WO2014034952A1 - Method for predicting efficacy of immunotherapy on cancer - Google Patents

Abstract

In a determination step, the genotype of a single nucleotide polymorphism that is registered as rs5472 in the SNP database of the U.S. National Center for Biotechnology Information in genomic DNA contained in a sample collected from a subject is determined. In a prediction step, the efficacy of an immunotherapy on cancer in the subject is predicted on the basis of the genotype determined in the determination step. In the prediction step, it is predicted that when the genotype determined in the determination step is a homozygote or heterozygote of guanine, the immunotherapy is more effective for the subject compared with the case in which the genotype is a homozygote of adenine, and it is predicted that when the genotype determined in the determination step is a homozygote of adenine, the immunotherapy is less effective for the subject compared with the case in which the genotype is a homozygote or heterozygote of guanine.

Description

How to predict the effectiveness of immunotherapy for cancer

The present invention relates to a method for predicting the effectiveness of immunotherapy for cancer.

Immunotherapy for cancer has been reported to have a life-prolonging effect that extends the survival time and progression-free survival time of cancer patients in addition to the tumor shrinking effect. In particular, this life-prolonging effect has been shown to be effective in end-stage cancer patients for whom anticancer drugs have stopped working, and immunotherapy has attracted attention as a treatment that improves the quality of life for end-stage cancer patients. ing.

Since immunotherapy is a treatment that activates immune functions with great individual differences, the effects expected of some cancer patients may not be obtained. For this reason, if a therapeutic effect can be predicted before immunotherapy is performed on a cancer patient, information useful for selecting a treatment method for the cancer patient can be provided.

Patent Document 1 discloses a method for predicting the therapeutic effect of immunotherapy on cancer patients from the expression level of a predetermined gene. According to this method, the therapeutic effect of immunotherapy for cancer patients can be predicted in advance.

International Publication No. 2012/002011

However, the gene expression level may change due to various factors such as treatment history of anticancer drugs taken, health condition, environment, and the like. For this reason, the prediction result depends on the patient's state when the sample is collected, and the prediction accuracy may vary.

The present invention has been made in view of the above circumstances, and an object thereof is to provide a method for predicting the effectiveness of immunotherapy for cancer that can predict the effectiveness of immunotherapy for cancer with higher accuracy.

In order to achieve the above object, the present inventor performed genetic polymorphism analysis using peripheral blood collected before receiving immunotherapy from a standard treatment resistant relapsed prostate cancer patient. As a result, a single nucleotide polymorphism related to a base 55 bases upstream from the transcription start point of a haptoglobin (hereinafter simply referred to as “HP”) gene (US Biotechnology Information Center (hereinafter sometimes simply referred to as “NCBI”). We found that rs5472) in the SNP database of SNP was associated with the effectiveness of immunotherapy. Patients with good prognosis after immunotherapy have a guanine homozygote or heterozygote with a statistically significantly higher genotype of the single nucleotide polymorphism compared to patients with poor prognosis. It was shown that there is. Based on this finding, the present inventor has completed the present invention.

That is, the method for predicting the effectiveness of immunotherapy for cancer according to the first aspect of the present invention is:
A determination step of determining a genotype of a single nucleotide polymorphism registered as rs5472 in the SNP database of the National Center for Biotechnology Information in genomic DNA contained in a sample collected from a subject;
A predicting step of predicting the effectiveness of immunotherapy for cancer in the subject based on the genotype determined in the determining step;
including.

In this case, in the prediction step,
When the genotype determined in the determination step is a guanine homozygote or heterozygote, the immunotherapy is more effective for the subject than when the genotype is adenine homozygote. Predict,
When the genotype determined in the determination step is an adenine homozygote, the immunotherapy is less effective for the subject than when the genotype is a guanine homozygote or heterozygote. Predict,
It is good as well.

In the prediction step,
When the genotype determined in the determination step is a guanine homozygote or a heterozygote, the survival time of the subject after the immunotherapy than when the genotype is an adenine homozygote Is expected to be long,
When the genotype determined in the determination step is a homozygote of adenine, the survival time of the subject after the immunotherapy than when the genotype is a homozygote or heterozygote of guanine Predict that is short,
It is good as well.

The cancer is
Prostate cancer or digestive cancer,
It is good as well.

In addition, the immunotherapy
Peptide vaccine therapy,
It is good as well.

Also, the sample is
Is blood,
It is good as well.

In addition, the primer pair used in the prediction method according to the second aspect of the present invention is:
Designed to contain at least 10 consecutive bases of genomic DNA containing the base of the single nucleotide polymorphism registered as rs5472 in the SNP database of the US Biotechnology Information Center in the base sequence of the PCR product .

Further, the probe used in the prediction method according to the third aspect of the present invention is:
Hybridizes to a nucleic acid containing at least 10 consecutive bases of genomic DNA containing a single nucleotide polymorphism site registered as rs5472 in the SNP database of the US Biotechnology Information Center, or a nucleic acid complementary to the nucleic acid. Soybeans.

In this case, the base corresponding to the 1 base 5 ′ terminal side from the single nucleotide polymorphism site is guanine, adenine or thymine.
It is good as well.

Moreover, the kit for predicting the effectiveness of immunotherapy for cancer according to the fourth aspect of the present invention is:
It includes at least one of a primer pair according to the second aspect of the present invention and a probe according to the third aspect of the present invention.

The microchip according to the fifth aspect of the present invention is
An injection part into which a sample containing genomic DNA collected from a subject is injected;
An extraction unit for extracting genomic DNA from the sample injected into the injection unit;
An amplification unit for amplifying a region containing a single nucleotide polymorphism site registered as rs5472 in the SNP database of the US Biotechnology Information Center in the genomic DNA extracted by the extraction unit;
Is provided.

Moreover, the analysis apparatus according to the sixth aspect of the present invention is:
A microchip according to a fifth aspect of the present invention;
A determination unit for determining the genotype of the single nucleotide polymorphism contained in the region amplified by the microchip;
A prediction unit for predicting the effectiveness of immunotherapy for cancer of the subject based on the genotype determined by the determination unit;
Is provided.

Moreover, the marker for predicting the effectiveness of immunotherapy for cancer according to the seventh aspect of the present invention is:
It is a polynucleotide consisting of 10 to 100 consecutive nucleotide sequences of genomic DNA containing a single nucleotide polymorphism site registered as rs5472 in the SNP database of the US Biotechnology Information Center.

According to the present invention, the effectiveness of immunotherapy for cancer is predicted based on the genotype of a single nucleotide polymorphism registered as rs5472 in the NCBI SNP database. Since the genotype is not affected by the condition of the subject when the sample is collected, the effectiveness of immunotherapy for cancer can be predicted with higher accuracy.

It is a figure which shows the structure of the microchip and analyzer which concern on Embodiment 5 of this invention. It is a figure which shows the structure of the microchip shown in FIG. It is a figure which shows the Kaplan-Meier curve of the prostate cancer patient which concerns on Example 2. FIG. It is a figure which shows the Kaplan-Meier curve of the stomach cancer patient which concerns on Example 3. FIG. It is a figure which shows the resonance angle variation | change_quantity of each probe with respect to the PCR sample which concerns on Example 4. FIG. FIG. 6 is a diagram showing the amount of change in resonance angle of each probe with respect to a synthetic nucleic acid sample A according to Example 4. FIG. 6 is a diagram showing the amount of change in resonance angle of each probe with respect to a synthetic nucleic acid sample G according to Example 4.

(Embodiment 1)
First, the first embodiment of the present invention will be described.

The method for predicting the effectiveness of immunotherapy for cancer according to the first embodiment of the present invention is a single nucleotide sequence registered as rs5472 in the NCBI SNP database in genomic DNA contained in a sample collected from a subject. A determination step for determining the genotype of the type, and a prediction step for predicting the effectiveness of the immunotherapy for the cancer of the subject based on the genotype determined in the determination step.

First, the decision step will be described in detail. In the determination step, the genotype of rs5472 in the genomic DNA contained in the sample collected from the subject is determined. The subject is a human. Although the race is not limited, since the present invention was made on the basis of genetic polymorphism analysis for Japanese cancer patients, the subject is preferably Asian, more preferably Japanese. It is.

A sample is an arbitrary biological sample as long as it contains genomic DNA. The sample is, for example, human blood, serum, bone marrow fluid, semen, peritoneal fluid, body fluid such as urine, cells such as liver and skin, body hair such as hair, and the like. Genomic DNA can be extracted from a sample, purified and prepared by a known method.

As shown in the Examples below, a single nucleotide polymorphism (hereinafter simply referred to as “SNP”) exists at a position 55 bases upstream from the transcription start point of the HP gene. The nucleotide sequence from −697 to +148 is shown in SEQ ID NO: 1, with the HP gene transcription start point being +1. The SNP is registered as “rs5472” in the NCBI SNP database. The transcription start point of the HP gene is Nobuyo Maeda, DNAmorphPolymorphisms in the Controlling Region of the Human Haptoglobin Genes: A Molecular Explanation for the Haptoglobin 2-1 Modified Phenotype., Am. J. Hum. Et. : Based on 158-166.

Here, the SNP is a mutation such as substitution, deletion, insertion, transposition, inversion, etc. of one base in the base sequence of genomic DNA in a population of organisms, and the mutation is 1% or more in the population. The one that appears with frequency. In the present specification, the term “SNP” means either or both of the polymorphism on the coding strand side and the non-coding strand side of the HP gene. Except for the base on the coding strand side.

The HP gene exists on chromosome 16. The HP gene encodes HP biosynthesized by mature granular leukocytes (particularly eosinophils) such as hepatocytes and lymph nodes. HP has the characteristics of an acute phase response protein. It has been reported that HP is significantly increased in serum in infectious diseases, inflammation, tissue disruption, malignant tumors and the like.

In determining the genotype of rs5472, it may be determined whether the base of the SNP site registered as rs5472 in the SNP database (hereinafter simply referred to as “target base”) is guanine or adenine. The target base can be determined by, for example, a direct sequence method. In the direct sequencing method, nucleic acid in a region containing a target base is amplified by a PCR (polymerase chain reaction) method using genomic DNA as a template, and the base sequence of the nucleic acid amplified by the PCR method is analyzed.

In the PCR method, DNA polymerase amplifies a target nucleic acid by extending a primer that is a nucleic acid fragment. The primer is extended in the direction from the 5 'end to the 3' end by adding a deoxynucleotide triphosphate complementary to the template DNA to the 3 'end of the primer. In the PCR method, a double-stranded template DNA is unwound into a single strand due to a change in reaction temperature, a primer is annealed to the template DNA, an extension reaction is performed by DNA polymerase, and the extended primer and template Unraveled with DNA. By repeating this, the target nucleic acid can be amplified.

The primer used in the PCR method is, for example, a nucleic acid having a base sequence of at least 10 or more consecutive bases of genomic DNA containing a target base, preferably a nucleic acid having a base sequence of 10 to 100 bases, more preferably 10 to 50 bases It is designed to amplify at least one of the nucleic acid of the base sequence of and the nucleic acid complementary thereto. For example, when the target base is adenine, the base sequence of the 10 base nucleic acid of the genomic DNA containing the target base to be amplified is “ggagAagggg” from the 5 ′ end to the 3 ′ end. “A” indicates a target base. On the other hand, the base sequence of a nucleic acid complementary to at least 10 consecutive bases of genomic DNA containing the target base is, for example, “ccccttctcc” from the 5 ′ end to the 3 ′ end. More specifically, for example, oligonucleotides having the base sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3 can be used as primers.

Analysis of the base sequence of the nucleic acid amplified by the PCR method can be performed using a sequence analyzer such as Applied Biosystems 3130 (Applied Biosystems). The analysis of the nucleic acid base sequence can be carried out by a known method such as the dideoxy method or the Maxam-Gilbert method.

The type of the target base of the nucleic acid amplified by the PCR method may be determined using, for example, a probe that specifically hybridizes when the target base is one type of base. A probe refers to a nucleic acid fragment for analyzing a specific site in a nucleic acid or its base sequence using hybridization based on the complementarity of the nucleic acid. The probe is, for example, a nucleic acid having a base sequence of at least 10 bases or more, preferably a nucleic acid having a base sequence of 10 to 100 bases, more preferably a base sequence of 10 to 50 bases of genomic DNA containing the target base. An oligonucleotide that hybridizes to a nucleic acid or a nucleic acid complementary to the nucleic acid. In this case, it is preferable that the base at the substantially central site of the probe is complementary to the target base. If the probe hybridizes with a nucleic acid whose target base is one type, but does not hybridize with a nucleic acid whose target base is another type, one or more substitutions or deletions in the base sequence , May include additions. The probe may be labeled with a fluorescent substance, a radioactive substance, or the like as necessary.

Hybridization conditions may be any conditions sufficient to distinguish target bases. For example, the hybridization conditions are stringent conditions in which the probe hybridizes with a nucleic acid having one type of target base but does not hybridize with a nucleic acid having another type of target base. Stringent conditions can be determined as appropriate based on, for example, Molecular Cloning a Laboratory Manual Third Edition (2001), and are, for example, 0.2 × SSC, 0.1% SDS, and incubation at 65 ° C. .

More specifically, the type of target base using a probe can be determined by, for example, the Invader (registered trademark) method. In this method, an invader probe complementary to the nucleic acid in the sample and a signal probe having a 5 'flap structure and complementary to the nucleic acid are used. The signal probe includes a base complementary to each type of target base. The signal probe is designed to overlap the invader probe at the site of the target base on the nucleic acid.

In the Invader (registered trademark) method, first, an invader probe and a signal probe are hybridized to a nucleic acid in a sample. Next, a flap endonuclease is allowed to act on the site where the invader probe and the signal probe overlap. When the target base and the base of the signal probe corresponding to the base are complementary, the flap of the signal probe is cleaved by the flap endonuclease. The cut flap is hybridized with a detection DNA substrate labeled with a fluorescent dye to form a new flap. The flap is recognized by the flap endonuclease and cleaved to release the fluorescent dye. By labeling the signal probe with a different fluorescent dye and detecting a fluorescent signal based on the fluorescent dye, the signal probe can be synthesized by a conventional method based on the base sequence information of the region containing the target base.

In addition, the probe used for determining the type of target base may be one used in the TaqMan (registered trademark) method. In the determination step, the genotype of the target base in the genomic DNA may be determined by determining the type of base corresponding to the target base for cDNA or mRNA that is identical or completely complementary to the genomic DNA.

Next, the prediction step will be described in detail. In the prediction step, the effectiveness of the immunotherapy for the cancer of the subject is predicted based on the genotype determined in the determination step.

The type of cancer is not particularly limited, and it may be solid cancer or liquid cancer. For example, the types of cancer are prostate cancer, digestive organ cancer, ovarian cancer, cervical cancer, skin cancer, breast cancer and the like. As cancer types, prostate cancer and gastrointestinal cancer are particularly preferable, and gastrointestinal cancer is particularly preferable in gastrointestinal cancer. The degree of progression of cancer is not particularly limited, and cancer that has relapsed may be used. For example, in prostate cancer, it may be relapsed prostate cancer in which hormonal therapy is ineffective, or may be standard treatment resistant that shows resistance to standard treatment.

Immunotherapy is a method of treating cancer by activating an immune response against tumor antigen protein in cancer patients. As immunotherapy, specifically, peptide vaccine therapy inoculated with tumor antigen peptide, activated self lymphocyte transfer therapy using patient-derived injured T cells and natural killer cells, expression of tumor antigen protein and tumor antigen peptide DNA vaccine therapy in which a viral vector is administered, dendritic cell vaccine therapy in which dendritic cells presenting tumor antigen peptides are administered, and the like. Among these, as shown in the Examples below, peptide vaccine therapy is preferred as immunotherapy.

For example, in the prediction step, when the genotype determined in the determination step is a guanine homozygote or heterozygote, immunotherapy is more effective for the subject than when the genotype is adenine homozygote. Predict that In addition, when the genotype determined in the determination step is adenine homozygote, it is predicted that immunotherapy is not effective for the subject than when the genotype is guanine homozygote or heterozygote. .

A homozygote with a genotype of guanine means that both target bases of the allele at the locus are guanine (G). On the other hand, if both target bases of the allele at the locus are adenine (A), the genotype is said to be a homozygote of adenine. A genotype heterozygote means that the target bases of alleles at a locus are different, one being guanine (G) and the other being adenine (A).

The effectiveness of immunotherapy can be evaluated by, for example, the overall survival period from the start of immunotherapy to death, or the survival period after immunotherapy. For example, in the prediction step, when the genotype determined in the determination step is a homozygote or heterozygote of guanine, the genotype of the subject after immunotherapy is more than that of a homozygote of adenine. It may be predicted that the lifetime will be long. On the other hand, when the genotype determined in the determination step is a homozygote of adenine, the survival period of the subject after immunotherapy is shorter than that of a homozygote or heterozygote of genotype It may be predicted.

More specifically, based on Example 1 below, when the genotype determined in the determination step is a homozygote of guanine, the survival period of the subject after the start of immunotherapy is 900 days or more. If the genotype determined in the determination step is an adenine homozygote, the survival time of the subject after the start of immunotherapy may be predicted to be 300 days or less. By doing so, the survival time of the subject can be predicted more specifically. In this case, it can be said that a subject with a survival period of 900 days or more was more effective in immunotherapy than a subject with a survival period of 300 days or less. In addition, the said threshold value regarding survival time can be determined according to the kind of cancer, a progress degree, a past history, etc.

In addition, the effectiveness of immunotherapy includes the disease-free survival period, which is the period from the start of immunotherapy to the recurrence or death in a subject whose cancer has been completely cured by surgery, etc. Response rate, the proportion of patients observed, progression-free survival from the start of immunotherapy to the progression or death of the cancer, time from the start of immunotherapy to progression of the cancer No progression period, 1 year, 3 years or 5 years after the start of immunotherapy, or 1 year, 3 years or 5 years survival rate or recurrence rate, life after immunotherapy It can be evaluated by indicators related to quality of life (QOL).

As described above in detail, according to the method for predicting the effectiveness of immunotherapy for cancer according to the present embodiment, the effectiveness of immunotherapy for cancer is predicted based on the genotype of rs5472. Since the genotype is not affected by the condition of the subject when the sample is collected, the effectiveness of immunotherapy for cancer can be predicted with higher accuracy.

In addition, according to the method for predicting the effectiveness of immunotherapy for cancer according to the present embodiment, the effectiveness of immunotherapy for a subject can be predicted only by determining the type of one base. The effectiveness of immunotherapy can be predicted easily and quickly.

In addition, according to the prediction method according to the present embodiment, the subject who can expect the effect of immunotherapy, the subject who cannot expect the effect of immunotherapy, the subject who shows treatment resistance to the immunotherapy, Predictable. Therefore, the prediction method is useful for decision making in selecting a treatment method.

In the present embodiment, in the prediction step, when the genotype determined in the determination step is a guanine homozygote or a heterozygote, immunotherapy is performed more than in the case where the genotype is adenine homozygote. If the genotype determined in the determination step is a homozygous homozygote or heterozygote of the guanine when the genotype determined in the determination step is predicted to have a longer survival time, It may be predicted that the survival time of the subject after immunotherapy will be short. Survival is an important endpoint in cancer treatment, and this is also useful for decision making in selecting treatment methods.

In the prediction method according to the present embodiment, the cancer may be prostate cancer or digestive organ cancer. Prostate cancer includes so-called refractory prostate cancer such as relapsed prostate cancer and standard treatment resistant prostate cancer. In addition, digestive organ cancer includes intractable digestive organ cancer such as standard treatment resistant digestive organ cancer. By applying the prediction method according to the present embodiment to such patients with refractory prostate cancer or digestive organ cancer, application or non-application of immunotherapy within a limited number of treatment methods that can be selected It can be used as a method for determining.

In the prediction method according to the present embodiment, the immunotherapy may be peptide vaccine therapy. Peptide vaccine therapy reduces cancer in prostate cancer, stomach cancer, brain tumor, cervical cancer, colon cancer, etc., or suppresses cancer progression over a long period of time, resulting in a longer survival time Cases have been reported. By selecting a patient by applying the prediction method according to the present embodiment, it is possible to increase the probability that an effect of peptide vaccine therapy such as a cancer reduction effect, a progression suppression effect, and a life prolongation effect can be obtained.

In the prediction method according to the present embodiment, the sample collected from the subject may be blood. Usually, blood is easily obtained because it is collected during cancer testing, treatment, and prognostic observation.

In addition, as shown in the Example below, the polynucleotide containing the rs5472 site is useful as a marker for predicting or diagnosing the effectiveness of immunotherapy for cancer. For example, a marker for predicting the effectiveness of immunotherapy for cancer is a polynucleotide comprising a continuous base sequence of 10 to 100 of genomic DNA containing the base at rs5472. The polynucleotide comprises, for example, 10 to 100 consecutive base sequences including the 643rd base in the base sequence represented by SEQ ID NO: 1. In addition, according to the following examples, the genotype of rs5472 in genomic DNA contained in a sample collected from a subject is determined, and the effectiveness of immunotherapy for cancer of the subject is determined based on the determined genotype. Sex can also be diagnosed.

(Embodiment 2)
Next, a second embodiment will be described. Embodiment 2 of the present invention is a method for predicting the effectiveness of immunotherapy for cancer described above, which is designed to include at least 10 consecutive bases of genomic DNA containing the target base in the base sequence of the PCR product. The primer pair used.

The at least 10 bases of the genomic DNA containing the target base is, for example, 10 bases whose base sequence is represented by the above-described “ggagAagggg”. A PCR product is a nucleic acid amplified by the PCR method. Here, the primer pair is, for example, a forward primer for extending the coding strand side of a double-stranded template DNA from the 5 ′ end to the 3 ′ end, and a non-coding strand side 3 ′ from the 5 ′ end. A pair with a reverse primer for extending in the terminal direction. For example, when “ggagAagggg” is included in the base sequence of the PCR product using the forward primer, “ccccttctcc” is included in the base sequence of the PCR product using the reverse primer.

The forward primer is preferably, for example, an oligonucleotide having the base sequence shown in SEQ ID NO: 2. Moreover, it is preferable that a reverse primer is an oligonucleotide of the base sequence shown to sequence number 3, for example. Other combinations of forward primer and reverse primer include a combination of an oligonucleotide having the base sequence shown in SEQ ID NO: 4 and an oligonucleotide having the base sequence shown in SEQ ID NO: 5, and an oligonucleotide having the base sequence shown in SEQ ID NO: 6. A combination with the oligonucleotide having the base sequence shown in SEQ ID NO: 7 is available.

Oligonucleotide as primer can be synthesized by a known method. Oligonucleotides are chemically synthesized by any nucleic acid synthesis method including, for example, the solid phase phosphoramidite method. Oligonucleotides can also be synthesized by the triester method. Various automatic oligonucleotide synthesizers are commercially available, and oligonucleotides can also be synthesized by the automatic oligonucleotide synthesizer. Multinucleotide synthesis methods can also be used as appropriate.

As described above in detail, according to the primer pair according to the present embodiment, a nucleic acid having a base sequence containing at least 10 consecutive bases of genomic DNA containing a target base is amplified. Can be determined efficiently. For this reason, it is suitable for the prediction method of the effectiveness of the immunotherapy with respect to the said cancer.

(Embodiment 3)
Embodiment 3 of the present invention hybridizes to a nucleic acid containing at least 10 consecutive bases of genomic DNA containing a target base in the base sequence, or a nucleic acid complementary to the nucleic acid, and is effective for immunotherapy against the cancer. It is a probe used for the sex prediction method.

The probe may be, for example, one used in the above Invader (registered trademark) method. In addition, the probe may be used in, for example, the TaqMan (registered trademark) method.

Also, the probe can be used to determine the genotype of the target base by quantifying the hybridization with the nucleic acid containing the target base.

Examples of the method for quantifying hybridization include an SPR (surface plasmon resonance) method and a method using anomalous reflection of gold. By using the SPR method or the like, hybridization can be accurately quantified in real time. When using the SPR method, for example, by adding a linker to the 3 'end of the probe and further adding biotin to the 3' end of the linker, the probe can be immobilized on a sensor chip having avidin on the surface.

The intensity of hybridization can be quantified as the difference in resonance angle before and after the sensor chip is set in a known SPR measurement device and a solution containing a nucleic acid is brought into contact with the sensor chip. In this case, the adenine detection probe whose base corresponding to the target base is thymine hybridizes more strongly with the nucleic acid whose target base is adenine. On the other hand, the guanine detection probe whose base corresponding to the target base is cytosine hybridizes more strongly with the nucleic acid whose target base is guanine. Here, as in Example 4 below, by using a thymine detection probe whose base corresponding to the target base is adenine, hybridization between the adenine detection probe or the guanine detection probe and the nucleic acid containing the target base can be performed. Can be quantified by correcting the strength.

The base sequences of the adenine detection probe, the guanine detection probe and the thymine detection probe are represented by SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, respectively.

In addition, the probe according to the present embodiment may have one or more base mutations as long as it hybridizes to a nucleic acid containing a target base. For example, in the probe, the base corresponding to the site at the 1 'base 5' end side from the site of rs5472 may be guanine, adenine or thymine. When the base corresponding to the 1 base 5 ′ terminal side from the site of rs5472 is guanine, the base sequences of the adenine detection probe, the guanine detection probe, and the thymine detection probe are SEQ ID NO: 11, SEQ ID NO: 12, and SEQ ID NO: 12, respectively. This is indicated by the number 13. When the base corresponding to the site on the 1 '5' end side from the site of rs5472 is adenine, the base sequences of the adenine detection probe, the guanine detection probe and the thymine detection probe are SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 15, respectively. It is indicated by the number 16. When the base corresponding to the site on the 1 '5' end side from the site of rs5472 is thymine, the base sequences of the adenine detection probe, the guanine detection probe, and the thymine detection probe are SEQ ID NO: 17, SEQ ID NO: 18, and It is indicated by the number 19.

Oligonucleotides as probes can be synthesized by known methods in the same manner as the primer synthesis described above.

As described in detail above, the probe according to the present embodiment hybridizes to a nucleic acid containing at least 10 consecutive bases of genomic DNA containing the target base in the base sequence, so the type of the target base is determined efficiently. it can. For this reason, it is suitable for the prediction method of the effectiveness of the immunotherapy with respect to the said cancer.

Further, in the probe according to the present embodiment, the base corresponding to the site on the 1-base 5 'end side from the site of rs5472 may be guanine, adenine, or thymine. As shown in Example 4 below, according to the probe, the genotype of rs5472 can be determined with higher accuracy.

(Embodiment 4)
Embodiment 4 of the present invention is a kit for predicting the effectiveness of immunotherapy for cancer, comprising at least one of the primer pair and the probe.

If the primer pair included in the kit for predicting the effectiveness of immunotherapy for cancer is designed to contain at least 10 consecutive bases of genomic DNA containing the target base in the base sequence of the PCR product Good. For example, the kit for predicting the effectiveness of immunotherapy for cancer preferably contains an oligonucleotide having the base sequence shown in SEQ ID NO: 2 and an oligonucleotide having the base sequence shown in SEQ ID NO: 3 as the primer pair.

In addition, the probe included in the kit for predicting the effectiveness of immunotherapy for cancer hybridizes to a nucleic acid containing at least 10 consecutive bases of genomic DNA containing the target base in the base sequence, or a nucleic acid complementary to the nucleic acid. Anything that soy is acceptable.

A primer pair and an oligonucleotide as a probe included in a kit for predicting the effectiveness of immunotherapy for cancer can be synthesized by the above-described known method. The kit for predicting the effectiveness of immunotherapy for cancer is a restriction enzyme, polymerase, nucleoside triphosphate, label, buffer, etc. used in the determination step in the method for predicting the effectiveness of immunotherapy for cancer. May be included.

As described above in detail, according to the kit for predicting the effectiveness of immunotherapy for cancer according to the present embodiment, since the type of target base can be determined more quickly, the effectiveness of immunotherapy for the cancer described above is effective. It is suitable for the sex prediction method.

Note that the type of target base in the first embodiment may be determined by a known restriction fragment length polymorphism (RFLP) analysis method. In this method, a nucleic acid in a sample is treated with a restriction enzyme that differs depending on the type of target base. Subsequently, by examining the size of the processed nucleic acid fragment, it can be determined whether or not the nucleic acid has been cleaved, so that the type of the target base can be determined.

In addition, the determination of the type of target base in the above-mentioned Embodiment 1 is a known method, such as denaturing gradient gel electrophoresis (DGGE), single strand conformation polymorphism analysis (SSCP: single strand conformation polymorphism). ), Allele-specific PCR (hybrid-specific PCR), hybridization method using ASO (allele-specific oligonucleotide), chemical cleavage of mismatch site (CCM), heteroduplex method (heteroduplexeplex method) , RCA ( using the following methods: “olling circuit amplification” method, LAMP method (Japanese Patent No. 3313358), NASBA method (Nucleic Acid Sequence-Based Amplification; Japanese Patent No. 2833586), ICAN method (Japanese Patent Laid-Open No. 2002-233379), etc. You may go.

In the determination of the type of target base in the first embodiment, the type of base in linkage disequilibrium with the target base may be determined. Here, the “base in linkage disequilibrium with the target base” means that the linkage disequilibrium coefficient with the target base is r ² > 0.5, preferably r ² > 0.8, more preferably r ² > 0.9. Says the base to fill. The base in linkage disequilibrium with the target base can be identified using, for example, the HapMap database (http://www.hapmap.org/index.html.ja). Bases that are in linkage disequilibrium with the target base can also be identified by analyzing DNA sequences collected from multiple individuals (usually about 20-40) and searching for SNPs in linkage disequilibrium. .

The probes in Embodiments 1, 3, and 4 are annealed with the genomic DNA and become circular like a single-stranded probe (padlock probe) used for amplification by the RCA (Rolling Circle Amplification) method. The probe may satisfy the above conditions. The probe may be used as a DNA chip with one end fixed to the substrate. In this case, only a probe complementary to a nucleic acid having one type of target base may be immobilized on the DNA chip, and in addition to this probe, the target base is complementary to a nucleic acid having another type. A simple probe may be fixed.

(Embodiment 5)
A microchip 100 and an analysis apparatus 200 according to Embodiment 5 of the present invention will be described with reference to the drawings.

FIG. 1 is a perspective view showing device configurations of a microchip 100 and an analysis device 200 according to the present embodiment. The microchip 100 has a multilayer structure configured by stacking a plurality of plates. The plurality of plates of the microchip 100 form a sample tank and a reaction tank by penetrating a part thereof. The microchip 100 is provided with pin holes 10a and 10b. The pin holes 10 a and 10 b determine the position of the microchip 100 with respect to the analysis device 200 when the microchip 100 is arranged in the analysis device 200.

The microchip 100 will be described in detail with reference to FIG. The microchip 100 includes a sample injection unit 101 as an injection unit, a washing buffer injection unit 102, a PCR reagent injection unit 103, an extraction unit 104, a discharge port 105, a PCR unit 106 as an amplification unit, and a flow path. 107.

The sample injection unit 101 is injected with a sample containing genomic DNA collected from a subject. Since the sample injection unit 101 is formed in a hollow shape, the user can inject a sample containing genomic DNA collected from the subject into the sample injection unit 101. The sample is a solution in which a sample (for example, oral mucosa, blood, body fluid, etc.) collected from a subject is suspended in a lysis buffer (for example, SDS / LiOAc solution (sodium dodecyl sulfate / lithium acetate solution)).

Since the cleaning buffer injection part 102 is formed in a hollow shape, the user can inject the cleaning buffer. The washing buffer is, for example, a Tris buffer, and is prepared at a high salt concentration in order to maintain the binding of DNA to magnetic beads (silica).

Since the PCR reagent injection part 103 is formed in a hollow shape, the user can inject the PCR reagent. PCR reagents include, for example, polymerase, fluorescently labeled ddNTP, magnesium, and the like.

In addition, a commercially available thing can be utilized for a lysis buffer, a washing | cleaning buffer, and a PCR reagent, and it can also prepare it by modifying a composition as needed. The washing buffer and the PCR reagent may be injected by the user as described above, but may be enclosed in the microchip 100 in advance.

The extraction unit 104 extracts genomic DNA from the sample injected into the sample injection unit 101. The extraction unit 104 is a reaction tank provided for extracting genomic DNA from a sample. The extraction unit 104 encloses magnetic beads for extracting genomic DNA. Hereinafter, genomic DNA extracted from a sample is also referred to as template DNA.

The discharge port 105 discharges drainage liquid such as a washing buffer remaining after the template DNA is extracted in the extraction unit 104.

The PCR unit 106 amplifies a region including the SNP site registered as rs5472 in the NCBI SNP database in the template DNA extracted by the extraction unit 104. The PCR unit 106 is a reaction vessel for amplifying a region including the rs5472 site of the template DNA. The PCR unit 106 amplifies the region by performing PCR. In order to perform PCR, the temperature of the PCR unit 106 is adjusted by the analysis device 200. In the PCR unit 106, a primer designed to amplify a region including the rs5472 site of the template DNA is enclosed.

The flow path 107 is a pipe, for example, and is formed so that liquid flows in the pipe. The channel 107 connects the sample injection unit 101, the washing buffer injection unit 102, the PCR reagent injection unit 103, the extraction unit 104, the discharge port 105, and the PCR unit 106 as shown in FIG. The flow of the liquid in the flow path 107 is controlled by the analysis device 200.

Next, returning to FIG. 1, the analyzing apparatus 200 will be described in detail. The analysis device 200 includes a pedestal 1, a table 2, a control unit 3, a lid 4, a pressure accumulator 5, a solenoid valve 6, a tube 7, a power supply unit 8, and an analysis unit 9.

A table 2 is arranged on the base 1. The table 2 is provided with pins 21a and 21b, a temperature adjusting unit 22 and a measuring unit 23 on the upper surface thereof. The pins 21 a and 21 b are respectively inserted into pin holes 10 a and 10 b provided in the microchip 100, so that the microchip 100 is disposed at a predetermined position on the table 2. When the microchip 100 is placed at a predetermined position on the table 2, the PCR unit 106 of the microchip 100 comes into contact with the temperature adjustment unit 22 and the measurement unit 23.

The control unit 3 includes a CPU (Central Processing Unit) and a memory (both not shown), and the CPU executes a program stored in the memory. The control unit 3 controls the temperature adjustment unit 22, the measurement unit 23, the electromagnetic valve 6, and the power supply unit 8.

The base 1 and the lid 4 are connected via a hinge 41 so as to be opened and closed. The lid 4 is provided with a plurality of pressure holes 42 penetrating the lid 4. The accumulator 5 is filled with compressed air or the like. The internal pressure of the accumulator 5 is controlled by a pressure sensor and a pump (not shown) so as to maintain a predetermined pressure level.

The electromagnetic valve 6 is interposed between the pressurizing hole 42 and the pressure accumulator 5 and connected by the pressurizing hole 42, the accumulator 5 and the tube 7. The pressure applied to the pressure hole 42 is controlled by opening and closing the electromagnetic valve 6. When the electromagnetic valve 6 is opened, compressed air is released from the pressurizing hole 42.

When the lid 4 is closed in a state where the microchip 100 is disposed at a predetermined position on the table 2, a predetermined area of the microchip 100 comes into contact with the pressure hole 42. The area of the microchip 100 that comes into contact with the pressure hole 42 is pressurized with compressed air discharged from the pressure hole 42. For this reason, the flow path 107 of the microchip 100 realizes an opening / closing function. More specifically, for example, when liquid is transferred from the extraction unit 104 to the PCR unit 106, the extraction unit 104 is pressurized while being pressurized to the flow path 107 except between the extraction unit 104 and the PCR unit 106. . By doing so, the liquid in the extraction unit 104 is pushed out into the flow path 107 between the extraction unit 104 and the PCR unit 106 and flows into the PCR unit 106. In FIG. 1, only two sets of the pressurizing hole 42, the tube 7, and the electromagnetic valve 6 are illustrated, but the pressurizing hole 42, the tube 7, and the electromagnetic valve 6 may be increased or decreased depending on the configuration of the flow path 107. Good.

An electromagnet 43 is disposed inside the lid 4. The electromagnet 43 is connected to the power supply unit 8. The power supply unit 8 supplies power to the electromagnet 43. When the control unit 3 instructs the power supply unit 8 to supply power to the electromagnet 43 and stop the supply, the excitation of the electromagnet 43 is controlled. When the lid 4 is closed with the microchip 100 placed at a predetermined position on the table 2, the magnetic field generated by the electromagnet 43 reaches the extraction unit 104 of the microchip 100.

Here, extraction of the template DNA in the extraction unit 104 will be described in detail. The analysis apparatus 200 transfers the sample injected into the sample injection unit 101 to the extraction unit 104. The template DNA contained in the sample transferred to the extraction unit 104 is adsorbed on the magnetic beads enclosed in the extraction unit 104. After transferring the sample to the extraction unit 104, the analysis apparatus 200 transfers the cleaning buffer of the cleaning buffer injection unit 102 to the extraction unit 104, and cleans the magnetic beads. Since the magnetic field generated by the electromagnet 43 can be applied to the extraction unit 104, the analysis apparatus 200 leaves the template DNA in the extraction unit 104 by adsorbing the magnetic beads to the electromagnet 43, and discharges the sample and the washing buffer. Eject from 105. In this way, the extraction unit 104 can extract the template DNA.

For extraction of template DNA using magnetic beads, for example, MagExtractor (registered trademark) manufactured by Toyobo Co., Ltd., NucleoMag (registered trademark) manufactured by Takara Bio Inc. can be used. The template DNA extraction method can be modified as necessary, for example, by increasing the number of washings. The template DNA extraction method is not limited to the method using magnetic beads, and the template DNA may be extracted using a silica bead column such as QIAamp manufactured by Qiagen.

The temperature adjusting unit 22 includes a heat transfer material and adjusts the temperature of the PCR unit 106 of the microchip 100 arranged at a predetermined position of the table 2. By adjusting the temperature by the temperature adjusting unit 22, the PCR unit 106 amplifies the region including the rs5472 site of the template DNA.

The amplification of the region including the rs5472 site in the PCR unit 106 will be described in detail. The analysis apparatus 200 transfers the PCR reagent from the PCR reagent injection unit 103 to the extraction unit 104. Since the PCR reagent also serves as an elution buffer for eluting the template DNA from the magnetic beads, it is prepared at a low salt concentration. The eluted template DNA and PCR reagent are further transferred to the PCR unit 106. The temperature adjustment unit 22 adjusts the temperature of the PCR unit 106 as programmed in advance through the heat transfer material under the control of the control unit 3. The temperature of the PCR unit 106 is maintained at 95 ° C. for 5 minutes, for example, after 30 cycles of 94 ° C. for 30 seconds → 55 ° C. for 30 seconds → 72 ° C. for 20 seconds, then 72 ° C. for 3 minutes and 4 ° C. To be controlled. The PCR temperature conditions and the number of cycles can be changed based on the Tm value (melting temperature), the length of the primer set, and the like.

Here, only forward primers for amplification may be enclosed in the PCR unit 106 as a primer set, for example, as in the SNaPshot (registered trademark) method. The 3 'end of the forward primer is designed to correspond to the base immediately adjacent to the rs5472 site. Since dNTP is not included in the solution of the PCR unit 106, the 3 'end of the forward primer is extended by only one base with ddNTP labeled with fluorescence corresponding to the type of base. As a result, the fluorescently labeled ddNTP is incorporated into the amplicon, which is DNA amplified by PCR. Reagents used in the SNaPshot (registered trademark) method are available from Life Technologies.

The measurement unit 23 includes a light emitting element that emits a laser, and a light receiving element that receives fluorescence emitted by excitation by the laser emitted from the light emitting element (all not shown). The measurement unit 23 receives the fluorescence emitted from the ddNTP taken into the amplicon by irradiating the PCR unit 106 with a laser. The measurement unit 23 outputs a signal corresponding to the received fluorescence.

The analysis unit 9 functions as a determination unit. The analysis unit 9 determines the genotype of rs5472 included in the region amplified by the microchip 100. More specifically, for example, the analysis unit 9 receives a signal output according to the fluorescence emitted from the ddNTP taken into the amplicon, and determines the genotype of rs5472 based on the type of base.

Also, the analysis unit 9 functions as a prediction unit. The analysis unit 9 predicts the effectiveness of immunotherapy for cancer of the subject based on the determined genotype of rs5472.

As described above in detail, the microchip 100 according to the present embodiment extracts genomic DNA from a sample collected from a subject and amplifies a region including the rs5472 site in the extracted genomic DNA. . Therefore, the genotype of rs5472 can be determined by applying various methods to the amplified nucleic acid. In addition, since the microchip 100 is small and lightweight, it is easy to handle and can easily amplify the region including the rs5472 region.

It should be noted that other methods using PCR can be used to determine the genotype of rs5472 in the present embodiment. For example, the PCR unit 106 may use an invader (registered trademark) method or a TaqMan (registered trademark) method. By synthesizing a primer corresponding to each method and enclosing it in the PCR unit 106, an amplicon corresponding to the method can be obtained.

In addition, electrophoresis method can also be used to determine the genotype of rs5472 in this embodiment. In this case, the amplicon denatured into single-stranded DNA with formamide is injected into the capillary in which the microchip 100 is filled with the migration polymer, and a DC voltage may be applied using an electrode connected to the capillary. When electrophoresis is used, dNTP is added to the PCR reagent, and the PCR unit 106 amplifies the region including the rs5472 site. By doing so, since the amplicon is separated according to the base sequence length by the molecular sieving effect, the genotype of rs5472 can be determined by using a primer set having a different base sequence length so that the genotype can be identified.

The analysis apparatus 200 according to the present embodiment determines the genotype of rs5472 amplified by the microchip 100, and predicts the effectiveness of the immunotherapy for the cancer of the subject based on the determined genotype. According to the analysis device 200, since the operation using a pipette or the like is not required for determining the genotype, the operability is improved and the effectiveness of immunotherapy for cancer can be predicted quickly.

The present invention will be described more specifically with reference to the following examples, but the present invention is not limited to the examples.

(Example 1: Analysis of gene expression profile and SNP analysis of HP gene)
In this example, gene expression profiles of patients before peptide vaccine therapy were analyzed using a DNA microarray. Next, genes were selected based on the expression level of each gene. Subsequently, paying attention to the HP gene selected as a gene related to immunity or cancer from the selected gene, the SNP of the HP gene was analyzed. Examples will be described in detail below.

Peripheral blood collected at the time when relapsed prostate cancer was diagnosed from a standard treatment resistant relapsed prostate cancer patient was used as a patient sample. Using a DNA microarray (manufactured by Illumina, HumanWG-6 v3.0 Expression BeadChip), the gene expression profile before peptide vaccine therapy was analyzed for patient samples according to the following procedure.

(1) Extraction and purification of RNA from patient samples Three times the amount of TRIzol (registered trademark) LS (manufactured by Invitrogen) was added to the patient sample, and it became cloudy.
2. 200 μl of chloroform was added to 750 μl of the resulting solution, and after turbidity, the solution was centrifuged.
3. The supernatant was transferred to a new tube, and 0.55 times the amount of ethanol was added to the supernatant.
4). The obtained solution was applied to a column of SV Total RNA Isolation System (manufactured by Promega) and passed through a filter.
5. The filter was washed with 500 μl Wash buffer.
6. RNA was eluted from the filter with 80 μl of nuclease-free water.
7). The concentration of RNA was measured using a spectrophotometer.
8). The quality of RNA was checked by electrophoresis using an Experion system (Bio-Rad).
As described above, gene expression from 18 patients in the good prognosis group (survival time after peptide vaccine therapy is 900 days or more) and 19 patients in the poor prognosis group (survival time after peptide vaccine therapy is 300 days or less) An RNA capable of analyzing the profile was obtained.

(2) Synthesis of cRNA for microarray using Illumina TotalPrep RNA Amplification Kit (Ambion) Synthesis of single-stranded cDNA by reverse transcription Nuclease-free water was added to each tube containing 500 μg of RNA to prepare 11 μl of solution.
2. To the prepared solution, 9 μl of Reverse Transcription Master Mix was added, and the tube was incubated at 42 ° C. for 2 hours.

Synthesis of double-stranded cDNA After incubation, 80 μl of Second Strand Master Mix was added to the tube.
2. The tube was incubated at 16 ° C. for 2 hours.

Purification of cDNA After incubation, 250 μl of cDNA binding buffer was added to the tube.
2. The resulting solution was passed through a filter by centrifugation using a cDNA Filter Cartridge.
3. The filter was washed with 500 μl Wash buffer.
4). The cDNA was eluted from the filter with 19 μl of nuclease-free water preheated to 50-55 ° C.

Synthesis of cRNA by transcription reaction 1.7.5 μl of IVT Master Mix was added to the tube containing the eluted cDNA solution.
2. The tube was incubated at 37 ° C. for 14 hours.
3. After incubation, 75 μl of nuclease free water was added to the tube.

Purification of cRNA 1. 350 μl of cRNA Binding buffer was added to the tube.
2. 250 μl of 100% ethanol was added to the tube and turbid.
3. The resulting solution was passed through a filter by centrifugation using a cRNA Filter Cartridge.
4). The filter was washed with 650 μl Wash buffer.
5. The cRNA was eluted from the filter with 100 μl of nuclease-free water preheated to 50-55 ° C.
6). After measuring the cRNA concentration by absorbance, it was used as a sample for hybridization.

(3) Hybridization in DNA microarray Preparation of cRNA for hybridization 1. Nuclease-free water was added to a hybridization sample containing 500 μg of cRNA to prepare 10 μl.
2. 20 μl of GEX-HYB was added to the resulting solution and incubated at 65 ° C. for 5 minutes.

Hybridization The prepared cRNA solution was applied to HumanWG-6 v3.0 Expression BeadChip (microarray) set in a dedicated chamber.
2. The lid of the dedicated chamber was closed and incubated at 55 ° C. for 18 hours.

(4) Microarray washing and staining The microarray cover was removed in the Wash E1BC solution.
2. The microarray was quickly set on a slide rack and washed with 1 × High-Temp Wash buffer preheated to 55 ° C. for 10 minutes.
3. The microarray was washed with Wash E1BC solution for 5 minutes.
4). The microarray was washed with ethanol for 5 minutes.
5. The microarray was washed with Wash E1BC solution for 5 minutes.
6). 4 ml of block E1 buffer was placed in the staining tray, and microarrays were set one by one, and blocking was performed at room temperature for 10 minutes.
7.2 μl of streptavidin-Cy3 was added to 7.2 ml of the block E1 buffer, and the microarrays were set one by one and stained at room temperature for 10 minutes.
8). The microarray was washed with the Wash E1BC solution for 5 minutes and then dried by centrifugation.

(5) Scan and digitization The microarray was set on an Illumina dedicated scanner and scanned in standard mode.
2. After the scan was completed, the signal intensity of each spot on the microarray was digitized using dedicated software BeadStudio.

The obtained data was normalized using VST (Variance Stabilizing Transformation) and RSN (Robust Spline Normalization). The expression level of a gene whose Presence Probability was less than 0.05 with respect to the negative control, which was the level of gene expression measured with a probe for a gene not present on the microarray, was judged to be significant. Among 37 patients, genes with a presence probability of less than 0.05 in 70% or more patients were used for the following analysis.

(6) Selection of gene set Genes were selected on the basis of the correlation between the expression level of each gene and the survival period and the expression fluctuation between the good prognosis group and the poor prognosis group. The expression fluctuation was evaluated by increasing or decreasing the average expression level of the poor prognosis group with the average expression level of the good prognosis group as a control. Pearson's product-moment correlation coefficient and Spearman's rank sum coefficient were used for statistical analysis of the correlation between gene expression level and survival time. On the other hand, there are three methods for statistical analysis of expression fluctuation between the good prognosis group and the poor prognosis group, Limma (Tusher VG et al. Significance analysis of microarrays applied to the ionizing radiation response, Proc. Natl. Acad. Sci. USA, 2001, 98, 5116-5121), SAM (Smyth GK, Linear models and empirical bayes methods for assessing differential expression in microarray experiments, Stat Appl. Genet. Mol. Biol., 2004, 3, Article 3), Rank Prod (Breitling R et al. Rank products: a simple, yet powerful, new method to detect differentially regulated genes in replicated microarray experiments, FEBS Lett, 2004, 573, 83-92) was used.
Table 1 shows gene symbols of 39 genes selected as genes related to immunity or cancer from the top 300 genes selected by the above five methods.

(7) Extraction of genomic DNA Organic solvent obtained by treating human peripheral blood mononuclear cells collected from each patient with Trizol (Invitrogen) in order to perform SNP analysis on the gene selected above Genomic DNA was extracted from the layer by the following treatment.
1. 100 μl of ethanol was added to 100 μl of the organic solvent layer, mixed, and allowed to stand at room temperature for 5 minutes.
After centrifugation at 20,000 rpm for 30 minutes at 2.4 ° C., the supernatant was removed.
3. The precipitate was suspended in 150 μl of 0.1 M sodium citrate solution, allowed to stand at room temperature for 30 minutes, and centrifuged at 4 ° C. and 20,000 rpm for 20 minutes, and then the supernatant was removed.
4). The above operation 3 was repeated.
5. The precipitate was suspended in 200 μl of 75% ethanol and allowed to stand at room temperature for 20 minutes. After centrifugation at 4 ° C. and 20,000 rpm for 10 minutes, the supernatant was removed.
6). After completely drying the precipitate, it was dissolved in 15 μl of 8 mM sodium hydroxide solution, allowed to stand at 4 ° C. for 15 hours, centrifuged at 4 ° C. and 1,200 rpm for 10 minutes, and the supernatant was recovered to obtain the genome. A DNA solution was obtained.
As a result of the above treatment, genomic DNA capable of sequence analysis was obtained from 17 patients in the good prognosis group and 21 patients in the poor prognosis group, and used for the determination of the following DNA base sequences.

(8) SNP analysis of HP Of the 39 genes selected above, paying attention to the promoter region of HP, SNP was identified by the following direct sequencing method.
1. First, amplification reaction by PCR was performed using a genomic DNA solution as a template. The amplification reaction was performed in a 25 μl reaction system using 2 μl of genomic DNA solution. The conditions for the amplification reaction were 94 ° C. for 3 minutes → 94 ° C. for 30 seconds → 56 ° C. for 40 seconds → 72 ° C. for 80 seconds for 35 cycles, and then 72 ° C. for 3 minutes. The composition of the reaction solution is shown below.
1 x Ex Taq Buffer
200 μM dNTP Mixture
200nM HP-F1 primer
200nM HP-R1 primer
1U TaKaRa Ex Taq HS DNA polymerase (Takara Bio Inc.)
The base sequence of Hp-F1 primer is tcagtgtcaccatgattatcca (SEQ ID NO: 2), and the base sequence of Hp-R1 primer is gatttaacacactaagccctttgg (SEQ ID NO: 3).
2. 1 μl of Eo-SAP (GE healthcare) was added to 9 μl of the DNA solution after the amplification reaction, treated at 37 ° C. for 30 minutes and at 80 ° C. for 30 minutes, and then BigDye® Terminator v3.1 Cycle Sequence Kit (Life (Technologies Japan) was used for sequence analysis reaction. The reaction system was prepared according to the protocol provided by the kit. HP-R1 primer was used as a primer for sequence analysis.
3. The nucleotide sequence was determined by Applied Biosystems 3130 using the solution obtained by the sequence analysis reaction.

(result)
As a result of sequencing, SNP (rs5472) was identified as a base 55 bases upstream from the transcription start point of the HP gene. Table 2 shows the distribution of genotypes of the identified SNPs. In the following description, the rs5472 genotype may be abbreviated as “AA” for adenine homozygote, “GG” for guanine homozygote, and “AG” for adenine and guanine heterozygote.

All five patients with genotype GG had a good prognosis. On the other hand, 11 out of 12 patients with genotype AA had a poor prognosis. Of the 21 patients with genotype AG, 11 had good prognosis and 10 had poor prognosis.
From this result, it can be said that when the genotype of the SNP is GG, the survival time after the peptide vaccine therapy is longer and the peptide vaccine therapy is more effective than when AG or AA is used. Conversely, when the genotype of the SNP is AA, it can be said that the survival time after peptide vaccine therapy is shorter and the effectiveness of peptide vaccine therapy tends to be lower than when AG or GG is used.

(Example 2: Relationship between rs5472 genotype and survival of relapsed prostate cancer patients)
The genotype of rs5472 in the genomic DNA of 73 relapsed prostate cancer patients, in which 35 were added to the patients in the good prognosis group and the poor prognosis group in Example 1 above, was determined in the same manner as in Example 1 above. .

(result)
FIG. 3 shows the survival rate of prostate cancer patients with respect to the number of days after the start of peptide vaccine therapy for each genotype of rs5472. The p value in this example was calculated by a log rank test. The genotype GG patient group had a significantly longer survival time than the AA patient group (p = 0.00114, hazard ratio = 0.4861). In addition, the AG patient group had a significantly longer survival time than the AA patient group (p = 0.0259, hazard ratio = 0.05078).

(Example 3: Relationship between genotype of rs5472 and survival time of gastric cancer patients)
For 43 gastric cancer patients who received peptide vaccine therapy, the correlation between survival time after the start of peptide vaccine therapy and rs5472 genotype was examined. Genomic DNA was extracted from human peripheral blood mononuclear cells of gastric cancer patients in the same manner as in Example 1 above, and the genotype of rs5472 was determined.

(result)
FIG. 4 shows the survival rate of gastric cancer patients with respect to the number of days after the start of peptide vaccine therapy in each genotype of rs5472. The genotype GG patient group had a significantly longer survival time than the AA patient group (p = 0.0444, hazard ratio = 0.5681).

(Example 4: Determination of SNP genotype by surface plasmon resonance)
The surface plasmon resonance (SPR) method was used to determine the genotype of rs5472 in real time and with high sensitivity. In determining the genotype of SNP by the SPR method, a sample solution containing a target nucleic acid was brought into contact with a sensor chip having a probe immobilized on the surface, and hybridization between the probe and the target nucleic acid was measured.

First, as a sample solution containing the target nucleic acid, a solution of the PCR product and the synthetic nucleic acid was prepared. As a target to be amplified by PCR, genomic DNA whose rs5472 genotype is AA, GG or AG was used.

(Preparation of PCR sample)
1. First, a primary amplification reaction by PCR was performed using a genomic DNA solution (10 ng / μl) whose rs5472 genotype is AA, GG or AG as a template to obtain a 763-base PCR product. The primary amplification reaction was performed in a 20 μl reaction system using 1 μl of genomic DNA solution. The amplification reaction was conducted at 95 ° C. for 5 minutes, followed by 35 cycles of 94 ° C. for 30 seconds → 59 ° C. for 30 seconds → 72 ° C. for 20 seconds, followed by 72 ° C. for 3 minutes and completion at 4 ° C. did. The composition of the PCR reaction solution is shown below.
Ex Taq (Takara Bio Inc.): 10.0 μl
5 μM LEFT Primer: 0.4 μl
5 μM RIGHT Primer: 0.4 μl
Distilled water: 8.2 μl
Genomic DNA solution: 1.0 μl
Here, the base sequence of the forward primer is agataggccacacacaaggtg (SEQ ID NO: 4), and the base sequence of the reverse primer is cccggggagctgatgacata (SEQ ID NO: 5).

2. Next, a secondary amplification reaction by PCR was performed using a solution obtained by diluting a 763 base PCR product solution 10,000 times to obtain a 90 base PCR product containing the rs5472 site. The secondary amplification reaction was performed in a 60 μl reaction system. The amplification reaction was performed at 95 ° C. for 5 minutes, 94 ° C. for 30 seconds → 55 ° C. for 30 seconds → 72 ° C. for 20 seconds, 30 cycles, 72 ° C. for 3 minutes, and 4 ° C. for completion. did. The composition of the PCR reaction solution is shown below.
Ex Taq (Takara Bio Inc.): 30.0 μl
5 μM LEFT Primer: 12.0 μl
0.5 μM RIGHT Primer: 3.0 μl
Distilled water: 13.5 μl
763 base PCR product solution (diluted 10,000 times): 1.5 μl
Here, the base sequence of the forward primer is ccagggccaaagtttgtaga (SEQ ID NO: 6), and the base sequence of the reverse primer is gggcatctgctggtcttttt (SEQ ID NO: 7).

3. Then, 50 μl of a 90 base PCR product solution was added to a 2 × concentration running buffer (2 × diluted phosphate buffered saline (PBS), 0.1% TW20, 3000 mM sodium chloride and 2 mM ethylenediaminetetraacetic acid ( EDTA)) 50 μl, 1 μl of 50 μM L blocker and 1 μl of 50 μM R blocker were added to obtain a PCR sample.
The base sequence of the L blocker is cgtaattcctgtgtctacaa (SEQ ID NO: 20), and the base sequence of the R blocker is ttatgctgccactagctcac (SEQ ID NO: 21).

(Preparation of synthetic nucleic acid sample)
1. First, a 90-base nucleic acid in which the rs5472 site was adenine or guanine was synthesized. The base sequence of the synthetic nucleic acid whose rs5472 site is adenine is ccagggccaaagtttgtagacacaggaattacgaaatggagaagggggagaagtgagctagtggcagcataaaaagaccagcagatgccc (SEQ ID NO: 22). On the other hand, the base sequence of the synthetic nucleic acid whose rs5472 site is guanine is ccagggccaaagtttgtagacacaggaattacgaaatggaggagggggagaagtgagctagtggcagcataaaaagaccagcagatgccc (SEQ ID NO: 23).

2. Next, add 50 μM L blocker and R blocker (both 3 times the amount of the synthetic nucleic acid solution) to the 5 μM synthetic nucleic acid solution, and run the buffer to 12.5, 25, 50 or 100 nM (1-fold dilution). PBS, 0.05% TW20, 1500 mM sodium chloride and 1 mM EDTA), containing a synthetic nucleic acid sample A containing a synthetic nucleic acid in which the rs5472 site is adenine and a synthetic nucleic acid in which the rs5472 site is guanine. A synthetic nucleic acid sample G was obtained.

(Immobilization of probe)
A sensor chip on which a BiotinSAM film was formed was loaded with polydimethylsiloxane (PDMS) having a 5-channel configuration and set in an SPR device. Each channel was thoroughly washed with PBS-T solution (1-fold diluted PBS and 0.05% TW20), and 15 μl of PBS-T solution was added to each channel and allowed to stand for 1 minute. The PBS-T solution was removed, and 15 μl of 0.025 mg / ml Avidin solution diluted with PBS-T solution was placed in each channel and allowed to stand for 30 minutes. On the way, pipetting was performed after 15 minutes. The Avidin solution was removed, washed with PBS-T solution, 15 μl of PBS-T solution was added, and allowed to stand for 1 minute. The PBS-T solution of each channel was removed, and 15 μl of the adenine detection probe, guanine detection probe, or thymine detection probe solution was added to the channel and allowed to stand for 30 minutes. On the way, pipetting was performed after 15 minutes. The solution of each channel was removed, washed with PBS-T solution, and 15 μl of PBS-T solution was added and allowed to stand for 1 minute.

The base sequence of the adenine detection probe is ccccttctcca (SEQ ID NO: 8). The base sequence of the guanine detection probe is cccctcctcca (SEQ ID NO: 9). The base sequence of the thymine detection probe is cccctactcca (SEQ ID NO: 10).

In addition, a probe was designed in which, when hybridized, the base (C) corresponding to the site (G) on the 1-base 5 'end side from the site of rs5472 was changed to guanine, adenine, or thymine. That is, the base sequences of the adenine detection probe, the guanine detection probe, and the thymine detection probe in which the base is changed to guanine are ccccttgtcca (SEQ ID NO: 11), cccctcgtcca (SEQ ID NO: 12), and cccctagtcca (SEQ ID NO: 13). . The base sequences of the adenine detection probe, the guanine detection probe, and the thymine detection probe in which the base is changed to adenine are ccccttatcca (SEQ ID NO: 14), cccctcatcca (SEQ ID NO: 15), and cccctaatcca (SEQ ID NO: 16). The base sequences of the adenine detection probe, the guanine detection probe and the thymine detection probe in which the base is changed to thymine are ccccttttcca (SEQ ID NO: 17), cccctcttcca (SEQ ID NO: 18) and cccctattcca (SEQ ID NO: 19). .

In practice, three adenines were added as linkers to the 3 'end of each probe, and biotin for immobilization on the sensor chip was further added to the adenine at the 3' end of the linker. The probe used was a 50 μM TE solution diluted to 10 μM with PBS-T solution.

(Resonance angle measurement)
After fixing the probe, the 5-channel PDMS is replaced with a measurement PDMS, the reaction tank formed on the sensor chip is washed with 200 μl of running buffer, 200 μl of running buffer is placed in the reaction tank, and the running buffer is placed in the reaction tank. The resonance angle after 45 seconds was measured and set as the resonance angle before reaction. The running buffer was removed, and 100 μl of the PCR sample, synthetic nucleic acid sample A or synthetic nucleic acid sample G prepared above was put into a reaction vessel, pipetted and allowed to stand for 5 minutes. Thereafter, the PCR sample is removed, the reaction vessel is washed with 200 μl of running buffer, 200 μl of running buffer is placed in the reaction vessel, the running buffer is placed in the reaction vessel, and the resonance angle after 45 seconds is measured. The resonance angle was used. After the measurement, the running buffer was removed, a 20 mM sodium hydroxide solution was put into the reaction vessel, pipetted, washed with the running buffer, and the next sample was measured.

(result)
The intensity of hybridization was quantified as the magnitude of the change in resonance angle, which is the difference between the resonance angles before and after the reaction (hereinafter simply referred to as “resonance angle change amount”). The resonance angle change amount is represented by the intensity of a resonance signal whose unit is RU, and is 1000 RU = 0.1 °.

FIG. 5 shows the results of PCR samples in which the rs5472 genotype is AG, AA or GG, the left side is the result without correction, the right side is the amount of resonance angle change in the thymine detection probe, and the adenine detection probe and guanine detection. It is the result of subtracting from the amount of change of the probe for each. As shown in (A), when a probe whose base is not changed is used, although the resonance angle change amount for AA of the adenine detection probe is larger than the resonance angle change amount for GG, the GG of the guanine detection probe The amount of change in resonance angle with respect to is smaller than the amount of change in resonance angle with respect to AA.

On the other hand, as shown in (B), (C) and (D), when the probe changed to guanine, adenine or thymine is used, the resonance angles in AA and GG are respectively used in the adenine detection probe and the guanine detection probe. The amount of change was specifically large. In addition, the adenine detection probe and the guanine detection probe had the same amount of change in the resonance angle in AG.

FIG. 6 shows the result of the synthetic nucleic acid sample A, the left side is the result without correction, and the right side is the result of subtracting the amount of change in the resonance angle in the thymine detection probe from the amount of change in the adenine detection probe and the guanine detection probe. is there. As shown in (A), the amount of change in the resonance angle when using an adenine detection probe whose base was not changed increased depending on the concentration of the synthetic nucleic acid sample A. When the guanine detection probe and the thymine detection probe whose base was not changed were used, the resonance angle change amount was smaller than the resonance angle change amount of the adenine detection probe.

On the other hand, as shown in (B), (C) and (D), when a probe changed to guanine, adenine or thymine is used, an increase in the amount of resonance angle change in the guanine detection probe and the thymine detection probe is suppressed. As a result, the amount of change in the resonance angle when using the adenine detection probe can be more clearly identified.

Similarly, FIG. 7 shows the result of the synthetic nucleic acid sample G. As shown in (A), the amount of change in resonance angle when using a guanine detection probe whose base was not changed increased depending on the concentration of the synthetic nucleic acid sample G. However, the amount of change in the resonance angle when the guanine detection probe was used was similar to the amount of change in the resonance angle when the adenine detection probe and the thymine detection probe were used, except for the concentration of 100 nM.

On the other hand, as shown in (B), (C) and (D), when a probe changed to guanine, adenine or thymine is used, the amount of resonance angle change when using a guanine detection probe is more clearly defined. It became possible to identify.

From the results of this example, the genotype of rs5472 can be determined using the SPR method. In particular, when hybridized, a probe in which the base corresponding to the 1 base 5 'terminal site from the rs5472 site is changed to guanine, adenine, or thymine can determine the genotype of rs5472 with higher accuracy.

The present invention is capable of various embodiments and modifications without departing from the broad spirit and scope of the present invention. The above-described embodiments are for explaining the present invention and do not limit the scope of the present invention. In other words, the scope of the present invention is shown not by the embodiments but by the claims. Various modifications within the scope of the claims and within the scope of the equivalent invention are considered to be within the scope of the present invention.

This application is based on Japanese Patent Application No. 2012-193618 filed on September 3, 2012. The specification, claims, and entire drawings of Japanese Patent Application No. 2012-193618 are incorporated herein by reference.

The present invention is suitable for predicting the effectiveness of immunotherapy for cancer. By applying the present invention, it is expected to contribute to the selection of immunotherapy as an effective treatment method for cancer patients in the clinical field and also to improve the therapeutic results of immunotherapy.

DESCRIPTION OF SYMBOLS 1 Base 2 Table 3 Control part 4 Cover 5 Accumulator 6 Solenoid valve 7 Tube 8 Power supply part 9 Analysis part 10a, 10b Pin hole 21a, 21b Pin 22 Temperature adjustment part 23 Measurement part 41 Hinge 42 Pressurization hole 43 Electromagnet 100 Microchip 101 Sample injection unit 102 Wash buffer injection unit 103 PCR reagent injection unit 104 Extraction unit 105 Discharge port 106 PCR unit 107 Flow path 200 Analysis device

Claims (13)

1. A determination step of determining a genotype of a single nucleotide polymorphism registered as rs5472 in the SNP database of the National Center for Biotechnology Information in genomic DNA contained in a sample collected from a subject;
   A predicting step of predicting the effectiveness of immunotherapy for cancer in the subject based on the genotype determined in the determining step;
   For predicting the effectiveness of immunotherapy for cancer, including cancer.
2. In the prediction step,
   When the genotype determined in the determination step is a guanine homozygote or heterozygote, the immunotherapy is more effective for the subject than when the genotype is adenine homozygote. Predict,
   When the genotype determined in the determination step is an adenine homozygote, the immunotherapy is less effective for the subject than when the genotype is a guanine homozygote or heterozygote. Predict,
   The prediction method of the effectiveness of the immunotherapy with respect to the cancer of Claim 1 characterized by the above-mentioned.
3. In the prediction step,
   When the genotype determined in the determination step is a guanine homozygote or a heterozygote, the survival time of the subject after the immunotherapy than when the genotype is an adenine homozygote Is expected to be long,
   When the genotype determined in the determination step is a homozygote of adenine, the survival time of the subject after the immunotherapy than when the genotype is a homozygote or heterozygote of guanine Predict that is short,
   The prediction method of the effectiveness of the immunotherapy with respect to the cancer of Claim 1 or 2 characterized by the above-mentioned.
4. The cancer is
   Prostate cancer or digestive cancer,
   The method for predicting the effectiveness of immunotherapy for cancer according to any one of claims 1 to 3.
5. Said immunotherapy is:
   Peptide vaccine therapy,
   The method for predicting the effectiveness of immunotherapy for cancer according to any one of claims 1 to 4.
6. The sample is
   Is blood,
   The method for predicting the effectiveness of immunotherapy for cancer according to any one of claims 1 to 5.
7. Designed to contain at least 10 consecutive bases of genomic DNA containing the base of the single nucleotide polymorphism registered as rs5472 in the SNP database of the US Biotechnology Information Center in the base sequence of the PCR product.
   The primer pair used for the prediction method of the effectiveness of the immunotherapy with respect to the cancer as described in any one of Claims 1 thru | or 6.
8. Hybridizes to a nucleic acid containing at least 10 consecutive bases of genomic DNA containing a single nucleotide polymorphism site registered as rs5472 in the SNP database of the US Biotechnology Information Center, or a nucleic acid complementary to the nucleic acid. Soy,
   The probe used for the prediction method of the effectiveness of the immunotherapy with respect to the cancer as described in any one of Claims 1 thru | or 6.
9. The base corresponding to the site on the 1 ′ base 5 ′ end side from the single nucleotide polymorphism site is guanine, adenine or thymine,
   The probe according to claim 8.
10. Comprising at least one of the primer pair of claim 7, the probe of claim 8, and the probe of claim 9,
    A kit for predicting the effectiveness of immunotherapy for cancer.
11. An injection part into which a sample containing genomic DNA collected from a subject is injected;
    An extraction unit for extracting genomic DNA from the sample injected into the injection unit;
    An amplification unit for amplifying a region containing a single nucleotide polymorphism site registered as rs5472 in the SNP database of the US Biotechnology Information Center in the genomic DNA extracted by the extraction unit;
    A microchip.
12. A microchip according to claim 11;
    A determination unit for determining the genotype of the single nucleotide polymorphism contained in the region amplified by the microchip;
    A prediction unit for predicting the effectiveness of immunotherapy for cancer of the subject based on the genotype determined by the determination unit;
    An analysis apparatus comprising:
13. A polynucleotide comprising 10 to 100 consecutive nucleotide sequences of genomic DNA containing a base at a single nucleotide polymorphism site registered as rs5472 in the SNP database of the US Biotechnology Information Center,
    A marker for predicting the effectiveness of immunotherapy for cancer.

Images