicative minicircle vectors of the invention also have additional utility for applications requiring extended duration expression, such as: liver gene therapy using hydrodynamic delivery with transgenes such as a -1 antitrypsin (AAT) for AAT deficiency, Coagulation Factor VIII for Hemophilia A Therapy or Coagulation Factor ⁇ for Hemophilia B Therapy etc: lung gene therapy with transgenes such as Cystic fibrosis transmembrane conductance regulator (CFTR) for cystic fibrosis etc; muscle gene therapy with transgenes such as the GNE gene for Hereditary inclusion body myopathies (HIBM), or dystrophin or dystrophin minigenes for duchenne muscular dystrophy (DMD).
  • transgenes such as a -1 antitrypsin (AAT) for AAT deficiency, Coagulation Factor VIII for Hemophilia A Therapy or Coagulation Factor ⁇ for Hemophilia B Therapy etc
  • a minimal pUC origin vector was constructed with an 866 bp spacer region
  • NTC8385-Min contains P min minimal pUC origin-RNA-OUT.
  • These vectors were tested for expression in vitro (lipofectamine 2000 delivery) and in vivo after intradermal electroporation delivery.
  • the results demonstrated ColE2 and R6K origin vector dramatically improved in vivo expression after intradermal delivery compared to NTC8685.
  • the NTC9385C vector was unexpectedly improved 2.7 to 3.1x compared to NTC8685 while the NTC9385R vector was unexpectedly improved 5.3 to 6.3x that of NTC8685 (Table 7).
  • the 866 bp minimal pUC origin vector also improved expression to 1.4-1.9 x that of NTC8685.
  • NTC9385C and NTC9385R vectors are not limited to muscle tissue, and is observed also after intradermal delivery.
  • Inclusion of the C2x4 eukaryotic transcription terminator in the NTC9385C vector further improved in vivo expression to 2.9 to 4.1x compared to NTC8685.
  • This demonstrates improved in vivo expression with Nanoplasmid vectors may be obtained with alternative/additional sequences flanking the bacterial region.
  • the resultant PCR product (a single band) was determined by sequencing to be the correct spliced exonl-exon2 fragment. This demonstrated that intronic RNA-OUT is accurately removed by splicing and does not interfere with splicing accuracy.
  • NTC9385Ra-02-EGFP also demonstrated improved in vivo expression compared to NTC8685 (Table 7: 1.6-3.5 x). This demonstrates that Nanoplasmid vectors with improved expression of the current invention may encode the RNA selection marker in the intron rather than the spacer region. The improved expression level after intradermal delivery demonstrates the application of
  • Nanoplasmid vectors of the invention for cutaneous gene therapy applications for example, for wound healing, burns, diabetic foot ulcer, or critical limb ischemia therapies using growth factors such as hypoxia inducible factor, hypoxia inducible factor 1 a, keratinocyte growth factor, vascular endothelial growth factor (VEGF), fibroblast growth factor- 1 (FGF-1 , or acidic FGF), FGF-2 (also known as basic FGF), FGF-4, placental growth factor (P1GF), angiotensin-1 (Ang-1), hepatic growth factor (HGF), Developmentally Regulated Endothelial Locus (Del-1), stromal cell derived factor-1 (SDF-1), etc.
  • growth factors such as hypoxia inducible factor, hypoxia inducible factor 1 a, keratinocyte growth factor, vascular endothelial growth factor (VEGF), fibroblast growth factor- 1 (FGF-1 , or acidic FGF), FGF-2 (also known as basic FGF), FGF
  • FIG. 11 This vector contains the human HI RNA Pol III promoter, but an alternative promoter such as the murine U6 promoter can be substituted.
  • This example vector expresses a 22 bp shRNA target RNA, but alternative RNAs may be expressed, including shorter or longer shRNAs, microRNAs, aptamer RNAs, hairpin RNAs, etc.
  • This example vector is very small, with a monomer size of 442 bp. Small size is advantageous, since vectors ⁇ 1.2 kb are highly resistant to shear forces used with gene therapy delivery formulation (Catanese et al 2012. Gene Ther 19:94-100).
  • RNA Pol III Nanoplasmid vectors were made by standard restriction digestion mediated fragment swaps to combine either U6 or HI RNA Pol ⁇ promoter-target RNA-TTTTTT terminator (Eukaryotic region) with either the 466 bp Bacterial region [Nhel site-trpA terminator-R6K Origin- RNA-OUT- pnl site; SEQ ID NO: 19] for NTC9385R-U6 and NTC9385RE-U6 vectors (Table 8) or the 281 bp Bacterial region [Nhel site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site; SEQ ID NO:20] for NTC9385C-U6 and NTC9385CE-U6 vectors (Table 8). Versions were modified to express from the U6 promoter eRNA18, a single stranded RNA the expression of which can be quantified by
  • Nanoplasmid vectors for RNA Pol ⁇ expression have superior manufacturing simplicity and yield compared to shRNA expressing minicircle vectors (Zhao et al 2011. Gene Ther 18:220-224).
  • optimal manufacture of minicircle vectors yields only 5 mg of minicircle per liter culture (Kay MA, He CY, Chen ZY. 2010. Nat Biotechnol 28:1287-1289).
  • HI promoter version (with shRNA) is 442 bp (FIG. 11)
  • Nanoplasmid vectors encoding RNA-OUT in the intron both orientations of RNA- OUT SEQ ID NO:23 inserted into the unique Hpal site in the intron SEQ ID NO:30; NTC9385Ra-01 dual and NTC9385Ra-02 dual
  • RNA-OUT in either orientation in the intron
  • Table 9 similarly high levels of expression are obtained with NTC9385Ra-01 (SEQ ID NO:40) and NTC9385Ra-02 (SEQ ID NO:39) which have opposite orientations of intronic RNA-OUT marker and the R6K origin in the spacer region.
  • Nanoplasmid variants with the pMBl antisense RNA RNAI (SEQ ID NO:31) with promoter and terminator region (RNAI selectable marker: SEQ ID NO:32 flanked by DraIII- ⁇ restriction sites for cloning as described previously for RNA-OUT) substituted for RNA-OUT were constructed and tested for expression to determine if alternative selection markers may be utilized in place of RNA-OUT.
  • the results (Table 9) demonstrate alternative RNA selection markers may be substituted for RNA-OUT.
  • RNAI for RNA-OUT in the vector backbone (NTC9385Ra-RNAI-01) or in the intron in either orientation (NTC9385R-RNAI-01 and NTC9385R-RNAI-02) did not reduce expression relative to the corresponding RNA-OUT construct.
  • NTC9385R- RNAI-Ol-EGFP and NTC9385R-RNAI-02-EGFP were transfected into the A549 cell line and cytoplasmic RNA isolated from transfected HEK293 and A549 cells using the protein and RNA isolation system (PARIS kit, Ambion, Austin TX) and quantified by A 2 6o- Samples were DNase treated (DNA-free DNase; Ambion, Austin TX) prior to reverse transcription using the Agpath-ID One step RT-PCR kit (Ambion, Austin TX) with a EGFP transgene specific complementary strand primer.
  • PARIS kit protein and RNA isolation system
  • a 2 6o- Samples were DNase treated (DNA-free DNase; Ambion, Austin TX) prior to reverse transcription using the Agpath-ID One step RT-PCR kit (Ambion, Austin TX) with a EGFP transgene specific complementary strand primer.
  • Intron splicing was determined by PCR amplification of the reverse transcribed cytoplasmic RNA with the exon 1 and exon 2 specific primers. The resultant PCR product (a single band in each case) was determined by sequencing to be the correct spliced exonl-exon2 f agment. This demonstrated that, like intronic RNA-OUT, intronic RNAI in either orientation is accurately removed by splicing and does not interfere with splicing accuracy. This demonstrates that alternative RNA based selection markers could be substituted for RNA-OUT in the spacer region or the intron and that pMB 1 RNAI is a preferred RNA based selection marker.
  • RNAI transcription unit (SEQ ED NO: 32) may be substituted for the RNA-OUT selection marker (SEQ ID NO: 23) in any of the constructs described in Examples 1-6.
  • the 108 bp RNAI antisense repressor RNA (SEQ ID NO: 31) may be substituted for the 70 bp RNA-OUT antisense repressor RNA (SEQ ID NO: 24) retaining the flanking RNA-OUT transcription control sequences in any of the constructs described in Examples 1-6.
  • RNAI regulated vectors may be grown in RNAII-SacB regulated cell lines further expressing, as required, R6K, ColE2-P9, or ColE2 related rep protein.
  • RNAII-SacB regulated cell lines may be made replacing the RNA- ⁇ sequence in pCAH63-CAT RNA-IN- SacB (P5/6 6/6) with a RNAII target sequence as described in Williams, JA Supra, 2008 included herein by reference.
  • RNAI regulated vectors may be grown in any of the RNAII regulated chromosomal selection marker cell lines disclosed in Grabherr and, Pfaffenzeller Supra,. 2006; Cranenburgh Supra, 2009. These cell lines would be modified for expression, as required, of R6K, ColE2-P9, or ColE2 related rep protein.
  • RNA-OUT Another preferred RNA based selection marker, IncB plasmid RNAI (SEQ ID NO:33; SEQ ID NO:34), is shown in FIG. 12.
  • a cell line for antibiotic free sucrose selection of IncB RNAI expressing plasmid vectors is created by modification of the genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation disclosed in Williams, JA Supra, 2008 by replacement of the 68 bp RNA-IN regulator in a Pstl-Maml restriction fragment with a 362 bp Pstl-Maml IncB RNAII regulator (SEQ ID NO:35).
  • RNA-OUT may be substituted with one of the many RNA based selection markers know in the art. Table 9: High level expression is obtained with pMBl RNAI or RNA-OUT antisense RNA vectors
  • RNA-OUT selectable marker may be substituted with an alternative RNA-OUT sequence variant that functionally binds RNA-IN to repress expression, for example, a CpG free RNA-OUT (SEQ ID NO:36).
  • SEQ ID NO:37 A CpG free R6K-RNA-OUT bacterial region (SEQ ID NO:37) or CpG free ColE2-RNA-OUT bacterial region (SEQ ID NO: 38) may be utilized.
  • the RNA-OUT promoter and/or terminator could be substituted with an alternative promoter and/or terminator.
  • the ColE2-P9 or R6K replication origin may be substituted with a ColE2 related replication origin, and propagated in a strain expressing the ColE2 related replication origin replication protein.
  • the ColE2-P9 or R6K origin may be substituted with an origin from one of the numerous additional Rep protein dependent plasmids that are know in the art, for example the Rep protein dependent plasmids described in del Solar et al Supra, 1998 which is included herein by reference.
  • the vectors may encode a diversity of transgenes different from the examples provided herein, for example, antigen genes for a variety of pathogens, or therapeutic genes such as hypoxia inducible factor, keratinocyte growth factor, factor IX, factor VIII, etc, or RNA genes such as microRNAs or shRNA.
  • the eukaryotic region may express RNA from a RNA Pol III promoter as described herein. The orientation of the various vector-encoded elements may be changed relative to each other.
  • the vectors may optionally contain additional functionalities, such as nuclear localizing sequences, and/or immunostimulatory RNA elements as disclosed in Williams, Supra, 2008.
  • the vectors may include a boundary element between the bacterial region and the eukaryotic region, for example, the CMV promoter boundary element upstream of the CMV enhancer (or heterologous promoter enhancer) may be included in the vector design (e.g. NTC9385R-BE; SEQ ID NO: 41).
  • the vectors may include a eukaryotic transcriptional terminator between the bacterial region and the eukaryotic region, for example, the 4x C2 terminator or the gastrin terminator.
  • the vectors may utilize a diversity of RNA Pol ⁇ promoters different from the CMV promoter examples provided herein, for example, constitutive promoters such as the elongation factor 1 (EF1) promoter, the chicken ⁇ -actin promoter, the ⁇ -actin promoter from other species, the elongation factor- 1 a (EF1 a) promoter, the phosphoglycerokinase (PGK) promoter, the Rous sarcoma virus (RSV) promoter, the human serum albumin (SA) promoter, the a -1 antitrypsin (AAT) promoter, the thyroxine binding globulin (TBG) promoter, the cytochrome P450 2E1 (CYP2E1) promoter, etc.
  • constitutive promoters such as the elongation factor 1 (EF1) promoter, the chicken ⁇ -actin promoter, the ⁇ -actin promoter from other species, the elongation factor- 1 a (
  • the vectors may also utilize combination promoters such as the chicken ⁇ -actin/CMV enhancer (CAG) promoter, the human or murine CMV-derived enhancer elements combined with the elongation factor la (EFl a) promoters, CpG free versions of the human or murine CMV-derived enhancer elements combined with the elongation factor la (EFla) promoters, the albumin promoter combined with an a -fetoprotein MERE enhancer, etc, or the diversity of tissue specific or inducible promoters know in the art such as the muscle specific promoters muscle creatine kinase (MCK), and C5-12 described herein or the specific promoter apolipoprotein A-I (ApoAI).
  • CAG chicken ⁇ -actin/CMV enhancer
  • EFl a human or murine CMV-derived enhancer elements combined with the elongation factor la
  • EFla elongation factor la
  • the albumin promoter combined with an a -f

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to the production and use of covalently closed circular (ccc) recombinant plasmids, and more particularly to vector modifications that improve expression of said DNA molecules in the target organism.

Description

DNA PLASMIDS WITH IMPROVED EXPRESSION
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
This invention was supported in part with government support under Grant No.
R44GM080768, awarded by the National Institutes of Health. The government has certain rights in this invention.
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims priority to United States Provisional Patent Application Serial
Number 61/743,219, entitled "DNA Plasmids With Improved Expression" which was filed August 29, 2012, the entire contents of which are incorporated herein by reference.
FHCLD OF THE INVENTION
The present invention relates to a family of eukaryotic expression plasmids useful for gene therapy, obtaining improved genetic immunization, natural interferon production, and more particularly, for improving the expression of plasmid encoded antigens, therapeutic proteins and RNAs.
The present invention also relates to the production of covalently closed circular (ccc) recombinant DNA molecules such as plasmids, cosmids, bacterial artificial chromosomes (BACs), bacteriophages, viral vectors and hybrids thereof, and more particularly to strain modifications that improve production yield of said DNA molecules in fermentation culture.
Such recombinant DNA molecules are useful in biotechnology, transgenic organisms, gene therapy, therapeutic vaccination, agriculture and DNA vaccines.
BACKGROUND OF THE INVENTION
E. coli plasmids have long been an important source of recombinant DNA molecules used by researchers and by industry. Today, plasmid DNA is becoming increasingly important as the next generation of biotechnology products {e.g., gene medicines and DNA vaccines) make their way into clinical trials, and eventually into the pharmaceutical marketplace. Plasmid DNA vaccines may find application as preventive vaccines for viral, bacterial, or parasitic diseases; immunizing agents for the preparation of hyper immune globulin products; therapeutic vaccines for infectious diseases; or as cancer vaccines. Plasmids are also utilized in gene therapy or gene replacement applications, wherein the desired gene product is expressed from the plasmid after administration to the patient.
Therapeutic plasmids often contain a pMBl, ColEl or pBR322 derived replication origin.
Common high copy number derivatives have mutations affecting copy number regulation, such as ROP (Repressor of primer gene) deletion, with a second site mutation that increases copy number (e.g. pMBl pUC G to A point mutation, or ColEl pMMl). Higher temperature (42°C) can be employed to induce selective plasmid amplification with pUC and pMMl replication origins.
US Patent 7943377 (Carnes, AE and Williams, JA, 2011) disclose methods for fed-batch fermentation, in which plasmid-containing E. coli cells were grown at a reduced temperature during part of the fed-batch phase, during which growth rate was restricted, followed by a temperature upshift and continued growth at elevated temperature in order to accumulate plasmid; the temperature shift at restricted growth rate improved yield and purity of plasmid. Other fermentation processes for plasmid production are described in Carnes A.E. 2005 BioProcess Intl; 3:36-44, which is incorporated herein by reference in its entirety.
The art teaches that one of the limitations of application of plasmid therapies and plasmid vaccines is regulatory agency (e.g. Food and Drug Administration, EMEC) safety concerns regarding 1) plasmid transfer and replication in endogenous bacterial flora, or 2) plasmid encoded selection marker expression in human cells, or endogenous bacterial flora. Additionally, regulatory agency guidances recommend removal of all non essential sequences in a vector. Plasmids containing a pMB 1 , ColEl or pBR322 derived replication origin can replicate promiscuously in E. coli hosts. This presents a safety concern that a plasmid therapeutic gene or antigen will be transferred and replicated to a patient's endogenous flora. Ideally, a therapeutic or vaccine plasmid would be replication incompetent in endogenous E. coli strains. This requires replacement of the pMBl, ColEl or pBR322 derived replication origin with a conditional replication origin that requires a specialized cell line for propagation. As well, regulatory agencies such as the EMEA and FDA are concerned with utilization of antibiotic resistance or alternative protein markers in gene therapy and gene vaccine vectors, due to concerns that the gene (antibiotic resistance marker or protein marker) may be expressed in a patients cells. Ideally, plasmid therapies and plasmid vaccines would be 1) replication incompetent in endogenous E. coli strains, 2) would not encode a protein based selection marker and 3) be minimalized to eliminate all non essential sequences.
The art further teaches that one of the limitations of application of plasmid therapies and vaccines is that antigen expression is generally very low. Vector modifications that improve antigen expression (e.g. codon optimization of the gene, inclusion of an intron, use of the strong constitutive CMV or CAGG promoters versus weaker or cell line specific promoter) are highly correlative with improved in vivo expression and, where applicable, immune responses (reviewed in Manoj S, Babiuk LA, van Drunen Little-van den Hurk S. 2004 Crit Rev Clin Lab Sci 41 : 1-39). A hybrid CMV promoter (CMV R), which increased antigen expression, also improved cellular immune responses to HIV DNA vaccines in mice and nonhuman primates (Barouch DH, Yang ZY, Kong WP, Korioth- Schmitz B, Sumida SM, Truitt DM, Kishko MG, Arthur JC, Miura A, Mascola JR, Letvin NL, Nabel GJ. 2005 J Virol. 79: 8828-8834). A plasmid containing the woodchuck hepatitis virus posttranscriptional regulatory element (a 600 bp element that increases stability and extranuclear transport of RNA resulting in enhanced levels of mRNA for translation) enhanced antigen expression and protective immunity to influenza hemagglutinin (HA) in mice (Garg S, Oran AE, Hon H, Jacob J. 2004 J Immunol. 173: 550-558). These studies teach that improvement in expression beyond that of current CMV based vectors may generally improve immunogenicity and, in the case of gene therapeutics, efficacy.
SUMMARY OF THE INVENTION The present invention relates to a family of minimalized eukaryotic expression plasmids that are replication incompetent in endogenous flora and have dramatically improved in vivo expression. These vectors are useful for gene therapy, genetic immunization and or interferon therapy.
The present invention also relates generally to methods of increasing production yield of covalently closed super-coiled plasmid DNA.
Improved vectors that utilize novel replication origins that unexpectedly improve antigen expression are disclosed.
One object of the invention is to provide improved expression plasmid vectors. Yet another object of the invention is to provide methods for improving plasmid copy number.
According to one object of the invention, a method of increasing expression from an expression plasmid vector comprises modifying the plasmid DNA to replace the pMB 1 , ColE 1 or pBR322 derived replication origin and selectable marker with an alternative replication origin selected from the group consisting of an minimal pUC origin, a R6K gamma replication origin, a ColE2-P9 replication origin, and a ColE2-P9 related replication origin and an RNA selectable marker; transforming the modified plasmid DNA into a bacterial cell line rendered competent for transformation; and isolating the resultant transformed bacterial cells. The resultant plasmid surprisingly has higher in vivo expression levels than the parent pMB 1 , ColEl or pBR322 derived replication origin expression plasmid vector.
According to one object of the invention, a composition for construction of a eukaryotic expression vector comprises an R6K origin with at least 90% sequence identity to the sequence set forth as SEQ ID NO: 1 , and a RNA selectable marker, wherein said R6K origin is operably linked to said RNA selectable marker and a eukaryotic region. According to another object of the invention, said R6 origin-RNA selectable marker improves said vector expression in vivo compared to a corresponding vector containing a pMBl, ColEl orpBR322 derived replication origin. According to still another object of the invention, said vector has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO:41.
According to one object of the invention, a composition for construction of a eukaryotic expression vector comprises a ColE2-P9 origin with at least 90% sequence identity to the sequence set forth as SEQ ID NO: 4, 5, 6, or 7, and a a RNA selectable marker, wherein said ColE2-P9 origin- a RNA selectable marker is operably linked to a eukaryotic region. According to another object of the invention, said ColE2-P9 origin-RNA selectable marker improves said vector expression in vivo compared to a corresponding vector containing a pMB 1 , Co IE 1 or pBR322 derived replication origin. According to still another object of the invention, said vector has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 8, SEQ ID NO: 9. According to still another object of the invention, a primosomal assembly site (ssiA) is optionally incorporated into the vector adjacent to the ColE2-P9 origin.
According to another object of the invention, production cell lines are disclosed that improve plasmid yield in shake flask and or fermentation culture with said R6 gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication origin plasmid vectors of the current invention.
According to another object of the invention, production cell lines providing heat inducible induction of R6K gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication origin plasmid vectors for DNA production are disclosed. These cell lines contain one or more copies of the corresponding R6K gamma replication origin, ColE2-P9 replication origin, or ColE2-P9 related replication protein integrated into the genome and expressed from the group consisting of: the heat inducible PL promoter (SEQ ID NO: 10), the heat inducible PL promoter incorporating the OLl-G deletion (SEQ ID NO: 11), the heat inducible PL promoter incorporating the OLl-G to T subsitution (SEQ ID NO: 12).
According to another object of the invention, mutant R6 replication proteins that improve heat inducible induction of R6K gamma replication origin vectors are disclosed. These cell lines contain one or more copies of the mutant R6K gamma replication origin replication protein integrated into the genome and expressed from the group consisting of: the heat inducible PL promoter (SEQ ID NO: 10), the heat inducible PL promoter incorporating the OLl-G deletion (SEQ ID NO: 11), the heat inducible PL promoter incorporating the OLl-G to T subsitution (SEQ ID NO: 12). The mutant R6K gamma replication origin replication protein are selected from the group consisting of: P42L-P113S (SEQ ID NO: 13), P42L-P106L-F107S (SEQ ID NO: 14).
According to another object of the invention, a mutant ColE2-P9 replication protein that improve heat inducible induction of ColE2-P9 replication origin vectors is disclosed. These cell lines contain one or more copies of the mutant ColE2-P9 replication origin replication protein integrated into the genome and expressed from the group consisting of: the heat inducible PL promoter (SEQ ID NO: 10), the heat inducible PL promoter incorporating the OLl-G deletion (SEQ ID NO: 11), the heat inducible PL promoter incorporating the OLl-G to T subsitution (SEQ ID NO: 12). The mutant ColE2-P9 replication origin replication protein is ColE2-P9 Rep mut G194D (SEQ ID NO: 16). Further objects and advantages of the invention will become apparent from a consideration of the drawings and ensuing description.
BRIEF DESCRIPTION OF THE FIGURES
FIG. 1 depicts the NTC8685 pUC origin expression vector;
FIG. 2 depicts the NTC9685C ColE2 origin expression vector;
FIG. 3 depicts the NTC9685R R6K origin expression vector;
FIG. 4 depicts the NTC9385C ColE2 origin expression vector;
FIG. 5 depicts the NTC9385R R6K origin expression vector;
FIG. 6 depicts the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector;
FIG. 7 depicts the PL promoter with OL1 mutations OL1-G and OL1-G to T;
FIG. 8 depicts the pINT pR pL ColE2 Rep protein integration vector;
FIG. 9 shows Nanoplasmid expression in vitro after lipofectamine transfection of HEK293 cell line; FIG. 10 shows Nanoplasmid expression in vivo after intramuscular injection with EP;
FIG. 11 depicts a ColE2 origin Nanoplasmid shRNA expression vector; and
FIG. 12 depicts an IncB RNAI based RNA selectable marker.
Table 1: PL promoter with OL1 mutations OL1-G and OL1-G to T improve plasmid yields in HyperGRO fermentation
Table 2: NTC9385R-EGFP LB media shake flask production yields in R6K production strains Table 3: NTC9385C-Luc plasmid performance in different processes and production cell lines Table 4: ColE2 Origin EGFP vector production in NTC701131 ColE2 production cell line
Table 5: NTC9382C, NTC9385C, NTC9382R, NTC9385R, NTC9682C, NTC9685C, NTC9682R, and NTC9685R vectors
Table 6: gWIZ and NTC9385C Nanoplasmid expression compared to NTC8685
Table 7: SR vector expression in vitro and in vivo
Table 8: RNA Pol III Nanoplasmid vector expression
Table 9: High level expression is obtained with pMBl RNAI or RNA-OUT antisense RNA vectors
SEQ ID NO:l : R6K gamma Origin
SEQ ID NO:2: NTC9385R vector backbone
SEQ ID NO:3: NTC9685R vector backbone
SEQ ID NO:4: ColE2 Origin (+7)
SEQ ID NO:5 : ColE2 Origin (+7, CpG free)
SEQ ID NO:6: ColE2 Origin (Min)
SEQ ID NO:7: ColE2 Origin (+16) SEQ ID NO:8: NTC9385C vector backbone
SEQ ID NO:9: NTC9685C vector backbone
SEQ ID NO 10
SEQ ID NO 11
SEQ ID NO 12
SEQ ID NO 13
SEQ ID NO 14
SEQ ID NO 15
SEQ ID NO 16
SEQ ID NO 17
SEQ ID NO 18
SEQ ID NO 19
Origin-RNA-OUT- pnl site]
SEQ ID NO:20: NTC9385C and NTC9685C Bacterial region. [Nhel site-ssiA-ColE2 Origin (+7)- RNA-OUT-Kpnl site]
SEQ ID NO:21: NTC9385C and NTC9685C CpG free ssiA [from plasmid R6K]
SEQ ID NO:22: CpG free R6K origin
SEQ ID NO:23: RNA-OUT selectable marker from NTC9385C, NTC9685C, NTC9385R, and NTC9685R
SEQ ID NO:24: RNA-OUT Sense strand RNA from NTC9385C, NTC9685C, NTC9385R,
NTC9685R, and NTC9385Ra
SEQ ID NO:25: TPA secretion sequence
SEQ ID NO:26: PCR primer 15061101
SEQ ID NO:27: PCR primer 15061102
SEQ ID NO:28: ColE2 core replication origin
SEQ ID NO:29: +7(CpG free)-ssiA ColE2 origin
SEQ ID NO:30: HTLV- IR-Rabbit β globin hybrid intron
SEQ ID NO:31 : pMBl RNAI antisense repressor RNA (origin antisense partner of RNAII)
SEQ ID NO:32: pMBl RNAI selectable Marker, RNAI RNA (Sense strand)
SEQ ID NO:33: IncB RNAI antisense repressor RNA (IncB plasmid origin RNAII antisense partner) SEQ ID NO:34: IncB RNAI selectable Marker. DraHI-Kpnl restriction fragment
SEQ ID NO:35: IncB RNAII-SacB. Pstl-MamI restriction fragment
SEQ ID NO:36: CpG free RNA-OUT selection marker - flanked by Kpnl and Bglll- EcoRI sites SEQ ID NO:37: CpG free R6 gamma - RNA-OUT bacterial region (CpG free R6K origin-CpG free RNA-OUT selection marker)~flanked by EcoRI-SphI and Bglll-EcoRI sites
SEQ ID NO:38: CpG free ColE2 bacterial region (CpG free ssiA-CpG free ColE2 origin-CpG free RNA-OUT selection marker)- flanked by EcoRI-SphI and BgUI-EcoRI sites SEQ ID NO:39: NTC9385Ra-02 vector backbone
SEQ ID NO:40: NTC9385Ra-01 vector backbone
SEQ ID NO:41 : NTC9385R-BE vector backbone
SEQ ID NO:42: Pmin minimal pUC replication origin
SEQ ID NO:43: pUC (0.85) Bacterial region [Nhel site- trpA terminator-Pmin pUC replication origin (minimal)-RNA-OUT-Kpnl site]
Definition of Terms
A405: Absorbance at 405 nanometers
AF: Antibiotic-free
APC: Antigen Processing Cell, for example, langerhans cells, plasmacytoid or conventional dendritic cells
Approximately: As used herein, the term "approximately" or "about," as applied to one or more values of interest, refers to a value that is the same or similar to a stated reference value
BAC: Bacterial artificial chromosome
Bacterial region: Region of a plasmid vector required for propagation and selection in the bacterial host
BE: Boundary element: Eukaryotic sequence that that blocks the interaction between enhancers and promoters. Also referred to as insulator element. An example is the AT-rich unique region upstream of the CMV enhancer Spel site that can function as an
insulator/boundary element (Angulo A, Kerry D, Huang H, Borst EM, Razinsky A, Wu J et al.. 2000 J Virol 74: 2826-2839)
bp: basepairs
ccc: Covalently Closed Circular
cl: Lambda repressor
cITs857: Lambda repressor further incorporating a C to T (Ala to Thr) mutation that confers temperature sensitivity. cITs857 is a functional repressor at 28-30°C, but is mostly inactive at 37- 42°C. Also called cI857
Cm": Chloramphenicol resistance
cmv: Cytomegalovirus
CMV promoter boundary element: AT-rich region of the human cytomegalovirus (CMV) genome between the UL127 open reading frame and the major immediate-early (ΜΓΕ) enhancer. Also referred to as unique region (Angulo et al.. Supra, 2000)
ColE2-P9 replication origin: a region which is specifically recognized by the plasmid-specified Rep protein to initiate DNA replication. Includes but not limited to ColE2-P9 replication origin sequences disclosed in SEQ ID NO:4: ColE2 Origin (+7), SEQ ID NO:5: ColE2 Origin (+7, CpG free), SEQ ID NO:6: ColE2 Origin (Min) and SEQ ID NO:7: ColE2 Origin (+16) and replication functional mutations as disclosed in Yagura et al 2006, JBacteriol 188:999-1010 included herein by reference ColE2 related replication origin: The ColE2-P9 origin is highly conserved across the ColE2-related plasmid family. Fifteen ColE2 related plasmid members including ColE3 are compared in Hiraga et al 1994, J Bacteriol. 176:7233 and 53 ColE2 related plasmid members including ColE3 are compared in Yagura et al Supra, 2006. These sequences are included herein by reference
ColE2-P9 plasmid: a circular duplex DNA molecule of about 7 kb that is maintained at about 10 to 15 copies per host chromosome. The plasmid encodes an initiator protein (Rep protein), which is the only plasmid-specified /raws-acting factor essential for ColE2-P9 plasmid replication
ColE2-P9 replication origin RNA-OUT bacterial region: Contains a ColE2-P9 replication origin for propagation and the RNA-OUT selection marker. Optionally includes a PAS, for example, the R6K plasmid CpG free ssiA primosomal assembly site (SEQ ID NO:21) or alternative 0X174 type or ABC type primosomal assembly sites, such as those disclosed in Nomura et al 1991 Gene 108:15 ColE2 plasmid: NTC9385C and NTC9685C vectors disclosed herein, as well as modifications and alternative vectors containing a ColE2-P9 replication origin
delivery methods: Methods to deliver gene vectors [e.g. poly(lactide-co-glycolide) (PLGA), ISCOMs, liposomes, niosomes, virosomes, chitosan, and other biodegradable polymers,
electroporation, piezoelectric permeabilization, sonoporation, ultrasound, corona plasma, plasma facilitated delivery, tissue tolerable plasma, laser microporation, shock wave energy, magnetic fields, contactless magneto-permeabilization, gene gun, microneedles, naked DNA injection, hydrodynamic delivery, high pressure tail vein injection, needle free biojector, liposomes, microparticles, microspheres, nanoparticles, virosomes, bacterial ghosts, bacteria, attenuated bacteria, etc] as known in the art and included herein by reference
DNA replicon: A genetic element that can replicate under its own control; examples include plasmids, cosmids, bacterial artificial chromosomes (BACs), bacteriophages, viral vectors and hybrids thereof
E. coli: Escherichia coli, a gram negative bacteria
EGFP: Enhanced green fluorescent protein
EP: Electroporation
Eukaryotic expression vector: A vector for expression of mRNA, protein antigens, protein therapeutics, shRNA, RNA or microRNA genes in a target organism
Eukaryotic region: The region of a plasmid that encodes eukaryotic sequences and/or sequences required for plasmid function in the target organism. This includes the region of a plasmid vector required for expression of one or more transgenes in the target organism including RNA Pol II enhancers, promoters, transgenes and polyA sequences. A eukaryotic region may express protein or RNA genes using one or more RNA Pol II promoters, or express RNA genes using one or more RNA Pol III promoters or encode both RNA Pol Π and RNA Pol ΙΠ expressed genes. Additional functional eukaryotic region sequences include RNA Pol I or RNA Pol III promoters, RNA Pol I or RNA Pol III expressed transgenes or RNAs, transcriptional terminators, S MARs, boundary elements, etc FU: Fluorescence units
g: Gram, kg for kilogram
Hr(s): Hour(s)
HTLV-I R: HTLV-I R 5' untranslated region (UTR). Sequences and compositions were disclosed in Williams, J A 2008 World Patent Application WO2008153733 and included herein by reference
EM: Intramuscular
immune response: Antigen reactive cellular (e.g. antigen reactive T cells) or antibody (e.g. antigen reactive IgG) responses
IncB RNAI: plasmid pMU720 origin encoded RNAI (SEQ ID NO: 33) that represses RNA II regulated targets (Wilson IW, Siemering KR, Praszkier J, Pittard AJ. 1997. J Bacteriol 179:742) kan: Kanamycin
kanR: Kanamycin Resistance gene
Kd: Kilodalton
kozak sequence: Optimized sequence of consensus DNA sequence gccRccATG (R = G or A) immediately upstream of an ATG start codon that ensures efficient tranlation initiation. A Sail site (GTCGAC) immediately upstream of the ATG start codon (GTCGACATG) is an effective Kozak sequence
Minicircle: Covalendy closed circular plasmid derivatives in which the bacterial region has been removed from the parent plasmid by in vivo or in vitro intramolecular (cis-) site specific
recombination or in vitro restriction digestion/ligation
mSEAP: Murine secreted alkaline phosphatase
Nanoplasmid vector: Vector combining an RNA selection marker with a R6K or ColE2 related replication origin. For example, NTC9385C, NTC9685C, NTC9385R, NTC9685R, NTC9385R-BE, NTC9385Ra-01 and NTC9385Ra-02 vectors described herein and modifications thereof
NTC7382 promoter: A chimeric promoter comprising the CMV enhancer-CMV promoter-HTLV R -synthetic rabbit β globin 3' intron acceptor -exon 2-SRF protein binding site-kozak sequence, with or without an upstream SV40 enhancer. The creation and application of this chimeric promoter is disclosed in Williams JA Supra, 2008 and included herein by reference
NTC8385: NTC8385 and NTC8685 plasmids are antibiotic-free vectors that contain a short RNA (RNA-OUT) selection marker in place of the antibiotic resistance marker (kanR). The creation and application of these RNA-OUT based antibiotic-free vectors are disclosed in Williams, JA Supra, 2008 and included herein by reference NTC8685: NTC8685 (FIG. 1) is an antibiotic-free vector that contains a short RNA (RNA-OUT) selection marker in place of the antibiotic resistance marker (kanR). The creation and application of NTC8685 is disclosed in Williams, JA 2010 US Patent Application 20100184158 and included herein by reference
OL1 : Lambda repressor binding site in the PL promoter (FIG. 7). Repressor binding to OL1 is altered by mutations in OL1, such as OL1-G (FIG. 7; this is a single base deletion that also reduces the distance between the PL promoter -35 and -10 boxes from optimal 17 bp to 16 bp) and OL1-G to T (FIG. 7; this is a G to T substitution that maintains the distance between the PL promoter -35 and -10 boxes at the optimal 17 bp; this is the V2 mutation described by Bailone A and Galibert F, 1980. Nucleic Acids Research 8:2147)
ODMO: optical density at 600 nm
PAS: Primosomal assembly site. Priming of DNA synthesis on a single stranded DNA ssi site. 0X174 type PAS: DNA hairpin sequence that binds priA, which, in turn, recruits the remaining proteins to form the preprimosome [priB, dnaT, recruits dnaB (delivered by dnaC)], which then also recruits primase (dnaG), which then, finally, makes a short RNA substrate for DNA polymerase I. ABC type PAS: DNA hairpin binds dnaA, recruits dnaB (delivered by dnaC) which then also recruits primase (dnaG), which then, finally, makes a short RNA substrate for DNA polymerase I. See Masai et al, 1990 J Biol Chem 265:15134. For example, the R6K plasmid CpG free ssiA primosomal assembly site (SEQ ID NO:21) or alternative 0X174 type or ABC type primosomal assembly sites, such as those disclosed in Nomura et al Supra, 1991
PAS-BH: Primosomal assembly site on the heavy (leading) strand
PAS-BH region: pBR322 origin region between ROP and PAS-BL (approximately pBR322 2067- 2351)
PAS-BL: Primosomal assembly site on the light (lagging) strand
PBS: Phosphate buffered Saline
PCR: Polymerase Chain Reaction
pDNA: Plasmid DNA
pINT pR pL vector: The pINT pR pL integration expression vector is disclosed in Luke et al 2011 Mol Biotechnol 47:43 and included herein by reference. The target gene to be expressed is cloned downstream of the pLl promoter (FIG. 7). The vector encodes the temperature inducible cI857 repressor, allowing heat inducible target gene expression.
PL promoter: Lambda promoter left (FIG. 7). PL is a strong promoter that is repressed by the cl repressor binding to OL1, OL2 and OL3 repressor binding sites. The temperature sensitive cI857 repressor allows control of gene expression by heat induction since at 30°C the cI857 repressor is functional and it represses gene expression, but at 37-42 °C the repressor is inactivated so expression of the gene ensues Plasmid: An extra chromosomal DNA molecule separate from the chromosomal DNA which is capable of replicating independently from the chromosomal DNA
pMBl RNAI: pMBl plasmid origin encoded RNAI that represses RNAII regulated targets (SEQ ID NO: 31 ; SEQ ID NO:32) that represses RNAII regulated targets such as those described iii Grabherr R, Pfaffenzeller I. 2006 US patent application US20060063232 and Cranenburgh RM. 2009; US Patent 7,611,883
Pmin: Minimal 678 bp pUC replication origin SEQ ID NO:42 and functional variants with base substitutions and/or base deletions. Vectors described herein incorporating Pmin include NTC8385- Min and NTC8885MP-U6
Pol: Polymerase
polyA: Polyadenylation signal or site. Polyadenylation is the addition of a poly(A) tail to an RNA molecule. The polyadenylation signal is the sequence motif recognized by the RNA cleavage complex. Most human polyadenylation sites contain an AAUAAA motif and conserved sequences 5' and 3' to it. Commonly utilized polyA sites are derived from the rabbit β globin (NTC8685; FIG. 1), bovine growth hormone (gWIZ; pVAXl), SV40 early, or SV40 late polyA signals
pUC replication origin: pBR322-derived replication origin, with G to A transition that increases copy number at elevated temperature and deletion of the ROP negative regulator
pUC plasmid: Plasmid containing the pUC origin
R6K plasmid: NTC9385R, NTC9685R, NTC9385Ra-01 and RNA9385Ra-02 vectors disclosed herein, as well as modifications, and alternative R6K vectors known in the art including but not limited to pCOR vectors (Gencell), pCpGfree vectors (Invivogen), and CpG free University of Oxford vectors including pGM 169
R6K replication origin: a region which is specifically recognized by the plasmid-specified Rep protein to initiate DNA replication. Includes but not limited to R6K replication origin sequence disclosed as SEQ ID NO:l : R6K Origin, and CpG free versions (SEQ ID NO:22) as disclosed in Drocourt et al United States Patent 7244609 and incorporated herein by reference
R6K replication origin-RNA-OUT bacterial region: Contains a R6 replication origin for propagation and the RNA-OUT selection marker
Rep: Replication
Rep protein dependent plasmid: A plasmid in which replication is dependent on a replication (Rep) protein provided in Trans. For example, R6 replication origin, ColE2-P9 replication origin and ColE2 related replication origin plasmids in which the Rep protein is expressed from the host strain genome. Numerous additional Rep protein dependent plasmids are known in the art, many of which are summarized in del Solar et al 1998 Microbiol. Mol. Biol. Rev 62:434-464 which is included herein by reference RNA-EN: Insertion sequence 10 (IS 10) encoded RNA-IN, an RNA complementary and antisense to RNA-OUT. When RNA-IN is cloned in the untranslated leader of a mRNA, annealing of RNA-IN to RNA-OUT reduces translation of the gene encoded downstream of RNA-IN
RNA-IN regulated selection marker: A genomically expressed RNA-IN regulated selectable marker. In the presence of plasmid borne RNA-OUT, expression of a protein encoded downstream of RNA-IN is repressed. An RNA-ΓΝ regulated selection marker is configured such that RNA-IN regulates either 1) a protein that is lethal or toxic to said cell per se or by generating a toxic substance (e.g. SacB), or 2) a repressor protein that is lethal or toxic to said bacterial cell by repressing the transcription of a gene that is essential for growth of said cell (e.g. murA essential gene regulated by RNA-ΓΝ tetR repressor gene). For example, genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation are disclosed in Williams, JA Supra, 2008 (SEQ ID NO:23) and included herein by reference. Alternative selection markers described in the art may be substituted for SacB
RNA-OUT: Insertion sequence 10 (IS10) encoded RNA-OUT (SEQ ID NO:24), an antisense RNA that hybridizes to, and reduces translation of, the transposon gene expressed downstream of RNA-IN. The sequence of the core RNA-OUT sequence (SEQ ID NO:24) and complementary RNA-IN SacB genomically expressed RNA-IN-SacB cell lines can be modified to incorporate alternative functional RNA-IN/RNA-OUT binding pairs such as those disclosed in Mutalik et al. 2012 Nat Chem Biol 8:447, including, but not limited to, the RNA-OUT A08/RNA-IN S49 pair, the RNA-OUT A08/RNA- IN S08 pair, and CpG free modifications of RNA-OUT A08 that modify the CG in the RNA-OUT 5' TTCGCT sequence to a non-CpG sequence
RNA-OUT Selectable marker: An RNA-OUT selectable marker DNA fragment including E. coli transcription promoter and terminator sequences flanking an RNA-OUT RNA. An RNA-OUT selectable marker, utilizing the RNA-OUT promoter and terminator sequences, that is flanked by Dralll and Kpnl restriction enzyme sites, and designer genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation, are disclosed in Williams, JA Supra, 2008 (SEQ ID NO:23) and included herein by reference. The RNA-OUT promoter and terminator sequences flanking the RNA-OUT RNA may be replaced with heterologous promoter and terminator sequences. For example, the RNA-OUT promoter may be substituted with a CpG free promoter known in the art, for example the I-EC2K promoter or the P5/6 5/6 or P5/6 6/6 promoters disclosed in Williams, JA Supra, 2008 and included herein by reference
RNA selectable marker: also RNA selection marker. An RNA selectable marker is a plasmid borne expressed non translated RNA that regulates a chromosomally expressed target gene to afford selection. This may be a plasmid borne nonsense suppressing tRNA that regulates a nonsense suppressible selectable chromosomal target as described by Crouzet J and Soubrier F 2005 US Patent 6,977,174 included herein by reference. This may also be a plasmid borne antisense repressor RNA, a non limiting list included herein by reference includes RNA-OUT that represses RNA-ΓΝ regulated targets, pMBl plasmid origin encoded RNAI that represses RNAII regulated targets (SEQ ID NO: 31 ; SEQ ID NO:32; Grabherr and, Pfaffenzeller Supra,. 2006; Cranenburgh RM. Supra, 2009), IncB plasmid pMU720 origin encoded RNAI that represses RNA II regulated targets (SEQ ID NO: 33; SEQ ID NO:34; Wilson et al Supra, 1997), ParB locus Sok of plasmid Rl that represses Hok regulated targets, Flm locus FlmB of F plasmid that represses flmA regulated targets (Morsey MA, 1999 US patent US5922583). An RNA selectable marker may be another natural antisense repressor RNAs known in the art such as those described in Wagner EGH, Altuvia S, Romby P. 2002. Adv Genet 46:361 and Franch T, and Gerdes K. 2000. Current Opin Microbiol 3:159. An RNA selectable marker may also be an engineered repressor RNAs such as synthetic small RNAs expressed SgrS, MicC or MicF scaffolds as described in Na D, Yoo SM, Chung H, Park H, Park JH, Lee SY. 2013. Nat Biotechnol 31 : n0
ROP: Repressor of primer
sacB: Structural gene encoding Bacillus subtilis levansucrase. Expression of sacB in gram negative bacteria is toxic in the presence of sucrose
SEAP: Secreted alkaline phosphatase
shRNA: Short hairpin RNA
SR: Spacer region. As used herein, spacer region is the region linking the 5' and 3' ends of the eukaryotic region sequences. The eukaryotic region 5' and 3' ends are typically separated by the replication origin and selection marker. In simple single RNA Pol Π transcription vectors this will be between the RNA Pol II promoter region (5' to a promoter, enhancer, boundary element, S/MAR) and the RNA Pol II polyA region (3' to a polyA sequence, eukaryotic transcriptional terminator sequence, boundary element, S/MAR). For example, in NTC9385R (FIG. 5) the spacer region is region between Nhel site at 1663 and Kpnl site at 460. In dual RNA Pol Π transcription vectors, the eukaryotic sequences separated by the spacer will depend on the orientation of the two transcription elements. For example, with divergent or convergent RNA Pol II transcription units, the spacer region may separate two polyA sequences or two enhancers respectively. In RNA Pol Π, RNA Pol ΙΠ dual expression vectors, the spacer region may separate an RNA Pol Π enhancer and a RNA Pol ΙΠ promoter. The spacer region may encode bacterial or eukaryotic selectable markers, bacterial transcription terminators, eukaryotic transcription terminators, boundary elements, S/MARs, RNA Pol I or RNA Pol ΙΠ expressed sequences or other functionalities
ssi: Single stranded initiation sequences
SV40 enhancer: Region containing the 72 bp and optionally the 21 bp repeats
target antigen: Immunogenic protein or peptide epitope, or combination of proteins and epitopes, against which an immune response can be mounted. Target antigens may by derived from a pathogen for infectious disease applications, or derived from a host organism for applications such as cancer, allergy, or autoimmune diseases. Target antigens are well defined in the art. Some examples are disclosed in Williams, Supra, 2008 and are included herein by reference TE buffer: A solution containing approximately lOmM Tris pH 8 and 1 mM EDTA
Transcription terminator: Bacterial: A DNA sequence that marks the end of a gene or operon for transcription. This may be an intrinsic transcription terminator or a Rho-dependent transcriptional terminator. For an intrinsic terminator, such as the trpA terminator, a hairpin structure forms within the transcript that disrupts the mRNA-DNA-RNA polymerase ternary complex. Alternatively, Rho- dependent transcriptional terminators require Rho factor, an RNA helicase protein complex, to disrupt the nascent mRNA-DNA-RNA polymerase ternary complex. Eukarvotic: PolyA sites are not 'terminators', instead internal cleavage at PolyA sites leaves an uncapped 5'end on the 3'UTR RNA for nuclease digestion. Nuclease catches up to RNA Pol Π and causes termination. Termination can be promoted within a short region of the poly A site by introduction of RNA Pol Π pause sites
(eukaryotic transcription terminator). Pausing of RNA Pol II allows the nuclease introduced into the 3' UTR mRNA after PolyA cleavage to catch up to RNA Pol II at the pause site. A nonlimiting list of eukaryotic transcription terminators know in the art include the C2x4 terminator (Ashfield R, Patel AJ, Bossone SA, Brown H, Campbell RD, Marcu KB, Proudfoot NJ. 1994. EMBO J 13:5656) and the gastrin terminator (Sato K, Ito R, Baek KH, Agarwal K, 1986. Mol. Cell. Biol. 6: 1032). Terminator element may stabilize mRNA by enhancing proper 3'-end processing of mRNA (Kim D, Kim JD, Baek K, Yoon Y, Yoon J. 2003. Biotechnol Prog 19:1620)
Transgene: Target antigen or protein or RNA gene that is cloned into a vector
ts: Temperature sensitive
μg: microgram
μΐ: microliter
UTR: Untranslated region of a mRNA (5' or 3' to the coding region)
VARNA: Adenoviral virus associated RNA, including VARNAI (VAI or VA1) and or VARNAII (VAII or VA2) from any Adenovirus serotype, for example, serotype 2, serotype 5 or hybrids thereof VARNAI: Adenoviral virus associated RNAI, also referred to as VAI, or VAI , from any Adenovirus serotype, for example, serotype 2, serotype 5 or hybrids thereof
Vector: A gene delivery vehicle, including viral (e.g. alphavirus, poxvirus, lentivirus, retrovirus, adenovirus, adenovirus related virus, etc) and nonviral (e.g. plasmid, midge, transcriptionally active PCR fragment, minicircles, bacteriophage, etc) vectors. These are well known in the art and are included herein by reference
Vector backbone: Eukaryotic region and bacterial region of a vector, without the transgene or target antigen coding region
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
The invention relates generally to plasmid DNA compositions and methods to improve plasmid expression and plasmid production. The invention can be practiced to improve
expression of vectors such as eukaryotic expression plasmids usefiil for gene therapy, genetic immunization and or interferon therapy. The invention can be practiced to improve the copy number of vectors such as eukaryotic expression plasmids useful for gene therapy, genetic immunization and or interferon therapy. It is to be understood that all references cited herein are incorporated by reference in their entirety.
According to one preferred embodiment, the present invention provides for method of increasing in vivo expression of transgene from covalently closed super-coiled plasmid DNA, which comprises modifying the plasmid DNA to replace the pMB 1 , ColEl or pBR322 derived replication origin and selectable marker with a replication origin selected from the group consisting of an Pmin minimal pUC replication origin, ColE2-P9 replication origin, ColE2 related replication origin, and R6 replication origin and a RNA selectable marker; transforming the modified plasmid DNA into a Rep protein producing bacterial cell line rendered competent for transformation; and isolating the resultant transformed bacterial cells. The modified plasmid produced from these cells has increased transgene expression in the target organism.
In one preferred embodiment, the spacer region encoded pMBl, ColEl or pBR322 derived replication origin is replaced with a CpG free ColE2 origin. In another preferred embodiment, a primosome assembly site is incorporated into a ColE2 plasmid DNA backbone to improve plasmid copy number. In yet another preferred embodiment, the pMBl, ColEl or pBR322 derived replication origin is replaced with a CpG free R6K origin.
The methods of plasmid modification of the present invention have been surprisingly found to improve plasmid expression in the target organism. Increased expression vectors may find application to improve the magnitude of DNA vaccination mediated antigen reactive B or T cell responses for preventative or therapeutic vaccination, increase RNA and or protein transgene levels to improve gene replacement therapy or gene knockdown therapy, increase plasmid based expression levels of DNA vector expressed therapeutic antibodies that neutralize infectious diseases such as influenza, HIV, malaria, hepatitis C virus, tuberculosis, etc.
Plasmid encoded transgene expression in the target organism is preferably increased by employing specific constructs or compositions incorporated in a vector. According to one preferred embodiment, the present invention provides a composition for construction of a vector, comprising a ColE2 origin with at least 90% sequence identity to the sequences set forth as SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, and a RNA selectable marker and a eukaryotic region, wherein the ColE2 origin is operably linked to the RNA selectable marker and eukaryotic region. It has been surprisingly found that this ColE2 origin-RNA selectable marker improves plasmid encoded transgene expression in the target organism. According to another preferred embodiment, the resultant vector of the invention has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 8, SEQ ID NO: 9.
According to another preferred embodiment, the present invention provides a composition for construction of a vector, comprising an R6K origin with at least 90% sequence identity to the sequences set forth as SEQ ID NO: 1, SEQ ID NO: 22, and a RNA selectable marker and a eukaryotic region, wherein the R6K origin is operably linked to the RNA selectable marker and eukaryotic region. It has been surprisingly found that this R6K origin-RNA selectable marker improves plasmid encoded transgene expression in the target organism. According to another preferred embodiment, the resultant vector of the invention has at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41.
As used herein, the term "sequence identity" refers to the degree of identity between any given query sequence, e.g., SEQ ID NO: 2, and a subject sequence. A subject sequence may, for example, have at least 90 percent, at least 95 percent, or at least 99 percent sequence identity to a given query sequence. To determine percent sequence identity, a query sequence (e.g., a nucleic acid sequence) is aligned to one or more subject sequences using any suitable sequence alignment program that is well known in the art, for instance, the computer program ClustalW (version 1.83, default parameters), which allows alignments of nucleic acid sequences to be carried out across their entire length (global alignment). Chema et al., 2003 Nucleic Acids Res., 31 :3497-500. In a preferred method, the sequence alignment program (e.g. , ClustalW) calculates the best match between a query and one or more subject sequences, and aligns them so that identities, similarities, and differences can be determined. Gaps of one or more nucleotides can be inserted into a query sequence, a subject sequence, or both, to maximize sequence alignments. For fast pair-wise alignments of nucleic acid sequences, suitable default parameters can be selected that are appropriate for the particular alignment program. The output is a sequence alignment that reflects the relationship between sequences. To further determine percent identity of a subject nucleic acid sequence to a query sequence, the sequences are aligned using the alignment program, the number of identical matches in the alignment is divided by the length of the query sequence, and the result is multiplied by 100. It is noted that the percent identity value can be rounded to the nearest tenth. For example, 78.11, 78.12, 78.13, and
78.14 are rounded down to 78.1, while 78.15, 78.16, 78.17, 78.18, and 78.19 are rounded up to 78.2.
According to another preferred embodiment, the present invention provides methods and compositions for production of a Rep protein dependent plasmid vector. Production cell lines providing improved heat inducible PL promoter expression of a Rep protein integrated into the genome and expressed from the heat inducible PL promoter incorporating the OL1-G deletion (SEQ ID NO: 11), or the heat inducible PL promoter incorporating the OL1-G to T subsitution (SEQ ID NO: 12). It has been surprisingly found that these promoter modifications improves Rep protein dependent plasmid vector copy number in shake flask and fermentation cultures.
Turning now to the drawings, FIG. 1. shows an annotated map of the antibiotic free
NTC8685 pUC origin expression vector with the locations of the pUC origin, PAS-BH primosomal assembly site, SV40 enhancer and other key elements indicated. The replication origin (PAS-BH and pUC origin) is from the Agel (230) site to the Dram (1548) site (1318 bp total). The antibiotic free RNA-OUT selection marker is between the Dralll (1548) and Kpnl (1695) sites (147 bp total). The spacer region encoded bacterial region (replication and selection) of this vector is 1465 bp.
FIG. 2 shows an annotated map of the antibiotic-free NTC9685C ColE2 origin expression vector with the locations of the primosomal assembly site, ColE2 Replication origin (Replication origin) and other key elements indicated. The spacer region encoded bacterial region (replication and selection) of this vector is 281 bp [Nhel site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site] (SEQ ID NO:20).
FIG. 3 shows an annotated map of the antibiotic-free NTC9685R R6K origin expression vector with the locations of the primosomal assembly site, R6K Replication origin (R6K mini-origin) and other key elements indicated. The spacer region encoded bacterial region (replication and selection) of this vector is 466 bp [Nhel site-trpA terminator-R6K Origin-RNA-OUT-Kpnl site] (SEQ ID NO: 19).
FIG. 4 shows an annotated map of the antibiotic-free NTC9385C ColE2 origin expression vector with the locations of the primosomal assembly site, ColE2 Replication origin (Replication origin) and other key elements indicated. The spacer region encoded bacterial region (replication and selection) of this vector is 281 bp [Nhel site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site] (SEQ ID NO:20). This vector differs from NTC9685C in that the VA1 RNA and SV40 enhancer are not present.
FIG. 5 shows an annotated map of the antibiotic- free NTC9385R R6K origin expression vector with the locations of the primosomal assembly site, R6K Replication origin (R6K mini-origin) and other key elements indicated. The spacer region encoded bacterial region (replication and selection) of this vector is 466 bp [Nhel site-trpA terminator-R6K Origin-RNA-OUT-Kpnl site] (SEQ ID NO:19). This vector differs from NTC9685R in that the VA1 RNA and SV40 enhancer are not present.
FIG. 6 shows an annotated map of the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector; key features such as the cI857 ts repressor, PL promoter, R6K Rep protein, HK022 phage attachment site for site specific integration into the E. coli genome, R6K replication origin and spectinomycin/streptomycin resistance marker (SpecR StrepR) are shown.
FIG. 7 show an annotated sequence of the PL promoter with locations of the PL promoter OL1 , OL2 and OL3 repressor binding sites, -10 and -35 promoter elements for PL1 and PL2 promoters. The OL1 mutations OL1-G and OL1-G to T alterations are shown.
FIG. 8 shows an annotated map of the pINT pR pL ColE2 Rep protein integration vector; key features such as the cI857 ts repressor, PL promoter, ColE2 Rep protein, HK022 phage attachment site for site specific integration into the E, coli genome, R6K replication origin and
spectinomycin/streptomycin resistance marker (SpecR StrepR) are shown. FIG. 9 shows Nanoplasmid expression in vitro after lipofectamine transfection of HEK293 cell line of various EGFP transgene encoding vectors.
FIG. 10 shows Nanoplasmid expression in vivo after intramuscular injection with EP of various muSEAP transgene encoding vectors.
FIG. 11 shows a ColE2 origin Nanoplasmid shRNA expression vector. In this vector, a 22 bp shRNA is expressed from the RNA Polymerase ΙΠ HI promoter, with a TTTTTT terminator. The bacterial region is the NTC9385C and NTC9685C Bacterial region (SEQ ID NO:20).
FIG. 12 shows an IncB RNAI based RNA selection marker. A) Genomically expressed target of IncB RNAI RNA selection marker (SEQ ID NO: 35). Plasmid expressed RNAI binding to the pseudoknot in the complementary genomically expressed RNAII target prevents translation of the downstream SacB gene, conferring sucrose resistance. The RNAI -10 and -35 promoter elements are mutated to prevent RNAI expression. B) Structure of plasmid expressed IncB RNAI RNA selection marker (SEQ ID NO: 34) encoding the IncB RNAI antisense repressor (SEQ ID NO: 33).
The invention also relates to compositions and methods for producing high expression level plasmids. The present invention provides sequences that, when introduced into a vector backbone, increase plasmid expression.
The surprising observation that a ColE2 replication origin-RNA selection marker or R6K replication origin -RNA selection marker can be utilized as a plasmid expression enhancer is disclosed.
As described herein, plasmid expression is increased by replacement of the pMB 1 , ColEl or pBR322 derived origin-selection marker bacterial region with an R6K origin-RNA selection marker in the plasmid backbone. In yet another preferred embodiment, the R6K origin is CpG free. In yet another preferred embodiment, the R6K origin is included with an RNA-OUT selection marker. In yet another preferred embodiment, the R6K origin is included with an pMBl RNAI selection marker. In yet another preferred embodiment, the R6K origin is included with an IncB RNAI selection marker.
In yet another preferred embodiment, plasmid expression is increased by replacement of the pMBl, ColEl or BR322 derived origin-selection marker bacterial region with a ColE2 origin-RNA selection marker in the plasmid backbone. In yet another preferred embodiment, the ColE2 origin is CpG free. In yet another preferred embodiment, the ColE2 origin is included with an RNA-OUT selection marker. In yet another preferred embodiment, the ColE2 origin is included with an pMBl RNAI selection marker. In yet another preferred embodiment, the ColE2 origin is included with an IncB RNAI selection marker. In yet another preferred embodiment, the ColE2 origin is included with a primosome assembly site.
In yet another preferred embodiment, plasmid expression is increased by replacement of the pMB 1 , ColEl or pBR322 derived origin-selection marker with a Pmin minimal pUC, ColE2 or a R6K origin in the plasmid backbone spacer region and an RNA selection marker in an intron. In yet another preferred embodiment, the R6 or ColE2 origin is CpG free. In yet another preferred embodiment, the RNA selection marker is the RNA-OUT selection marker. In yet another preferred embodiment, the RNA selection marker is the pMBl RNAI selection marker. In yet another preferred embodiment, the RNA selection marker is the IncB RNAI selection marker.
EXAMPLES
The methods of the invention are further illustrated by the following examples. These are provided by way of illustration and are not intended in any way to limit the scope of the invention. Example 1 : Heat inducible R6K replication origin plasmid production
Fermentation : Fermentations were performed using proprietary fed-batch media (NTC3019, HyperGRO media) in New Brunswick BioFlo 110 bioreactors as described (Carnes and Williams, Supra, 2011). The seed cultures were started from glycerol stocks or colonies and streaked onto LB medium agar plates containing 6% sucrose. The plates were grown at 30-32°C; cells were resuspended in media, and used to provide approximately 0.1% inoculums for the fermentations that contained 0.5% sucrose to select for RNA-OUT plasmids.
Antibiotic-free RNA-OUT plasmid fermentations were performed in E. coli strain XLlBlue [recAJ endAl gyrA96 thi-1 hsdRl 7 supE44 relAl lac [F' proAB ladqZAMJ5 Tn70 (Tef)] (Stratagene, La JoUa, CA)] or GT115 [F- mcrA A(mrr-hsdRMS-mcrBC) (p801acZAM15 AlacX74 recAl rspL (StrA) endAl Adcm uidA(AMluI)::pir-l 16 AsbcC-sbcD (Invivogen, San Diego)] strains containing chromosomally integrated pCAH63-CAT RNA-IN-SacB (P5/6 6/6) at the phage lambda integration site as disclosed in Williams, JA Supra, 2008. SacB {Bacillus subtilis levansucrase) is a
counterselectable marker which is lethal to E. coli cells in the presence of sucrose. Translation of
SacB from the RNA-IN-SacB transcript is inhibited by plasmid encoded RNA-OUT. This facilitates plasmid selection in the presence of sucrose, by inhibition of SacB mediated lethality.
Analytical Methods: Culture samples were taken at key points and at regular intervals during all fermentations. Samples were analyzed immediately for biomass (OD6oo) and for plasmid yield.
Plasmid yield was determined by quantification of plasmid obtained from Qiagen Spin Miniprep Kit preparations as described (Carnes and Williams, Supra, 2011). Briefly, cells were alkaline lysed, clarified, plasmid was column purified, and eluted prior to quantification. Agarose gel electrophoresis analysis (AGE) was performed on 0.8-1% Tris/acetate/EDTA (TAE) gels as described in Carnes and Williams J A, Supra, 2011. R6K background: The R6K gamma plasmid replication origin requires a single plasmid replication protein n that binds as a monomer to multiple repeated 'iteron' sites (seven core repeats containing TGAGNG consensus) and as a dimer to repressive sites [TGAGNG (dimer repress) as well as to iterons with reduced affinity]. Various host factors are used including IHF, DnaA, and primosomal assembly proteins DnaB, DnaC, DnaG (Abhyankar et al 2003 J Biol Chem 278:45476-45484). The R6K core origin contains binding sites for DnaA and IHF that affect plasmid replication (n, IHF and DnaA interact to initiate replication).
Different versions of the R6 gamma replication origin have been utilized in various eukaryotic expression vectors, for example pCOR vectors (Soubrier et al 1999, Gene Therapy 6:l482) and a CpG free version in pCpGfree vectors (Invivogen, San Diego CA), and pGMl 69 (University of Oxford). Incorporation of the R6K replication origin does not improve expression levels compared to an optimized pUC origin vector (Soubrier et al Supra, 1999). However, use of a conditional replication origin such as R6K gamma that requires a specialized cell line for propagation adds a safety margin since the vector will not replicate if transferred to a patients endogenous flora.
A highly minimalized R6K gamma derived replication origin that contains core sequences required for replication (including the DnaA box and stb 1-3 sites; Wu et al, 1995. J Bacteriol. 177: 6338- 6345), but with the upstream Π dimer repressor binding sites and downstream Π promoter deleted (by removing one copy of the iterons, as with pCpG; see map below) was designed (SEQ ID NO: 1 ) and NTC9685R and NTC9385R expression vectors incorporating it constructed (see Example 3).
Typical R6K production strains incorporate the Π protein derivative PIR116 that contains a P106L substitution that increases copy number (by reducing Π dimerization; Π monomers activate while Π dimers repress). Fermentation results with pCOR (Soubrier et al., Supra, 1999) and pCpG plasmids (Hebel HL, Cai Y, Davies LA, Hyde SC, Pringle IA, Gill DR. 2008. Mol Ther 16: SI 10) were low; around 100 mg/L in PIR116 cell lines.
As expected, fermentation yields of the R6K expression vector NTC9685R-EGFP in R6K plasmid production cell line NTC641642 (GTl 15-SacB; GTl 15 modified for RNA-OUT AF vector selection by insertion of pCAH63-CAT RNA-IN-SacB (P5/66/6) into the genome. The GTl 15 genome encoded endogenous n gene P3 promoter constitutively expresses R6 replication protein Π containing the pir- 1 16 mutation; Metcalf et al, 1994; Gene 138;l-7) were low (Table 1). Mutagenesis of the pir-116 replication protein and selection for increased copy number has been used to make new production strains. For example, the TEX2pir42 strain contains a combination of P106L and P42L. The P42L mutation interferes with DNA looping replication repression. The TEX2pir42 cell line improved copy number and fermentation yields with pCOR plasmids with reported yields of 205 mg/L (Soubrier F. 2004. World Patent Application WO2004033664). Methods to improve R6K origin yields are needed.
Other combinations of Π copy number mutants have been shown to improve copy number. This includes 'P42L and PI 13S' and 'P42L, P106L and F107S' (Abhyankar et al 2004. J Biol Chem 279:6711-6719).
Two cell lines using the endogenous Π gene P3 promoter to express Π mutants 'P42L and PI 13S' (SEQ ID NO:13) (NTC640722 cell line) and 'P42L, P106L and F107S' (SEQ ID NO:14) were constructed and tested for copy number improvement with NTC9685R-EGFP. Two additional cell lines using the PL promoter in addition to the endogenous Π gene P3 promoter to express Π mutants 'P42L and PI 13S' (NTC641981 cell line) and 'P42L, P106L and F107S' (NTC641053 cell line) were made and tested for copy number improvement with NTC9685R-EGFP. R6 production cell lines were made in XLl-Blue SacB (XLl-Blue atU:P5/6 6/6-RNAIN-5ac5, CmR).
These cell lines were constructed as follows. The R6K replication proteins Π were cloned into the pINT pR pL integration vectors as described in Luke et al Supra, 2011 and included herein by reference. Constructed R6K Rep protein vectors were integrated into the genome at the HK022 phage attachment site as described in Luke et al, Supra, 2011. Briefly the pINT pINT pR pL R6 Rep vectors were amplified by PCR to delete the R6K replication origin, ligated to form a circle, and integrated into the HK022 attachment site using the pAH69 helper plasmid as described.
The results (Table 1) demonstrated that constitutive expression of 'P42L and PI 13S' or 'P42L, P106L and F107S' resulted in much higher levels of NTC9685R-EGFP than the NTC641642 encoded P106L Rep protein. However, constitutive expression from P3 resulted in low overall biomass and plasmid multimerization with P42L, P106L and F107S (RF306, RF314), due to high plasmid levels and resultant metabolic burden during the growth phase.
Table 1: 2.6 kb NTC9685R-EGFP R6K Nanoplasmid fermentation yields in R6K rep cell lines
Growth Induced Final phase Growth phase Induced plasmid Plasmid
Ferm temp spec temp spec Final yield multimer-
# Cell line Rep Gene Promoter (C) yield" (C) yield" OD600 (mg L) ization
RF310 NTC641642 P106L Const P3 37 1.1 NA, 37 1.2 43 53
RF323 NTC641642 P 106L Const P3 37 ND NA, 37 0.9 54 49 Monomer
RF305 NTC640722 P42L-P113S Const P3 30 3.4 37 3.6 96 345 Monomer
RF321 NTC641981 P42L-P113S pR PL& P3 32 4.4-5.0 42 2.8 93 259 Monomerb
P42L-P106L-
RF306 NTC641053 F107S pRPL& P3 30 3.1 37 6.6 86 567 Multimer
P42L-P106L-
RF314 NTC641053 F107S pRPL& P3 32 2.6-4.7 42 7.1 79 558 Multimer
P42L-P106L-
RF351 NTC661135 F107S pR PL only 32 0.4 42 1.45 88 128 Monomer
NTC66113 P42L-P106L- pR PLOLl
RF326 5-MUT FI07S G 32 0.64 42 6.7 81 545 Monomer
P42L-P106L- pR PLOLl
RF358 NTC711055 F107S G 32 1 . 42 5.9 118 690 Monomer
P42L-P106L- pR PLOLl
RF359 NTC711231 F107S GtoT 30 1.8 42 8.5 82 695 Monomer
NTC640721 = NTC5402-P42L-P 106L-F107S ND = Not determined NTC5402 =XLlBhie, SacB
NTC640722 =NTC5402-P42L-P 113S NA = Not applicable NTC54208 = XLlBhie, SacB, dcm-
NTC641053 = NTC5402-pR pL P42L-P 106L-F107S 1 1
NTC641642 = GT115-SacB (relA+) pirl 16=P 1 36L "Specific Yield = mg plasmic /L/OD60( )
NTC641981= NTC5402-pR pL P42L-P 113S b Some dimer present
NTC661135 = NTC54208-pR pL P42L-P 106L-F107S (P3-)
NTC661135-MUT = NTC54208-pR pL (OLl-G) P42L-P 106L-F107S (P3-)
NTC661134 = NTC5402-pR pL P42L-P113S (P3-)
NTC711055 = NTC54208-pR pL (OLl-G) P42L-P 106L-F107S (P3-)
NTC711231 = NTC54208-pR pL (OLl-G to T) P42L-P 106L-F107S (P3-) Heat inducible versions were then made by deletion of the P3 promoter to determine if PL promoter mediated replication protein induction in a temperature shift improved R6K plasmid production yields and quality by reduction of plasmid copy number and metabolic burden during the reduced temperature growth phase. A strain encoding a deletion of the P3 promoter expressing P42L, P106L and F107S (NTC661135, incorporating a single copy of the pINT pR pL R6K Rep pi P42L-P106L- F107S (P3-) integration vector; FIG. 6, SEQ ID NO: 17) constructed as described above dramatically reduced copy number during the reduced temperature growth phase with copy number induction after temperature upshift (Table 1; RF351). However, the yield (128 mg L) was overall lower than with the P3 promoter (567, 558 mg/L).
However, excellent results were obtained after fermentation with a second NTC661135 cell line (RF326) in which plasmid copy number was increased 10 fold by temperature shifting, resulting in excellent final plasmid yields of 545 mg L. PCR amplification and sequencing of the P42L, P106L and F107S expression cassette from the RF326 cell line (NTC661135-MUT) and the RF351 cell line (NTC661135) demonstrated that NTC661 135-MUT contained a mutation in the OL1 lambda repressor binding site in the PL promoter (FIG. 7; OLl-G this is a single base deletion that also reduces the distance between the PL1 promoter -35 and -10 boxes from optimal 17 bp to 16 bp).
This mutation was introduced into the pINT pR pL R6K Rep pi P42L-P106L-F107S (P3-) integration vector by PCR mutagenesis and a sequence verified clone incorporating the OLl-G mutation integrated into the genome (NTC71 1055) as described above. Fermentation evaluation of this cell line with the NTC9685R-EGFP plasmid (Table 1; RF358) demonstrated similar dramatic 6 fold heat inducible plasmid copy number induction, resulting in excellent final plasmid yields of 690 mg/L. Repressor binding to OL1 is altered by mutations in OL1 , such as OLl-G (FIG. 7; SEQ ID NO:l 1) and V2 (OLl-G to T; FIG. 7; SEQ ID NO: 12; this is a G to T substitution that maintains the distance between the PL promoter -35 and -10 boxes at the optimal 17 bp; this is the V2 mutation described by Bailone and Galibert, Supra, 1980). The OLl-G to T (V2) mutation was introduced into the ρΓΝΤ pR pL R6 Rep pi P42L-P106L-F107S (P3-) integration vector by PCR mutagenesis and a sequence verified clone incorporating the OLl-G mutation integrated into the genome as described above to create NTC711231. Fermentation evaluation of this cell line with the NTC9685R-EGFP plasmid (Table 1; RF359) demonstrated, similar to OL1G, a dramatic 5 fold heat inducible plasmid copy number induction, resulting in excellent final plasmid yields of 695 mg/L. Cell lines incorporating the pINT pR pL R6 Rep pi P42L-P106L-F107S (P3-) integration vector containing either the wildtype PL promoter (NTC661135, SEQ ID NO: 10), the OL1 -G mutation (NTC711055, SEQ ID NO: l 1) or the OL1-G to T mutation (NTC711231, SEQ ID NO: 12) were transformed with the NTC9385R-EGFP plasmid and yields in shake flask determined (Table 2). The results demonstrated the OL1 -G and OL1 -G to T mutations dramatically improve temperature inducible R6K plasmid yields in shake flask culture. Improved yield with two different R6 plasmids (NTC9385R, Table 2; NTC9685R, Table 1) in either LB shake flask media or HyperGRO fermentation media demonstrates improved temperature inducible R6K plasmid is generic, and is not plasmid or growth media specific. Thus the invention can be utilized with a plurality of R6K origin vectors, in various plasmid growth media described in the art and various temperature induction profiles.
Likewise the pENT pR pL R6K Rep plasmids can be integrated into alternative E. coli strains to create production hosts. Any strain that is acceptable for plasmid production, such as JM108, BL21 , DH5, DH1, DH5a, GT1 15, GT1 16, DH10B, EC 100, can be converted to a high yield temperature inducible R6K plasmid production host by integration of a ρΓΝΤ pR pL R6K Rep plasmid into the genome. The pR pL R6K Rep expression cassette may alternatively be removed from the pENT vector backbone and directly integrated into the chromosome, for example, using Red Gam recombination cloning (for example, using the methods described in Datsenko and Wanner 2000 Proc Natl Acad Sci USA
97:6640-6645). The pR pL R6K Rep expression cassette may alternatively be transferred to a different vector backbone, such as integration vectors that target different phage attachment sites, for example, those described by Haldimann and Wanner 2001, J Bacteriol 183:6384-6393.
Table 2: NTC9385R-EGFP LB media shake flask production yields in R6K production strains
Figure imgf000025_0001
"Specific yield = mg plasmid L/OD6oo
These results are surprising since the art teaches that PL promoter mutations in the OL1 binding site such as V2 (OL1-G to T) are constitutive ly active due to an inability of the lambda repressor to stop expression from the PL promoter (Bailone and Galibert, Supra, 1980). While not limiting the application of the invention, it is possible that the lambda repressor is able to repress the PL promoter through binding to the OL2 and OL3 sites (FIG. 7) when the PL promoter is integrated in the genome; the lambda repressor may not be able to bind multiple copies of the mutated PL promoter as in a phage infection. The application of two independent OL1 mutations (OL1-G and OL1-G to T) to create cell lines for high yield R6K plasmid production demonstrates the general utility of PL promoters incorporating OL1 mutations to improve heat inducible chromosomal expression of a target protein. Any OL1 mutation is contemplated for use in the current invention. New OL1 mutations can be defined by standard methods known in the art, for example error prone mutagenesis of the OL1 region, with subsequent selection of beneficial OL1 mutations by screening for heat inducible target protein production. The target protein can be a Rep protein as described herein, or a fluorescent marker, or any target protein or RNA. Thus application of PL promoters incorporating OL1 mutations is contemplated generally as a platform for improved heat inducible chromosomal expression of any recombinant protein or RNA. This can be applied to improve heat inducible chromosomal expression of any recombinant protein or RNA using either shake flask (Table 2) or fermentation (Table 1) culture.
These cell lines may also be used to produce alternative R6K plasmids, such as CpGfree vectors, pCOR vectors, pGM169, etc. PL promoter vectors with the OL1 mutations may be used to improve expression of alternative target proteins or mRNAs from the genome.
These cell lines may also be used to produce alternative Rep protein dependent plasmids, such as ColE2-P9 replication origin plasmids (Examples 2 and 3), ColE2 related replication origin plasmids, etc. Numerous additional Rep protein dependent plasmids known in the art may also be produced using the cell lines of the invention. Many Rep protein dependent plasmids are described in del Solar et al Supra, 1998 which is included herein by reference.
Heat inducible target protein production may be further improved, by further mutating OL1-G and OL1-G to T or an alternative OL1 mutation to incorporate a mutation in the PL -10 GATACT sequence to make it more closely match the consensus TATAAT (-35 is already consensus TTGACA (FIG. 7).
Alternative temperature sensitive (ts) lambda repressors (cl) may be substituted for the cITs857 mutation utilized in the pINT vectors. Multiple alternative ts lambda repressors have been defined (for example, see Lieb M. 1979 J Virol 32:162 included herein by reference) or new ts lambda repressors may be isolated by screening for temperature sensitive cl function. Alternative integration methods rather than the described pINT pR pL integration vectors may be utilized such as integration of the pR pL expression cassette into the genome at defined sites using Red Gam recombination cloning (for example, using the methods described in Datsenko and Wanner Supra, 2000).
Example 2: ColE2-P9 replication origin plasmid production
Similar to plasmid R6K, the ColE2 replication origin is separate from the replication protein, so the ColE2 replication origin theoretically may be utilized to construct Rep protein dependent plasmids. Here application of the ColE2 replication origin, using ColE2-P9 as an example, to produce ColE2 Rep protein dependent plasmids is demonstrated (Example 3).
ColE2 background: The ColE2 replication origin (for example, ColE2-P9) is highly conserved across the ColE2-related plasmid family (15 members are compared in Hiraga et al Supra, 1994, and 53 ColE2 related plasmid members including ColE3 are compared in Yagura et al Supra, 2006, both references are included herein by reference). Plasmids containing this origin are normally 10 copies/cell (low copy #). For application in gene therapy or DNA vaccination vectors, the copy number of ColE2 replication origin vectors needs to be improved dramatically.
Expression of the ColE2-P9 replication (Rep) protein is regulated by antisense RNA (RNAI). Copy number mutations have been identified that interfere with this regulation and raise the copy number to 40/cell (Takechi et al 1994 Mol Gen Genet 244:49-56). pINT pR pL ColE2 Rep protein cell line NTC641711: The ColE2 Rep protein (SEQ ID NO: 15) was expressed using the heat inducible pINT pR pL vector as described in Example 1. The ColE2 RNAI region was removed and replaced with an optimal kozak-ATG region. This modification deletes the RNAI - 10 promoter box. The Rep internal RNAI -35 box (Yasueda et al 1994 Mol Gen Genet 244:41 - 48) was mutagenized (from (opposite strand) TTGAAG to CTGAAG) to lower the consensus. A high copy mutation in the Rep coding region (C139T; Nagase et al 2008 Plasmid 59:36-44) was also incorporated.
These changes do not alter the Rep protein amino acid sequence (SEQ ID NO: 15).
The ColE2 Rep gene was PCR amplified from CGSC Strain # 8203 with following primers
15061101 : ggaacgggatccagaaggagatatacatatgagtgccgtacttcagcgcttcaggga (SEQ ID NO:26)
15061102: ggaacggaattcttatcattttgcgagatctggatcacat (SEQ ID NO:27)
The 920 bp PCR product was digested with BamHI EcoRI and cloned into BamHI EcoRI digested pINT pR pL BamHI/EcoRI (3766, polylinker). Recombinant clones were selected by restriction digestion and sequence verified. The map of the resultant pINT pR pL CoE2 Rep integration vector is shown in FIG. 8. The integration plasmid was integrated into NTC54208 (XLlBlue-sacB [dcm-]) to create cell line NTC641711 as described in Example 1. A kanR ColE2-P9 replication origin fluorescent reporter plasmid (pDNAVACCUltra5-C2-P5/6,4/6- T7RBS EGFP) was constructed to select for copy number improving mutations. The 1067 bp pUC replication origin was removed from the kanR pDNAVACCUltra5 -P5/6,4/6-T7RBS EGFP vector (the pDNAV ACCUltra5 -EGFP vector disclosed in Williams JA, 2006 World patent application WO06078979, modified to express the EGFP reporter in E. coli utilizing the weak constitutive P5/6,4/6 promoter disclosed in Lissemore JL, Jankowski JT, Thomas CB, Mascotti DP, deHaseth PL. 2000. Biotechniques 28: 82-89 and included herein by reference) by Nhel-Dralll digestion, and replaced with a 132 bp ColE2-P9 replication origin (+7-ssiA; see below). Recombinant clones were recovered in cell line NTC641711 and the ColE2 origin confirmed by restriction digestion and sequence verification. This demonstrates that the ColE2-P9 Rep protein cell line NTC641711 can be used to select and propagate ColE2 replication origin containing plasmids.
ColE2 Rep protein mutagenesis, selection of copy number increasing mutants
Background: The ColE2 Rep protein binds as a monomer to the ColE2 replication origin. However, Rep protein exists mostly as a dimer in solution; Rep dimerization will limit the amount of active monomelic Rep which is hypothesized will maintain ColE2 plasmid at a low copy number (Han M,
Aoki K, Yagura M, Itoh T. 2007. Biochem Biophys Res Commun 353 :306). Copy number autoregulation by Rep protein dimerization is a common copy number control mechanism.
Significantly, R6K Rep protein mutations such as P106L (PIR116) utilized in Example 1 that interfere with dimer formation dramatically increase copy number (Abhyankar et al Supra, 2004). It was hypothesized that ColE2 plasmid copy number can also be increased with a dimerization deficient Rep mutation.
Mutagenesis: ColE2 Rep protein functional domains have been mapped and a region responsible for dimerization defined (FIG. 8). The dimerization region was mutagenized using the GeneMorph II Random Mutagenesis Kit (Stratagene) as described (Lanza AM, Alper HS. 2011. Methods in Molecular Biology, Vol. 765, Strain Engineering: Methods and Protocols, Ed. J. A. Williams, Humana Press Inc., Totowa, NJ. pp 253-274). The Rep gene was error prone PCR amplified from the pINT pR pL ColE2 Rep vector with the kit enzyme. The mutagenized dimerization domain (359 bp BstBl EcoRI fragment; FIG. 8) was cloned back into the pINT pR pL ColE2 Rep vector replacing the non mutagenized 359 bp BstBl EcoRI fragment. An integrated pINT pR pL ColE2 Rep library was then made by mass genome integration without purification of the mutagenized plasmid pool into NTC54208 containing the pAH69 integration plasmid. The integrated Rep library was transformed with the kanR pDNAVACCUltra5-C2-P5/6,4/6-T7RBS EGFP fluorescent ColE2 reporter plasmid and transformants plated on LB+kanamycin agar plates and grown at 37°C. This EGFP reporter plasmid allows 1 ) visual selection of plasmid copy number improvement using a Dark Reader for agar plate illumination; and 2) quantitative copy number evaluation (fluorescence is linear with copy number) in liquid culture using a fluorometer (BioTek FLx800 microplate fluorescence reader).
Two colonies were isolated from 30,000 screened cells with significantly higher colony fluorescence. Both cell lines were verified to have improved pDNAVACCUltra5-C2-P5/6,4/6-T7RBS EGFP plasmid copy number in liquid culture demonstrating increased fluorescence corresponds to increased copy number.
The lambda repressor- PL -ColE2 Rep regions from genomic DNA from these two cell lines were amplified by PCR and sequenced to determine the basis for improvement. One colony had a mutation in the lambda repressor which presumably reduces the activity of the repressor leading to Rep protein overexpression. This demonstrates that alternations to the vector backbone that increase PL promoter activity improve ColE2 plasmid copy number. Thus ColE2 copy number, like R6K plasmids, will be improved by making a cell line with the ColE2 Rep protein (or Rep protein copy number improving mutations) expressed from pINT pR pL vectors incorporating the lambda repressor binding site OL1 mutations (OL1-G and OL1-G to T) identified in Example 1.
The second colony had a mutation in the Rep protein (G194D; SEQ ID NO:16). This mutation was introduced back into the pINT pR pL ColE2 Rep vector to create the pINT pR pL ColE2 Rep protein mutant (G194D) (SEQ ID NO: 18). The integration plasmid was integrated into NTC54208 (XLlBlue- sacB [dcm-]) to create cell line NTC701131 as described in Example 1. ColE2 plasmid production yields were improved in the ColE2 Rep protein mutant cell line NTC701131, compared to the parental ColE2 Rep protein cell line NTC641711 in both shake flask and fermentation culture (Table 3). This demonstrates that the ColE2 Rep protein, like the R6K Rep protein, can be mutagenized to create copy number improving variants. Combining the ColE2 Rep protein G194D mutant with pINT pR pL vector incorporating the lambda repressor binding site OL1 OL1-G to T mutation identified in Example 1 further increased copy number (cell line NTC710351 = NTC54208-pR pL (OL1-G to T) GolE2 rep G194D) and fermentation production yields (Example 3). Table 3: NTC9385C-Luc plasmid performance in different processes and production cell lines9
Figure imgf000030_0001
a All plasmid preparations at harvest were high quality monomer.
b Specific yield = mg plasmid L/OD60o c Plasmid + media from Thomson Instruments Company Additional rounds of mutagenesis of the wild type Rep protein, or mutagenesis of mutant Rep protein such as G194D may be performed to further improve copy number. The entire Rep protein or subfragments can be mutagenized (e.g. BamHl-EcoRI fragment for entire Rep protein; FIG. 8). The ideal mutant will be similar to the R6K Rep protein mutants 'P42L and PI 13S' and 'P42L, P106L and F107S' (Example 1) with higher copy number at 37-42°C (i.e. higher levels of replication inducing monomeric Rep protein are produced from the heat inducible PR PL promoters) to facilitate adaptation into NTC's inducible fermentation plasmid production process as in Example 1.
ColE2 origin vectors: The following vectors containing the minimal ColE2-P9 origin (Y agura and Itoh 2006 Biochem Biophys Res Commun 345:872-877) and various origin region modifications were constructed.
-f7-ssiA: This combines the ColE2 origin (+7) (SEQ ID NO:4) with ssiA from plasmid R6K (SEQ ID NO:21). Thus ssiA vectors contain, in addition to the ColE2-P9 origin, a downstream primosome assembly site. Like most plasmid origins, the ColE2 origin contains a primosomal assembly site about 100 bp downstream of the origin (Nomura et al Supra, 1991). This site primes lagging strand DNA replication (Masai et al 1990 J Biol Chem 265:15124-15133) which may improve plasmid copy number or plasmid quality. The ColE2 PAS (ssiA) is similar to PAS-BH (ColEl ssiA =PAS-BL Marians et al 1982 J Biol Chem 257:5656-5662) and both sites (and PAS-BH) are CpG rich 0X174 type PAS. A CpG free PAS (ssiA from R6K; Nomura et al Supra, 1991 ; SEQ ID NO:21) that acts as a dnaA, dnaB dnaC (ABC) primosome on a dnaA box hairpin sequence (Masai et al 1990 J Biol Chem 265:15134-15144) was selected for inclusion in the +7-ssiA vectors. Alternative ABC or 0X174 type PAS sequences are functionally equivalent to ssiA from R6 , and may be substituted for ssiA in these ColE2 replication origin vectors. +7-ssiA vectors were constructed by replacing the pUC origin Nhel-Dralll region (FIG. 1) with a Nhel-Dralll compatible synthetic ssiA-+7 ColE2 origin restriction fragment (FIG. 2, FIG.4). Plasmids were transformed into ColE2 plasmid production NTC641711. The correct ColE2 vectors were identified by restriction digestion and sequence verified.
+7 (no ssiA): This deletes the ssiA sequence from +7-ssiA while retaining the ColE2 origin (+7) (SEQ ID NO:4). The ssiA sequence was removed by Nhel-Mfel digestion, the sites blunted with Klenow and the vector religated to delete the 64 bp ssiA region. Plasmids were transformed into ColE2 plasmid production host NTC64171 1. The correct ColE2 vector was identified by restriction digestion and sequence verified.
+7 CpG-ssiA: This combines the ColE2 replication origin (+7 CpG) (SEQ ID NO:5) with ssiA from plasmid R6K (SEQ ID NO:21). The single CpG in the ColE2 replication origin (Table 4) was removed from the vector by site directed mutagenesis. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
+ 16-ssiA: This combines the ColE2 replication origin (+16) (SEQ ID NO: 7) with ssiA from plasmid R6K (SEQ ID NO:21). A 16 bp region of homology downstream of the ColE2-P9 replication origin is conserved with the ColE3 replication origin. This 16 bp region was added to the vector by site directed mutagenesis. Plasmids were transformed into ColE2 plasmid production host NTC641711. The correct ColE2 vector was identified by restriction digestion and sequence verified.
Min-ssiA: This combines the ColE2 Min replication origin (SEQ ID NO:6) with ssiA from plasmid R6K (SEQ ID NO:21). This is the minimal 32 bp ColE2 sequence sufficient for replication defined by Yasueda et al 1989 Mol Gen Genet 215:209) (SEQ ID NO:28), extended by an additional 6 bp (Table 4). This vector was created by site directed mutagenesis of the +7-ssiA clone. Plasmids were transformed into ColE2 plasmid production host NTC64171 1. The correct ColE2 vector was identified by restriction digestion and sequence verified.
The series of plasmids were transformed into ColE2 plasmid production host NTC701 131 (Rep mutant). The resultant cell lines were then used determine plasmid copy number and quality (Table 4). Two different backbones were evaluated with the +7-ssiA and +16-ssiA ColE2 replication origins to determine the effect of plasmid sequence alterations.
The results demonstrate that the four replication origin variants containing the ssiA sequence [+7- ssiA; +16-ssiA; +7 (CpG free) ssiA; Min-ssiA] are functional in NTC701 131 , replicating to a similar copy number (0.73-lx). All plasmids were high quality monomer. This demonstrates that any of these minimal ColE2 origin variants can function as a plasmid replication origin to produce high quality plasmid. Yagura et al Supra, 2006 have demonstrated that the Min ColE2 Replication origin (SEQ ID NO:28, which is reverse complement of residues 7-38, in Figure 1 of Yagura et al Supra, 2006) can be further deleted without eliminating replication function. Yagura et al, Supra, 2006, demonstrated that the core sequence is residues 8-35, with residues 5-36 are required for full activity. The +7 ColE2 Replication origin (SEQ ID NO:4; which is the reverse complement of residues 0-44 in Figure 1 of Yagura et al Supra, 2006) could therefore be reduced to span residues 8-35 or 5-36 of Figure 1 of Yagura et al Supra, 2006. Such vectors should replicate similarly to the disclosed vectors. As well, a number of base changes can be made within the core ColE2 origin 8-34 region that do not affect ColE2 replication (see changes to residues that retain function in Table 2 in Yagura et al Supra, 2006). A surprising observation that is contrary to the teachings of Yagura et al Supra, 2006 is that the +7(CpG free)-ssiA ColE2 origin is fully functional. This origin contains a change of a G to C in residue 36 (Figure 1 Yagura et al Supra, 2006). This change is predicted to reduce origin activity (Relative transformation frequency 5 fold reduced with 36 G-C to C-G; Table 2 in Yagura et al Supra, 2006). This may be due to the different context in the +7(CpG free)-ssiA ColE2 origin, or the longer origin fragment (0-44). Regardless, the 121 bp +7(CpG free)-ssiA ColE2 origin (SEQ ID NO 29) or +7(CpG free) ColE2 origin (SEQ ID NO 5) are smaller CpG free replication origin alternatives to the 260 bp CpG free R6K replication origins (SEQ ID NO:22). CpG free ColE2 origins may be utilized to construct CpG free plasmid vectors, or to retrofit the replication origin in existing vectors with a CpG free alternative replication origin. Combinations of a CpG free ColE2 or R6 replication origin with a CpG free RNA-OUT selection marker may be utilized to construct antibiotic free CpG free plasmid vectors, or to retrofit the selection marker- replication origin region in existing vectors with an antibiotic free-CpG free alternative selection marker- replication origin;
The ssiA sequence was not necessary for plasmid replication, although removal of ssiA in +7 (no ssiA) reduced copy number to 55% of +7 (ssiA). Thus inclusion of a primosomal assembly site is beneficial to ColE2 plasmid copy number. Table 4: ColE2 Origin EGFP vector production in NTC701131 ColE2 production cell line b
Figure imgf000033_0001
" Average specific yield/+7-ssiA average specific yield (specific yield = mg plasmid/L/OD6oo) b Plasmid+ media, 37°C throughout growth conditions. All plasmid preparations at harvest were quality monomer
0 NTC ColE2 origin sequences
+7: caaaagggcgctgttatctgataaggcttatctggtctcattttg (SEQ ID NO:4) Min bold underlined
+7 (CpG free): caaaagggG_gctgttatctgataaggcttatctggtctcattttg (SEQ ID NO:5)(C to G change in bold underlined core to eliminate CpG is uppercase double underlined)
Min: The 32 bp minimal origin defined by Yasueda et al Supra, 1989 (SEQ ID NO: 28) is Bold underlined): ggcgctgttatctgataaggcttatctggtctcatttt (SEQ ID NO:6)
+16: CTGCTCAAAAAGACGCcaaaagggcgctgttatctgataaggcttatctggtctcattttg(SEO ID NO:7) Min bold underlined, additional 16 bp in +16 is uppercase Example 3: NTC9382C , NTC9385C, NTC9382R , NTC9385R, NTC9682C , NTC9685C, NTC9682R , and NTC9685R vectors
A series of AF eukaryotic expression vectors incorporating these novel ColE2-P9 derived vector origins were made. To replace the pUC origin, the +7 (ssiA) ColE2 origin from Example 2 was selected as well as the R6K origin (SEQ ID NO:l) from Example 1. The features of these vectors (NTC9382C , NTC9385C, NTC9382R , NTC9385R, NTC9682C , NTC9685C, NTC9682R , and NTC9685R) are summarized in Table 5. NTC9682C , NTC9685C (FIG. 2), NTC9682R , NTC9685R (FIG. 3) are antibiotic-free RNA-OUT ColE2 origin (C) or R6 origin (R) versions of the pUC origin NTC8682, TC8685 (FIG. 1) equivalents disclosed in Williams JA, Supra, 2010. These vectors contain the SV40 enhancer upstream of the CMV enhancer, and Adenoviral serotype 5 VA RNAI regulatory RNA (VARNAI) . NTC9382C , NTC9385C (FIG. 4), NTC9382R , NTC9385R (FIG. 5) are versions without the SV40 enhancer or VARNAI sequences.
NTC9682C, NTC9682R, NTC9382C, and NTC9382R all express the secreted transgene product as TPA fusion proteins while NTC9685C, NTC9685R, NTC9385C, and NTC9385R all express the native transgene product from a vector encoded ATG start codon.
The remainder of the vector sequences is identical between the different vectors, with the exception that the two R vectors NTC9682R and NTC9382R (FIG. 3, FIG. 5) contain the trpA bacterial terminator, which is absent in the two C vectors NTC9682C and NTC9382C (FIG. 2, FIG. 4).
An R6 gamma origin vector was constructed by swapping in the R6K gamma origin (SEQ ID NO:l) in a Notl-DralTI R6 origin synthetic gene for the corresponding Notl-Dralll pUC origin region in NTC8685. The NTC9682R , NTC9685R NTC9382R , NTC9385R vectors were made by standard restriction digestion mediated fragment swaps. The ColE2 origin vectors were constructed in a similar fashion, by swapping in the +7 ssiA ColE2 origin in a Nhel-Dralll synthetic gene for the corresponding Nhel-Dralll pUC origin region. The NTC9682C, NTC9685C, NTC9382C ,
NTC9385C vectors were made by standard restriction digestion mediated fragment swaps. The 466 bp Bacterial region [Nhel site-trpA terminator-R6K Origin-RNA-OUT-Kpnl site] for NTC9385R and NTC9685R is shown in SEQ ID NO: 19. The 281 bp Bacterial region [Nhel site-ssiA-ColE2 Origin (+7)-RNA-OUT- pnI site] for NTC9385C and NTC9685C is shown in SEQ ID NO:20. High fermentation yields in HyperGRO media are obtained with these vectors. For example 695 mg mL with NTC9685R-EGFP in R6K production cell line NTC711231 (Table 1) and 672 mg/L with NTC9385C-EGFP in ColE2 production cell line NTC710351.
These are just a few possible nonlimiting vector configurations. Many alternative vector configurations incorporating the novel R6K or ColE2 origin vector modifications may also be made, including but not limited to vectors with alternative selection markers, alternative promoters, alternative terminators, and different orientations of the various vector-encoded elements or alternative R6K or ColE2 origins as described in Examples 1 and 2.
Table 5: NTC9382C , NTC9385C, NTC9382R , NTC9385R, NTC9682C , NTC9685C, NTC9682R , and NTC9685R vectors
Figure imgf000035_0001
An example strategy for cloning into these vectors is outlined below.
GTCGACATG- Gene of interest— -Stop codon AGATCT
Sail BgHl
For the NTC9385C, NTC9685C, NTC9385R, and NTC9685R vectors, the ATG start codon (double underlined) is immediately preceded by a unique Sail site. The Sail site is an effective ozak sequence for translational initiation. In NTC9382C, NTC9682C, NTC9382R, and NTC9682R, the Sail site is downstream in frame with the optimized TPA secretion sequence (SEQ ID NO:25). The TPA ATG start codon is double underlined and the Sail site single underlined.
SEQ ID NO:25: TPA secretion sequence
ajggatgcaatgaagagagggctctgctgtgtgctgctgctgtgtggagcagtcttcgmcgcccagcggtaccggatccgtegac For precise cloning, genes are copied by PCR amplification from clones, cDNA, or genomic DNA using primers with Sail (5' end) and Bglll (3' end) sites. Alternatively, genes are synthesized chemically to be compatible with the unique Sail I Bglll cloning sites in these vectors. For NTC9385C, NTC9685C, NTC9385R, and NTC9685R, the start codon ATG may immediately follow the Sail site fGTCGACATGt since the Sail site is a high function ozak sequence. For all vectors one or two stop codons (preferably TAA or TGA) may be included after the open reading frame, prior to the BgHl site. A PCR product or synthetic gene designed for NTC9385C, NTC9685C, NTC9385R, and NTC9685R is compatible with, and can also be cloned into, the NTC9382C, NTC9682C, NTC9382R, and NTC9682R vectors.
EGFP and muSEAP transgene versions NTC9385C, NTC9685C, NTC9385R, and NTC9685R were constructed by standard restriction fragment swaps. The muSEAP gene is secreted using its endogenous secretion signal, while EGFP is cell associated. Expression levels in vitro were determined using EGFP, while expression levels in vivo were determined using muSEAP. Expression levels were compared to the NTC8685 parent vector, the gWIZ vector, and a minicircle comparator.
Adherent HEK293 (human embryonic kidney), A549 (human lung carcinoma),cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA). Cell lines were propagated in Dulbecco's modified Eagle's medium/F12 containing 10% fetal bovine serum and split (0.25% trypsin-EDTA) using Invitrogen (Carlsbad, CA, USA) reagents and conventional methodologies. For transfections, cells were plated on 24-well tissue culture dishes, plasmids were transfected into cell lines using Lipofectamine 2000 following the manufacturer's instructions (Invitrogen).
Total cellular lysates for EGFP determination were prepared by resuspending cells in cell lysis buffer (BD Biosciences Pharmingen, San Diego, CA, USA), lysing cells by incubating for 30 min at 37°C, followed by a freeze-thaw cycle at -80 °C. Lysed cells were clarified by centrifugation and the supernatants assayed for EGFP by FLX800 microplate fluorescence reader (Bio-Tek, Winooski, VT, USA). The results are summarized in FIG. 9 and Table 6.
Groups of five mice were injected with plasmid DNA in an IACUC-approved study. Five micrograms of muSEAP plasmid in 25 or 50 μΐ, of phosphate-buffered saline (PBS) was injected intramuscularly (IM) into a tibialis cranialis muscles of female BALB/c mice or ND4 Swiss Webster mice (6 to 8 weeks old) followed by Ichor TriGrid electroporation. SEAP levels in serum were determined using the Phospha-light SEAP Reporter Gene Assay System from Applied Biosystems (Foster City.CA) according to the manufacturer's instructions. The results are summarized in FIG. 10 and Table 6.
The NTC9385C, NTC9685C, NTC9385R, and NTC9685R vectors had similar expression to the parent NTC8685 vector in vitro, and higher expression than the gWIZ comparator (FIG. 9). Thus substitution of the R6 or ColE2 replication origin for the pUC origin was not detrimental for eukaryotic cell expression. However, surprisingly, in vivo expression was dramatically improved compared to NTC8685 or gWIZ with the ColE2 and R6K origin vectors (FIG. 10). For example the NTC9385C vector was unexpectedly improved 1.5 to 3.8x that of NTC8385 (Table 6) or NTC8685 (not shown) after IM delivery with EP.
Table 6: gWIZ and NTC9385C Nanoplasmid expression compared to NTC8685
Figure imgf000037_0001
" 100 ng/well EGFP transgene vectors transfected with lipofectamine into HEK293 cells b murine SEAP (muSEAP) transgene vectors in 8-10 week old BALB/c or ND4 Swiss Webster female mice, 5 μg dose with EP intramuscular into one anterior tibialis muscle followed by Ichor TriGrid electroporation. 25 \xL dose for ND4 mice, 50 μί dose for BALB/c.
c Minicircle equivalent to NTC9385C or NTC9385R, with Nhel-Kpnl region containing the replication origin and RNA-OUT selection marker (bacterial region) removed from NTC8385- muSEAP by Spel/Nhel digestion, gel purification of the eukaryotic region, in vitro ligation and supercoiling with DNA gyrase. The Spel site is the same site used to truncate the CMV promoter to make NTC8685 and the NTC9385C-muSEAP vector so the minicircle eukaryotic region is the same as NTC9385C-muSEAP, the difference being the C2 and RNA-OUT region including the Kpnl site is deleted in the minicircle. NA = Not assayed This improved in vivo expression was not specific to the CMV promoter. Versions of
NTC8685-muSEAP and NTC9385C-muSEAP were constructed in which the murine creatine kinase (MCK) promoter (3 copies of the MCK Enhancer upstream of the MCK promoter and 50 bp of the MCK exon 1 leader sequence; Wang B, Li J, Fu FH, Chen C, Zhu X, Zhou L, Jiang X, Xiao X. 2008. Gene Ther 15:1489) was substituted for the CMV promoter. The swaps replaced the entire CMV enhancer CMV promoter-exon 1 leader (NTC8685: from a Xbal site immediately after the SV40 enhancer to a SacII site in the CMV derived exon 1 leader sequence FIG. 1; NTC9385C: from the Kpnl site to a SacII site in the CMV derived exon 1 leader sequence FIG. 4) with the MCK enhancer, MCK promoter-exon 1 leader retaining the HTLV-I R portion of exon 1. Purified plasmid DNA from the resultant vectors, NTC8685-MCK-muSEAP (4847 bp) and NTC9385C-MCK- muSEAP (3203 bp), was injected ΓΜ into one anterior tibialis muscle of 8-10 week old BALB/c female mice (5 mice/group), 5 μg dose in 50 μΐ-, followed by Ichor TriGrid electroporation as described in Table 6. SEAP levels in serum was determined on day 28 (T=28) post delivery. The NTC9385C-MCK-muSEAP vector (98.4 ± 55.8) had 4.5x higher average expression than NTC8685- muSEAP (22.0 ± 10.9). All 5 NTC9385C-MCK-muSEAP injected mice had higher muSEAP levels than any of the NTC8685-muSEAP mice. This demonstrates that improved in vivo expression with the Nanoplasmid vectors of the invention is not specific to the CMV promoter.
While the basis for expression improvement is unknown, it is not simply due to the size difference between the parent pUC origin vectors and the modified R6K origin-RNA selection marker or ColE2 origin-RNA selection marker vectors of the invention, since expression was not improved with a minicircle comparator vector that contains no bacterial region (Table 6). This demonstrates improved in vivo expression with the R6K origin-RNA selection marker or ColE2 origin-RNA selection marker vectors is not the result of simple elimination of a threshold amount of bacterial region sequences.
Reduction of the vector spacer region size as described herein by replacement of the spacer region replication origin and selection marker with the R6K, ColE2 origin-RNA selection marker vectors of the invention will also increase the duration of in vivo expression since expression duration is improved with plasmid vectors in which the bacterial region is removed (minicircle) or replaced with a spacer region of up to at least 500 bp (Lu J, Zhang F, Xu S, Fire AZ, Kay MA. 2012. Mol Ther. 20:2111-9). Thus the replicative minicircle vectors of the invention also have additional utility for applications requiring extended duration expression, such as: liver gene therapy using hydrodynamic delivery with transgenes such as a -1 antitrypsin (AAT) for AAT deficiency, Coagulation Factor VIII for Hemophilia A Therapy or Coagulation Factor ΓΧ for Hemophilia B Therapy etc: lung gene therapy with transgenes such as Cystic fibrosis transmembrane conductance regulator (CFTR) for cystic fibrosis etc; muscle gene therapy with transgenes such as the GNE gene for Hereditary inclusion body myopathies (HIBM), or dystrophin or dystrophin minigenes for duchenne muscular dystrophy (DMD). Example 4: Spacer region and intron modified Nanoplasmid vectors NTC8685 (SR = 1465 bp) has much lower expression than NTC9385R (SR = 466 bp) and NTC9385C (SR = 281 bp). A minimal pUC origin vector was constructed with an 866 bp spacer region
(NTC8385-Min; contains Pmin minimal pUC origin-RNA-OUT). These vectors were tested for expression in vitro (lipofectamine 2000 delivery) and in vivo after intradermal electroporation delivery. As with Intramuscular injection (Example 3), the results (Table 7) demonstrated ColE2 and R6K origin vector dramatically improved in vivo expression after intradermal delivery compared to NTC8685. For example the NTC9385C vector was unexpectedly improved 2.7 to 3.1x compared to NTC8685 while the NTC9385R vector was unexpectedly improved 5.3 to 6.3x that of NTC8685 (Table 7). The 866 bp minimal pUC origin vector also improved expression to 1.4-1.9 x that of NTC8685. This demonstrates improved in vivo expression with the NTC9385C and NTC9385R vectors is not limited to muscle tissue, and is observed also after intradermal delivery. Inclusion of the C2x4 eukaryotic transcription terminator in the NTC9385C vector further improved in vivo expression to 2.9 to 4.1x compared to NTC8685. This demonstrates improved in vivo expression with Nanoplasmid vectors may be obtained with alternative/additional sequences flanking the bacterial region.
A NTC9385R derivative was made in which the RNA-OUT antibiotic free marker was transferred to the intron (NTC9385Ra-02 SEQ ID NO:39; RNA-OUT SEQ ID NO:23) inserted into the unique Hpal site in the intron (SEQ ID NO: 30). This vector encodes the R6K rephcation origin in the spacer region (SR = 306 bp). To determine splicing accuracy NTC9385Ra-02-EGFP was transfected into the A549 cell line and cytoplasmic RNA isolated. The RNA was reverse transcribed using an EGFP specific primer, and PCR amplified using Exon 1 and Exon 2 specific primers. The resultant PCR product (a single band) was determined by sequencing to be the correct spliced exonl-exon2 fragment. This demonstrated that intronic RNA-OUT is accurately removed by splicing and does not interfere with splicing accuracy. NTC9385Ra-02-EGFP also demonstrated improved in vivo expression compared to NTC8685 (Table 7: 1.6-3.5 x). This demonstrates that Nanoplasmid vectors with improved expression of the current invention may encode the RNA selection marker in the intron rather than the spacer region. The improved expression level after intradermal delivery demonstrates the application of
Nanoplasmid vectors of the invention for cutaneous gene therapy applications, for example, for wound healing, burns, diabetic foot ulcer, or critical limb ischemia therapies using growth factors such as hypoxia inducible factor, hypoxia inducible factor 1 a, keratinocyte growth factor, vascular endothelial growth factor (VEGF), fibroblast growth factor- 1 (FGF-1 , or acidic FGF), FGF-2 (also known as basic FGF), FGF-4, placental growth factor (P1GF), angiotensin-1 (Ang-1), hepatic growth factor (HGF), Developmentally Regulated Endothelial Locus (Del-1), stromal cell derived factor-1 (SDF-1), etc. Table 7: SR vector expression in vitro and in vivo
Figure imgf000040_0001
Prokaryotic terminator = T; HTLV-IR =HR; B globin 3' acceptor site = β; RNA-OUT =AF;
pUC origin = P; minimal pUC origin = Pmill; R6K origin =R; ColE2-P9 origin = C; C2x4 eukaryotic transcription terminator = C2x4
b All plasmids produced in XLlBlue dcm- host strains. P vectors were produced in dcm- XLlBlue NTC54208; R vectors were produced in dcm- R6K rep cell line NTC711231 (OL1 G to T); C vectors were produced in dcm- ColE2 rep cell line NTC710351 (OL1 G to T).
c Dose = 50 μg in 50 μΐ saline injected intradermal (ID) with EP on day 0. 6 mice/group. Mean ± SD pg/mL muSEAP reported for day 4, 7 and 14. () Mean muSEAP standardized to NTC8685 d muSEAP plasmid DNA transfected with Lipofectamine 2000. Mean ± SD A405 reported
48 hrs post transfection. () Mean A405 standardized to NTC8685
e Pmin minimal pUC origin (SEQ ID NO: 42) and RNA-OUT (bacterial region = SEQ ID NO:43)
Example 5: RNA Pol III Nanoplasmid vectors
An example Nanoplasmid vector for RNA Pol HI directed expression of RNA is shown in
FIG. 11. This vector contains the human HI RNA Pol III promoter, but an alternative promoter such as the murine U6 promoter can be substituted. This example vector expresses a 22 bp shRNA target RNA, but alternative RNAs may be expressed, including shorter or longer shRNAs, microRNAs, aptamer RNAs, hairpin RNAs, etc. This example vector is very small, with a monomer size of 442 bp. Small size is advantageous, since vectors <1.2 kb are highly resistant to shear forces used with gene therapy delivery formulation (Catanese et al 2012. Gene Ther 19:94-100).
RNA Pol III Nanoplasmid vectors were made by standard restriction digestion mediated fragment swaps to combine either U6 or HI RNA Pol ΠΙ promoter-target RNA-TTTTTT terminator (Eukaryotic region) with either the 466 bp Bacterial region [Nhel site-trpA terminator-R6K Origin- RNA-OUT- pnl site; SEQ ID NO: 19] for NTC9385R-U6 and NTC9385RE-U6 vectors (Table 8) or the 281 bp Bacterial region [Nhel site-ssiA-ColE2 Origin (+7)-RNA-OUT-KpnI site; SEQ ID NO:20] for NTC9385C-U6 and NTC9385CE-U6 vectors (Table 8). Versions were modified to express from the U6 promoter eRNA18, a single stranded RNA the expression of which can be quantified by
Reverse transcriptase dependent RT-PCR. Vector performance (U6 promoter mediated eRNA18 RNA expression) was determined in total RNA extracted from HE 293 at either 25 or 48 hrs after lipofectamine 2000 mediated transfection as described (Luke J, Simon GG, Soderholm J, Errett JS, August JT, Gale M Jr, Hodgson CP, Williams JA. 2011. J Virol. 85:1370). These results (Table 9) demonstrate Nanoplasmid RNA Pol III vectors direct dramatically improved RNA expression relative to a plasmid RNA Pol ΙΠ vector (NTC7485-U6-eRNA18) comparator.
Random 22 bp shRNA (KP2F11) versions of NTC9385CE-U6 (903 bp NTC9385CE-U6- KP2F11 shRNA propagated in ColE2 rep cell line NTC710351) and NTC9385R-U6 (855 bp NTC9385R-U6-KP2F11 shRNA propagated in R6K rep cell line NTC711231) were fermented in HyperGRO media as described in Example 1 except fermentation and cultures for inoculations were grown at 37°C throughout. Final yields were 149 mg/L (NTC9385CE-U6-KP2F11) and 216 mg/L (NTC9385R-U6-KP2F11 shRNA). This demonstrates that Nanoplasmid vectors for RNA Pol ΠΙ expression (and RNA Pol II; Example 3) have superior manufacturing simplicity and yield compared to shRNA expressing minicircle vectors (Zhao et al 2011. Gene Ther 18:220-224). For example, optimal manufacture of minicircle vectors yields only 5 mg of minicircle per liter culture (Kay MA, He CY, Chen ZY. 2010. Nat Biotechnol 28:1287-1289).
Table 8: RNA Pol III Nanoplasmid vector expression
Figure imgf000042_0001
b Standardized mU6 expression compared to NTC7485-U6 shRNA eRNA18 vector (C)= test vector average pg RNA/C vector average pg RNA x test vector size (bp)/2978 l00% c Pmin minimal pUC origin (SEQ ID NO: 42) and RNA-OUT (bacterial region = SEQ ID NO:43) with SV40 enhancer. HI promoter version (with shRNA and no SV40) is 1035 bp d R6 origin and RNA-OUT (bacterial region = SEQ ID NO: 19). HI promoter version (with shRNA) is 635 bp
e C2 origin and RNA-OUT (bacterial region = SEQ ID NO: 20). HI promoter version (with shRNA) is 442 bp (FIG. 11)
Example 6: Alternative RNA selection marker Nanoplasmid vectors
Expression of Nanoplasmid vectors encoding RNA-OUT in the intron (both orientations of RNA- OUT SEQ ID NO:23 inserted into the unique Hpal site in the intron SEQ ID NO:30; NTC9385Ra-01 dual and NTC9385Ra-02 dual) demonstrated robust expression with RNA-OUT in either orientation in the intron (Table 9). Consistent with this, similarly high levels of expression are obtained with NTC9385Ra-01 (SEQ ID NO:40) and NTC9385Ra-02 (SEQ ID NO:39) which have opposite orientations of intronic RNA-OUT marker and the R6K origin in the spacer region. Nanoplasmid variants with the pMBl antisense RNA RNAI (SEQ ID NO:31) with promoter and terminator region (RNAI selectable marker: SEQ ID NO:32 flanked by DraIII-ΚρηΙ restriction sites for cloning as described previously for RNA-OUT) substituted for RNA-OUT were constructed and tested for expression to determine if alternative selection markers may be utilized in place of RNA-OUT. The results (Table 9) demonstrate alternative RNA selection markers may be substituted for RNA-OUT. Substitution of RNAI for RNA-OUT in the vector backbone (NTC9385Ra-RNAI-01) or in the intron in either orientation (NTC9385R-RNAI-01 and NTC9385R-RNAI-02) did not reduce expression relative to the corresponding RNA-OUT construct. To determine splicing accuracy, NTC9385R- RNAI-Ol-EGFP and NTC9385R-RNAI-02-EGFP were transfected into the A549 cell line and cytoplasmic RNA isolated from transfected HEK293 and A549 cells using the protein and RNA isolation system (PARIS kit, Ambion, Austin TX) and quantified by A26o- Samples were DNase treated (DNA-free DNase; Ambion, Austin TX) prior to reverse transcription using the Agpath-ID One step RT-PCR kit (Ambion, Austin TX) with a EGFP transgene specific complementary strand primer. Intron splicing was determined by PCR amplification of the reverse transcribed cytoplasmic RNA with the exon 1 and exon 2 specific primers. The resultant PCR product (a single band in each case) was determined by sequencing to be the correct spliced exonl-exon2 f agment. This demonstrated that, like intronic RNA-OUT, intronic RNAI in either orientation is accurately removed by splicing and does not interfere with splicing accuracy. This demonstrates that alternative RNA based selection markers could be substituted for RNA-OUT in the spacer region or the intron and that pMB 1 RNAI is a preferred RNA based selection marker.
The RNAI transcription unit (SEQ ED NO: 32) may be substituted for the RNA-OUT selection marker (SEQ ID NO: 23) in any of the constructs described in Examples 1-6. Alternatively, the 108 bp RNAI antisense repressor RNA (SEQ ID NO: 31) may be substituted for the 70 bp RNA-OUT antisense repressor RNA (SEQ ID NO: 24) retaining the flanking RNA-OUT transcription control sequences in any of the constructs described in Examples 1-6. RNAI regulated vectors may be grown in RNAII-SacB regulated cell lines further expressing, as required, R6K, ColE2-P9, or ColE2 related rep protein. RNAII-SacB regulated cell lines may be made replacing the RNA-ΓΝ sequence in pCAH63-CAT RNA-IN- SacB (P5/6 6/6) with a RNAII target sequence as described in Williams, JA Supra, 2008 included herein by reference. Alternatively, RNAI regulated vectors may be grown in any of the RNAII regulated chromosomal selection marker cell lines disclosed in Grabherr and, Pfaffenzeller Supra,. 2006; Cranenburgh Supra, 2009. These cell lines would be modified for expression, as required, of R6K, ColE2-P9, or ColE2 related rep protein. Another preferred RNA based selection marker, IncB plasmid RNAI (SEQ ID NO:33; SEQ ID NO:34), is shown in FIG. 12. A cell line for antibiotic free sucrose selection of IncB RNAI expressing plasmid vectors is created by modification of the genomically expressed RNA-IN-SacB cell lines for RNA-OUT plasmid propagation disclosed in Williams, JA Supra, 2008 by replacement of the 68 bp RNA-IN regulator in a Pstl-Maml restriction fragment with a 362 bp Pstl-Maml IncB RNAII regulator (SEQ ID NO:35). Alternatively, RNA-OUT may be substituted with one of the many RNA based selection markers know in the art. Table 9: High level expression is obtained with pMBl RNAI or RNA-OUT antisense RNA vectors
Figure imgf000044_0001
a ΐφΑ term = T; HTLV-IR =HR; B globin 3' acceptor site = β; RNA-OUT sucrose selection marker = AF; pUC origin RNAI antisense RNA = RNAI; pUC origin = P; R6K origin =R; ColE2 origin = C; BH = PAS-BH UP = upstream pUC plasmid derived DNA.
b EGFP plasmid DNA transfected with Lipofectamine 2000. Fluorescence units (FU) reported. Mean FU standardized to NTC8685
c HR β intron is 225 bp
d Pmin minimal pUC origin (SEQ ID NO: 42) and RNA-OUT (bacterial region = SEQ ID NO:43)
Thus, the reader will see that the improved expression vectors of the invention provide for rational approach to improve plasmid expression. While the above description contains many examples, these should not be construed as limitations on the scope of the invention, but rather should be viewed as an exemplification of preferred embodiments thereof. Many other variations are possible. For example, the RNA-OUT selectable marker may be substituted with an alternative RNA-OUT sequence variant that functionally binds RNA-IN to repress expression, for example, a CpG free RNA-OUT (SEQ ID NO:36). A CpG free R6K-RNA-OUT bacterial region (SEQ ID NO:37) or CpG free ColE2-RNA-OUT bacterial region (SEQ ID NO: 38) may be utilized. Likewise, the RNA-OUT promoter and/or terminator could be substituted with an alternative promoter and/or terminator. Likewise, the ColE2-P9 or R6K replication origin may be substituted with a ColE2 related replication origin, and propagated in a strain expressing the ColE2 related replication origin replication protein. Likewise, the ColE2-P9 or R6K origin may be substituted with an origin from one of the numerous additional Rep protein dependent plasmids that are know in the art, for example the Rep protein dependent plasmids described in del Solar et al Supra, 1998 which is included herein by reference. Likewise, the vectors may encode a diversity of transgenes different from the examples provided herein, for example, antigen genes for a variety of pathogens, or therapeutic genes such as hypoxia inducible factor, keratinocyte growth factor, factor IX, factor VIII, etc, or RNA genes such as microRNAs or shRNA. Likewise, the eukaryotic region may express RNA from a RNA Pol III promoter as described herein. The orientation of the various vector-encoded elements may be changed relative to each other. The vectors may optionally contain additional functionalities, such as nuclear localizing sequences, and/or immunostimulatory RNA elements as disclosed in Williams, Supra, 2008. The vectors may include a boundary element between the bacterial region and the eukaryotic region, for example, the CMV promoter boundary element upstream of the CMV enhancer (or heterologous promoter enhancer) may be included in the vector design (e.g. NTC9385R-BE; SEQ ID NO: 41). The vectors may include a eukaryotic transcriptional terminator between the bacterial region and the eukaryotic region, for example, the 4x C2 terminator or the gastrin terminator. Likewise, the vectors may utilize a diversity of RNA Pol Π promoters different from the CMV promoter examples provided herein, for example, constitutive promoters such as the elongation factor 1 (EF1) promoter, the chicken β -actin promoter, the β -actin promoter from other species, the elongation factor- 1 a (EF1 a) promoter, the phosphoglycerokinase (PGK) promoter, the Rous sarcoma virus (RSV) promoter, the human serum albumin (SA) promoter, the a -1 antitrypsin (AAT) promoter, the thyroxine binding globulin (TBG) promoter, the cytochrome P450 2E1 (CYP2E1) promoter, etc. The vectors may also utilize combination promoters such as the chicken β -actin/CMV enhancer (CAG) promoter, the human or murine CMV-derived enhancer elements combined with the elongation factor la (EFl a) promoters, CpG free versions of the human or murine CMV-derived enhancer elements combined with the elongation factor la (EFla) promoters, the albumin promoter combined with an a -fetoprotein MERE enhancer, etc, or the diversity of tissue specific or inducible promoters know in the art such as the muscle specific promoters muscle creatine kinase (MCK), and C5-12 described herein or the specific promoter apolipoprotein A-I (ApoAI).
Accordingly, the scope of the invention should be determined not by the embodiments illustrated, but by the appended claims.

Claims

What is claimed is:
1. A method to construct a eukaryotic expression vector with improved in vivo expression, comprising:
a. combining a eukaryotic region with a bacterial region, wherein said bacterial region comprises an RNA selectable marker linked to a replication origin selected from the group consisting of Pmin minimal pUC origin, R6K replication origin, ColE2-P9 replication origin, and ColE2 related replication origin;
b. transforming the plasmid DNA into competent cells of an RNA selectable marker regulated selection marker encoding bacterial cell line further modified to express the necessary R6K, ColE2-
P9 or ColE2 related replication protein; and
c. isolating the resultant transformed bacterial cells.
2. A composition for a vector constructed by the method of claim 1, wherein said RNA selectable marker encodes an RNA selected from the group consisting of: RNA-OUT selection marker encoding an RNA-IN regulating RNA-OUT RNA with at least 95% sequence identity to SEQ ID NO: 24; RNAI selection marker encoding an RNAII regulating RNAI RNA with at least 95% sequence identity to SEQ ID NO: 31 ; IncB RNAI selection marker encoding an RNAII regulating RNAI RNA with at least 95% sequence identity to SEQ ID NO: 33.
3. A composition for a vector constructed by the method of claim 1, wherein said ColE2-P9 replication origin is a functional variant with at least 95% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7; SEQ ID NO: 28.
4. A composition for a vector constructed by the method of claim 1 , wherein said R6K replication origin is a functional variant with at least 95% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 22.
5. A composition for a vector constructed by the method of claim 1, wherein the R6K replication origin- RNA selectable marker bacterial region is a R6K replication origin- RNA-OUT bacterial region or a functional variant with at least 95% sequence identity to SEQ ID NO: 19 or SEQ ID NO: 37.
6. A composition for a vector constructed by the method of claim 1, wherein the ColE2-P9 replication origin-RNA selectable marker bacterial region is a ColE2-P9 replication origin-RNA-OUT bacterial region or a functional variant with at least 95% sequence identity to SEQ ID NO: 20 or SEQ ID NO: 38.
7. A composition for a vector constructed by the method of claim 1 , wherein said vector has a vector backbone with at least 95% sequence identity to a sequence selected from the group consisting of:
SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 9; SEQ ID NO: 41.
8. A method to construct a eukaryotic expression vector with improved in vivo expression, comprising:
a. combining a eukaryotic region with a RNA selectable marker and a replication origin selected from the group consisting of Pmin minimal pUC origin, R6K replication origin, ColE2-P9 replication origin, and ColE2 related replication origin, wherein said replication origin is positioned within the spacer region linking the 5' and 3' ends of the eukaryotic region sequences and said RNA selectable marker is positioned within an intron;
b. transforming the plasmid DNA into competent cells of an RNA selectable marker regulated selection marker encoding bacterial cell line further modified as necessary to express the necessary R6K, ColE2-P9 or ColE2 related replication protein; and
c. isolating the resultant transformed bacterial cells.
9. A composition for a vector constructed by the method of claim 8, wherein said RNA selection marker encodes an RNA selected from the group consisting of: RNA-OUT selection marker encoding an RNA-IN regulating RNA-OUT RNA with at least 95% sequence identity to SEQ ID NO: 24; RNAI selection marker encoding an RNAII regulating RNAI RNA with at least 95% sequence identity to SEQ ID NO: 31 ; IncB RNAI selection marker encoding an RNAII regulating RNAI RNA with at least 95% sequence identity to SEQ ID NO: 33.
10. A composition for a vector constructed by the method of claim 8, wherein said R6K replication origin is a functional variant with at least 95% sequence identity to a sequence selected from the group consisting of SEQ ID NO: 1 , SEQ ID NO: 22.
11. A composition for a vector constructed by the method of claim 8, wherein said vector has a vector backbone with at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 39; SEQ ID NO: 40.
12. A method for heat inducible production of a Rep protein dependent replication origin plasmid vector, comprising: a. cloning the plasmid replication regulating Rep protein into a expression vector to create a PL - Rep protein expression cassette in which said Rep protein is expressed under the control of the PL promoter;
b. integrating said PL - Rep protein expression cassette into a host strain genome to create a PL - Rep protein host strain in which expression from the said PL - Rep protein expression cassette is repressed by the temperature sensitive cI857 repressor;
c. transforming said PL - Rep protein host strain with said Rep protein dependent replication origin plasmid vector;
d. isolating the resultant transformed bacterial cells;
e. propagating said transformed bacterial cells at 25-32°C to maintain the said Rep protein dependent plasmid vector at a basal copy number; and
f. inducing said transformed bacterial cells at 37-42°C to increase copy number of said Rep protein dependent plasmid vector.
13. The method of claim 12, wherein said PL promoter is selected from the group comprising a PL promoter (SEQ ID NO: 10), PL promoter OL1-G (SEQ ID NO: 11) , and PL promoter OL1-G to T (SEQ ID NO: 12) .
14. The method of claim 12, wherein said Rep protein dependent replication origin is selected from the group consisting of a R6K replication origin, ColE2-P9 replication origin and ColE2 related replication origin.
15. The method of claim 12, wherein said plasmid replication regulating Rep protein comprises an R6K Rep protein mutation selected from the group consisting of P42L-P113S (SEQ ID NO: 13) and P42L-P106L-F107S (SEQ ID NO: 14).
16. The method of claim 12, wherein said plasmid replication regulating Rep protein comprises a ColE2 Rep protein selected from the group consisting of Rep protein (SEQ ID NO: 15) and G194D (SEQ ID NO: 16).
17. The method of claim 12, wherein said PL - Rep protein host strain further contains an RNA-IN regulated selection marker.
18. The method of claim 12, wherein said Rep protein dependent plasmid vector for heat inducible production has a vector backbone with at least 95% sequence identity to a sequence selected from the group consisting of: SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41.
19. A method for heat inducible production of a target protein or mRNA gene from the Escherichia coli genome, comprising:
a. Cloning the said target protein or mRNA gene into an expression vector to create a PL - target protein or mRNA gene expression cassette in which said target protein or mRNA gene is expressed under the control of the PL promoter and said PL promoter further contains a OLl mutation; b. Integrating said PL - target protein or mRNA gene expression cassette into a host strain genome to create a PL - target protein or mRNA host strain in which expression from the said PL - target protein or mRNA gene expression cassette is repressed by the temperature sensitive cI857 repressor;
c. propagating said PL - target protein or mRNA host strain at 25-32°C to maintain said target protein or mRNA at a basal copy number; and
d. inducing said PL - target protein or mRNA host strain at 37-42°C to increase expression of said target protein or mRNA.
20. The method of claim 19, wherein said PL promoter OLl mutation is selected from the group comprising PL promoter OLl-G (SEQ ID NO: 11), and PL promoter OLl-G to T (SEQ ID NO: 12).
ABSTRACT
The present invention relates to the production and use of covalently closed circular (ccc) recombinant plasmids, and more particularly to vector modifications that improve expression of said DNA molecules in the target organism.
PCT/US2013/000068 2012-08-29 2013-03-14 Dna plasmids with improved expression WO2014035457A1 (en)

Priority Applications (16)

Application Number Priority Date Filing Date Title
US14/422,865 US9550998B2 (en) 2012-08-29 2013-03-14 DNA plasmids with improved expression
AU2013309488A AU2013309488A1 (en) 2012-08-29 2013-03-14 DNA plasmids with improved expression
CA2883227A CA2883227A1 (en) 2012-08-29 2013-03-14 Dna plasmids with improved expression
EP13727671.3A EP2890404B1 (en) 2012-08-29 2013-03-14 Dna plasmids with improved expression
PCT/US2013/000259 WO2014077866A1 (en) 2012-11-19 2013-11-18 Replicative minicircle vectors with improved expression
EP13836246.2A EP2920309B1 (en) 2012-11-19 2013-11-18 Replicative minicircle vectors with improved expression
CA2883943A CA2883943C (en) 2012-11-19 2013-11-18 Replicative minicircle vectors with improved expression
US14/432,693 US10047365B2 (en) 2012-11-19 2013-11-18 Replicative minicircle vectors with improved expression
AU2013345428A AU2013345428B2 (en) 2012-11-19 2013-11-18 Replicative minicircle vectors with improved expression
US15/096,517 US10167478B2 (en) 2012-11-19 2016-04-12 Replicative minicircle vectors with improved expression
US15/375,215 US10144935B2 (en) 2012-08-29 2016-12-12 DNA plasmids with improved expression
US16/016,229 US10844388B2 (en) 2012-11-19 2018-06-22 Replicative minicircle vectors with improved expression
US16/022,881 US11098313B2 (en) 2012-11-19 2018-06-29 Replicative minicircle vectors with improved expression
US17/031,791 US11851665B2 (en) 2012-11-19 2020-09-24 Replicative minicircle vectors with improved expression
US17/112,918 USRE49423E1 (en) 2012-08-29 2020-12-04 DNA plasmids with improved expression
US18/067,035 US20230242924A1 (en) 2012-08-29 2022-12-16 DNA Plasmids with Improved Expression

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261743219P 2012-08-29 2012-08-29
US61/743,219 2012-08-29

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US14/422,865 A-371-Of-International US9550998B2 (en) 2012-08-29 2013-03-14 DNA plasmids with improved expression
US15/375,215 Division US10144935B2 (en) 2012-08-29 2016-12-12 DNA plasmids with improved expression

Publications (1)

Publication Number Publication Date
WO2014035457A1 true WO2014035457A1 (en) 2014-03-06

Family

ID=48577845

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2013/000068 WO2014035457A1 (en) 2012-08-29 2013-03-14 Dna plasmids with improved expression

Country Status (5)

Country Link
US (4) US9550998B2 (en)
EP (1) EP2890404B1 (en)
AU (1) AU2013309488A1 (en)
CA (1) CA2883227A1 (en)
WO (1) WO2014035457A1 (en)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014077866A1 (en) * 2012-11-19 2014-05-22 Nature Technology Corporation Replicative minicircle vectors with improved expression
WO2016040344A1 (en) * 2014-09-08 2016-03-17 Perkins Biosystems, Llc Innate immune modulating molecule complex for the activation of the innate immune system of aquatic animals and methods therefor
CN106480079A (en) * 2016-10-13 2017-03-08 扬州大学 A kind of based on λ cI857/pL to thermally-stabilised temperature control cracking system and its construction method and application
WO2019057774A1 (en) 2017-09-19 2019-03-28 Deutsches Krebsforschungszentrum Non-integrating dna vectors for the genetic modification of cells
WO2019060253A1 (en) 2017-09-19 2019-03-28 Nature Technology Corporation Non-integrating dna vectors for the genetic modification of cells
WO2019183248A1 (en) 2018-03-21 2019-09-26 Nature Technology Corporation Viral and non-viral nanoplasmid vectors with improved production
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10724029B2 (en) 2012-03-15 2020-07-28 Flodesign Sonics, Inc. Acoustophoretic separation technology using multi-dimensional standing waves
US10785574B2 (en) 2017-12-14 2020-09-22 Flodesign Sonics, Inc. Acoustic transducer driver and controller
US10975368B2 (en) 2014-01-08 2021-04-13 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
WO2021072031A1 (en) * 2019-10-11 2021-04-15 Insideoutbio, Inc. Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases
EP3825407A1 (en) * 2015-08-10 2021-05-26 CureVac Real Estate GmbH Method of increasing the replication of a circular dna molecule
US11085035B2 (en) 2016-05-03 2021-08-10 Flodesign Sonics, Inc. Therapeutic cell washing, concentration, and separation utilizing acoustophoresis
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
CN113939593A (en) * 2019-06-06 2022-01-14 因思科瑞普特公司 Treatment for recursive nucleic acid-guided cell editing
WO2022104109A1 (en) 2020-11-13 2022-05-19 Catamaran Bio, Inc. Genetically modified natural killer cells and methods of use thereof
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
US11459540B2 (en) 2015-07-28 2022-10-04 Flodesign Sonics, Inc. Expanded bed affinity selection
US11474085B2 (en) 2015-07-28 2022-10-18 Flodesign Sonics, Inc. Expanded bed affinity selection
WO2023014922A1 (en) 2021-08-04 2023-02-09 The Regents Of The University Of Colorado, A Body Corporate Lat activating chimeric antigen receptor t cells and methods of use thereof
EP3946470A4 (en) * 2019-04-05 2023-05-31 Earli Inc. Improved methods and compositions for synthetic biomarkers
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
EP3973066A4 (en) * 2019-05-23 2023-07-26 Spacecraft Seven, LLC Gene therapy vectors for infantile malignant osteopetrosis
WO2023172514A1 (en) 2022-03-07 2023-09-14 Catamaran Bio, Inc. Engineered immune cell therapeutics targeted to her2 and methods of use thereof

Families Citing this family (30)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9745548B2 (en) 2012-03-15 2017-08-29 Flodesign Sonics, Inc. Acoustic perfusion devices
US10322949B2 (en) 2012-03-15 2019-06-18 Flodesign Sonics, Inc. Transducer and reflector configurations for an acoustophoretic device
US9950282B2 (en) 2012-03-15 2018-04-24 Flodesign Sonics, Inc. Electronic configuration and control for acoustic standing wave generation
US9752113B2 (en) 2012-03-15 2017-09-05 Flodesign Sonics, Inc. Acoustic perfusion devices
US10967298B2 (en) 2012-03-15 2021-04-06 Flodesign Sonics, Inc. Driver and control for variable impedence load
US10689609B2 (en) 2012-03-15 2020-06-23 Flodesign Sonics, Inc. Acoustic bioreactor processes
US10737953B2 (en) 2012-04-20 2020-08-11 Flodesign Sonics, Inc. Acoustophoretic method for use in bioreactors
US9550998B2 (en) * 2012-08-29 2017-01-24 Nature Technology Corporation DNA plasmids with improved expression
US9745569B2 (en) 2013-09-13 2017-08-29 Flodesign Sonics, Inc. System for generating high concentration factors for low cell density suspensions
US9744483B2 (en) 2014-07-02 2017-08-29 Flodesign Sonics, Inc. Large scale acoustic separation device
US11021699B2 (en) 2015-04-29 2021-06-01 FioDesign Sonics, Inc. Separation using angled acoustic waves
US10975420B2 (en) * 2015-12-18 2021-04-13 California Institute Of Technology Thermal bioswitches and related genetic circuits, vectors, cells, compositions, methods and systems
JP2020513248A (en) 2016-10-19 2020-05-14 フロデザイン ソニックス， インク．Ｆｌｏｄｅｓｉｇｎ Ｓｏｎｉｃｓ， Ｉｎｃ． Affinity cell extraction by sound
PL3534936T3 (en) 2016-11-01 2021-01-25 Novo Nordisk A/S Tolerogenic dna vaccine
RU2678756C1 (en) * 2017-08-25 2019-01-31 Селл энд Джин Терапи Лтд Vtvaf17 gene-therapy dna vector, method for producing thereof, escherichia coli scs110-af strain, method for producing thereof, escherichia coli scs110-af/vtvaf17 strain, bearing vtvaf17 gene-therapy dna vector, method for producing thereof
WO2019055618A1 (en) 2017-09-15 2019-03-21 Arizona Board Of Regents On Behalf Of Arizona State University Methods of classifying response to immunotherapy for cancer
RU2705252C1 (en) * 2018-06-08 2019-11-06 Селл энд Джин Терапи Лтд GENE-THERAPEUTIC DNA VECTOR BASED ON THE GENE-THERAPEUTIC DNA VECTOR VTvaf17, CARRYING THE TARGET GENE CFTR, OR NOS1, OR AQ1, OR AQ3, OR AQ5, FOR TREATING DISEASES ASSOCIATED WITH THE NEED TO INCREASE THE LEVEL OF EXPRESSION OF THESE TARGET GENES, A METHOD FOR PRODUCING AND USING IT, ESCHERICHIA COLI SCS110-AF/VTvaf17-CFTR STRAIN, OR ESCHERICHIA COLI SCS110-AF/VTvaf17-NOS1, OR ESCHERICHIA COLI SCS110-AF/VTvaf17-AQ1, OR ESCHERICHIA COLI SCS110-AF/VTvaf17-AQ3, OR ESCHERICHIA COLI SCS110-AF/VTvaf17-AQ5, CARRYING A GENE-THERAPEUTIC DNA VECTOR, METHOD FOR PRODUCTION THEREOF, A METHOD FOR INDUSTRIAL PRODUCTION OF A GENE-THERAPEUTIC DNA VECTOR
RU2712838C1 (en) * 2018-09-04 2020-01-31 Генетик Диагностик Энд Терапи 21 Лтд Gene-therapeutic dna-vector gdtt1.8nas12, method for its preparation, escherichia coli jm110-nas strain, a method for its preparation, escherichia coli jm110-nas/gdtt1.8nas12 strain, carrying a gene-therapeutic dna-vector gdtt1.8nas12, a method for production thereof, a method for industrial production of a gene-therapeutic dna vector
RU2707537C1 (en) * 2018-09-04 2019-11-27 Общество с ограниченной ответственностью "Аллель Центр Инновационных Биотехнологий" GENE-THERAPEUTIC DNA-VECTOR BASED ON THE GENE-THERAPEUTIC DNA-VECTOR VTvaf17, CARRYING THE TARGET GENE SELECTED FROM THE GROUP OF GENES COL1A1, COL1A2, BMP2, BMP7, TO INCREASE THE LEVEL OF EXPRESSION OF THESE TARGET GENES, METHOD FOR PRODUCTION AND USE THEREOF, ESCHERICHIA COLI SCS110-AF/VTvaf17-COL1A1 STRAIN OR ESCHERICHIA COLI SCS110-AF/VTvaf17-COL1A2 OR ESCHERICHIA COLI SCS110-AF/VTvaf17-BMP2 OR ESCHERICHIA COLI SCS110-AF/VTvaf17-BMP7, CARRYING A GENE-THERAPEUTIC DNA VECTOR, METHOD FOR PRODUCTION THEREOF, A METHOD FOR INDUSTRIAL PRODUCTION OF A GENE-THERAPEUTIC DNA-VECTOR
RU2705256C1 (en) * 2018-09-05 2019-11-06 Общество С Ограниченной Ответственностью "Прорывные Инновационные Технологии" GENE-THERAPEUTIC DNA VECTOR BASED ON THE GENE-THERAPEUTIC DNA VECTOR VTvaf17, CARRYING THE TARGET GENE SELECTED FROM THE GROUP OF SKI, TGFB3, TIMP2, FMOD GENES TO INCREASE THE LEVEL OF EXPRESSION OF THESE TARGET GENES, A METHOD FOR PREPARING AND USING IT, ESCHERICHIA COLI SCS110-AF/VTvaf17-SKI STRAIN OR ESCHERICHIA COLI SCS110-AF/VTvaf17-TGFB3 OR ESCHERICHIA COLI SCS110-AF/VTvaf17-TIMP2 OR ESCHERICHIA COLI SCS110-AF/VTvaf17-FMOD, CARRYING A GENE-THERAPEUTIC DNA VECTOR, A METHOD FOR PRODUCTION THEREOF, A METHOD FOR INDUSTRIAL PRODUCTION OF A GENE-THERAPEUTIC DNA VECTOR
RU2732479C2 (en) * 2018-12-21 2020-09-17 Селл энд Джин Терапи Лтд Gene-therapeutic dna-vector based on the gene-therapeutic dna-vector vtvaf17, carrying the target gene selected from a group of genes bdnf, vegfa, bfgf, ngf, gdnf, nt3, cntf, igf1, to increase expression level of said target genes, method for production and use thereof, a strain escherichia coli scs110-af/vtvaf17-bdnf, or escherichia coli scs110-af/vtvaf17-vegfa, or escherichia coli scs110-af/vtvaf17-bfgf, or escherichia coli scs110-af/vtvaf17-ngf, or escherichia coli scs110-af/vtvaf17-gdnf, or escherichia coli scs110-af/vtvaf17-nt3, or escherichia coli scs110-af/vtvaf17-cntf, or escherichia coli scs110-af/vtvaf17-igf1, carrying a gene-therapeutic dna vector, method for production thereof, a method for industrial production of a gene-therapeutic dna vector
RU2730664C2 (en) * 2018-12-27 2020-08-24 Селл энд Джин Терапи Лтд Gene-therapeutic dna-vector based on gene-therapeutic dna-vector vtvaf17, carrying target gene selected from group of genes ang, angpt1, vegfa, fgf1, hif1α, hgf, sdf1, klk4, pdgfc, prok1, prok2 to increase expression level of said target genes, method for production and use thereof, strain escherichia coli scs110-af/vtvaf17-ang, or escherichia coli scs110-af/vtvaf17-angpt1, or escherichia coli scs110-af/vtvaf17-vegfa, or escherichia coli scs110-af/vtvaf17-fgf1, or escherichia coli scs110-af/vtvaf17-hif1α, or escherichia coli scs110-af/vtvaf17-hgf, or escherichia coli scs110-af/vtvaf17-sdf1, or escherichia coli scs110-af/vtvaf17-klk4, or escherichia coli scs110-af/vtvaf17-pdgfc, or escherichia coli scs110-af/vtvaf17-prok1, or escherichia coli scs110-af/vtvaf17-prok2, carrying gene-therapeutic dna vector, method for production thereof, method for industrial production of gene-therapeutic dna vector
RU2715314C1 (en) * 2019-01-25 2020-02-26 Селл энд Джин Терапи Лтд VTvaf17-Act1-Cas9 GENE-THERAPEUTIC DNA VECTOR BASED ON VTvaf17 GENE-THERAPEUTIC DNA VECTOR CARRYING TARGET Cas9 GENE FOR HETEROLOGOUS EXPRESSION OF THIS TARGET GENE IN PLANT CELLS DURING GENOME EDITING OF PLANTS, METHOD OF PRODUCING AND USING GENE-THERAPEUTIC DNA VECTOR, STRAIN OF ESCHERICHIA COLI SCS110-AF/VTvaf17-Act1-Cas9 CARRYING GENE-THERAPEUTIC DNA VECTOR, METHOD FOR PREPARING THEREOF, METHOD FOR INDUSTRIAL PRODUCTION OF GENE-THERAPEUTIC DNA VECTOR
CN109837277A (en) * 2019-03-01 2019-06-04 深圳生生凡非基因技术有限公司 A kind of CPGK chimeric promoters, gland relevant viral vector and its application
US11279745B2 (en) 2019-04-26 2022-03-22 Novo Nordisk A/S Tolerogenic DNA vaccine
EP3997110A4 (en) 2019-07-12 2023-05-31 California Institute of Technology Modular dimerization thermoswitches and related monomers, dimers, constructs, dimeric complexes, vectors, cells, surfaces, devices compositions, methods and systems
EP4038222A4 (en) 2019-10-02 2023-10-18 Arizona Board of Regents on behalf of Arizona State University Methods and compositions for identifying neoantigens for use in treating and preventing cancer
KR20220153606A (en) * 2020-03-11 2022-11-18 네이쳐 테크놀로지 코포레이션 bacterial host strain
WO2022125822A1 (en) * 2020-12-10 2022-06-16 Arizona Board Of Regents On Behalf Of Arizona State University Canine cancer vaccine
CN113025651B (en) * 2021-03-31 2023-03-24 重庆医科大学 Novel application of drug screening cell model, triciribine and structural analogue of targeted HBV core promoter

Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5922583A (en) 1995-10-17 1999-07-13 Biostar Inc. Methods for production of recombinant plasmids
WO2004033664A2 (en) 2002-10-11 2004-04-22 Centelion Circular dna molecule having a conditional origin of replication, process for their preparation and their use in gene therapy
US6977174B2 (en) 1995-09-15 2005-12-20 Centelion Circular DNA molecule with conditional origin of replication, method for preparing the same and use thereof in gene therapy
US20060063232A1 (en) 2004-09-17 2006-03-23 Boehringer Ingelheim Austria Gmbh Host-vector system for antibiotic-free CoIE1 plasmid propagation
WO2006078979A2 (en) 2005-01-20 2006-07-27 Nature Technology Corp. Vectors and methods for genetic immunization
US7244609B2 (en) 2001-03-09 2007-07-17 Cayla Synthetic genes and bacterial plasmids devoid of CpG
WO2008153733A2 (en) 2007-05-29 2008-12-18 Nature Technology Corporation Vectors and methods for genetic immunization
US7611883B2 (en) 2003-11-20 2009-11-03 Cobra Biologics Limited Plasmid maintenance
US20100184158A1 (en) 2009-01-21 2010-07-22 James Arthur Williams DNA Plasmids with improved copy number
US7943377B2 (en) 2004-08-19 2011-05-17 Nature Technology Corp. Process for plasmid DNA fermentation

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB2214508A (en) 1988-01-27 1989-09-06 Bayer Ag Plasmid vector for the efficient expression of foreign genes fused with newly conceived transcriptional and translational signal sequences.
US20030225260A1 (en) * 2002-04-30 2003-12-04 Snyder Richard O. Production of recombinant AAV virions
WO2006029449A1 (en) 2004-09-14 2006-03-23 Btf Pty Ltd Chromosomal insertion of gfp into bacteria for quality control
WO2009025690A2 (en) 2007-05-23 2009-02-26 Nature Technology Corporation Improved e. coli plasmid dna production
US9550998B2 (en) * 2012-08-29 2017-01-24 Nature Technology Corporation DNA plasmids with improved expression

Patent Citations (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6977174B2 (en) 1995-09-15 2005-12-20 Centelion Circular DNA molecule with conditional origin of replication, method for preparing the same and use thereof in gene therapy
US5922583A (en) 1995-10-17 1999-07-13 Biostar Inc. Methods for production of recombinant plasmids
US7244609B2 (en) 2001-03-09 2007-07-17 Cayla Synthetic genes and bacterial plasmids devoid of CpG
WO2004033664A2 (en) 2002-10-11 2004-04-22 Centelion Circular dna molecule having a conditional origin of replication, process for their preparation and their use in gene therapy
US7611883B2 (en) 2003-11-20 2009-11-03 Cobra Biologics Limited Plasmid maintenance
US7943377B2 (en) 2004-08-19 2011-05-17 Nature Technology Corp. Process for plasmid DNA fermentation
US20060063232A1 (en) 2004-09-17 2006-03-23 Boehringer Ingelheim Austria Gmbh Host-vector system for antibiotic-free CoIE1 plasmid propagation
WO2006078979A2 (en) 2005-01-20 2006-07-27 Nature Technology Corp. Vectors and methods for genetic immunization
WO2008153733A2 (en) 2007-05-29 2008-12-18 Nature Technology Corporation Vectors and methods for genetic immunization
US20100184158A1 (en) 2009-01-21 2010-07-22 James Arthur Williams DNA Plasmids with improved copy number

Non-Patent Citations (42)

* Cited by examiner, † Cited by third party
Title
ABHYANKAR ET AL., J BIOL CHEM, vol. 278, 2003, pages 45476 - 45484
ABHYANKAR ET AL., J BIOL CHEM, vol. 279, 2004, pages 6711 - 6719
ANGULO A; KERRY D; HUANG H; BORST EM; RAZINSKY A; WU J ET AL., J VIROL, vol. 74, 2000, pages 2826 - 2839
ASHFIELD R; PATEL AJ; BOSSONE SA; BROWN H; CAMPBELL RD; MARCU KB; PROUDFOOT NJ, EMBO J, vol. 13, 1994, pages 5656
BAILONE A; GALIBERT F, NUCLEIC ACIDS RESEARCH, vol. 8, 1980, pages 2147
BAROUCH DH; YANG ZY; KONG WP; KORIOTH- SCHMITZ B; SUMIDA SM; TRUITT DM; KISHKO MG; ARTHUR JC; MIURA A; MASCOLA JR, J VIROL., vol. 79, 2005, pages 8828 - 8834
CARNES A.E., BIOPROCESS INTL, vol. 3, 2005, pages 36 - 44
CATANESE ET AL., GENE THER, vol. 19, 2012, pages 94 - 100
CHEMA ET AL., NUCLEIC ACIDS RES., vol. 31, 2003, pages 3497 - 500
DATSENKO; WANNER, PROC NATL ACAD SCI USA, vol. 97, 2000, pages 6640 - 6645
DEL SOLAR ET AL., MICROBIOL. MOL. BIOL. REV, vol. 62, 1998, pages 434 - 464
FRANCH T; GERDES K, CURRENT OPIN MICROBIOL, vol. 3, 2000, pages 159
GARG S; ORAN AE; HON H; JACOB J., J IMMUNOL., vol. 173, 2004, pages 550 - 558
HALDIMANN; WANNER, J BACTERIOL, vol. 183, 2001, pages 6384 - 6393
HAN M; AOKI K; YAGURA M; ITOH T, BIOCHEM BIOPHYS RES COMMUN, vol. 353, 2007, pages 306
HEBEL HL; CAI Y; DAVIES LA; HYDE SC; PRINGLE IA; GILL DR, MOL THER, vol. 16, 2008, pages 110
KAY MA; HE CY; CHEN ZY, NAT BIOTECHNOL, vol. 28, 2010, pages 1287 - 1289
KIM D; KIM JD; BAEK K; YOON Y; YOON J, BIOTECHNOL PROG, vol. 19, 2003, pages 1620
LANZA AM; ALPER HS: "Methods in Molecular Biology, Vol. 765, Strain Engineering: Methods and Protocols", vol. 765, 2011, HUMANA PRESS INC., pages: 253 - 274
LIEB M., J VIROL, vol. 32, 1979, pages 162
LISSEMORE JL; JANKOWSKI JT; THOMAS CB; MASCOTTI DP; DEHASETH PL, BIOTECHNIQUES, vol. 28, 2000, pages 82 - 89
LU J; ZHANG F; XU S; FIRE AZ; KAY MA, MOL THER, vol. 20, 2012, pages 2111 - 9
LUKE J ET AL: "Improved antibiotic-free DNA vaccine vectors utilizing a novel RNA based plasmid selection system", VACCINE, ELSEVIER LTD, GB, vol. 27, no. 46, 30 October 2009 (2009-10-30), pages 6454 - 6459, XP026704482, ISSN: 0264-410X, [retrieved on 20090624], DOI: 10.1016/J.VACCINE.2009.06.017 *
MANOJ S; BABIUK LA; VAN DRUNEN LITTLE-VAN DEN HURK S., CRIT REV CLIN LAB SCI, vol. 41, 2004, pages 1 - 39
MARIANS ET AL., J BIOL CHEM, vol. 257, 1982, pages 5656 - 5662
MASAI ET AL., J BIOL CHEM, vol. 265, 1990, pages 15134 - 15144
MASAI ET AL., JBIOL CHEM, vol. 265, 1990, pages 15124 - 15133
METCALF ET AL., GENE, vol. 138, 1994, pages 1 - 7
NA D; YOO SM; CHUNG H; PARK H; PARK JH; LEE SY, NAT BIOTECHNOL, vol. 31, 2013, pages 170
NAGASE ET AL., PLASMID, vol. 59, 2008, pages 36 - 44
NATURE TECHNOLOGY CORPORATION: "Targeting RIG-I activating Expression Vectors", vol. version 1, 1 September 2011 (2011-09-01), XP002713690, Retrieved from the Internet <URL:http://natxbiologics.com/assets/ntc8681_ntc8682_ntc8684_ntc8685_erna41husermanual1_0.pdf> [retrieved on 20130925], DOI: www.natx.com *
SATO K; ITO R; BACK KH; AGARWAL K, MOL. CELL. BIOL., vol. 6, 1986, pages 1032
SOUBRIER ET AL., GENE THERAPY, vol. 6, 1999, pages 1482
TAKECHI ET AL., MOL GEN GENET, vol. 244, 1994, pages 49 - 56
WAGNER EGH; ALTUVIA S; ROMBY P, ADV GENET, vol. 46, 2002, pages 361
WANG B; LI J; FU FH; CHEN C; ZHU X; ZHOU L; JIANG X; XIAO X, GENE THER, vol. 15, 2008, pages 1489
WU ET AL., J BACTERIOL., vol. 177, 1995, pages 6338 - 6345
YAGURA ET AL., JBACTERIOL, vol. 188, 2006, pages 999 - 1010
YAGURA; ITOH, BIOCHEM BIOPHYS RES COMMUN, vol. 345, 2006, pages 872 - 877
YASUEDA ET AL., MOL GEN GENET, vol. 215, 1989, pages 209
YASUEDA ET AL., MOL GEN GENET, vol. 244, 1994, pages 41 - 48
ZHAO ET AL., GENE THER, vol. 18, 2011, pages 220 - 224

Cited By (33)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10704021B2 (en) 2012-03-15 2020-07-07 Flodesign Sonics, Inc. Acoustic perfusion devices
US10724029B2 (en) 2012-03-15 2020-07-28 Flodesign Sonics, Inc. Acoustophoretic separation technology using multi-dimensional standing waves
US10047365B2 (en) 2012-11-19 2018-08-14 Nature Technology Corporation Replicative minicircle vectors with improved expression
US10167478B2 (en) 2012-11-19 2019-01-01 Nature Technology Corporation Replicative minicircle vectors with improved expression
US11098313B2 (en) 2012-11-19 2021-08-24 Nature Technology Corporation Replicative minicircle vectors with improved expression
WO2014077866A1 (en) * 2012-11-19 2014-05-22 Nature Technology Corporation Replicative minicircle vectors with improved expression
US11851665B2 (en) 2012-11-19 2023-12-26 Aldevron, L.L.C. Replicative minicircle vectors with improved expression
US10844388B2 (en) 2012-11-19 2020-11-24 Nature Technology Corporation Replicative minicircle vectors with improved expression
US10975368B2 (en) 2014-01-08 2021-04-13 Flodesign Sonics, Inc. Acoustophoresis device with dual acoustophoretic chamber
WO2016040344A1 (en) * 2014-09-08 2016-03-17 Perkins Biosystems, Llc Innate immune modulating molecule complex for the activation of the innate immune system of aquatic animals and methods therefor
US11708572B2 (en) 2015-04-29 2023-07-25 Flodesign Sonics, Inc. Acoustic cell separation techniques and processes
US11474085B2 (en) 2015-07-28 2022-10-18 Flodesign Sonics, Inc. Expanded bed affinity selection
US11459540B2 (en) 2015-07-28 2022-10-04 Flodesign Sonics, Inc. Expanded bed affinity selection
EP3825407A1 (en) * 2015-08-10 2021-05-26 CureVac Real Estate GmbH Method of increasing the replication of a circular dna molecule
US11085035B2 (en) 2016-05-03 2021-08-10 Flodesign Sonics, Inc. Therapeutic cell washing, concentration, and separation utilizing acoustophoresis
US11214789B2 (en) 2016-05-03 2022-01-04 Flodesign Sonics, Inc. Concentration and washing of particles with acoustics
CN106480079B (en) * 2016-10-13 2019-09-03 扬州大学 It is a kind of based on λ cI857/pL to thermostabilization temperature control cracking system and its construction method and application
CN106480079A (en) * 2016-10-13 2017-03-08 扬州大学 A kind of based on λ cI857/pL to thermally-stabilised temperature control cracking system and its construction method and application
US11377651B2 (en) 2016-10-19 2022-07-05 Flodesign Sonics, Inc. Cell therapy processes utilizing acoustophoresis
WO2019060253A1 (en) 2017-09-19 2019-03-28 Nature Technology Corporation Non-integrating dna vectors for the genetic modification of cells
WO2019057774A1 (en) 2017-09-19 2019-03-28 Deutsches Krebsforschungszentrum Non-integrating dna vectors for the genetic modification of cells
US10785574B2 (en) 2017-12-14 2020-09-22 Flodesign Sonics, Inc. Acoustic transducer driver and controller
WO2019183248A1 (en) 2018-03-21 2019-09-26 Nature Technology Corporation Viral and non-viral nanoplasmid vectors with improved production
EP4151735A1 (en) 2018-03-21 2023-03-22 Nature Technology Corporation Viral and non-viral nanoplasmid vectors with improved production
JP2021518150A (en) * 2018-03-21 2021-08-02 ネイチャー テクノロジー コーポレーション Viral and non-viral nanoplasmid vectors with improved production
EP3946470A4 (en) * 2019-04-05 2023-05-31 Earli Inc. Improved methods and compositions for synthetic biomarkers
EP3973066A4 (en) * 2019-05-23 2023-07-26 Spacecraft Seven, LLC Gene therapy vectors for infantile malignant osteopetrosis
EP3953477A4 (en) * 2019-06-06 2022-06-22 Inscripta, Inc. Curing for recursive nucleic acid-guided cell editing
CN113939593A (en) * 2019-06-06 2022-01-14 因思科瑞普特公司 Treatment for recursive nucleic acid-guided cell editing
WO2021072031A1 (en) * 2019-10-11 2021-04-15 Insideoutbio, Inc. Methods and compositions for the manufacture and use of circular dna encoded therapeutics for genetic disorders and other diseases
WO2022104109A1 (en) 2020-11-13 2022-05-19 Catamaran Bio, Inc. Genetically modified natural killer cells and methods of use thereof
WO2023014922A1 (en) 2021-08-04 2023-02-09 The Regents Of The University Of Colorado, A Body Corporate Lat activating chimeric antigen receptor t cells and methods of use thereof
WO2023172514A1 (en) 2022-03-07 2023-09-14 Catamaran Bio, Inc. Engineered immune cell therapeutics targeted to her2 and methods of use thereof

Also Published As

Publication number Publication date
AU2013309488A1 (en) 2015-03-05
EP2890404B1 (en) 2018-06-13
CA2883227A1 (en) 2014-03-06
US20170088844A1 (en) 2017-03-30
US10144935B2 (en) 2018-12-04
EP2890404A1 (en) 2015-07-08
US9550998B2 (en) 2017-01-24
USRE49423E1 (en) 2023-02-21
US20150191735A1 (en) 2015-07-09
US20230242924A1 (en) 2023-08-03

Similar Documents

Publication Publication Date Title
USRE49423E1 (en) DNA plasmids with improved expression
US10167478B2 (en) Replicative minicircle vectors with improved expression
JP7189943B2 (en) Non-Integrating DNA Vectors for Genetic Modification of Cells
ES2950736T3 (en) Viral and non-viral nanoplasmid vectors with improved production
WO2019057774A1 (en) Non-integrating dna vectors for the genetic modification of cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13727671

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 14422865

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2883227

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2013309488

Country of ref document: AU

Date of ref document: 20130314

Kind code of ref document: A