WO2014033644A2 - Methods of nuclease-based genetic engineering - Google Patents

Methods of nuclease-based genetic engineering Download PDF

Info

Publication number
WO2014033644A2
WO2014033644A2 PCT/IB2013/058083 IB2013058083W WO2014033644A2 WO 2014033644 A2 WO2014033644 A2 WO 2014033644A2 IB 2013058083 W IB2013058083 W IB 2013058083W WO 2014033644 A2 WO2014033644 A2 WO 2014033644A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
zfns
obligare
vector
genome
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2013/058083
Other languages
French (fr)
Other versions
WO2014033644A3 (en
Inventor
Yi Yang
Marcello Maresca
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis AG
Original Assignee
Novartis AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis AG filed Critical Novartis AG
Publication of WO2014033644A2 publication Critical patent/WO2014033644A2/en
Publication of WO2014033644A3 publication Critical patent/WO2014033644A3/en
Priority to US14/632,497 priority Critical patent/US9567608B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/80—Vectors containing sites for inducing double-stranded breaks, e.g. meganuclease restriction sites

Definitions

  • CDNs including ZFNs and TALENs have made it possible to perform precise genetic engineering in many cell types and species(Bibikova et al., 2003;Christian et al., 2010;Hockemeyer et al., 2009;Kim et al., 1996;Meyer et al., 2010;Moehle et al., 2007;Porteus and Baltimore, 2003;Urnov et al., 2010).
  • hybrid endonucleases consist of a Fokl nuclease domain and a DNA binding domain assembled from optimized DNA binding modules that are specific for either single nucleotide (for TALENs) or trinucleotide motifs (for ZFNs).
  • ObLiGaRe a strategy of site-specific gene insertion utilizing the NHEJ pathway. It applies a similar logic to the one used in unidirectional loxP sites(Oberdoerffer et al, 2003) but maintains all the advantages and flexibility of CDNs.
  • the alternate design of the ZFNs site that we insert in the vector is necessary and sufficient to achieve precise end joining of the vector in the genomic ZFN site. Though less frequent, we did observe that aberrant joining products involving small deletions or insertions at the junctions. We speculated that these might result from processing alternative overhang types generated by the same ZFNs that were mismatched (Hockemeyer er a/., 2009;Orlando et al.
  • ObLiGaRe is applicable with both ZFNs and TALENs (Supplementary Fig. 1) and can be used as a high throughput method for screening potent CDNs replacing the current Cel-I assay (Reyon et al, 2012) It works in a wide variety of cell types including KBM7 and C2C12 cells in which precise gene insertion has not be demonstrated. We are currently testing whether it can be used in primary, non replicating cells in which NHEJ seems to be the predominant pathway to repair DSBs. We are also exploring whether it can work in embryos of mice and zebrafish. Finally we inserted the largest construct in the genome by ZFN to date (Fig. 3) and we predict that we can use it to deliver even larger construct such as BACs into a pre-defined genomic locus, which is very challenging, if not impossible, to achieve via HR.
  • Nras ZFN sites are indicated as violet and red circles with the corresponding sequences displayed in the same color scheme.
  • the predicted joining sequences between the vector and the genome are shown.
  • Primers for PCR detection of the junctions and probes are indicated.
  • the insertion of the vector will cause a size shift of an Ndel (N) digested fragment from wild type of 6.2 kb (WT) to the ligation product of 11.6 kb (LP) at Nras locus.
  • AAVS1 internal probe (int) and vector specific probe (CM) are indicated in the map at the hybridization sites.
  • P1 -P2 primers amplify the 5' junction and P3-P4 primes amplify the 3'junction.
  • the table lists the sequences of 5' and 3' junctions from pooled MEF cells obtained by cloning the genomic PCR products into TOPO TA vectors followed by sequences.
  • Figure 4 Introduce a 15 kb inducible gene expression cassette in AAVS1 locus by single step ObLiGaRe.
  • TALENs site wt
  • ObLiGaRe TALENs site iv
  • the predicted joining sequences after precise end joining between the vector and the genome are indicated.
  • Figure 7 Generate a reporter cell line for monitoring HR vs. ObLiGaRe.
  • CDNs Doyon et al., 201 1 ;Miller et al., 2007;Ramalingam et al., 2011 ;Szczepek et al., 2007
  • This method ObLiGaRe (Obligated Ligation- Gated Recombination) to reflect the etymologic meaning of the Latin verb obligare (to ligate head to head). It is broadly applicable in different cell lines and provides an additional approach for genetic engineering.
  • ObLiGaRe a strategy of site-specific gene insertion utilizing the NHEJ pathway. It applies a similar logic to the one used in unidirectional loxP sites(Oberdoerffer et al. , 2003) but maintains all the advantages and flexibility of CDNs.
  • the alternate design of the ZFNs site that we insert in the vector is necessary and sufficient to achieve precise end joining of the vector in the genomic ZFN site. Though less frequent, we did observe that aberrant joining products involving small deletions or insertions at the junctions.
  • ObLiGaRe is applicable with both ZFNs and TALENs (Supplementary Fig. 1) and can be used as a high throughput method for screening potent CDNs replacing the current Cel-I assay (Reyon et al. , 2012) It works in a wide variety of cell types including KBM7 and C2C12 cells in which precise gene insertion has not be demonstrated. We are currently testing whether it can be used in primary, non replicating cells in which NHEJ seems to be the predominant pathway to repair DSBs. We are also exploring whether it can work in embryos of mice and zebrafish. Finally we inserted the largest construct in the genome by ZFN to date (Fig. 3) and we predict that we can use it to deliver even larger construct such as BACs into a pre-defined genomic locus, which is very challenging, if not impossible, to achieve via HR.
  • KBM-7 a human myeloid leukemia cell line with double Philadelphia chromosomes lacking normal c-ABL and BCR transcripts. Leukemia 9: 2100-2108.
  • DNA-PK DNA-dependent protein kinase
  • Example 1 Precise end-joining by ObLiGaRe.
  • clones #1 had extra inserts in the genome as detected by the vector specific probe (CM probe) which might have been the result of either random insertion or insertion in other unidentified locus cleaved by PTEN ZFNs.
  • CM probe vector specific probe
  • all the clones showed the precise predicted sequences at the junction between PTEN and T2A-cherry while clone #2 presents additional insertions at the junctions of the second targeted allele of both PTEN and PTENP1 (Fig. 2b table).
  • Previously inducible transgene expression from the AAVS1 locus was achieved by targeting a tetracycline controlled responder in the AAVS1 locus followed by delivery of the reverse tetracycline transcription activator (rtTA) by lentiviral transduction or by gene targeting in a second allele of AAVS1 (DeKelver et al.,
  • HCT1 16 and RKO (American Type Culture Collection, VA) were cultured in McCoy's 5A medium (Life Technologies, CA) supplemented with 10% fetal bovine serum (Life Technologies, CA).
  • C2C12 (American Type Culture Collection, VA) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Life Technologies, CA).
  • KBM7 cells were cultured in IMDM Glutamax (Life
  • HCT116, RKO, C2C12 and MEFs cells were plated in 6-wells plates (50-80% confluence) and transfected with Lipofectamine LTX according to manufacture's instructions. Briefly, 2 g of ZFNs plasmid and 0.5 g of ObLiGaRe vector were mixed with 12 I of Lipofectamine LTX reagent and co-transfected into 5* 10 5 cells. 2 days after transfection cells were transferred to 15cm plates and subject to either puromycin (Life Technologies, CA) selection (0.5 g/ml) or G418 (Life Technologies, CA) selection (100 g/ ml ) the following day.
  • puromycin Life Technologies, CA
  • G418 Life Technologies, CA
  • GFP positive, puromycin resistant clones were harvested after 15 days of selection. 10 7 KBM7 cells were electroporated with 8 g of ZFN plasmids and 2 g of ObLiGaRe donor using Gene Pulserll electroporation system (Bio-Rad, Melville, NY) with electrical settings of 250 V and 950 pF. GFP positive cells were sorted by FACS (Y- Aria Becton Dickinson, NJ) two days after transfection and 100 GFP positives cells were seeded in 12 wells and selected with puromycin (1.0 g/mL); GFP positives, puromycin resistant clones (pools) were harvested after 10 days of selection.
  • ZFNs and TALENs used in this work carried obligate heterodimer forms of the Fokl endonuclease.
  • AAVS1 ZFNs and TALENs were made according to (Hockemeyer et al , 2009;Hockemeyer et al., 201 1).
  • the ZFN expression constructs were obtained by Sigma-Aldrich but modified to insert both ZFNs in one plasmids using ad h.o.c. recombination (Maresca ef al. unpublished).

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Enzymes And Modification Thereof (AREA)

Description

METHODS OF NUCLEASE-BASED GENETIC ENGINEERING
BACKGROUND OF THE INVENTION
[0001] The development of CDNs including ZFNs and TALENs has made it possible to perform precise genetic engineering in many cell types and species(Bibikova et al., 2003;Christian et al., 2010;Hockemeyer et al., 2009;Kim et al., 1996;Meyer et al., 2010;Moehle et al., 2007;Porteus and Baltimore, 2003;Urnov et al., 2010). These are hybrid endonucleases consist of a Fokl nuclease domain and a DNA binding domain assembled from optimized DNA binding modules that are specific for either single nucleotide (for TALENs) or trinucleotide motifs (for ZFNs). Once introduced in cells, these enzymes generate a DSB in the genome at or near the desired modification site. This event induces the natural DDR process to mend the breakage(Rouet et al., 1994). The primary pathway is NHEJ in which the two ends are processed and ligated together with nucleotide insertions and deletions. Though highly efficient, this mechanism can only produce functional knockout alleles that are often heterogeneous and difficult to isolate without clonal selection. Accurate gene modification relies on HR in which exogenous DNA fragments flanked by homology sequences around the DSB site can be copied faithfully from a template with defined boundaries (Rouet et al., 1994) .
[0002] Targeted gene modification has been almost exclusively mediated by homologous recombination. Though CDNs have made gene targeting feasible in cell lines that have low intrinsic HR efficiency, NHEJ is still the dominant DSB repair pathway. As a result, KO alleles generated by NHEJ are obtained at a much higher frequency than Kl alleles generated by HR. A deficiency in NHEJ can significantly promote HR as seen in E.coli in which NHEJ is neglectable(Liang et al., 1996; aresca et al., 2010) .
SUMMARY OF THE INVENTION
[0003] We have successfully applied ZFNs on generating knockout or knock-in alleles directly in mouse zygotes as reported in the literature(Cui et al., 201 1 ;Meyer et al.,
2010). While optimizing gene targeting conditions, we observed that a donor plasmid can be "ligated" into the genome if it contained the same ZFN recognition sites. It had been reported that short double strand DNAs with 5' overhangs could be ligated to the complementary ends generated after ZFN digestion(Orlando et al., 2010). This observation has not been further explored probably because it requires the knowledge of the overhangs generated by ZFNs and its application is limited to small
oligonucleotide insertions(Orlando ef al. , 2010). Furthermore, it had also been shown that sometimes donor molecules including single strand oligodeoxynucleotides
(ssODNs)(Chen et al., 2011 ;Radecke et al., 2010) and larger external linear sequences could be captured at DSB sites generated by ZFNs(Fung and Weinstock, 2011 ;Li et al., 2011 ;Mittelman et al., 2009). This feature has been harnessed to track "off-target" effects of the homing endonuclease l-Scel and ZFNs(Petek et al. , 2010). Based on these reports and our own observation in mouse embryos, we surmised that it should be possible to directly ligate an external DNA fragment generated in situ by the same ZFNs that target the genome.
[0004] We took advantage of the obligated herterodimeric property of the CDNs (Doyon et al., 201 1 jMiller et al. , 2007;Ramalingam et al, 2011 ;Szczepek et al, 2007) and designed a strategy to achieve efficient and precise gene targeting without homology in the donor plasmid. We named this method ObLiGaRe (Obligated Ligat ion-Gated Recombination) to reflect the etymologic meaning of the Latin verb obligare (to ligate head to head). It is broadly applicable in different cell lines and provides an additional approach for genetic engineering.
[0005] In this study we developed ObLiGaRe, a strategy of site-specific gene insertion utilizing the NHEJ pathway. It applies a similar logic to the one used in unidirectional loxP sites(Oberdoerffer et al, 2003) but maintains all the advantages and flexibility of CDNs. The alternate design of the ZFNs site that we insert in the vector is necessary and sufficient to achieve precise end joining of the vector in the genomic ZFN site. Though less frequent, we did observe that aberrant joining products involving small deletions or insertions at the junctions. We speculated that these might result from processing alternative overhang types generated by the same ZFNs that were mismatched (Hockemeyer er a/., 2009;Orlando et al. , 2010;Smith et al, 2000;Zeevi et al, 2008) . We never observed precise insertion of the vector at targeted genomic locus when a ZFNs site identical to the one present in the genome is introduced in the vector. In fact no integration of a surrogate reporter plasmid bringing a ZFNs site identical to the one in the genome was observed in a recent study(Kim et al, 201 1). ObLiGaRe eliminates cloning homology arms into the donor vector and does not require any previous knowledge of the overhangs generated by specific CDNs.
[0006] ObLiGaRe is applicable with both ZFNs and TALENs (Supplementary Fig. 1) and can be used as a high throughput method for screening potent CDNs replacing the current Cel-I assay (Reyon et al, 2012) It works in a wide variety of cell types including KBM7 and C2C12 cells in which precise gene insertion has not be demonstrated. We are currently testing whether it can be used in primary, non replicating cells in which NHEJ seems to be the predominant pathway to repair DSBs. We are also exploring whether it can work in embryos of mice and zebrafish. Finally we inserted the largest construct in the genome by ZFN to date (Fig. 3) and we predict that we can use it to deliver even larger construct such as BACs into a pre-defined genomic locus, which is very challenging, if not impossible, to achieve via HR.
[0007] Beyond the practical value of our method, it can be used as a new tool in the study of NHEJ and the crosstalk between NHEJ and HR. Although similar strategies were reported using the l-Scel homing endonuclease(Certo et al. , 201 1), our strategy allows us to track any endogenous locus that can be targeted by ZFNs. We are interested in using this reporter system to monitor differential utilizations of NHEJ and HR in cells before and after oncogenic transformation. We are also continuing to identify chemical and genetic modulators that influence the cells to choose NHEJ or HR.
BRIEF DESCRIPTION OF THE DRAWINGS
[0008] Figure 1 ObLiGaRe at AAVS1 locus.
[0009] (a) Schematic illustration of ObLiGaRe strategy. ZFN recognition sites are indicated as grey and blue circles with the corresponding sequences displayed in the same color scheme. The predicted joining sequences between the vector and the genome are shown. The insertion of the vector in the AAVS1 locus will cause a size shift from 6.7 kb (WT) to 14.2 kb (LP) of a Hindlll (H) digested fragment. AAVS1 internal probe (int) and vector specific probe (CM) are indicated in the map at the hybridization sites.
[00010] (b) Southern blot of 4 puro resistant colonies after ObLiGaRe at AAVS1 locus in HCT116 (upper), RKO (middle) and KBM-7 (lower) with int probe (left) and CM probe (right) with sequences at the 5' and 3' junctions corresponding to each clones listed on the right. Insertions are indicated in red, deletions are indicated as red dotted lines.
[00011 ] Figure 2 ObLiGaRe at PTEN locus.
[00012] (a) Strategy for targeting human PTEN (left) and PTENP1. PTEN ZFN recognition sites are indicated as orange and cyan circles with the corresponding sequences displayed in the same color scheme. The predicted joining sequences between the vector and the genome are indicated. The insertion of the vector will cause a size shift of a BsrGI (B) digested fragment from wild type of 2.4 kb (WT) to the ligation product of 7.8 kb (LP) at PTEN locus and 25.6 kb (WT) to 31 .0 kb (LP) at PTENP1 locus. AAVS1 internal probe (int) and vector specific probe (CM) are indicated in the map at the hybridization sites.
[00013] (b) Southern blots using probes specific for PTEN (PT, left), PTENP1 (P1 middle), and the vector (CM, right) for 4 G418 resistant colonies. The sequence of the 5' junction between PTEN or PTENP1 and mCherry are indicated in the table. Insertions are indicated in red where "ins" represents a 224bp insertion.
[00014] Figure 3 ObLiGaRe in C2C112 and MEF cells.
[00015] (a) Strategy for targeting Nras locus in MEF and C2C12 cells. Nras ZFN sites are indicated as violet and red circles with the corresponding sequences displayed in the same color scheme. The predicted joining sequences between the vector and the genome are shown. Primers for PCR detection of the junctions and probes (CM and NR) are indicated. The insertion of the vector will cause a size shift of an Ndel (N) digested fragment from wild type of 6.2 kb (WT) to the ligation product of 11.6 kb (LP) at Nras locus. AAVS1 internal probe (int) and vector specific probe (CM) are indicated in the map at the hybridization sites.
[00016] (b) Southern blot for 4 C2C12 clones expressing mCherry. LP indicates the expected ligation product band upon integration of the vector in the genome.
[00017] (c) Genomic PCR products amplified from pools of MEFs after transfection with ObLiGaRe donor alone (V) or co-transfection with ObLiGaRe donor and Nras ZFNs
(V+l). P1 -P2 primers amplify the 5' junction and P3-P4 primes amplify the 3'junction.
The table lists the sequences of 5' and 3' junctions from pooled MEF cells obtained by cloning the genomic PCR products into TOPO TA vectors followed by sequences.
Deletions are indicated as red dotted lines and insertion in red capital letters.
[00018] Figure 4 Introduce a 15 kb inducible gene expression cassette in AAVS1 locus by single step ObLiGaRe.
[00019] (a) Strategy to introduce an inducible gene expression cassette. ZFN cutting sites are the same as in Figure 1 . The expression of rtTA is controlled by the constitutive CAG promoter while GFP is under the doxycycline responsive promoter (tetO). The STOP sign indicates a transcription termination cassette. Int and CM represent the probe for Southern blot. P1 -P2 and P3-P4 are PCR primers used to amplify the 5' and 3' junctions. K: Kpnl.
[00020] (b) Southern blot of 8 positive clones is showed with both internal (int) and vector specific probe (CM). LP product indicates the expected ligation product upon vector integration. The sequence for 5' and 3' junction of the 8 clones are reported in the table on the right with dotted lines indicate deletions.
[00021 ] (c) GFP fluorescence is detected by fluorescence microscopy in cells from Clone No. 6 without (-) and with (+) 48 hr treatment of 1 g/ml doxycycline (dox).
[00022] Figure 5 ObLiGaRe is mediated via NHEJ.
[00023] (a) Illustration of the reporter DGF cassette in the AAVS1 locus. ZFN sites are the same as in Figure 3. A functional GFP is generated after HR using the HA plasmid as donor, while a functional mCherry is inserted upon ObLiGaRe using the ObLiGaRe donor. The two donors are about the same size.
[00024] (b) Determination of fluorescent cells number after co-transfection of Nras ZFN, ObLiGaRe and HA donors by FACS. Detection of GFP and mCherry cells were gated using parental cells (WT, left) which did not show any fluorescent cells upon co- transfection. When the reporter cell line was contrasfected with the 3 constructs, GFP and mCherry cells were shown in their corresponding gates (DGF, right).
[00025] (c) Representation of the percentage of GFP and mCherry positive cells out of total live cells in WT HCT116 cells, reporter HCT1 16 cells, without any treatment (DGF) or after treatment with 10 M Nu7026 or 4 mM Caffeine. Error bars: standard deviation; n=3.
[00026] Figure 6 ObLiGaRe using AAVS1 TALEN.
[00027] (a) Schematic illustration of ObLiGaRe strategy at PPP1 R12C (AAVS1) locus with TALENs. TALENs recognition sites are indicated as grey and blue circles connected with small arrows (cutting sites). The DNA sequence of AAVS1 specific
TALENs site (wt) and the ObLiGaRe TALENs site (iv) are shown. The predicted joining sequences after precise end joining between the vector and the genome are indicated.
[00028] (b) Southern blot of 6 puromycin resistant clones after ObLiGaRe. LP indicates the predicted ligation product. The probes are the same as used in Fig. 1. The 5' and 3' junction sequences of the 6 clones are in the tables on the right. S: Sphl.
[00029] Figure 7 Generate a reporter cell line for monitoring HR vs. ObLiGaRe.
[00030] (a) Strategy of inserting the DGF reporter at the AAVS1 locus. Primers used for PCR screening (P1 -P2) and probe for Southern blot (int) are reported in the map.
[00031 ] (b) Genomic PCR screening of 15 puromycin resistant colonies for the insertion of the puro cassette at PPP1 R12C locus.
[00032] (c) Southern blot of the seven clones identified after PCR screening. WT indicates the expected wild type band upon Hindlll (H) digestion. HRP indicates the expected homologous recombination product upon correct integration at PPP1 R12C locus. Clone#10 was used for the experiments described in Fig. 5.
DETAILED DESCRIPTION OF THE INVENTION
[00033] We have successfully applied ZFNs on generating knockout or knock-in alleles directly in mouse zygotes as reported in the literature(Cui et al., 2011 ;Meyer ef al., 2010) . While optimizing gene targeting conditions, we observed that a donor plasmid can be "ligated" into the genome if it contained the same ZFN recognition sites. It had been reported that short double strand DNAs with 5' overhangs could be ligated to the complementary ends generated after ZFN digestion(Orlando et al., 2010). This observation has not been further explored probably because it requires the knowledge of the overhangs generated by ZFNs and its application is limited to small
oligonucleotide insertions(Orlando et al. , 2010). Furthermore, it had also been shown that sometimes donor molecules including single strand oligodeoxynucleotides
(ssODNs)(Chen et al., 2011 ;Radecke et al., 2010) and larger external linear sequences could be captured at DSB sites generated by ZFNs(Fung and Weinstock, 2011 ;Li et al., 2011 ;Mittelman et al., 2009). This feature has been harnessed to track "off-target" effects of the homing endonuclease l-Scel and ZFNs(Petek et al. , 2010). Based on these reports and our own observation in mouse embryos, we surmised that it should be possible to directly ligate an external DNA fragment generated in situ by the same ZFNs that target the genome.
[00034] We took advantage of the obligated herterodimeric property of the
CDNs(Doyon et al., 201 1 ;Miller et al., 2007;Ramalingam et al., 2011 ;Szczepek et al., 2007) and designed a strategy to achieve efficient and precise gene targeting without homology in the donor plasmid. We named this method ObLiGaRe (Obligated Ligation- Gated Recombination) to reflect the etymologic meaning of the Latin verb obligare (to ligate head to head). It is broadly applicable in different cell lines and provides an additional approach for genetic engineering.
[00035] In this study we developed ObLiGaRe, a strategy of site-specific gene insertion utilizing the NHEJ pathway. It applies a similar logic to the one used in unidirectional loxP sites(Oberdoerffer et al. , 2003) but maintains all the advantages and flexibility of CDNs. The alternate design of the ZFNs site that we insert in the vector is necessary and sufficient to achieve precise end joining of the vector in the genomic ZFN site. Though less frequent, we did observe that aberrant joining products involving small deletions or insertions at the junctions. We speculated that these might result from processing alternative overhang types generated by the same ZFNs that were mismatched (Hockemeyer et al,, 2009;Orlando et al, , 2010;Smith et al, 2000;Zeevi et al., 2008) . We never observed precise insertion of the vector at targeted genomic locus when a ZFNs site identical to the one present in the genome is introduced in the vector. In fact no integration of a surrogate reporter plasmid bringing a ZFNs site identical to the one in the genome was observed in a recent study(Kim et al., 201 1). ObLiGaRe eliminates cloning homology arms into the donor vector and does not require any previous knowledge of the overhangs generated by specific CDNs.
[00036] ObLiGaRe is applicable with both ZFNs and TALENs (Supplementary Fig. 1) and can be used as a high throughput method for screening potent CDNs replacing the current Cel-I assay (Reyon et al. , 2012) It works in a wide variety of cell types including KBM7 and C2C12 cells in which precise gene insertion has not be demonstrated. We are currently testing whether it can be used in primary, non replicating cells in which NHEJ seems to be the predominant pathway to repair DSBs. We are also exploring whether it can work in embryos of mice and zebrafish. Finally we inserted the largest construct in the genome by ZFN to date (Fig. 3) and we predict that we can use it to deliver even larger construct such as BACs into a pre-defined genomic locus, which is very challenging, if not impossible, to achieve via HR.
[00037] Beyond the practical value of our method, it can be used as a new tool in the study of NHEJ and the crosstalk between NHEJ and HR. Although similar strategies were reported using the l-Scel homing endonuclease(Certo et al. , 201 1), our strategy allows us to track any endogenous locus that can be targeted by ZFNs. We are interested in using this reporter system to monitor differential utilizations of NHEJ and HR in cells before and after oncogenic transformation. We are also continuing to identify chemical and genetic modulators that influence the cells to choose NHEJ or HR.
[00038] REFERENCES
[00039] 1 . Andersson BS, Collins VP, Kurzrock R, Larkin DW, Childs C, Ost A, Cork A, Trujillo JM, Freireich EJ, and Siciliano MJ. 1995. KBM-7, a human myeloid leukemia cell line with double Philadelphia chromosomes lacking normal c-ABL and BCR transcripts. Leukemia 9: 2100-2108.
[00040] 2. Bibikova M, Beumer K, Trautman JK, and Carroll D. 2003. Enhancing gene targeting with designed zinc finger nucleases. Science 300: 764.
[00041 ] 3. Brown KD, Rathi A, Kamath R, Beardsley Dl, Zhan Q, and Mannino JL. 2003. The mismatch repair system is required for S-phase checkpoint activation. Nature Genetics 33: 80-84.
[00042] 4. Carette JE, Guimaraes CP, Varadarajan M, Park AS, Wuethrich I, Kotecki M, Cochran BH, Spooner E, Ploegh HL, and Brummelkamp TR. 2009. Haploid genetic screens in human cells identify host factors used by pathogens. Science 326: 1231 -1235.
[00043] 5. Certo MT, Ryu BY, Annis JE, Garibov M, Jarjour J, and Rawlings DJ. 2011 . Tracking genome engineering outcome at individual DNA breakpoints. Nature Methods 8: 671-676.
[00044] 6. Chen F, Pruett-Miller SM, Huang Y, Gjoka M, Duda K, Taunton J, Frodin M, and Davis GD. 2011. High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases. Nature Methods 8: 753-757.
[00045] 7. Christian M, Cermak T, Doyle EL, Schmidt C, Zhang F, Hummel A, Bogdanove A. J., and Voytas DF. 2010. Targeting DNA double-strand breaks with TAL effector nucleases. Genetics 186: 757-761. [00046] 8. Cui X, Ji D, Fisher DA, Wu Y, Briner DM, and Weinstein EJ. 2011.
Targeted integration in rat and mouse embryos with zinc-finger nucleases. Nature Biotechnology 29: 64-67.
[00047] 9. DeKelver RC, Choi VM, Moehle EA, Paschon DE, Hockemeyer D, Meijsing S.H., Sancak Y, Cui X, Steine EJ, Miller JC, Tarn P, Bartsevich W, Meng X., Rupniewski I, Gopalan SM, Sun HC, Pitz KJ, Rock JM, Zhang L, Davis G.D., Rebar EJ, Cheeseman IM, Yamamoto KR, Sabatini DM, Jaenisch R, and Urnov FD. 2010.
Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a safe harbor locus in the human genome. Genome Research 20: 1133-1 142.
[00048] 10. Doyon Y, Vo TD, Mendel MC, Greenberg SG, Wang J, Xia DF,
Miller JC, Gregory PD, and Holmes MC. 2011. Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures. Nature Method 8: 74-79.
[00049] 1 1 . Fung H and Weinstock DM. 2011. Repair at single targeted DNA double-strand breaks in pluripotent and differentiated human cells. PloS one 6: e20514.
[00050] 12. Hockemeyer D, Soldner F, Beard C, Gao Q, Mitalipova M,
DeKelver RC, Katibah GE, Amora R, Boydston EA, Zeitler B, Meng X, Miller JC, Zhang L, Rebar EJ, Gregory PD, Urnov FD, and Jaenisch R. 2009 Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases. Nature Biotechnology 27: 851-857.
[00051 ] 13. Hockemeyer D, Wang H, Kiani S, Lai CS, Gao Q, Cassady JP,
Cost GJ, Santiago Y, Miller JC, Zeitler B, Cherone JM, Meng X, Hinkley S.J. , Rebar EJ, Gregory PD, Urnov FD, and Jaenisch R. 201 1 Genetic engineering of human pluripotent cells using TALE nucleases. Nature Biotechnology 29: 731-734.
[00052] 14. Hollick JJ, Golding BT, Hardcastle IR, Martin N, Richardson C,
Smith GCM, and Griffin RJ. 2003. 2,6-Disubstituted pyran-4-one and thiopyran-4-one inhibitors of DNA-dependent protein kinase (DNA-PK). Bioorganic and Medicinal Chemistry Letters 13: 3083-3086.
[00053] 15. Kim H, Urn E, Cho SR, Jung C, Kim H, and Kim JS. 201 1.
Surrogate reporters for enrichment of cells with nuclease-induced mutations. Nature Methods 8: 941-943.
[00054] 16. Kim Y-G, Cha J, and Chandrasegaran S. 1996. Hybrid restriction enzymes: Zinc finger fusions to Fok I cleavage domain. Proceedings of the National Academy of Sciences of the United States of America 93: 1 156-1160.
[00055] 17. Li H, Haurigot V, Doyon Y, Li T, Wong SY, Bhagwat AS, Malani
N, Anguela X.M., Sharma R, Ivanciu L, Murphy SL, Finn JD, Khazi FR, Zhou S, Rebar EJ, Bushman FD, Gregory PD, Holmes MC, and High KA. 201 1. In vivo genome editing restores haemostasis in a mouse model of haemophilia. Nature 475: 217-221 .
[00056] 18. Liang F, Romanienko PJ, Weaver DT, Jeggo PA, and Jasin M.
1996. Chromosomal double-strand break repair in Ku80-deficient cells. Proceedings of the National Academy of Sciences of the United States of America 93: 8929-8933.
[00057] 19. Maresca M, Erler A, Fu J, Friedrich A, Zhang Y, and Stewart AF.
2010. Single-stranded heteroduplex intermediates in Red homologous recombination. BMC molecular biology 11.
[00058] 20. Meyer M, De Angelis MH, Wurst W, and Kuhn R. 2010. Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases. Proceedings of the National Academy of Sciences of the United States of America 107: 15022-15026.
[00059] 21 . Miller JC, Holmes MC, Wang J, Guschin DY, Lee Y-L, Rupniewski
I, Waite AJ, Wang NS, Kim KA, Gregory PD, and Pabo CO. 2007. An improved zinc- finger nuclease architecture for highly specific genome editing. Nature Biotechnology 25: 778-785.
[00060] 22. Mittelman D, Moye C, Morton J, Sykoudis K, Lin Y, Carroll D, and
Wilson JH. 2009. Zinc-finger directed double-strand breaks within CAG repeat tracts promote repeat instability in human cells. Proceedings of the National Academy of Sciences of the United States of America 106: 9607-9612.
[00061 ] 23. Moehle EA, Rock JM, Lee YL, Jouvenot Y, DeKelver RC, Gregory
PD, and Holmes MC. 2007. Targeted gene addition into a specified location in the human genome using designed zinc finger nucleases. Proceedings of the National Academy of Sciences of the United States of America 104: 3055-3060.
[00062] 24. Oberdoerffer P, Otipoby KL, Maruyama M, and Rajewsky K.
2003. Unidirectional Cre-mediated genetic inversion in mice using the mutant loxP pair lox66/lox71 . Nucleic Acids Research 31 : e140.
[00063] 25. Orlando SJ, Santiago Y, DeKelver RC, Freyvert Y, Boydston EA,
Moehle E.A., Choi VM, Gopalan SM, Lou JF, Li J, Miller JC, Holmes MC, Urnov FD, and Cost GJ. 2010. Zinc-finger nuclease-driven targeted integration into mammalian genomes using donors with limited chromosomal homology. Nucleic Acids Research 38: e152.
[00064] 26. Petek LM, Russell DW, and Miller DG. 2010. Frequent endonuclease cleavage at off-target locations in vivo. Molecular Therapy 18: 983-986.
[00065] 27. Poliseno L, Salmena L, Zhang J, Carver B, Haveman WJ, and
Pandolfi PP. 2010. A coding-independent function of gene and pseudogene mRNAs regulates tumour biology. Nature 465: 1033-1038. [00066] 28. Porteus MH and Baltimore D. 2003. Chimeric nucleases stimulate gene targeting in human cells. Science 300: 763.
[00067] 29. Pruett-Miller SM, Connelly JP, Maeder ML, Joung JK, and
Porteus MH. 2008. Comparison of zinc finger nucleases for use in gene targeting in mammalian cells. Molecular Therapy: the Journal of the American Society of Gene Therapy 16: 707-717.
[00068] 30. Radecke S, Radecke F, Cathomen T, and Schwarz K. 2010. Zinc- finger nuclease-induced gene repair with oligodeoxynucleotides: Wanted and unwanted target locus modifications. Molecular Therapy 18: 743-753.
[00069] 31 . Ramalingam S, Kandavelou K, Rajenderan R, and
Chandrasegaran S. 2011. Creating designed zinc-finger nucleases with minimal cytotoxicity. Journal of Molecular Biology 405: 630-641 .
[00070] 32. Reyon D, Tsai SQ, Khgayter C, Foden JA, Sander JD, and Joung
JK. 2012. FLASH assembly of TALENs for high-throughput genome editing. Nature Biotechnology 30: 460-465.
[00071 ] 33. Rouet P, Smih F, and Jasin M. 1994. Introduction of double- strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease. Molecular and Cellular Biology 14: 8096-8106.
[00072] 34. Sarkaria JN, Busby EC, Tibbetts RS, Roos P, Taya Y, and Karnitz
LM. 1999. Inhibition of ATM and ATR kinase activities by the radiosensitizing agent, caffeine. Cancer Research 59: 4375-4382.
[00073] 35. Smith J, Bibikova M, Whitby FG, Reddy AR, Chandrasegaran S, and Carroll D. 2000. Requirements for double-strand cleavage by chimeric restriction enzymes with zinc finger DNA-recognition domains. Nucleic Acids Research 28: 3361 - 3369.
[00074] 36. Szczepek M, Brondani V, Buchel J, Serrano L, Segal DJ, and
Cathomen T. 2007. Structure-based redesign of the dimerization interface reduces the toxicity of zinc-finger nucleases. Nature Biotechnology 25: 786-793.
[00075] 37. Urnov FD, Rebar EJ, Holmes MC, Zhang HS, and Gregory PD
2010. Genome editing with engineered zinc finger nucleases. Nature Reviews Genetics 11 : 636-646.
[00076] 38. Xu Z-L, Mizuguchi H, Ishii-Watabe A, Uchida E, Mayumi T, and
Hayakawa T. 2001. Optimization of transcriptional regulatory elements for constructing plasmid vectors. Gene 272: 149-156.
[00077] 39. Zeevi V, Tovkach A, and Tzfira T. 2008. Increasing cloning possibilities using artificial zinc finger nucleases. Proceedings of the National Academy of Sciences of the United States of America 105: 12785-12790. EXAMPLES
Example 1 : Precise end-joining by ObLiGaRe.
[00078] In order to directly ligate an exogenous DNA fragment into the genome, we initially introduced ZFN binding sites in a donor plasmid with the same orientation as in the genome. However we found this strategy often yielded unpredictable products presumably because the same ZFN binding sites were produced after ligation which could then be repetitively digested, a process that could stimulate end recessing before joining (Pruett-Miller et al., 2008) . One essential requirement for ZFN-mediated site- specific digestion using obligated heterodimers is that a pair of ZFNs needs to form heterodimers through the modified Fokl nuclease domain after binding to their targeted DNA sequences on the opposite strands. We thought that if we altered the orientation of the genomic ZFN recognition sequences in the donor plasmid we could lock the ligation product in a palindrome of identical half ZFN recognition site which would be no longer sensitive to the same obligated heterodimeric ZFN pairs. We used the well- characterized AAVS1 ZFN binding sites (located in the second intron of
PPP1 R12C)(Hockemeyer et al., 2009) to illustrate this design principle (Fig. 1a). Here we inverted the two half AAVS1 ZFN binding sites in the vector without changing the orientation of the linker region (Fig. 1a, ObLiGaRe donor). The AAVS1 ZFNs cut both the genome and the donor plasmid to produce complementary overhangs. After ligation, the newly formed junctions are resistant to further digestion by AAVS1 ZFNs.
[00079] To test this hypothesis we constructed a vector containing the modified AAVS1 ZFN site followed by a promoterless T2A-puro cassette. Precise ligation of this cassette into the AAVS1 site in the genome would render the cells resistant to puromycin. We also included a constitutive GFP reporter driven by CAG promoter(Xu et al., 2001) in the vector to track the cells transfected with the plasmid. We transfected the donor plasmid into HCT116 cells either with or without the plasmids encoding AAVS1 ZFNs and observed an increase in the number of puromycin resistant colonies when the donor plasmid was co-transfected with the plasmids encoding AAVS1
ZFNs(data not shown) . We randomly isolated four puromycin resistant, GFP positive clones and examined the vector integration by Southern blot. All four clones were heterozygous insertions of the vector as indicated with an AAVS1 locus specific probe (int probe, Fig. 1 b). In addition, we did not observe random insertions of the vector in the genome when using a vector specific probe (CM probe, Fig. 1 b). We then amplified the integration junctions by PCR and sequenced the PCR products. We found that 3 out of 4 clones had perfectly ligated junctions as predicted and one of them had a two nucleotides insertion in the linker region at the 5' junction (Fig. 1 b). Similar results were obtained in RKO cells (Fig. 1 b). Interestingly, one of the RKO clones turned out to be homozygous for a single copy vector insertion (clone #2). One clone (clone #4) was homozygous for a bigger insertion which might contain more than 1 copy of the vector.
[00080] We then tested ObLiGaRe in KBM7 cells. KB 7 is a close to haploid human myeloid leukemia cell line in which gene targeting has not been reported(Andersson et al., 1995;Carette et al., 2009). We co-transfected the donor plasmid with plasmids encoding AAVS1 ZFNs into KBM7 cells. Since the transfection efficiency was low we sorted GFP positive cells by FACS and subjected them for puromycin selection. We characterized 4 puromycin resistant clones and found 3 had correct insertions at the
AAVS1 locus with no detectable random insertions as judged by Southern blot (Fig. 1 b). Interestingly, the sequences of the junctions were very heterogeneous and often involved deletions probably between potential micro-homologies (Fig. 1 b). It's important to add that the KB 7 resistant clones might have be originated from different cells as indicated by the appearance of additional bands and junctions sequences in the same clone (Fig. 1 b).
[00081 ] To determine whether ObLiGaRe is restricted to the AAVS1 locus and/or AAVS1 ZFNs, we used PTEN specific ZFNs to insert a vector containing a promoterless T2A-mCherry cassette and a CAG-neo selection marker into the PTEN locus in HCT1 16 cells. Human genome contains a PTEN pseudogene, PTENP1 (Poliseno et al.,
2010)which is also targeted by the PTEN ZFNs. We isolated 4 G418 resistant clones and examined integration sites at both PTEN and PTENP1 loci by Southern blot. All clones had an insertion of the vector in PTEN locus, 2 are heterozygous (clones #1 & 3, Fig. 2b) for the insertion while 2 clones had an insertion on both alleles of PTEN (clones # 2 & 3, Fig. 2b). Clone #2 had an insertion of one copy of the vector in one allele and a larger insertion in the other allele as indicated by the presence of a higher band (Fig. 2b). It also contained an insertion in PTENP1 locus (Fig. 2b). Interestingly, clones #1 had extra inserts in the genome as detected by the vector specific probe (CM probe) which might have been the result of either random insertion or insertion in other unidentified locus cleaved by PTEN ZFNs. However all the clones showed the precise predicted sequences at the junction between PTEN and T2A-cherry while clone #2 presents additional insertions at the junctions of the second targeted allele of both PTEN and PTENP1 (Fig. 2b table).
[00082] In order to test whether ObLiGaRe does not rely on any specific mutations in HCT116 and RKO cells which are known to be defective in DNA mismatch
repairs(Brown et al., 2003), we decided to use a pair of ZFNs to target exon3 of Nras gene in mouse myoblast C2C12 cells (Fig. 3a). We co-transfected C2C12 cells with either Nras ZFNs alone or Nras ZFNs plus an ObLiGaRe vector containing a promoterless T2AmCherry cassette with a PGKneo selection marker and determined targeted integration in 4 randomly selected G418 resistant, mCherry fluorescent clones by Southern blot. All the clones showed targeted insertion of the vector at Nras locus as well as additional genomic insertion events except clone #4 (Fig. 3b). We sequenced the junctions between Nras and mCherry and confirmed that all 4 clones had precise end joining (data not shown). Finally, we applied the same strategy to target primary mouse embryonic fibroblast (MEF) cells. Since we could not perform clonal selection with MEFs, we pooled cells 3 days after transfection. We genotyped the pools by genomic PCR using primers that were specific for both 5' and 3' junction. We observed PCR products expected for correct integration only in cells transfected with ObLiGaRe vector and Nras ZFNs pair (Fig. 3c). We cloned the PCR products in a TOPO TA vector and sequenced 6 clones for each end. Majority of the sequences were the precise end joining sequence at both 5' and 3' ends (Fig. 3c).
[00083] Insertion of a 15 kb inducible gene expression cassette by ObLiGaRe at the AAVS1 locus.
[00084] Previously inducible transgene expression from the AAVS1 locus was achieved by targeting a tetracycline controlled responder in the AAVS1 locus followed by delivery of the reverse tetracycline transcription activator (rtTA) by lentiviral transduction or by gene targeting in a second allele of AAVS1 (DeKelver et al.,
2010;Hockemeyer et al., 2009). We decided to determine whether ObLiGaRe could facilitate insertion of the entire 15kb transgenic cassette into the AAVS1 locus in a single step which has not been reported before. We inserted the modified AAVS1 ZFN site at the 5' of an inducible cassette that contains all the components for doxycycline- induced transgene expressions in mice (Yi Yang, unpublished data) and co-transfected it with AAVS1 ZFNs in HCT116 cells. We screened 18 puromycin resistant clones for correct integrations by PCR and identified 14 have expected PCR product (data not shown). We chose 8 positive clones for further analysis by Southern blot and showed all of them had correct integration (Fig. 4b). We observed precise end joining in the majority of 8 clones tested at both 5' and 3' junctions (Fig. 4b). Furthermore we could induce GFP expression by adding doxycycline in all 8 clones as shown with clone# 6 (Fig. 4c).
Example 2: Mechanism of ObLiGaRe
[00085] We speculated that ObLiGaRe might be mediated by NHEJ since it dose not require any homology between the donor and the target. To test this hypothesis, we inserted a defective GFP (DGF) harboring a mouse Nras ZFN recognition site at the AAVS1 locus by HR in HCT116 cells (Fig. 5a). We chose one of the correctly heterozygous targeted clones as a reporter (Clone#10 Supplementary Fig. 2) . We co- transfected Nras ZFNs with 2 plasmids to measure ObLiGaRe vs. HR simultaneously. One had 500bp homology arms to the DGF and could reconstitute functional GFP by HR; the other had a modified Nras ZFNs site 5' to a promoterless T2A-mCherry cassette which would lead to mCherry expression upon insertion by ObLiGaRe (Fig. 5a). We FACS sorted cells and detected 6 times more mCherry positive cells than GFP positive cells in the reporter line but not the parental line (Fig. 5b). All clones derived from the mCherry fluorescent cells presented precise end joining of the mCherry with the defective GFP (data not shown). Interestingly, when we added 10 M Nu7026(Hollick et al., 2003) to the medium, a potent inhibitor of DNA-PK, the number of mCherry fluorescent cells was significantly reduced whereas that of GFP fluorescent cells was increased (p<0.001 , Fig. 5c), suggesting ObLiGaRe requires DNA-PK, a key component of NHEJ. On the other hand the addition of 4 mM caffeine to the medium, a non specific inhibitor of the ATM and ATR kinases which are involved in HR pathway(Sarkaria et al., 1999),causes a significant increase of mCherry fluorescent cells with a decrease of GFP fluorescent cells (p<0.001 , Fig. 5c). We plan to use our reporter system to study the balance between homologous recombination and NHEJ. Example 3: Cell culture and transections
[00086] HCT1 16 and RKO (American Type Culture Collection, VA) were cultured in McCoy's 5A medium (Life Technologies, CA) supplemented with 10% fetal bovine serum (Life Technologies, CA). C2C12 (American Type Culture Collection, VA) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Life Technologies, CA). KBM7 cells, were cultured in IMDM Glutamax (Life
Technologies, CA) supplemented with 10% fetal bovine serum. HCT116, RKO, C2C12 and MEFs cells were plated in 6-wells plates (50-80% confluence) and transfected with Lipofectamine LTX according to manufacture's instructions. Briefly, 2 g of ZFNs plasmid and 0.5 g of ObLiGaRe vector were mixed with 12 I of Lipofectamine LTX reagent and co-transfected into 5* 105 cells. 2 days after transfection cells were transferred to 15cm plates and subject to either puromycin (Life Technologies, CA) selection (0.5 g/ml) or G418 (Life Technologies, CA) selection (100 g/ ml ) the following day. GFP positive, puromycin resistant clones were harvested after 15 days of selection. 107 KBM7 cells were electroporated with 8 g of ZFN plasmids and 2 g of ObLiGaRe donor using Gene Pulserll electroporation system (Bio-Rad, Melville, NY) with electrical settings of 250 V and 950 pF. GFP positive cells were sorted by FACS (Y- Aria Becton Dickinson, NJ) two days after transfection and 100 GFP positives cells were seeded in 12 wells and selected with puromycin (1.0 g/mL); GFP positives, puromycin resistant clones (pools) were harvested after 10 days of selection.
Example 4: Comparing Homologous Recombination to ObLiGaRe:
[00087] 2* 105 reporter cells were transfected with 0.2 g ZFN plasmid, 0.3 g ObLiGaRe donor (Ob) and 0.5 g HA donor plasm ids (HA), using 4 L
Lipofectamine LTX in 12 wells.
[00088] The percentage of GFP and mCherry positive cells was measured using FACS cantoll flow cytometer (Becton Dickinson, NJ) 4 days after transfection.
[00089] Treatment with Nu7026 (Sigma Aldrich, MO) was started one day before transfection with a final concentration of 10 M Nu7026 (from a 10 mM stock solution in DMSO) and was continued for 2 days after transfection.
[00090] ANOVA and Tukey's HSD tests were adopted to perform statistical analysis using R statistics software.
[00091 ] ZFN expression plasmids
[00092] ZFNs against the human PTEN and Nras loci were designed and
manufactured by Sigma-Aldrich. ZFNs and TALENs used in this work carried obligate heterodimer forms of the Fokl endonuclease. AAVS1 ZFNs and TALENs were made according to (Hockemeyer et al , 2009;Hockemeyer et al., 201 1). The ZFN expression constructs were obtained by Sigma-Aldrich but modified to insert both ZFNs in one plasmids using ad h.o.c. recombination (Maresca ef al. unpublished).
[00093] PCR primers:
Southern blot internal probe for 5 '-tttctgtctgcagcttgtgg 5 '-gggtggaggggacagataaa
AA VS1
AA VS1 5' ObLiGaRe 5 '-cccetatgtccacttcagga ' - tgaggaagagttcttgcagct
AA VS1 3' ObLiGaRe '- tggctcattaggg atgctt 5 '- acaggaggtgggggttagac
Southern blot probe for CM 5'- tcactggatataccaccgttg 5 ' - tggtctgacagttattacgcc
Southern blot probe for PTEN 5'- gctgcagtccattgagcata 5 ' - gctgtggtgggttatggtct
Southern blot probe for hPTENPl 5'- attcgtcttctccccattcc 5 ' - gtgaattgctgcaacatga hPTEN 5' ObLiGaRe 5'- aagaccataacccaccacagc 5 ' - ttggtcaccttcagcttggc hPTENPl 5' ObLiGaRe 5'- aaagacattatgacaccgcc 5 '- ttggtcaccttcagcttggc
Southern blot probe for Nras 5'- gttccagtgccctgttcaat 5 '- cacaaccacttcccgaaact
Nras 5' ObLiGaRe 5'- ctgttagcgggttgagggta 5 '- aagcgcatgaactccttgat
Nras 3' ObLiGaRe 5'- attaatgcagctggcacgac 5 ' - tggcaaatacacagaggaacc
Southern blot probe for neo 5'- gatcggccattgaacaagat 5 '- gcgataccgtaaagcacgag

Claims

1. A method for providing site-specific gene insertion, said method employing obligated ligation-gated recombination.
2. The method of claim 1 whereby zinc finger nucleases (ZFNs) are used as enzymes for gene insertion.
3. The method of claim 1 whereby transcription activator-like effector nucleases (TALENs) are used as enzymes for gene insertion.
4. A method for engineering DNA damage repair (DDR) caused by a DNA double-strand break (DSB) in a target genome, said method employing obligated ligation-gated recombination.
5. The method of claim 4 whereby zinc finger nucleases (ZFNs) are used as enzymes for gene insertion.
6. The method of claim 4 whereby transcription activator-like effector nucleases (TALENs) are used as enzymes for gene insertion.
PCT/IB2013/058083 2012-08-28 2013-08-28 Methods of nuclease-based genetic engineering Ceased WO2014033644A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US14/632,497 US9567608B2 (en) 2012-08-28 2015-02-26 Methods of nuclease-based genetic engineering

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261693907P 2012-08-28 2012-08-28
US61/693,907 2012-08-28

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US14/632,497 Continuation US9567608B2 (en) 2012-08-28 2015-02-26 Methods of nuclease-based genetic engineering

Publications (2)

Publication Number Publication Date
WO2014033644A2 true WO2014033644A2 (en) 2014-03-06
WO2014033644A3 WO2014033644A3 (en) 2014-07-10

Family

ID=49585444

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2013/058083 Ceased WO2014033644A2 (en) 2012-08-28 2013-08-28 Methods of nuclease-based genetic engineering

Country Status (2)

Country Link
US (1) US9567608B2 (en)
WO (1) WO2014033644A2 (en)

Cited By (38)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015166272A3 (en) * 2014-05-02 2015-12-30 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
WO2017201476A1 (en) 2016-05-20 2017-11-23 Regeneron Pharmaceuticals, Inc. Methods for breaking immunological tolerance using multiple guide rnas
WO2018023014A1 (en) 2016-07-29 2018-02-01 Regeneron Pharmaceuticals, Inc. Mice comprising mutations resulting in expression of c-truncated fibrillin-1
WO2018136758A1 (en) 2017-01-23 2018-07-26 Regeneron Pharmaceuticals, Inc. Hsd17b13 variants and uses thereof
WO2019006034A1 (en) 2017-06-27 2019-01-03 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized asgr1 locus
WO2019028029A1 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Assessment of crispr/cas-induced recombination with an exogenous donor nucleic acid in vivo
WO2019028023A2 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Methods and compositions for assessing crispr/cas-mediated disruption or excision and crispr/cas-induced recombination with an exogenous donor nucleic acid in vivo
WO2019028032A1 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Cas-transgenic mouse embryonic stem cells and mice and uses thereof
WO2019067875A1 (en) 2017-09-29 2019-04-04 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus and methods of use
WO2019094735A1 (en) 2017-11-10 2019-05-16 Regeneron Pharmaceuticals, Inc. Non-human animals comprising slc30a8 mutation and methods of use
WO2019108983A1 (en) 2017-11-30 2019-06-06 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized trkb locus
WO2019183123A1 (en) 2018-03-19 2019-09-26 Regeneron Pharmaceuticals, Inc. Transcription modulation in animals using crispr/cas systems
WO2020056122A1 (en) 2018-09-13 2020-03-19 Regeneron Pharmaceuticals, Inc. Complement factor h gene knockout rat as a model of c3 glomerulopathy
WO2020131632A1 (en) 2018-12-20 2020-06-25 Regeneron Pharmaceuticals, Inc. Nuclease-mediated repeat expansion
WO2020190927A1 (en) 2019-03-18 2020-09-24 Regeneron Pharmaceuticals, Inc. Crispr/cas dropout screening platform to reveal genetic vulnerabilities associated with tau aggregation
WO2020190932A1 (en) 2019-03-18 2020-09-24 Regeneron Pharmaceuticals, Inc. Crispr/cas screening platform to identify genetic modifiers of tau seeding or aggregation
WO2020206162A1 (en) 2019-04-03 2020-10-08 Regeneron Pharmaceuticals, Inc. Methods and compositions for insertion of antibody coding sequences into a safe harbor locus
WO2020206139A1 (en) 2019-04-04 2020-10-08 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized coagulation factor 12 locus
WO2020247452A1 (en) 2019-06-04 2020-12-10 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus with a beta-slip mutation and methods of use
WO2020247812A1 (en) 2019-06-07 2020-12-10 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized albumin locus
EP3798250A1 (en) 2019-09-25 2021-03-31 University College Dublin Hyperbranched cationic polymers useful as nucleic acid delivery vectors for transfecting
WO2021058492A1 (en) 2019-09-25 2021-04-01 University College Dublin Nanoparticle compositions for gene therapy
WO2021092513A1 (en) 2019-11-08 2021-05-14 Regeneron Pharmaceuticals, Inc. Crispr and aav strategies for x-linked juvenile retinoschisis therapy
WO2021108363A1 (en) 2019-11-25 2021-06-03 Regeneron Pharmaceuticals, Inc. Crispr/cas-mediated upregulation of humanized ttr allele
WO2021154791A1 (en) 2020-01-28 2021-08-05 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized pnpla3 locus and methods of use
WO2021158883A1 (en) 2020-02-07 2021-08-12 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized klkb1 locus and methods of use
WO2021195079A1 (en) 2020-03-23 2021-09-30 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus comprising a v30m mutation and methods of use
WO2021263146A2 (en) 2020-06-26 2021-12-30 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ace2 locus
WO2023077053A2 (en) 2021-10-28 2023-05-04 Regeneron Pharmaceuticals, Inc. Crispr/cas-related methods and compositions for knocking out c5
WO2023081847A1 (en) 2021-11-04 2023-05-11 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a modified cacng1 locus
EP4183884A1 (en) 2021-11-19 2023-05-24 Branca Bunus Limited A method of preparing a fraction of a starting polymer vector for gene therapy
WO2023108047A1 (en) 2021-12-08 2023-06-15 Regeneron Pharmaceuticals, Inc. Mutant myocilin disease model and uses thereof
WO2023122506A1 (en) 2021-12-20 2023-06-29 Regeneron Pharmaceuticals, Inc. Non-human animals comprising humanized ace2 and tmprss loci
WO2023131648A1 (en) 2022-01-05 2023-07-13 Branca Bunus Limited Nanoparticulate compositions for gene therapy
WO2023150798A1 (en) 2022-02-07 2023-08-10 Regeneron Pharmaceuticals, Inc. Compositions and methods for defining optimal treatment timeframes in lysosomal disease
WO2023235725A2 (en) 2022-05-31 2023-12-07 Regeneron Pharmaceuticals, Inc. Crispr-based therapeutics for c9orf72 repeat expansion disease
WO2024026488A2 (en) 2022-07-29 2024-02-01 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a modified transferrin receptor locus
WO2025122754A1 (en) 2023-12-07 2025-06-12 Regeneron Pharmaceuticals, Inc. Gaa knockout non-human animals

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019099943A1 (en) 2017-11-16 2019-05-23 Astrazeneca Ab Compositions and methods for improving the efficacy of cas9-based knock-in strategies

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2013518602A (en) * 2010-02-09 2013-05-23 サンガモ バイオサイエンシーズ, インコーポレイテッド Targeted genome modification by partially single-stranded donor molecules
JP6559063B2 (en) * 2012-05-07 2019-08-14 サンガモ セラピューティクス, インコーポレイテッド Methods and compositions for nuclease-mediated targeted integration of transgenes

Non-Patent Citations (39)

* Cited by examiner, † Cited by third party
Title
ANDERSSON BS; COLLINS VP; KURZROCK R; LARKIN DW; CHILDS C; OST A; CORK A; TRUJILLO JM; FREIREICH EJ; SICILIANO MJ.: "KBM-7, a human myeloid leukemia cell line with double Philadelphia chromosomes lacking normal c-ABL and BCR transcripts", LEUKEMIA, vol. 9, 1995, pages 2100 - 2108
BIBIKOVA M; BEUMER K; TRAUTMAN JK; CARROLL D.: "Enhancing gene targeting with designed zinc finger nucleases", SCIENCE, vol. 300, 2003, pages 764
BROWN KD; RATHI A; KAMATH R; BEARDSLEY DI; ZHAN Q; MANNINO JL.: "The mismatch repair system is required for S-phase checkpoint activation", NATURE GENETICS, vol. 33, 2003, pages 80 - 84
CARETTE JE; GUIMARAES CP; VARADARAJAN M; PARK AS; WUETHRICH , KOTECKI M; COCHRAN BH; SPOONER E; PLOEGH HL; BRUMMELKAMP TR.: "Haploid genetic screens in human cells identify host factors used by pathogens", SCIENCE, vol. 326, 2009, pages 1231 - 1235
CERTO MT; RYU BY; ANNIS JE; GARIBOV M; JARJOUR J; RAWLINGS DJ.: "Tracking genome engineering outcome at individual DNA breakpoints", NATURE METHODS, vol. 8, 2011, pages 671 - 676
CHEN F; PRUETT-MILLER SM; HUANG Y; GJOKA M; DUDA K; TAUNTON J; FRODIN M; DAVIS GD.: "High-frequency genome editing using ssDNA oligonucleotides with zinc-finger nucleases.", NATURE METHODS, vol. 8, 2011, pages 753 - 757
CHRISTIAN M; CERMAK T; DOYLE EL; SCHMIDT C; ZHANG F; HUMMEL A; BOGDANOVE A.J.; VOYTAS DF: "Targeting DNA double-strand breaks with TAL effector nucleases.", GENETICS, vol. 186, 2010, pages 757 - 761
CUI X; JI D; FISHER DA; WU Y; BRINER DM; WEINSTEIN EJ.: "Targeted integration in rat and mouse embryos with zinc-finger nucleases", NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 64 - 67
DEKELVER RC; CHOI VM; MOEHLE EA; PASCHON DE; HOCKEMEYER D; MEIJSING S.H.; SANCAK Y; CUI X; STEINE EJ; MILLER JC: "Functional genomics, proteomics, and regulatory DNA analysis in isogenic settings using zinc finger nuclease-driven transgenesis into a safe harbor locus in the human genome.", GENOME RESEARCH, vol. 20, 2010, pages 1133 - 1142
DOYON Y; VO TD; MENDEL MC; GREENBERG SG; WANG J; XIA DF; MILLER JC; GREGORY PD; HOLMES MC: "Enhancing zinc-finger-nuclease activity with improved obligate heterodimeric architectures", NATURE METHOD, vol. 8, 2011, pages 74 - 79
FUNG H; WEINSTOCK DM: "Repair at single targeted DNA double-strand breaks in pluripotent and differentiated human cells", PLOS ONE, vol. 6, 2011, pages E20514
HOCKEMEYER D; SOLDNER F; BEARD C; GAO Q; MITALIPOVA M; DEKELVER RC; KATIBAH GE; AMORA R; BOYDSTON EA; ZEITLER B: "Efficient targeting of expressed and silent genes in human ESCs and iPSCs using zinc-finger nucleases", NATURE BIOTECHNOLOGY, vol. 27, 2009, pages 851 - 857
HOCKEMEYER D; WANG H; KIANI S; LAI CS; GAO Q; CASSADY JP; COST GJ; SANTIAGO Y; MILLER JC; ZEITLER B: "Genetic engineering of human pluripotent cells using TALE nucleases", NATURE BIOTECHNOLOGY, vol. 29, 2011, pages 731 - 734
HOLLICK JJ; GOLDING BT; HARDCASTLE IR; MARTIN N; RICHARDSON C; SMITH GCM; GRIFFIN RJ.: "2,6-Disubstituted pyran-4-one and thiopyran-4-one inhibitors of DNA-dependent protein kinase (DNA-PK", BIOORGANIC AND MEDICINAL CHEMISTRY LETTERS, vol. 13, 2003, pages 3083 - 3086
KIM H; UM E; CHO SR; JUNG C; KIM H; KIM JS: "Surrogate reporters for enrichment of cells with nuclease-induced mutations", NATURE METHODS, vol. 8, 2011, pages 941 - 943
KIM Y-G; CHA J; CHANDRASEGARAN S.: "Hybrid restriction enzymes: Zinc finger fusions to Fok I cleavage domain", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 93, 1996, pages 1156 - 1160
LI H; HAURIGOT V; DOYON Y; LI T; WONG SY; BHAGWAT AS; MALANI N; ANGUELA X.M.; SHARMA R; IVANCIU L: "In vivo genome editing restores haemostasis in a mouse model of haemophilia.", NATURE, vol. 475, 2011, pages 217 - 221
LIANG F; ROMANIENKO PJ; WEAVER DT; JEGGO PA; JASIN M.: "Chromosomal double-strand break repair in Ku80-deficient cells", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 93, 1996, pages 8929 - 8933
MARESCA M; ERLER A; FU J; FRIEDRICH A; ZHANG Y; STEWART AF.: "Single-stranded heteroduplex intermediates in Red homologous recombination", BMC MOLECULAR BIOLOGY, 2010, pages 11
MEYER M; DE ANGELIS MH; WURST W; KUHN R.: "Gene targeting by homologous recombination in mouse zygotes mediated by zinc-finger nucleases", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 107, 2010, pages 15022 - 15026
MILLER JC; HOLMES MC; WANG J; GUSCHIN DY; LEE Y-L; RUPNIEWSKI , WAITE AJ; WANG NS; KIM KA; GREGORY PD; PABO CO.: "An improved zinc-finger nuclease architecture for highly specific genome editing", NATURE BIOTECHNOLOGY, vol. 25, 2007, pages 778 - 785
MITTELMAN D; MOYE C; MORTON J; SYKOUDIS K; LIN Y; CARROLL D; WILSON JH.: "Zinc-finger directed double-strand breaks within CAG repeat tracts promote repeat instability in human cells", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 106, 2009, pages 9607 - 9612
MOEHLE EA; ROCK JM; LEE YL; JOUVENOT Y; DEKELVER RC; GREGORY PD; HOLMES MC: "Targeted gene addition into a specified location in the human genome using designed zinc finger nucleases", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 104, 2007, pages 3055 - 3060
OBERDOERFFER P; OTIPOBY KL; MARUYAMA M; RAJEWSKY K.: "Unidirectional Cre-mediated genetic inversion in mice using the mutant loxP pair lox66/lox71.", NUCLEIC ACIDS RESEARCH, vol. 31, 2003, pages E140
ORLANDO SJ; SANTIAGO Y; DEKELVER RC; FREYVERT Y; BOYDSTON EA; MOEHLE E.A.; CHOI VM; GOPALAN SM; LOU JF; LI J: "Zinc-finger nuclease-driven targeted integration into mammalian genomes using donors with limited chromosomal homology", NUCLEIC ACIDS RESEARCH, vol. 38, 2010, pages E152
PETEK LM; RUSSELL DW; MILLER DG.: "Frequent endonuclease cleavage at off-target locations in vivo.", MOLECULAR THERAPY, vol. 18, 2010, pages 983 - 986
POLISENO L; SALMENA L; ZHANG J; CARVER B; HAVEMAN WJ; PANDOLFI PP.: "A coding-independent function of gene and pseudogene mRNAs regulates tumour biology.", NATURE, vol. 465, 2010, pages 1033 - 1038
PORTEUS MH; BALTIMORE D.: "Chimeric nucleases stimulate gene targeting in human cells.", SCIENCE, vol. 300, 2003, pages 763
PRUETT-MILLER SM; CONNELLY JP; MAEDER ML; JOUNG JK; PORTEUS MH.: "Comparison of zinc finger nucleases for use in gene targeting in mammalian cells.", MOLECULAR THERAPY: THE JOURNAL OF THE AMERICAN SOCIETY OF GENE THERAPY, vol. 16, 2008, pages 707 - 717
RADECKE S; RADECKE F; CATHOMEN T; SCHWARZ K.: "Zinc-finger nuclease-induced gene repair with oligodeoxynucleotides: Wanted and unwanted target locus modifications.", MOLECULAR THERAPY, vol. 18, 2010, pages 743 - 753
RAMALINGAM S; KANDAVELOU K; RAJENDERAN R; CHANDRASEGARAN S.: "Creating designed zinc-finger nucleases with minimal cytotoxicity", JOURNAL OF MOLECULAR BIOLOGY, vol. 405, 2011, pages 630 - 641
REYON D; TSAI SQ; KHGAYTER C; FODEN JA; SANDER JD; JOUNG JK.: "FLASH assembly of TALENs for high-throughput genome editing", NATURE BIOTECHNOLOGY, vol. 30, 2012, pages 460 - 465
ROUET P; SMIH F; JASIN M.: "Introduction of double-strand breaks into the genome of mouse cells by expression of a rare-cutting endonuclease.", MOLECULAR AND CELLULAR BIOLOGY, vol. 14, 1994, pages 8096 - 8106
SARKARIA JN; BUSBY EC; TIBBETTS RS; ROOS P; TAYA Y; KARNNZ LM.: "Inhibition of ATM and ATR kinase activities by the radiosensitizing agent, caffeine", CANCER RESEARCH, vol. 59, 1999, pages 4375 - 4382
SMITH J; BIBIKOVA M; WHITBY FG; REDDY AR; CHANDRASEGARAN S; CARROLL D.: "Requirements for double-strand cleavage by chimeric restriction enzymes with zinc finger DNA-recognition domains", NUCLEIC ACIDS RESEARCH, vol. 28, 2000, pages 3361 - 3369
SZCZEPEK M; BRONDANI V; BUCHEL J; SERRANO L; SEGAL DJ; CATHOMEN T.: "Structure-based redesign of the dimerization interface reduces the toxicity of zinc-finger nucleases", NATURE BIOTECHNOLOGY, vol. 25, 2007, pages 786 - 793
URNOV FD; REBAR EJ; HOLMES MC; ZHANG HS; GREGORY PD: "Genome editing with engineered zinc finger nucleases", NATURE REVIEWS GENETICS, vol. 11, 2010, pages 636 - 646
XU Z-L; MIZUGUCHI H; ISHII-WATABE A; UCHIDA E; MAYUMI T; HAYAKAWA T.: "Optimization of transcriptional regulatory elements for constructing plasmid vectors.", GENE, vol. 272, 2001, pages 149 - 156
ZEEVI V; TOVKACH A; TZFIRA T.: "Increasing cloning possibilities using artificial zinc finger nucleases", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 105, 2008, pages 12785 - 12790

Cited By (51)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015166272A3 (en) * 2014-05-02 2015-12-30 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
EA034190B1 (en) * 2014-05-02 2020-01-15 Ионтас Лимитед Preparation of libraries of protein variants expressed in eukaryotic cells and use thereof for selecting binding molecules
US11286477B2 (en) 2014-05-02 2022-03-29 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
US11926818B2 (en) 2014-05-02 2024-03-12 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
US11912984B2 (en) 2014-05-02 2024-02-27 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
EP3461893A1 (en) * 2014-05-02 2019-04-03 Iontas Limited Preparation of libraries of protein variants expressed in eukaryotic cells and use for selecting binding molecules
EP4368637A2 (en) 2016-05-20 2024-05-15 Regeneron Pharmaceuticals, Inc. Methods for breaking immunological tolerance using multiple guide rnas
WO2017201476A1 (en) 2016-05-20 2017-11-23 Regeneron Pharmaceuticals, Inc. Methods for breaking immunological tolerance using multiple guide rnas
WO2018023014A1 (en) 2016-07-29 2018-02-01 Regeneron Pharmaceuticals, Inc. Mice comprising mutations resulting in expression of c-truncated fibrillin-1
WO2018136758A1 (en) 2017-01-23 2018-07-26 Regeneron Pharmaceuticals, Inc. Hsd17b13 variants and uses thereof
WO2019006034A1 (en) 2017-06-27 2019-01-03 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized asgr1 locus
EP4484562A2 (en) 2017-06-27 2025-01-01 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized asgr1 locus
US11696572B2 (en) 2017-06-27 2023-07-11 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ASGR1 locus
WO2019028023A2 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Methods and compositions for assessing crispr/cas-mediated disruption or excision and crispr/cas-induced recombination with an exogenous donor nucleic acid in vivo
WO2019028032A1 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Cas-transgenic mouse embryonic stem cells and mice and uses thereof
WO2019028029A1 (en) 2017-07-31 2019-02-07 Regeneron Pharmaceuticals, Inc. Assessment of crispr/cas-induced recombination with an exogenous donor nucleic acid in vivo
EP4276185A2 (en) 2017-09-29 2023-11-15 Regeneron Pharmaceuticals, Inc. Rodents comprising a humanized ttr locus and methods of use
WO2019067875A1 (en) 2017-09-29 2019-04-04 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus and methods of use
WO2019094735A1 (en) 2017-11-10 2019-05-16 Regeneron Pharmaceuticals, Inc. Non-human animals comprising slc30a8 mutation and methods of use
WO2019108983A1 (en) 2017-11-30 2019-06-06 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized trkb locus
EP4299732A2 (en) 2017-11-30 2024-01-03 Regeneron Pharmaceuticals, Inc. Rats comprising a humanized trkb locus
WO2019183123A1 (en) 2018-03-19 2019-09-26 Regeneron Pharmaceuticals, Inc. Transcription modulation in animals using crispr/cas systems
WO2020056122A1 (en) 2018-09-13 2020-03-19 Regeneron Pharmaceuticals, Inc. Complement factor h gene knockout rat as a model of c3 glomerulopathy
WO2020131632A1 (en) 2018-12-20 2020-06-25 Regeneron Pharmaceuticals, Inc. Nuclease-mediated repeat expansion
WO2020190932A1 (en) 2019-03-18 2020-09-24 Regeneron Pharmaceuticals, Inc. Crispr/cas screening platform to identify genetic modifiers of tau seeding or aggregation
EP4729947A2 (en) 2019-03-18 2026-04-22 Regeneron Pharmaceuticals, Inc. Crispr/cas screening platform to identify genetic modifiers of tau seeding or aggregation
EP4317950A2 (en) 2019-03-18 2024-02-07 Regeneron Pharmaceuticals, Inc. Crispr/cas screening platform to identify genetic modifiers of tau seeding or aggregation
WO2020190927A1 (en) 2019-03-18 2020-09-24 Regeneron Pharmaceuticals, Inc. Crispr/cas dropout screening platform to reveal genetic vulnerabilities associated with tau aggregation
WO2020206162A1 (en) 2019-04-03 2020-10-08 Regeneron Pharmaceuticals, Inc. Methods and compositions for insertion of antibody coding sequences into a safe harbor locus
WO2020206139A1 (en) 2019-04-04 2020-10-08 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized coagulation factor 12 locus
WO2020247452A1 (en) 2019-06-04 2020-12-10 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus with a beta-slip mutation and methods of use
WO2020247812A1 (en) 2019-06-07 2020-12-10 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized albumin locus
WO2021058491A1 (en) 2019-09-25 2021-04-01 University College Dublin Hyperbranched cationic polymers useful as nucleic acid delivery vectors for transfecting cells
EP3798250A1 (en) 2019-09-25 2021-03-31 University College Dublin Hyperbranched cationic polymers useful as nucleic acid delivery vectors for transfecting
WO2021058492A1 (en) 2019-09-25 2021-04-01 University College Dublin Nanoparticle compositions for gene therapy
WO2021092513A1 (en) 2019-11-08 2021-05-14 Regeneron Pharmaceuticals, Inc. Crispr and aav strategies for x-linked juvenile retinoschisis therapy
WO2021108363A1 (en) 2019-11-25 2021-06-03 Regeneron Pharmaceuticals, Inc. Crispr/cas-mediated upregulation of humanized ttr allele
WO2021154791A1 (en) 2020-01-28 2021-08-05 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized pnpla3 locus and methods of use
WO2021158883A1 (en) 2020-02-07 2021-08-12 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized klkb1 locus and methods of use
WO2021195079A1 (en) 2020-03-23 2021-09-30 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ttr locus comprising a v30m mutation and methods of use
WO2021263146A2 (en) 2020-06-26 2021-12-30 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a humanized ace2 locus
WO2023077053A2 (en) 2021-10-28 2023-05-04 Regeneron Pharmaceuticals, Inc. Crispr/cas-related methods and compositions for knocking out c5
WO2023081847A1 (en) 2021-11-04 2023-05-11 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a modified cacng1 locus
EP4183884A1 (en) 2021-11-19 2023-05-24 Branca Bunus Limited A method of preparing a fraction of a starting polymer vector for gene therapy
WO2023108047A1 (en) 2021-12-08 2023-06-15 Regeneron Pharmaceuticals, Inc. Mutant myocilin disease model and uses thereof
WO2023122506A1 (en) 2021-12-20 2023-06-29 Regeneron Pharmaceuticals, Inc. Non-human animals comprising humanized ace2 and tmprss loci
WO2023131648A1 (en) 2022-01-05 2023-07-13 Branca Bunus Limited Nanoparticulate compositions for gene therapy
WO2023150798A1 (en) 2022-02-07 2023-08-10 Regeneron Pharmaceuticals, Inc. Compositions and methods for defining optimal treatment timeframes in lysosomal disease
WO2023235725A2 (en) 2022-05-31 2023-12-07 Regeneron Pharmaceuticals, Inc. Crispr-based therapeutics for c9orf72 repeat expansion disease
WO2024026488A2 (en) 2022-07-29 2024-02-01 Regeneron Pharmaceuticals, Inc. Non-human animals comprising a modified transferrin receptor locus
WO2025122754A1 (en) 2023-12-07 2025-06-12 Regeneron Pharmaceuticals, Inc. Gaa knockout non-human animals

Also Published As

Publication number Publication date
US9567608B2 (en) 2017-02-14
WO2014033644A3 (en) 2014-07-10
US20160032321A1 (en) 2016-02-04

Similar Documents

Publication Publication Date Title
US9567608B2 (en) Methods of nuclease-based genetic engineering
Maresca et al. Obligate ligation-gated recombination (ObLiGaRe): custom-designed nuclease-mediated targeted integration through nonhomologous end joining
JP7419328B2 (en) genome engineering
Cristea et al. In vivo cleavage of transgene donors promotes nuclease‐mediated targeted integration
KR102683423B1 (en) METHODS AND COMPOSITIONS FOR TARGETED GENETIC MODIFICATION USING PAIRED GUIDE RNAs
Giacalone et al. CRISPR‐Cas9‐based genome editing of human induced pluripotent stem cells
Sizova et al. Chlamydomonas POLQ is necessary for CRISPR/Cas9-mediated gene targeting
Horii et al. Challenges to increasing targeting efficiency in genome engineering
Chiba et al. Genome editing in human pluripotent stem cells using site-specific nucleases
Fong et al. Transgene integration in mammalian cells: The tools, the challenges, and the future
US11254928B2 (en) Gene modification assays
Vannocci et al. Nuclease‐stimulated homologous recombination at the human β‐globin gene
Hauser Cell line development
Erbs et al. Increased on-target rate and risk of concatemerization after CRISPR-enhanced targeting in ES cells. Genes. 2023; 14: 401
Sato Engineered Recombinases: Tools for Therapeutic Human Genome Editing
WO2026038057A1 (en) Improved methods for gene editing
Kosicki Cas9-induced on-target genomic damage
Adikusuma Development and Applications of CRISPR/Cas9 Genome Editing Technology
Kumar Enhanced CRISPR/Cas9-mediated precise genome
Zhuang Group II Intron-Based Gene Targeting Reactions in Eukaryotes
Reh Enhancing gene targeting in mammalian cells by the transient down-regulation of DNA repair pathways
NZ754904A (en) Genome engineering
NZ754904B2 (en) Genome engineering
NZ754903B2 (en) Genome engineering
NZ754902B2 (en) Genome engineering

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13792075

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 13792075

Country of ref document: EP

Kind code of ref document: A2