WO2014033463A1 - Prevention of the interaction between tenascin-c and mir-155 to treat sepsis - Google Patents

Prevention of the interaction between tenascin-c and mir-155 to treat sepsis Download PDF

Info

Publication number
WO2014033463A1
WO2014033463A1 PCT/GB2013/052276 GB2013052276W WO2014033463A1 WO 2014033463 A1 WO2014033463 A1 WO 2014033463A1 GB 2013052276 W GB2013052276 W GB 2013052276W WO 2014033463 A1 WO2014033463 A1 WO 2014033463A1
Authority
WO
WIPO (PCT)
Prior art keywords
tenascin
mir
tnc
agent
level
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2013/052276
Other languages
French (fr)
Inventor
Kim Suzanne Midwood
Anna Maria Piccinini
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oxford University Innovation Ltd
Original Assignee
Oxford University Innovation Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oxford University Innovation Ltd filed Critical Oxford University Innovation Ltd
Publication of WO2014033463A1 publication Critical patent/WO2014033463A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/5308Immunoassay; Biospecific binding assay; Materials therefor for analytes not provided for elsewhere, e.g. nucleic acids, uric acid, worms, mites
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00Screening for compounds of potential therapeutic value
    • G01N2500/02Screening involving studying the effect of compounds C on the interaction between interacting molecules A and B (e.g. A = enzyme and B = substrate for A, or A = receptor and B = ligand for the receptor)
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00Detection or diagnosis of diseases
    • G01N2800/26Infectious diseases, e.g. generalised sepsis

Definitions

  • the present invention relates to agents for use in the treatment of pathogen induced inflammation, in particular bacterial sepsis.
  • Bacterial sepsis is a clinical term used to describe symptomatic bacteremia, with or without organ dysfunction. Bacterial sepsis is characterized by the presence of acute inflammation throughout the entire body, and is, therefore, frequently associated with fever or lower-than-average temperature, an elevated or low white blood cell count and elevated heart and respiratory rate. The modern concept of sepsis is that the host's immune response to the infection causes most of the symptoms of sepsis, resulting in hemodynamic consequences and damage to organs. Bacterial sepsis is triggered by release of toxic products from gram-negative or gram-positive bacteria (e.g. lipopolysaccharide (LPS) molecules from the outer wall of gram-negative bacteria or exotoxins produced by gram-positive bacteria) which activate the complex inflammatory pathways and cause disease.
  • LPS lipopolysaccharide
  • Bacterial sepsis is a common consequence of uncontrolled bacterial infection and is potentially fatal. Approximately 20-35% of patients with severe bacterial sepsis and 40-60% of patients with septic shock die within 30 days. Many others die within the ensuing 6 months. Bacterial sepsis accounts for about 9% of overall mortality in the US.
  • SAB S. aureus bacteraemia
  • MRSA methicillin-resistant S. aureus
  • the invention provides an agent which reduces the level and/or activity of tenascin-C and/or miR- 155 for use in the treatment of pathogen induced inflammation.
  • Bacterial sepsis is an example of pathogen induced inflammation.
  • the pathogen induced inflammation is caused by lipopolysaccharide (LPS), which preferably acts by inducing the activation of TLR4.
  • LPS lipopolysaccharide
  • pathogen induced inflammation may be caused by microbial structures, such as flagellin, which may act by inducing the activation of TLR5; or compounds such as peptidoglycan and lipoteichoic acids from gram-positive bacteria, which may act by inducing the activation of TLR2.
  • exotoxins produced by gram-positive bacteria including the toxic shock syndrome toxin- 1 (TSST- 1 ) from Staphylococcus aureus, the streptococcal pyrogenic exotoxin A (SPEA) and the streptococcal mitogenic exotoxin Z (SMEZ), may induce bacterial sepsis.
  • the pathogen induced inflammation, and in particular septic shock may be caused by one or more of the following bacteria E.
  • pathogen induced inflammation include periodontal disease, meningococcal sepsis, meningitis, gastroenteritis, cystitis, and gonococcal arthritis.
  • Periodontal disease is one of the most common inflammatory diseases and affects approximately 100 million people in the US. The disease is caused by an infection with the gram-negative bacterium P. gengivalis, which acts by inducing the activation of TLR2 and TLR4 and leads to inflammatory bone destruction.
  • Meningococcal sepsis and meningitis are caused by infection with Neisseria meningitidis.
  • the pathogen induced inflammation is caused by the meningococcal lipopoly(oligo)saccharide (LOS), which acts by inducing the activation of TLR4.
  • LOS meningococcal lipopoly(oligo)saccharide
  • Gastroenteritis is an inflammation of the stomach and the intestine caused by infection with E. coli (or Salmonella, Shigella or Campylobacter).
  • Cystitis is a urinary bladder inflammation caused by infection with E. coli (or Staphylococcus saprophyticus).
  • Gonococcal arthritis is caused by infection with the gram-negative diplococcus Neisseria gonorrhoeae. In the USA, gonococcal arthritis is the most common form of septic arthritis.
  • the agent of the invention is preferably not for the treatment of sterile tissue damage, that is tissue damage which is not caused directly by infection, such as rheumatoid arthritis.
  • the agent may act directly to reduce the level and/or activity of tenascin-C.
  • the agent may act indirectly to reduce the level and/or activity of tenascin-C.
  • the agent may act directly to reduce the level and/or activity of miR- 155.
  • the agent may act indirectly to reduce the level and/or activity of miR- 155.
  • the agent may act on tenascin-C to reduce the level and/or activity of miR- 155
  • the agent may act directly to reduce the level of tenascin-C below the threshold required to induce inflammation.
  • the agent may act indirectly to reduce the level of tenascin-C below the threshold required to induce inflammation.
  • a reduction in the level of tenascin-C is a reduction in the circulating level of an active form of tenascin-C.
  • a reduction in miR- 155 is a reduction in the circulating level and/or in the cellular level of an active (mature) form of miR- 1 55.
  • a reduction is defined as when a sample contains less than about 80%, less than 75%, less than about 70%, less than about 65%, less than about 60%, less than about 65%, less than about 50% the level or activity of tenascin-C and/or miR- 155 observed in a reference sample.
  • the reference value, to which the determined levels or activities of tenascin-C and/or miR- 155 are compared is the level or activity of tenascin-C and/or miR- 155 observed in a sample from one or more subjects that do not have any detectable pathogen induced inflammation, or any clinical symptoms of a pathogen induced inflammation, and have so called "normal values" of tenascin-C and/or miR- 155.
  • the level of tensascin-C and/or miR- 155 may be determined in a sample of blood, such as a whole blood sample, plasma or serum.
  • the sample may be urine.
  • the sample is a serum sample.
  • Tenascin-C is a pro-inflammatory extracellular matrix glycoprotein (Midwood et al (2009) Nat. Med. 15 : 774-780), that induces inflammatory cytokine synthesis in primary human macrophages and synovial fibroblasts by activation of the pattern recognition receptor, TLR4, in sterile tissue induced inflammation.
  • Tenascin-C is a large hexameric protein of approximately 1500kDa. High levels of tenascin-C have been found at sites of inflammation, for example in the synovial fluid of rheumatoid arthritis patients and in tumor stroma. The involvement of tenascin-C in pathogen induced inflammation has to date not been known.
  • the level or activity of the tenascin-C or miR- 155 present in a sample may be determined by any suitable assay, which may comprise the use of any of the group comprising immunoassays, spectrometry, western blot, ELISA, immunoprecipitation, slot or dot blot assay, isoelectric focussing, SDS-PAGE and antibody microarray immunohistological staining, radio immuno assay (RIA), fluoroimmunoassay, an immunoassay using an avidin-biotin or streptoavidin-biotin system, etc or combinations thereof.
  • any suitable assay which may comprise the use of any of the group comprising immunoassays, spectrometry, western blot, ELISA, immunoprecipitation, slot or dot blot assay, isoelectric focussing, SDS-PAGE and antibody microarray immunohistological staining, radio immuno assay (RIA), fluoroimmunoassay, an immuno
  • the level of tenascin-c mRNA or miR- 1 55 present in a sample may be determined by any suitable assay, which may comprise the use of any of the group comprising RT-PCR, real time PCR, microarray assays, northern blot, nuclease protection assay (RPA), serial analysis of gene expression (SAGE) and amplified differential gene expression (ADGE). These methods are well known to persons skilled in the art.
  • it is the level of cell associated tenascin-C which is determined, that is intracellular and/or membrane bound tenascin-C.
  • the level of soluble extracellular tenascin-C is not determined/considered in the invention.
  • miR- 155 is a short non-coding RNA that is very well conserved throughout the animal kingdom.
  • Mouse miR- 155 (MIMAT0000165) has the sequence
  • the miR- 155 gene is about 1500 bases long located on the BiC area on chromosome 21 band q21.3. Transcription in this area releases a non-coding RNA product that upon processing finalization becomes miR- 155. This particular chromosomal location shows strong sequence conservation in humans, mouse and chickens.
  • the agent may act on miR- 155 or tenascin-C at a post-transcriptional level and may be a viral vector, including retroviruses/lentiviruses, adenoviruses, adeno-associated viruses, pox viruses, alphaviruses and herpes viruses, or a non-viral vector, including naked DNA, oligonucleotides, lipoplexes and polyplexes.
  • a viral vector including retroviruses/lentiviruses, adenoviruses, adeno-associated viruses, pox viruses, alphaviruses and herpes viruses, or a non-viral vector, including naked DNA, oligonucleotides, lipoplexes and polyplexes.
  • the agent to reduce levels of tenascin-C is an antagonist of tenascin-C
  • the agent to reduce levels of tenascin-C and/or miR- 155 may be a small molecule, a protein, a peptide, a polymer, an antibody, a nucleic acid, an siRNA, an antisense oligonucleotide, an antagomer, an aptamer or a polysaccharide.
  • the agent is an antibody it may be a human, humanized, mouse or chimeric antibody.
  • the agent may be for systemic and/or local administration
  • the agent acts to prevent, inhibit or reduce interaction between tenascin-C and miR- 1 5.
  • the efficacy of an agent according to the invention may be measured by observing the level of TNF-alpha in a sample. Preferably a reduction in TNF-alpha will be seen if an agent according to the invention is working to reduce inflammation.
  • the invention provides the use of an agent that reduces the level of tenascin-C and/or miR- 155 for the preparation of a medicament for the prevention or treatment of pathogen induced inflammation.
  • the invention provides a method of treating pathogen induced inflammation comprising administering to a subject in need thereof an effective amount of an agent according to the invention.
  • the invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising an agent according to the invention and a pharmaceutically acceptable excipient.
  • Suitable acceptable excipients and carriers will be well known to those skilled in the art. These may include solid or liquid carriers. Suitable liquid carriers include water and saline. The proteins of the composition may be formulated into an emulsion or they may be formulated into biodegradable microspheres or liposomes. The composition may be formulated to protect the agent from degradation.
  • the composition may also comprise polymers or other agents to control the consistency of the composition, and/or to control the release of the antigen/secreted protein from the composition.
  • the composition may also comprise other agents such as diluents, which may include water, saline, glycerol or other suitable alcohols etc; wetting or emulsifying agents; buffering agents; thickening agents for example cellulose or cellulose derivatives; preservatives; detergents, antimicrobial agents; and the like.
  • the active ingredients in the composition are greater than 50% pure, usually greater than 80% pure, often greater than 90% pure and more preferably greater than 95%, 98% or 99% pure. With active ingredients approaching 100% pure, for example about 99.5%) pure or about 99.9% pure, being used most often.
  • the invention provides a method for determining the efficacy of a treatment for pathogen induced inflammation comprising the steps of: i) determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample from a subject;
  • a reduction in the level and/or activity of tenascin-C and/or miR- 155 following administration of the treatment is indicative of said treatment being a therapy for pathogen induced inflammation.
  • the invention provides a method of screening agents/compositions for efficacy in the treatment of pathogen induced inflammation.
  • the invention provides an in vivo method of screening agents/compositions for efficacy in the treatment of pathogen induced inflammation comprising the steps of:
  • determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample from a subject the subject may be known to be suffering from pathogen induced inflammation;
  • the invention provides an in vitro method of screening agents/compositions for efficacy in the treatment of pathogen induced inflammation comprising the steps of:
  • a reduction in the level and/or activity of tenascin-C and/or miR- 155 following administration of the agent/composition is indicative of said agent/composition being a therapy for pathogen induced inflammation.
  • the biological sample in all aspects of the invention may be a sample of blood, such as a whole blood sample, plasma or serum.
  • the sample may be urine.
  • the sample is a serum sample.
  • the invention also provides for agents/compositions identified by any method of the invention.
  • FIG. 1 - demonstrates that Tnc-/- mice are less susceptible to LPS-induced sepsis
  • a and B Body weight (A) and mobility (B) loss in tnc+/+ and tnc-/- mice upon LPS injection, monitored over 8 h.
  • E and F Immunoblot analysis of plasma tenascin-C in tnc+/+ ( 1 -3) and tnc-/- (4-6) mice 8 h (E) and 0, 1.5, 4 and 8 h (F) after LPS injection. Results are representative of three independent experiments.
  • Figure 2 - demonstrates that allogeneic bone marrow transplantation rescues LPS-induced circulating TNF-a in tnc-/- mice.
  • A Quantification of male donor cell engraftment in female recipients 8 weeks after bone marrow transplantation by quantitative RT-PCR analysis of mouse testis-specific Y- encoded protein (TSPY) gene in erythrocyte-depleted peripheral blood cells. Data are shown as percentage of donor chimerism relative to that of male control mice.
  • TSPY mouse testis-specific Y- encoded protein
  • Figure 3 demonstrates that tenascin-C expression is transiently induced by LPS.
  • Figure 4 Tenascin-C post-transcriptionally regulates the synthesis of specific cytokine subsets in BMDMs
  • A ELISA of TNFa, IL-6, CXCL 1 , IL- 10, IL- ⁇ ⁇ , IL- 12 and TGFp i secreted by tnc+/+ and tnc-/- BMDMs stimulated for 1.5, 4, 8, 24 and 48 h with l OOng/ml LPS .
  • Figure 5 - demonstrates the translation of pro-inflammatory cytokines is inhibited in the absence of tenascin-C.
  • A ELISA of secreted and cellular TNFa, IL-6 and CXCL1 in tnc+/+ and tnc-/- BMDMs stimulated for 1.5, 4, 8, 24 and 48 h with l OOng/ml LPS. Results are normalized to the cell number. Data are from five to nine independent experiments (mean ⁇ SEM).
  • FIG. 7 - illustrates that miR- 155 overexpression rescues TNF-a release in tnc-/- BMDMs in response to LPS.
  • Figure 9 - demonstrates that BMDMs mature effectively in the absence of tenascin-C in vitro and in vivo.
  • A-D FACS analysis of CD l l b and F4/80 surface expression in tnc+/+ and tnc-/- BMDMs.
  • A One representative plot per genotype is shown;
  • B percentage of CD 1 l b+/F4/80+ BMDMs;
  • E-G FACS analysis of intracellular CD68 expression in tnc+/+ and tnc-/- BMDMs.
  • FIG. 10 shows Tenascin-C does not affect LPS-induced activation of BMDMs.
  • A-J FACS analysis of macrophage activation marker expression in tnc+/+ and tnc-/- BMDMs non-stimulated or stimulated for 24 h with l OOng/ml LPS .
  • A-D Analysis of MHC II and CD40 surface expression in tnc+/+ and tnc-/- BMDMs +/- LPS.
  • FIG 11 - demonstrates TNF-a production in tnc-/- BMDMs is rescued by miR- 155 overexpression but not soluble tenascin-C
  • (B) ELISA of TNF-a secreted by tnc+/+ untransfected BMDMs and tnc-/- untransfected, mock transfected and transfected with control precursor or miR- 155 precursor BMDMs (n 6; mean ⁇ SEM). Data are from two independent experiments each with cells obtained from three mice per genotype.
  • (C) ELISA of TNF- a and IL-6 secreted by tnc+/+ and tnc-/- BMDMs stimulated for 24 h with l OOng/ml LPS without (-) or with recombinant purified tenascin-C (TN-C) (n 3 ; mean ⁇ SEM).
  • tenascin-C is expressed at both mRNA and protein level in LPS- activated BMDMs, the major cellular players in sepsis.
  • macrophages In response to bacterial endotoxins, macrophages promptly release pro-inflammatory cytokines, including TNF-a, which is both crucial for effective innate immunity and a key pathologic contributor to sepsis.
  • TNF-a pro-inflammatory cytokines
  • septic tnc-/- mice had significantly less circulating TNF-a, a phenomenon that was reversed by allogeneic bone marrow transplantation.
  • tnc-/- mice transplantation of tnc+/+ bone marrow rescued LPS-induced circulating TNF-a and vice-versa, indicating that bone marrow-derived cells from tnc-/- mice exhibit defects in TNF-a production. Consistent with low circulating TNF-a, less plasma IL-6 and reduced neutrophil infiltration to lungs and liver were observed in tnc-/- mice after LPS injection compared to tnc+/+ mice. Furthermore, tnc-/- mice failed to induce release of HMGB 1 , a late mediator of sepsis that is released by activated macrophages partly through a TNF-a-dependent mechanism.
  • tenascin-C is an early response gene that regulates LPS-induced TLR4-mediated inflammation operating upstream of TNF-a and HMGB 1. This is further supported by in vitro findings that tnc-/- BMDMs secreted significantly less TNF-a, IL-6 and CXCL 1 , upon stimulation with LPS than tnc-/- cells. This effect was specific, as it was not observed in other cytokine subsets, including IL- ⁇ ⁇ , IL- 12 or TGFp i . Furthermore, in BMDMs, tenascin-C appears to specifically control the switch from anti- to pro-inflammatory cytokine programs downstream of TLR4 activation.
  • BMDMs In the absence of tenascin-C, not only do BMDMs induce submaximal TNF-a levels, they also secreted more IL- 10, an anti-inflammatory cytokine that is key to dampening the inflammatory response to infection induced by TLR signaling. Thus, transient tenascin-C expression promotes an initial pro-inflammatory response that is later suppressed by IL- 10 synthesis.
  • Tissue damage following systemic LPS injection results from immune cell recruitment to susceptible sites; most notably neutrophil infiltration to lungs and liver occurs rapidly during sepsis.
  • Immunohistochemical staining of neutrophil elastase in lungs and liver from tnc+/+ mice 1.5 h after LPS injection demonstrated substantial neutrophil infiltration, which was significantly reduced in tnc-/- mice, an effect also evident at 4 and 8 h after injection ( Figures I D and 8C, 8D).
  • TNF-a was the cytokine most affected by tenascin-C ablation.
  • allogeneic bone marrow transplantation was performed.
  • Whole bone marrow cells isolated from tnc+/+ or tnc-/- male mice were injected into sublethally irradiated tnc+/+ or tnc-/- female recipient mice.
  • Tnc+/+/+/+, tnc+/+/-/-, tnc-/-/-/- and tnc-/-/+/+ chimeric mice were generated.
  • mice displayed equally high donor engraftment as shown by quantitative RT-PCR analysis of the mouse testis-specific Y-encoded protein (TSPY) gene in erythrocyte-depleted peripheral blood cells from recipient mice ( Figure. 2A). These data indicate that the majority of bone marrow cells are from the donor.
  • TSPY testis-specific Y-encoded protein
  • BMDMs primary bone marrow- derived macrophages
  • BMDMs primary bone marrow- derived macrophages
  • a kinetic analysis of tenascin-C expression was performed in LPS- stimulated BMDMs.
  • Non-stimulated cells showed low basal levels of tenascin-C expression, which significantly increased upon stimulation with LPS.
  • Tenascin-C mRNA started to increase at 1 h and peaked between 4 and 8 h and returned to basal levels by 24 h ( Figure 3A), as observed in human myeloid cells.
  • Increased tenascin-C mRNA correlated with tenascin-C protein synthesis.
  • Non-stimulated BMDMs produced no detectable tenascin-C, however, cell associated tenascin-C significantly increased after LPS activation and peaked 8 h after stimulation (Figure 3B). Tenascin- C was also secreted into the medium where its levels significantly increased 24 h after stimulation ( Figure 3C). These data demonstrate that tenascin-C expression in BMDMs is transiently induced by LPS.
  • tnc+/+ and tnc-/- BMDMs or freshly isolated peritoneal macrophages were assayed for CD l l b, F4/80 and CD68 expression.
  • Each maturation marker was equally highly expressed in tnc+/+ and tnc-/- cells ( Figures 9A-0), indicating that tenascin-C has no effect on macrophage maturation.
  • TNF-a, IL-6, CXCL 1 and IL- 10 mRNA was induced in tnc+/+ BMDMs by LPS stimulation and was not significantly affected by tenascin-C ablation (Figure 4B). No difference in IL- 12 and TGFp i mRNA expression was observed in tnc+/+ and tnc-/- BMDMs (data not shown). These results suggest that regulation of cytokine synthesis by tenascin-C occurs at a post-transcriptional level.
  • Tenascin-C promotes translation of pro-inflammatory cytokines
  • the data presented herein demonstrates that tenascin-C mediates an initial proinflammatory response to infection by post-transcriptionally modulating the expression of the early TLR-induced microRNA miR- 155.
  • This miRNA is processed from the non-protein-coding transcript of the bic gene.
  • a miRNA screen and validation analysis it was found that expression of both primary transcript pri- miR155 and mature miR- 155 was induced in tnc+/+ BMDMs immediately after LPS stimulation.
  • the induction of mature miR- 155 in tnc-/- BMDMs was significantly inhibited. This is underscored by the significantly lower miR- 155 expression detected in vivo in the spleen of septic tnc-/- mice.
  • miRNA expression in tnc+/+ and tnc-/- BMDMs stimulated with LPS for 8 h was analyzed with an array containing 375 miRNAs. 35 miRNAs were found that were reproducibly and significantly upregulated or downregulated by LPS (Figure 6A). A number of miRNAs have emerged as important regulators of TLR signaling including those induced by LPS activation of TLR4. Among these, expression of early response genes such as miR- 155, miR- 125b and let-7i (Figure 6B) was observed, as well as late response genes, including miR- 146a, miR- 132 and miR-21 ( Figure 6C).
  • TNF-a production in tnc-/- BMDMs transfected with pre-miR-155 precursor and stimulated with LPS for 8 h was significantly higher than in LPS-activated tnc-/- cells transfected with control precursor and was equal to that of control tnc+/+ BMDMs ( Figures 7B and 1 1B).
  • miR- 155 overexpression rescued TNF-a release in tnc-/- BMDMs in response to LPS.
  • mice Littermate tnc+/+ and tnc-/- mice were from heterozygous breeding pairs on a 129/SvJ background (Saga et al., 1992). All mice were male aged between 8- 12 weeks, except for bone marrow transplantation which were female aged 6-8 weeks.
  • bone marrow was flushed from tibias and femurs of tnc+/+ and tnc-/- mice and red blood cells were lysed with Red Blood Cell Lysis Buffer (Sigma).
  • the resulting cells were cultured in DMEM (PAA) supplemented with 20% FCS (GIBCO), 1 % Antibiotic-Antimycotic solution (PAA) and 50 ⁇ ⁇ - mercaptoethanol (Invitrogen) containing l OOng/ml recombinant murine M-CSF (Peprotech). After 7 d, adherent cells were washed and replated, then stimulated with LPS alone ( l OOng/ml; Enzo Life Sciences) or with brefeldin A ( l ⁇ g/m ⁇ , ⁇ Sigma). To avoid cell toxicity, we treated BMDMs with brefeldin A for the last 8 h of incubation with LPS.
  • tnc+/+ and tnc-/- mice were injected intraperitoneally with 1 ml thioglycollate (3% wt/vol; Sigma). Peritoneal exudates were collected 5 d after with cold PBS and cells were analyzed by FACS.
  • tnc+/+ and tnc-/- mice were injected intraperitoneally with lipopolysaccharides from E. coli 055 :B5 (8mg/kg; Sigma). Mice were observed for 8 h.
  • Body weight, mobility, uveitis, respiration, fur ruffling and diarrhoea were recorded at 0, 1.5, 4 and 8 h after LPS injection.
  • ELISA ELISA for TNF-a, IL-6, IL-8 (R&D), IL- ⁇ ⁇ (eBioscience), IL- 12, TGFp l , IL- 10, (BD Biosciences), HMGB 1 and TN-C (IBL) were used to quantify secreted and cell-associated pro-inflammatory mediators in plasma, cell supernatants and total protein extracts respectively. Extracts were prepared by lysing cells ( lxl O 6 ) with 0.1 ml RIPA buffer containing a protease inhibitor cocktail (Sigma).
  • Plasma samples from tnc+/+ and tnc-/- mice were resolved by SDS- PAGE and analyzed by Western blotting using goat anti-tenascin-C polyclonal Ab (AF3358; R&D Systems).
  • Bone marrow transplantation Each tnc-/- and tnc+/+ female recipient mouse was exposed to a single dose of 9 Gy at 80 cGy/min radiation in a ⁇ irradiator (Nordion) and, 3 h later, intravenously injected with whole bone marrow cells isolated from one tnc-/- or tnc+/+ male mouse resuspended in 0.2 ml PBS.
  • Transplanted mice received antibiotic orally for 1 1 weeks (2.5% Baytril; Bayer). The degree of donor engraftment was assessed as described previously (Wang et al., 2002). Genomic DNA was extracted from peripheral blood cells of female recipient and control mice using a QIAamp DNA Blood Mini kit (Qiagen). DNA samples were analyzed for the presence of the Y chromosome by two-standard curve method based on quantitative real-time PCR in a Corbett Rotor-gene 6000 machine (Corbett Research) with TaqMan primers and probe designed to detect the TSPY gene
  • RNA extraction and quantitative real-time PCR Total RNA was extracted from cells ( lxl O 6 ) using a RNeasy Mini Kit (Qiagen). cDNA was synthesized from equivalent amounts of RNA with AffinityScript reverse transcriptase and oligo(dT) primer (Stratagene).
  • RNA was reverse transcribed using the Taqman miRNA reverse transcription kit, including the miRNA-specific primers, followed by real-time PCR with individual miRNA TaqMan assays for the endogenous reference RNA RNU6B, miR- 155, miR- 146a and miR-21 (Applied Biosystems).
  • AACT change-in-threshold
  • RNA array The expression profile of 375 miRNAs was analyzed with TaqMan Low Density Arrays in an ABI 7900HT (Applied Biosystems). Total RNA was extracted from cells with Trizol. RNA integrity was analyzed using an Agilent RNA 6000 Nano kit and an Agilent 2100 bioanalyzer (Agilent Technologies). cDNA was synthesized with a TaqMan microRNA reverse transcription kit and Megaplex RT primers and was followed by real-time PCR with a TaqMan universal PCR master mix and TaqMan array rodent microRNA cards (Applied Biosystems). Data were analyzed with SDS Relative Quantitation software (Applied Biosystems).
  • Transient transfection For transfection of miRNA, 2xl 0 6 tnc-/- BMDMs were transfected with negative control precursor or miR- 155 precursors at a final concentration of 5nM with siPORT NeoFX transfection agent (Ambion) for 8 h. Cells were allowed to recover for 24 h before treatment with LPS for 8 h.
  • mice were observed during a period of 8 h upon LPS injection. Pictures of mice were taken to record uveitis at 0, 4 and 8 h after LPS injection. Uveitis was considered mild when eyes were watery, moderate when one or two eyes displayed pus and severe when one or two eyes were closed. Fur ruffling was recorded at 0, 1 .5, 4 and 8 h after LPS injection and was scored as 0, 1 , 2 or 3 for absent, mild, moderate or severe, respectively.
  • peritoneal macrophages and BMDMs were stained for 20 min at 4°C with anti-F4/80-PE (Caltag Medsystems), anti-CD 1 l b-APC, anti-MHC II (I-A/I-E)-PE, anti-CD40-APC, anti-CD80-PE, anti-CD86-FITC, anti- TLR4/MD-2-APC and appropriate isotype controls (ebioscience).
  • cells were fixed with 4% paraformaldehyde in PBS for 20 min, were made permeable with PBS containing 2% (vol/vol) BSA, 2mM EDTA, 0.02% NaN3 and 0.05% (vol/vol) saponin and were stained with anti-CD68-APC (AbD Serotec). Samples were analyzed on a FACSCanto II (BD Bioscience) and data were analyzed with FlowJo software (TreeStar). Treatment of BMDMs with soluble tenascin-C.
  • recombinant human tenascin-C was synthesized and purified as described previously (Midwood et al., 2009), or commercially purified human tenascin-C (IBL, Japan) was used.
  • l xl O 5 tnc+/+ and tnc-/- BMDMs were stimulated for 24 h with l OOng/ml LPS without or with 1 ng/ml to ⁇ g/ml recombinant purified tenascin-C.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Urology & Nephrology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Analytical Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biotechnology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Epidemiology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Description

PREVENTION OF THE INTERACTION BETWEEN TENASCIN-C AND MIR-155 TO TREAT
SEPSIS
The present invention relates to agents for use in the treatment of pathogen induced inflammation, in particular bacterial sepsis.
Bacterial sepsis is a clinical term used to describe symptomatic bacteremia, with or without organ dysfunction. Bacterial sepsis is characterized by the presence of acute inflammation throughout the entire body, and is, therefore, frequently associated with fever or lower-than-average temperature, an elevated or low white blood cell count and elevated heart and respiratory rate. The modern concept of sepsis is that the host's immune response to the infection causes most of the symptoms of sepsis, resulting in hemodynamic consequences and damage to organs. Bacterial sepsis is triggered by release of toxic products from gram-negative or gram-positive bacteria (e.g. lipopolysaccharide (LPS) molecules from the outer wall of gram-negative bacteria or exotoxins produced by gram-positive bacteria) which activate the complex inflammatory pathways and cause disease.
Bacterial sepsis is a common consequence of uncontrolled bacterial infection and is potentially fatal. Approximately 20-35% of patients with severe bacterial sepsis and 40-60% of patients with septic shock die within 30 days. Many others die within the ensuing 6 months. Bacterial sepsis accounts for about 9% of overall mortality in the US.
Current treatment for sepsis comprises intra venous administration of broad spectrum antibiotics which may or may not be effective depending on the cause or scope of infection. Moreover, treatment of patients with antibiotics is not a cure for sepsis as often following administration of antibiotics there is a release of LPS from gram- negative bacteria. As such, antibiotic administration is often followed by blood transfusion, mechanical ventilation to aid respiration and/or dialysis to help with kidney function.
Furthermore, as antibiotic use has increased, many strains of bacteria have become resistant to antibiotics, making the treatment of sepsis more difficult. The incidence of S. aureus bacteraemia (SAB), particularly bacteraemia caused by methicillin-resistant S. aureus (MRSA) strains, has increased dramatically in recent years in the USA and in some European countries. Resistance of S. aureus strains to antibiotics has been increasing; thus, the ability of these pathogens to spread in both hospital and community settings has increased. Increased antibiotic resistance, in addition to the increased frequency of invasive surgery, increased use of intravascular devices, and increased numbers of patients with immunocompromised status because of HIV infection or immunosuppression after transplantation or cancer treatment or a splenectomy, has led to sharp increases in the incidence of SAB and S. aureus infective endocarditis (SAIE) over the past 30 years. There is therefore a need for further or alternative therapies for the treatment of bacterial sepsis.
According to a first aspect the invention provides an agent which reduces the level and/or activity of tenascin-C and/or miR- 155 for use in the treatment of pathogen induced inflammation.
Bacterial sepsis is an example of pathogen induced inflammation. Preferably the pathogen induced inflammation is caused by lipopolysaccharide (LPS), which preferably acts by inducing the activation of TLR4. Alternatively, or additionally, pathogen induced inflammation may be caused by microbial structures, such as flagellin, which may act by inducing the activation of TLR5; or compounds such as peptidoglycan and lipoteichoic acids from gram-positive bacteria, which may act by inducing the activation of TLR2. Furthermore, exotoxins produced by gram-positive bacteria, including the toxic shock syndrome toxin- 1 (TSST- 1 ) from Staphylococcus aureus, the streptococcal pyrogenic exotoxin A (SPEA) and the streptococcal mitogenic exotoxin Z (SMEZ), may induce bacterial sepsis. The pathogen induced inflammation, and in particular septic shock, may be caused by one or more of the following bacteria E. coli, Streptococcus pyogenes, staphylococcus aureus, Vibrio vulnificus, Staphylococcus saprophyticus, Pseudomonas aeruginosa, Viridans streptococci, Neisseria meningitidis, Neisseria gonorrhoeae, P. gengivalis and Rickettsia rickettsiae. Other examples of pathogen induced inflammation include periodontal disease, meningococcal sepsis, meningitis, gastroenteritis, cystitis, and gonococcal arthritis. Periodontal disease is one of the most common inflammatory diseases and affects approximately 100 million people in the US. The disease is caused by an infection with the gram-negative bacterium P. gengivalis, which acts by inducing the activation of TLR2 and TLR4 and leads to inflammatory bone destruction.
Meningococcal sepsis and meningitis are caused by infection with Neisseria meningitidis. The pathogen induced inflammation is caused by the meningococcal lipopoly(oligo)saccharide (LOS), which acts by inducing the activation of TLR4. Gastroenteritis is an inflammation of the stomach and the intestine caused by infection with E. coli (or Salmonella, Shigella or Campylobacter). Cystitis is a urinary bladder inflammation caused by infection with E. coli (or Staphylococcus saprophyticus). Gonococcal arthritis is caused by infection with the gram-negative diplococcus Neisseria gonorrhoeae. In the USA, gonococcal arthritis is the most common form of septic arthritis.
The agent of the invention is preferably not for the treatment of sterile tissue damage, that is tissue damage which is not caused directly by infection, such as rheumatoid arthritis.
The agent may act directly to reduce the level and/or activity of tenascin-C. The agent may act indirectly to reduce the level and/or activity of tenascin-C. The agent may act directly to reduce the level and/or activity of miR- 155. The agent may act indirectly to reduce the level and/or activity of miR- 155.
The agent may act on tenascin-C to reduce the level and/or activity of miR- 155 The agent may act directly to reduce the level of tenascin-C below the threshold required to induce inflammation. The agent may act indirectly to reduce the level of tenascin-C below the threshold required to induce inflammation. Preferably a reduction in the level of tenascin-C is a reduction in the circulating level of an active form of tenascin-C.
Preferably a reduction in miR- 155 is a reduction in the circulating level and/or in the cellular level of an active (mature) form of miR- 1 55.
Preferably a reduction is defined as when a sample contains less than about 80%, less than 75%, less than about 70%, less than about 65%, less than about 60%, less than about 65%, less than about 50% the level or activity of tenascin-C and/or miR- 155 observed in a reference sample.
Preferably the reference value, to which the determined levels or activities of tenascin-C and/or miR- 155 are compared, is the level or activity of tenascin-C and/or miR- 155 observed in a sample from one or more subjects that do not have any detectable pathogen induced inflammation, or any clinical symptoms of a pathogen induced inflammation, and have so called "normal values" of tenascin-C and/or miR- 155.
The level of tensascin-C and/or miR- 155 may be determined in a sample of blood, such as a whole blood sample, plasma or serum. In an alternative embodiment the sample may be urine. Preferably the sample is a serum sample.
Tenascin-C is a pro-inflammatory extracellular matrix glycoprotein (Midwood et al (2009) Nat. Med. 15 : 774-780), that induces inflammatory cytokine synthesis in primary human macrophages and synovial fibroblasts by activation of the pattern recognition receptor, TLR4, in sterile tissue induced inflammation. Tenascin-C is a large hexameric protein of approximately 1500kDa. High levels of tenascin-C have been found at sites of inflammation, for example in the synovial fluid of rheumatoid arthritis patients and in tumor stroma. The involvement of tenascin-C in pathogen induced inflammation has to date not been known.
The level or activity of the tenascin-C or miR- 155 present in a sample may be determined by any suitable assay, which may comprise the use of any of the group comprising immunoassays, spectrometry, western blot, ELISA, immunoprecipitation, slot or dot blot assay, isoelectric focussing, SDS-PAGE and antibody microarray immunohistological staining, radio immuno assay (RIA), fluoroimmunoassay, an immunoassay using an avidin-biotin or streptoavidin-biotin system, etc or combinations thereof. The level of tenascin-c mRNA or miR- 1 55 present in a sample may be determined by any suitable assay, which may comprise the use of any of the group comprising RT-PCR, real time PCR, microarray assays, northern blot, nuclease protection assay (RPA), serial analysis of gene expression (SAGE) and amplified differential gene expression (ADGE). These methods are well known to persons skilled in the art. Preferably it is the level of cell associated tenascin-C which is determined, that is intracellular and/or membrane bound tenascin-C. Preferably the level of soluble extracellular tenascin-C is not determined/considered in the invention. miR- 155 is a short non-coding RNA that is very well conserved throughout the animal kingdom.
Mouse miR- 155 (MIMAT0000165) has the sequence;
UUAAUGCUAAUUGUGAUAGGGGU (Seq ID No: 1)
Human miR155 (MIMAT0000646) has the sequence;
UUAAUGCUAAUCGUGAUAGGGGU (Seq ID No: 2)
The miR- 155 gene is about 1500 bases long located on the BiC area on chromosome 21 band q21.3. Transcription in this area releases a non-coding RNA product that upon processing finalization becomes miR- 155. This particular chromosomal location shows strong sequence conservation in humans, mouse and chickens.
The agent may act on miR- 155 or tenascin-C at a post-transcriptional level and may be a viral vector, including retroviruses/lentiviruses, adenoviruses, adeno-associated viruses, pox viruses, alphaviruses and herpes viruses, or a non-viral vector, including naked DNA, oligonucleotides, lipoplexes and polyplexes.
Preferably the agent to reduce levels of tenascin-C is an antagonist of tenascin-C The agent to reduce levels of tenascin-C and/or miR- 155 may be a small molecule, a protein, a peptide, a polymer, an antibody, a nucleic acid, an siRNA, an antisense oligonucleotide, an antagomer, an aptamer or a polysaccharide. If the agent is an antibody it may be a human, humanized, mouse or chimeric antibody. The agent may be for systemic and/or local administration
In one embodiment the agent acts to prevent, inhibit or reduce interaction between tenascin-C and miR- 1 5. The efficacy of an agent according to the invention may be measured by observing the level of TNF-alpha in a sample. Preferably a reduction in TNF-alpha will be seen if an agent according to the invention is working to reduce inflammation.
According a further aspect the invention provides the use of an agent that reduces the level of tenascin-C and/or miR- 155 for the preparation of a medicament for the prevention or treatment of pathogen induced inflammation.
According to another aspect the invention provides a method of treating pathogen induced inflammation comprising administering to a subject in need thereof an effective amount of an agent according to the invention.
According to a still further aspect the invention provides a pharmaceutical composition comprising an agent according to the invention and a pharmaceutically acceptable excipient.
Suitable acceptable excipients and carriers will be well known to those skilled in the art. These may include solid or liquid carriers. Suitable liquid carriers include water and saline. The proteins of the composition may be formulated into an emulsion or they may be formulated into biodegradable microspheres or liposomes. The composition may be formulated to protect the agent from degradation.
The composition may also comprise polymers or other agents to control the consistency of the composition, and/or to control the release of the antigen/secreted protein from the composition. The composition may also comprise other agents such as diluents, which may include water, saline, glycerol or other suitable alcohols etc; wetting or emulsifying agents; buffering agents; thickening agents for example cellulose or cellulose derivatives; preservatives; detergents, antimicrobial agents; and the like.
Preferably the active ingredients in the composition are greater than 50% pure, usually greater than 80% pure, often greater than 90% pure and more preferably greater than 95%, 98% or 99% pure. With active ingredients approaching 100% pure, for example about 99.5%) pure or about 99.9% pure, being used most often.
According to a further aspect the invention provides a method for determining the efficacy of a treatment for pathogen induced inflammation comprising the steps of: i) determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample from a subject;
ii) administering said treatment to the subject:
iii) determining the level and/or activity of tenascin-C and/or miR-155 in a biological sample from said mammalian subject at a time following administration of said treatment
wherein a reduction in the level and/or activity of tenascin-C and/or miR- 155 following administration of the treatment is indicative of said treatment being a therapy for pathogen induced inflammation.
According to a yet further aspect the invention provides a method of screening agents/compositions for efficacy in the treatment of pathogen induced inflammation. In one aspect the invention provides an in vivo method of screening agents/compositions for efficacy in the treatment of pathogen induced inflammation comprising the steps of:
i) determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample from a subject, the subject may be known to be suffering from pathogen induced inflammation;
ii) administering said agent/composition to the subject:
iii) determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample taken from the subject at a time following administration of said agent/composition; wherein a reduction in the level and/or activity of tenascin-C and/or miR- 155 following administration of the agent/composition is indicative of said agent/composition being a therapy for pathogen induced inflammation.
In another aspect the invention provides an in vitro method of screening agents/compositions for efficacy in the treatment of pathogen induced inflammation comprising the steps of:
i) providing a biological sample obtained from a subject;
ii) determining the level and/or activity of tenascin-C and/or miR- 155 in the biological sample;
iii) treating the biological sample with said agent/composition in vitro:
iv) determining the level and/or activity of tenascin-C and/or miR- 155 in the biological sample at a time following administration of said agent/composition;
wherein a reduction in the level and/or activity of tenascin-C and/or miR- 155 following administration of the agent/composition is indicative of said agent/composition being a therapy for pathogen induced inflammation.
The biological sample in all aspects of the invention may be a sample of blood, such as a whole blood sample, plasma or serum. In an alternative embodiment the sample may be urine. Preferably the sample is a serum sample.
The invention also provides for agents/compositions identified by any method of the invention.
The skilled man will appreciate that preferred features of any one embodiment and/or aspect of the invention may be applied to all other embodiments and/or aspects of the invention.
The present invention will be further described in more detail, by way of example only, with reference to the following figures in which:
Figure 1 - demonstrates that Tnc-/- mice are less susceptible to LPS-induced sepsis (A and B) Body weight (A) and mobility (B) loss in tnc+/+ and tnc-/- mice upon LPS injection, monitored over 8 h. Data in (A) are presented as percent loss relative to non-injected mice. (n= 17 (A) or 10 (B) mice per group; mean ± SEM); *** *= P<0.0001 and ***= P<0.001 compared to non-injected mice (A). Data are from three (A) or two (B) independent experiments. (C) Time-course analysis of TNF-cc, IL-6 and HMGB 1 in plasma from tnc+/+ and tnc-/- mice after LPS injection by ELISA (n=3 to 5 mice per group; mean ±
SEM); * * * *= PO.0001 , * * *= PO.001 and * *= P<0.01 . Data are representative of three independent experiments. (D) Immunohistochemical analysis of neutrophil elastase+ cell infiltration in lungs from tnc+/+ and tnc-/- mice 0, 1 .5 , 4 and 8 h after LPS injection (n=4 LPS-injected mice per genotype and 3 non-injected mice per genotype); scale bars, 100 μπι. Data are representative of three independent experiments. (E and F) Immunoblot analysis of plasma tenascin-C in tnc+/+ ( 1 -3) and tnc-/- (4-6) mice 8 h (E) and 0, 1.5, 4 and 8 h (F) after LPS injection. Results are representative of three independent experiments. (G) ELISA of plasma tenascin-C in tnc+/+ mice 0, 1 .5, 4 and 8 h after LPS injection (n=7; mean ± SEM). Data are from two independent experiments.
Figure 2 - demonstrates that allogeneic bone marrow transplantation rescues LPS-induced circulating TNF-a in tnc-/- mice. (A) Quantification of male donor cell engraftment in female recipients 8 weeks after bone marrow transplantation by quantitative RT-PCR analysis of mouse testis-specific Y- encoded protein (TSPY) gene in erythrocyte-depleted peripheral blood cells. Data are shown as percentage of donor chimerism relative to that of male control mice. (B) Quantitative RT-PCR analysis of tenascin-C mRNA in erythrocyte-depleted peripheral blood cells of female recipients 1.5 h after LPS injection. Results are presented relative to those of tnc+/+ / +/+ chimeric mice. *= P<0.05 compared to tnc+/+ / +/+ chimeric mice. (C and D) ELISA of TNF- α in plasma from tnc+/+ / +/+ and tnc+/+ / -/- (C) and tnc-/- /-/- and tnc-/- /+/+ (D) chimeric mice 1.5 and 8 h after LPS injection. Results represent measurements of three mice per group (mean ± SD); * * * *= P<0.0001 and * *=
P<0.01.
Figure 3 demonstrates that tenascin-C expression is transiently induced by LPS. (A) Quantitative RT-PCR analysis of tenascin-C mRNA in BMDMs stimulated for 1 , 1.5, 4, 8, 24 and 48 h with l OOng/ml LPS. Results are presented relative to those of untreated BMDMs. Data are from seven independent experiments (mean ± SEM); * * *= P<0.001 and * *= P<0.01 compared to non-stimulated cells. (B) ELISA of cellular tenascin-C in BMDMs stimulated for 1 .5, 4, 8, 24, 48 and 72 h with l OOng/ml LPS. Results are normalized to the cell number. Data are from six independent experiments (mean ± SEM); * * *= P<0.001 compared to non-stimulated cells. (C) ELISA of secreted tenascin-C by BMDMs stimulated for 1.5, 4, 8, 24, 48 and 72 h with l OOng/ml LPS. Data are from six independent experiments (mean ± SEM); * *= P<0.01 and *= P<0.05 compared to non-stimulated cells.
Figure 4 - Tenascin-C post-transcriptionally regulates the synthesis of specific cytokine subsets in BMDMs (A) ELISA of TNFa, IL-6, CXCL 1 , IL- 10, IL- Ι β, IL- 12 and TGFp i secreted by tnc+/+ and tnc-/- BMDMs stimulated for 1.5, 4, 8, 24 and 48 h with l OOng/ml LPS . Data are from six to nine independent experiments (mean ± SEM); ** * *= P<0.0001 , ** *= P<0.001 , * *= P<0.01 and *= P<0.05. (B) Quantitative RT-PCR analysis of TNFa, IL-6, CXCL 1 and IL- 10 mRNA in tnc+/+ and tnc-/- BMDMs stimulated for 0.5, 1 , 1.5, 4, 8, 24 and 48 h with l OOng/ml LPS. Results are presented relative to those of untreated BMDMs. Data are from four to five independent experiments (mean ± SEM).
Figure 5 - demonstrates the translation of pro-inflammatory cytokines is inhibited in the absence of tenascin-C. (A) ELISA of secreted and cellular TNFa, IL-6 and CXCL1 in tnc+/+ and tnc-/- BMDMs stimulated for 1.5, 4, 8, 24 and 48 h with l OOng/ml LPS. Results are normalized to the cell number. Data are from five to nine independent experiments (mean ± SEM). (B) Total amounts of TNF-a, IL-6 and CXCL 1 in tnc+/+ and tnc-/- BMDMs stimulated for 1 .5, 4, 8, 24 and 48 h with l OOng/ml LPS; results are shown as the sum of the amounts of secreted and cellular protein fractions normalized to the cell number. Data are from five to nine independent experiments (mean ± SEM); * * *= p<o.001 , * *= P<0.01 and *= P<0.05. (C) ELISA of cellular TNF-a, IL-6 and CXCL 1 in tnc+/+ and tnc-/- BMDMs stimulated for 24 h with l OOng/ml LPS in the presence of ^g/ml brefeldin A. Results are normalized to the cell number. Data are from three independent experiments (mean ± SEM); * * * *= PO.0001 and *= P<0.05. Figure 6 - shows that tenascin-C is required for induction of miR- 155 in activated BMDMs and in septic mice. (A) Microarray analysis of miRNA profile in tnc+/+ and tnc-/- BMDMs stimulated for 8 h with l OOng/ml LPS. The heat-map shows suppression (green) and induction (red) of expression as fold change on a log2 scale, relative to non-stimulated BMDMs (n=3 mice per genotype). (B and C) Expression of TLR-induced miRNAs in tnc+/+ and tnc-/- BMDMs (identified in A) classified as early (B) and late (C) response genes (n=3 per genotype; mean ± SEM); * *= P<0.01 , ns = not significant. (D) Time- course analysis of miR- 155, pri-miR- 155, miR- 146a and miR-21 expression in tnc+/+ and tnc-/- BMDMs stimulated for 4-72 h (miR- 155), 0.5-48 h (pri-miR- 155) or 4-96 h (miR- 146a, miR-21 ) with l OOng/ml LPS. RNA used in A (n=3 mice per group) and RNA isolated from BMDMs derived from two (miR- 146a, miR-21 ) and four (miR- 155, pri-miR- 155) additional mice per genotype was analyzed by quantitative RT-PCR (mean ± SEM); * *= P<0.01 compared to tnc- /- BMDMs at the same time point. (E) Correlation of miR- 155 expression with TNF-a synthesis in tnc+/+ and tnc-/- BMDMs stimulated with l OOng/ml LPS for 4, 8 and 24 h (n=5 mice per genotype; R=1 .0, P<0.05). (F) Quantitative RT-PCR analysis of miR- 155 expression in spleen from tnc+/+ and tnc-/- mice 1 .5 h after LPS injection (n=3 per genotype; mean ± SEM); *= P<0.05. Data are from two independent experiments.
Figure 7 - illustrates that miR- 155 overexpression rescues TNF-a release in tnc-/- BMDMs in response to LPS. (A) Quantitative RT-PCR analysis of miR- 155 expression in tnc+/+ untransfected BMDMs and tnc-/- untransfected, mock transfected and transfected with control precursor or miR- 155 precursor BMDMs stimulated for 8 h with l OOng/ml LPS. Results are presented relative to those of non-stimulated BMDMs (n=3 ; mean ± SEM); *= P<0.05 and ns = not significant. Data are representative of four independent experiments each with cells obtained from three mice per genotype. (B) ELISA of TNF-a secreted by tnc+/+ untransfected BMDMs and tnc-/- untransfected, mock transfected and transfected with control precursor or miR- 155 precursor BMDMs stimulated for 8 h with l OOng/ml LPS (n=6; mean ± SEM); ** *= P<0.001 , * *= P<0.01 and ns = not significant. Data are from two independent experiments each with cells obtained from three mice per genotype. Figure 8 - shows Tnc-/- mice develop less severe symptoms upon LPS injection. (A) Representative images of the eyes of tnc+/+ and tnc-/- mice 0, 4 and 8 h after LPS injection. Data are representative of three independent experiments. (B) Fur ruffling in tnc+/+ and tnc-/- mice upon LPS injection, monitored over 8 h. (n = 10 per genotype; mean ± SEM); * * * *= P<0.0001.
Data are from two independent experiments. (C) Immunohistochemical analysis of neutrophil elastase+ cell infiltration in liver from tnc+/+ and tnc-/- mice 0, 1 .5, 4 and 8 h after LPS injection (n = 4 LPS-injected mice per genotype and 3 non-injected mice per genotype); scale bars, 100 μιη. Results are representative of three independent experiments. (D) Neutrophil elastase+ cell count in lungs and liver from tnc+/+ and tnc-/- mice 0, 1 .5, 4 and 8 h after LPS injection. Values are expressed as mean ± SD (n). Data are representative of three independent experiments.
Figure 9 - demonstrates that BMDMs mature effectively in the absence of tenascin-C in vitro and in vivo. (A-D) FACS analysis of CD l l b and F4/80 surface expression in tnc+/+ and tnc-/- BMDMs. (A) One representative plot per genotype is shown; (B) percentage of CD 1 l b+/F4/80+ BMDMs; (C,D) mean fluorescence intensity (MFI) of CD l lb+ (C) and F4/80+ (D) BMDMs (n = 3 ; mean ± SEM). (E-G) FACS analysis of intracellular CD68 expression in tnc+/+ and tnc-/- BMDMs. (E) One representative histogram per genotype is shown; percentage (F) and MFI (G) of CD68+ BMDMs (n = 4; mean ± SEM); ns = not significant. (H) Quantitative RT-PCR analysis of CD l l b, F4/80 and CD68 mRNA in tnc+/+ and tnc-/- BMDMs. Results are presented relative to those of tnc+/+ BMDMs (n = 4; mean ± SEM); ns = not significant. (I-L) FACS analysis of CD l lb and F4/80 surface expression in thioglycollate- elicited peritoneal macrophages from tnc+/+and tnc-/- mice. (I) One representative plot per genotype is shown; (J) percentage of CD 1 lb+/F4/80+ macropahges; (K,L) MFI of CD l lb+ (K) and F4/80+ (L) macrophages (n = 3 ; mean ± SEM); ns = not significant. (M-O) FACS analysis of intracellular CD68 expression in tnc+/+ and tnc-/- macrophages. (M) One representative histogram per genotype is shown; percentage (N) and MFU (O) of CD68+ macrophages (n = 3 ; mean ± SEM). Data are from three or four (E-H) independent experiments. Figure 10 - shows Tenascin-C does not affect LPS-induced activation of BMDMs. (A-J) FACS analysis of macrophage activation marker expression in tnc+/+ and tnc-/- BMDMs non-stimulated or stimulated for 24 h with l OOng/ml LPS . (A-D) Analysis of MHC II and CD40 surface expression in tnc+/+ and tnc-/- BMDMs +/- LPS. (A) One representative plot per genotype +/- LPS is shown; (B) percentage of MHC II+/CD40+ BMDMs +/- LPS; (C,D) MFI of MHC 11+ (C) and CD40+ (D) BMDMs +/- LPS (n= 3 ; mean ± SEM); ns = not significant. (E-G) Analysis of CD86 surface expression in tnc+/+ and tnc-/- BMDMs +/- LPS. (E) One representative histogram from tnc+/+ and tnc-/- BMDMs +/- LPS is shown; percentage (F) and MFI (G) of CD86+ BMDMs +/- LPS (n = 3; mean ± SEM); ns = not significant. (H-J) Analysis of TLR4/MD-2 surface expression in tnc+/+and tnc-/- BMDMs +/- LPS. (H) One representative histogram from tnc+/+ and tnc-/- BMDMs +/- LPS is shown; percentage (I) and MFI (J) of TLR4/MD-2+ BMDMs +/- LPS (n= 3 ; mean ± SEM); ns = not significant. Data are from three independent experiments.
Figure 11 - demonstrates TNF-a production in tnc-/- BMDMs is rescued by miR- 155 overexpression but not soluble tenascin-C (A) Quantitative RT-PCR analysis of miR- 155 expression in tnc+/+ untransfected BMDMs and tnc-/- untransfected, mock transfected and transfected with control precursor or miR- 155 precursor BMDMs, all in the absence of any stimulation with LPS (n = 3 ; mean ± SEM). Data are representative of four independent experiments each with cells obtained from three mice per genotype. (B) ELISA of TNF-a secreted by tnc+/+ untransfected BMDMs and tnc-/- untransfected, mock transfected and transfected with control precursor or miR- 155 precursor BMDMs (n = 6; mean ± SEM). Data are from two independent experiments each with cells obtained from three mice per genotype. (C) ELISA of TNF- a and IL-6 secreted by tnc+/+ and tnc-/- BMDMs stimulated for 24 h with l OOng/ml LPS without (-) or with recombinant purified tenascin-C (TN-C) (n=3 ; mean ± SEM). ** *= P<0.001 compared to tnc+/+ BMDMs stimulated with LPS. Data are representative of three independent experiments each with cells obtained from three mice per genotype. The same results were obtained when equivalent amounts of commercially purified human tenascin-C were added. Figure 12 - details the amino acid sequence of human tenascin C (Seq ID No 6).
Tenascin-C expression is required for the proinflammatory response to LPS
Using an experimental model of LPS-induced systemic inflammation in tnc+/+ and tnc-/- mice a rapid increase in circulating tenascin-C was observed in septic tnc+/+ mice. Maximal tenascin-C levels in plasma are detected 90 min after LPS injection, long before the induction of HMGB 1 release, an established tissue injury marker in sepsis. This data supports specific tenascin-C upregulation by LPS-induced TLR4 signaling rather than tissue damage-driven release of tenascin-C. Indeed, the data demonstrates that tenascin-C is expressed at both mRNA and protein level in LPS- activated BMDMs, the major cellular players in sepsis. In response to bacterial endotoxins, macrophages promptly release pro-inflammatory cytokines, including TNF-a, which is both crucial for effective innate immunity and a key pathologic contributor to sepsis. However, septic tnc-/- mice had significantly less circulating TNF-a, a phenomenon that was reversed by allogeneic bone marrow transplantation. In tnc-/- mice, transplantation of tnc+/+ bone marrow rescued LPS-induced circulating TNF-a and vice-versa, indicating that bone marrow-derived cells from tnc-/- mice exhibit defects in TNF-a production. Consistent with low circulating TNF-a, less plasma IL-6 and reduced neutrophil infiltration to lungs and liver were observed in tnc-/- mice after LPS injection compared to tnc+/+ mice. Furthermore, tnc-/- mice failed to induce release of HMGB 1 , a late mediator of sepsis that is released by activated macrophages partly through a TNF-a-dependent mechanism. These in vivo data suggest that tenascin-C is an early response gene that regulates LPS-induced TLR4-mediated inflammation operating upstream of TNF-a and HMGB 1. This is further supported by in vitro findings that tnc-/- BMDMs secreted significantly less TNF-a, IL-6 and CXCL 1 , upon stimulation with LPS than tnc-/- cells. This effect was specific, as it was not observed in other cytokine subsets, including IL- Ι β, IL- 12 or TGFp i . Furthermore, in BMDMs, tenascin-C appears to specifically control the switch from anti- to pro-inflammatory cytokine programs downstream of TLR4 activation. In the absence of tenascin-C, not only do BMDMs induce submaximal TNF-a levels, they also secreted more IL- 10, an anti-inflammatory cytokine that is key to dampening the inflammatory response to infection induced by TLR signaling. Thus, transient tenascin-C expression promotes an initial pro-inflammatory response that is later suppressed by IL- 10 synthesis. Results
To examine the role of tenascin-C in host defence against pathogenic infection, sepsis was induced with a sublethal dose of LPS in tnc+/+ and tnc-/- mice. The major clinical symptoms of sepsis, including weight loss, reduced mobility, uveitis, ruffled fur and diarrhea, were evident in tnc+/+ mice 1.5 h after injection of LPS, in contrast to tnc-/- mice, which showed no symptoms by 1.5 h. While symptoms became progressively more severe in tnc+/+ mice 4 and 8 h after injection, only a mild phenotype was observed in tnc-/- mice, which exhibited significantly less weight loss (47% ± 16.8PO.0001 at 4h; 38% ± 4.5P=0.0006 at 8h), less mobility impairment (76% ± 20 PO.0001 at 4h; 57% ± 26.6P<0.0001 at 8h) and less fur ruffling (50% ± 0PO.0001 at 4h; 56% ± 19.2PO.0001 at 8h) than tnc+/+ mice, with mild uveitis and diarrhea (Figures 1A and I B, and 8A and 8B). On the molecular level, sepsis is driven by a 'cytokine storm' comprising elevated circulating levels of pro-inflammatory cytokines induced in response to LPS. Analysis of plasma levels of key inflammatory mediators of sepsis showed that tnc-/- mice synthesize significantly less TNF-a (70% ± 12. I PO.0001 ) and IL-6 (50% ± 8P .0001 ) compared to tnc+/+ mice 1.5 h after LPS injection, consistent with the lack of clinical symptoms in the absence of tenascin-C. By 4 h after LPS injection, there was 79% (± 8.7) significantly less TNF-a (P=0.001) in tnc-/- mice compared to tnc+/+ mice. Plasma TNF-a and IL-6 dropped by 8 h after LPS injection similarly in both tnc-/- and tnc+/+ mice. Furthermore, tnc-/- mice fail to induce release of HMGB 1 , a late mediator that is essential for organ damage in sepsis, which was significantly increased in tnc+/+ mice 8 h after LPS injection (Figure 1 C).
Tissue damage following systemic LPS injection results from immune cell recruitment to susceptible sites; most notably neutrophil infiltration to lungs and liver occurs rapidly during sepsis. Immunohistochemical staining of neutrophil elastase in lungs and liver from tnc+/+ mice 1.5 h after LPS injection demonstrated substantial neutrophil infiltration, which was significantly reduced in tnc-/- mice, an effect also evident at 4 and 8 h after injection (Figures I D and 8C, 8D).
To determine whether tenascin-C expression was elevated in mice with LPS-induced sepsis plasma tenascin-C in tnc+/+ mice was quantified after LPS injection. Immunoblot analysis and ELISA revealed increased tenascin-C in mice upon administration of LPS. Notably, the kinetics of tenascin-C expression was similar to the early pro-inflammatory cytokines TNF-a and IL-6 peaking 1 .5 h after LPS injection and decreasing over time (Figures 1 E-G). Together these results indicate that tenascin-C expression is required for the pro-inflammatory response to LPS in vivo.
Bone marrow engraftment rescues TNF-a synthesis in tnc-/- mice
TNF-a was the cytokine most affected by tenascin-C ablation. To determine if the reduced plasma levels of TNF-a observed in tnc-/- mice is mediated by defects in their hematopoietic cell population, allogeneic bone marrow transplantation was performed. Whole bone marrow cells isolated from tnc+/+ or tnc-/- male mice were injected into sublethally irradiated tnc+/+ or tnc-/- female recipient mice. Tnc+/+/+/+, tnc+/+/-/-, tnc-/-/-/- and tnc-/-/+/+ chimeric mice were generated. All mice displayed equally high donor engraftment as shown by quantitative RT-PCR analysis of the mouse testis-specific Y-encoded protein (TSPY) gene in erythrocyte-depleted peripheral blood cells from recipient mice (Figure. 2A). These data indicate that the majority of bone marrow cells are from the donor.
Analysis of tenascin-C mRNA in erythrocyte-depleted peripheral blood cells from recipient tnc+/+/-/- mice 1.5 h after LPS injection showed significantly reduced expression of tenascin-C compared to tnc+/+/+/+ mice. The tenascin-C mRNA observed in tnc+/+/-/- mice is likely produced by residual bone marrow cells of the tnc+/+ recipient. Likewise, replenishment of tnc-/- mice with tnc+/+ bone marrow resulted in significantly more tenascin-C expression compared to at levels half of that expressed by tnc+/+/+/+ -/-/-/- mice (Figure. 2B).
TNF-a levels in plasma from tnc+/+/-/- chimeric mice were 71 % (± 15.5) significantly lower (P=0.0033) than those from tnc+/+/+/+ chimeric mice 1.5 h after LPS injection (Figure 2C). Accordingly, 75% (± 5.9) significantly more TNF-a (P<0.0001 ) was found in plasma from tnc-/-/+/+ chimeric mice compared to tnc-/-/-/- chimeric mice (Figure 2D). 8 h after LPS injection, TNF-a was reduced almost to basal levels in each group. Collectively, these data indicate that tenascin-C derived from bone marrow-derived cells drives TNF-a synthesis during LPS-induced sepsis and that bone marrow-derived cells from tnc-/- mice exhibit defects in TNF-a synthesis in vivo. LPS-activated bone marrow-derived macrophages express tenascin-C
Experiments were also undertaken to investigate whether primary bone marrow- derived macrophages (BMDMs) obtained from tnc+/+ mice express tenascin-C in response to LPS. A kinetic analysis of tenascin-C expression was performed in LPS- stimulated BMDMs. Non-stimulated cells showed low basal levels of tenascin-C expression, which significantly increased upon stimulation with LPS. Tenascin-C mRNA started to increase at 1 h and peaked between 4 and 8 h and returned to basal levels by 24 h (Figure 3A), as observed in human myeloid cells. Increased tenascin-C mRNA correlated with tenascin-C protein synthesis. Non-stimulated BMDMs produced no detectable tenascin-C, however, cell associated tenascin-C significantly increased after LPS activation and peaked 8 h after stimulation (Figure 3B). Tenascin- C was also secreted into the medium where its levels significantly increased 24 h after stimulation (Figure 3C). These data demonstrate that tenascin-C expression in BMDMs is transiently induced by LPS.
To verify that tenascin-C ablation does not affect macrophage development in vitro and in vivo, tnc+/+ and tnc-/- BMDMs or freshly isolated peritoneal macrophages were assayed for CD l l b, F4/80 and CD68 expression. Each maturation marker was equally highly expressed in tnc+/+ and tnc-/- cells (Figures 9A-0), indicating that tenascin-C has no effect on macrophage maturation.
Tenascin-C post-transcriptionally regulates LPS-mediated synthesis of specific cytokine subsets in BMDMs
To further examine the mechanism behind impaired pro-inflammatory cytokine synthesis in tnc-/- mice upon LPS administration, the effects of tenascin-C on cytokine synthesis in BMDMs was studied. There was no significant difference in IL- 1 β, IL- 12 and TGFp i secretion between tnc+/+ and tnc-/- BMDMs. However, BMDMs obtained from tnc-/- mice secreted significantly less TNF-a, IL-6 and CXCL 1 , and significantly more IL- 10, upon stimulation with LPS than did tnc+/+ cells (Figure 4A).
The expression of TNF-a, IL-6, CXCL 1 and IL- 10 mRNA was induced in tnc+/+ BMDMs by LPS stimulation and was not significantly affected by tenascin-C ablation (Figure 4B). No difference in IL- 12 and TGFp i mRNA expression was observed in tnc+/+ and tnc-/- BMDMs (data not shown). These results suggest that regulation of cytokine synthesis by tenascin-C occurs at a post-transcriptional level.
To ensure that the effect of tenascin-C on cytokine synthesis is not due to abnormal macrophage activation in vitro or in vivo, the expression of activation markers in tnc+/+ and tnc-/- BMDMs or freshly isolated peritoneal macrophages was analysed. Equal expression of MHC II, CD40 or CD86 and the LPS receptor TLR4/MD2 was observed in tnc+/+ and tnc-/- BMDMs (Figures 10A-J) or peritoneal macrophages (data not shown). Thus, tenascin-C has no effect on macrophage activation.
Tenascin-C promotes translation of pro-inflammatory cytokines
Impaired pro-inflammatory cytokine production in the absence of any reduction in cytokine mRNA levels in tnc-/- cells led us to investigate whether tnc-/- BMDMs exhibit abnormal intracellular cytokine levels as a consequence of deficient secretion. There was no significant difference in cellular TNF-a, IL-6 and CXCL 1 levels in LPS-stimulated tnc+/+ and tnc-/- BMDMs (Figure 5A). Cytokine levels in the cellular fraction did not account for the defective cytokine secretion by tnc-/- BMDMs as shown by the sum of the amounts of cellular and secreted protein fractions (Figure 5B). These data demonstrate that pro-inflammatory cytokine cellular trafficking occurs normally in BMDMs in the absence of tenascin-C.
The effect of tenascin-C on pro-inflammatory cytokine translation was also analysed. Brefeldin A, an inhibitor of ER-to-Golgi protein transport, resulted in intracellular accumulation of TNF-a, IL-6 and CXCL1 in tnc+/+ cells at 24 h. In contrast, intracellular accumulation of TNF-a was abrogated in tnc-/- BMDMs. Significantly less IL-6 and CXCL1 also accumulated within the Golgi in tnc-/- BMDMs (Figure 5C). Together these results indicate that tenascin-C may be required for effective translation of LPS-induced pro-inflammatory cytokines in BMDMs. Tenascin-C controls TNF-alpha production by driving miR-155 expression
The data presented herein demonstrates that tenascin-C mediates an initial proinflammatory response to infection by post-transcriptionally modulating the expression of the early TLR-induced microRNA miR- 155. This miRNA is processed from the non-protein-coding transcript of the bic gene. By means of a miRNA screen and validation analysis, it was found that expression of both primary transcript pri- miR155 and mature miR- 155 was induced in tnc+/+ BMDMs immediately after LPS stimulation. However, the induction of mature miR- 155 in tnc-/- BMDMs was significantly inhibited. This is underscored by the significantly lower miR- 155 expression detected in vivo in the spleen of septic tnc-/- mice. Consistent with this a positive correlation between miR- 155 expression and TNF-a production was observed in tnc+/+ BMDMs upon LPS stimulation. Interestingly, in the absence of tenascin-C, impaired TNF-a synthesis was parallel to impaired miR- 155 expression. This observation that tenascin-C functions as a tuner of miR- 1 55 expression for an effective TNF-a production was demonstrated by overexpressing miR- 155 in tnc-/- BMDMs, which fully regained the ability to release TNF-a in response to LPS. These data suggest that tenascin-C induced by LPS in BMDMs uses miR- 155 to modulate TNF-a levels.
Results
miRNA expression in tnc+/+ and tnc-/- BMDMs stimulated with LPS for 8 h was analyzed with an array containing 375 miRNAs. 35 miRNAs were found that were reproducibly and significantly upregulated or downregulated by LPS (Figure 6A). A number of miRNAs have emerged as important regulators of TLR signaling including those induced by LPS activation of TLR4. Among these, expression of early response genes such as miR- 155, miR- 125b and let-7i (Figure 6B) was observed, as well as late response genes, including miR- 146a, miR- 132 and miR-21 (Figure 6C). In tnc+/+ BMDMs LPS strongly induced miR- 155 expression, which was significantly inhibited in tnc-/- cells (Figures 6A,B). Using quantitative RT-PCR, these results were confirmed and showed that miR- 155 expression was rapidly induced by LPS, peaked at 24 h and progressively declined in tnc+/+ BMDMs. Conversely, LPS-induced miR- 155 expression in tnc-/- BMDMs was inhibited and did not recover later (Figure 6D). Furthermore, analysis of the primary transcript pri-miR- 155 in the same samples revealed no significant difference between tnc-/- and tnc+/+ BMDMs, which suggests that tenascin-C post-transcriptionally regulates LPS-induced miR- 1 55 expression.
Changes in TNF-a levels and miR- 155 expression were shown to significantly correlate in LPS-stimulated tnc+/+ BMDMs. Accordingly, low TNF-a levels correlated with low miR- 155 expression in tnc-/- BMDMs (Figure 6E). This effect was specific, as IL-6, CXCL 1 , and IL- 10 synthesis did not correlate with miR155 expression (P=0.233; data not shown). To determine whether these in vitro data are 52276
20 relevant in vivo, the expression of LPS-induced miR- 155 in the spleen of tnc+/+ and tnc-/- mice upon LPS injection was examined. Tnc-/- mice expressed significantly less miR- 155 than tric+/+ mice (Figure 6F). Taken together, these data suggest that tenascin-C is required for the induction of miR- 155 by LPS in BMDMs and in septic mice.
Tenascin-C controls TNF- release via the induction of miR-155
To determine whether reconstituting miR- 155 expression rescues LPS-induced TNF-a production in the absence of tenascin-C, the mature 23-nucleotide miRNA was overexpressed in tnc-/- BMDMs. Cells were transiently transfected with a negative control precursor or pre-miR- 155 precursor, which mimics the endogenous precursor miR- 1 55. Transfection of pre-miR- 155 precursor, but not control precursor, resulted in increased expression of mature miR-155 with or without LPS stimulation. However, stimulation of transfected tnc-/- BMDMs with LPS for 8 h further increased miR- 155 expression, which was similar to that induced by LPS in control tnc+/+ BMDMs (Figures 7A and 1 1A). Thus, impaired miR- 155 expression in tnc-/- BMDMs was recovered. The effect of miR- 155 overexpression on cytokine TNF-a release in tnc-/- BMDMs upon LPS stimulation for 8 h was analysed. In the absence of LPS, very low basal levels of TNF-a cytokines were detected in untransfected and transfected cells. TNF-a production in tnc-/- BMDMs transfected with pre-miR-155 precursor and stimulated with LPS for 8 h was significantly higher than in LPS-activated tnc-/- cells transfected with control precursor and was equal to that of control tnc+/+ BMDMs (Figures 7B and 1 1B). Thus, miR- 155 overexpression rescued TNF-a release in tnc-/- BMDMs in response to LPS. Together, these data provide evidence that tenascin-C post-transcriptionally controls the production of TNF-a in response to LPS via miR- 1 55.
The addition of soluble tenascin-C at a concentration comparable to that made by LPS stimulated tnc+/+ BMDMs (<10ng/ml) did not rescue defects in tnc-/- BMDM cytokine synthesis. Moreover, high concentrations of soluble tenascin-C (up to ^g/ml) inhibited cytokine synthesis (Figure 1 1 C).
Experimental Procedures
Mice. Littermate tnc+/+ and tnc-/- mice were from heterozygous breeding pairs on a 129/SvJ background (Saga et al., 1992). All mice were male aged between 8- 12 weeks, except for bone marrow transplantation which were female aged 6-8 weeks. For the generation of BMDMs, bone marrow was flushed from tibias and femurs of tnc+/+ and tnc-/- mice and red blood cells were lysed with Red Blood Cell Lysis Buffer (Sigma). The resulting cells were cultured in DMEM (PAA) supplemented with 20% FCS (GIBCO), 1 % Antibiotic-Antimycotic solution (PAA) and 50μΜ β- mercaptoethanol (Invitrogen) containing l OOng/ml recombinant murine M-CSF (Peprotech). After 7 d, adherent cells were washed and replated, then stimulated with LPS alone ( l OOng/ml; Enzo Life Sciences) or with brefeldin A ( l μg/m\, Sigma). To avoid cell toxicity, we treated BMDMs with brefeldin A for the last 8 h of incubation with LPS. For the generation of thioglycollate-elicited peritoneal macrophages, tnc+/+ and tnc-/- mice were injected intraperitoneally with 1 ml thioglycollate (3% wt/vol; Sigma). Peritoneal exudates were collected 5 d after with cold PBS and cells were analyzed by FACS. For analysis of LPS-induced sepsis, tnc+/+ and tnc-/- mice were injected intraperitoneally with lipopolysaccharides from E. coli 055 :B5 (8mg/kg; Sigma). Mice were observed for 8 h. Body weight, mobility, uveitis, respiration, fur ruffling and diarrhoea were recorded at 0, 1.5, 4 and 8 h after LPS injection. Mobility impairment was graded using an arbitrary scale where 0 = none, 1 = mild (reduced and slower movement), 2 = moderate (movement upon stimulation) and 3 = severe (no movement at all). Mice were killed after 1 .5, 4 or 8 h and plasma and tissues were collected. All procedures were approved by the UK Home Office.
ELISA. ELISA for TNF-a, IL-6, IL-8 (R&D), IL- Ι β (eBioscience), IL- 12, TGFp l , IL- 10, (BD Biosciences), HMGB 1 and TN-C (IBL) were used to quantify secreted and cell-associated pro-inflammatory mediators in plasma, cell supernatants and total protein extracts respectively. Extracts were prepared by lysing cells ( lxl O6) with 0.1 ml RIPA buffer containing a protease inhibitor cocktail (Sigma).
Immunohistochemical analysis. Formalin-fixed tissues from tnc+/+ and tnc-/- mice were paraffin-embedded, cut into 4μιη sections and stained with neutrophil elastase primary antibody (MCA7771 G; AbD Serotec). Immunostaining specificity was confirmed by omitting the primary antibody or using a non-immune rat IgG2a (MCA 1212, AbD Serotec). Neutrophil elastase+ cell number was determined by counting cells in five different areas of the total tissue section.
Immunoblot. Plasma samples from tnc+/+ and tnc-/- mice were resolved by SDS- PAGE and analyzed by Western blotting using goat anti-tenascin-C polyclonal Ab (AF3358; R&D Systems). Bone marrow transplantation. Each tnc-/- and tnc+/+ female recipient mouse was exposed to a single dose of 9 Gy at 80 cGy/min radiation in a γ irradiator (Nordion) and, 3 h later, intravenously injected with whole bone marrow cells isolated from one tnc-/- or tnc+/+ male mouse resuspended in 0.2 ml PBS. Transplanted mice received antibiotic orally for 1 1 weeks (2.5% Baytril; Bayer). The degree of donor engraftment was assessed as described previously (Wang et al., 2002). Genomic DNA was extracted from peripheral blood cells of female recipient and control mice using a QIAamp DNA Blood Mini kit (Qiagen). DNA samples were analyzed for the presence of the Y chromosome by two-standard curve method based on quantitative real-time PCR in a Corbett Rotor-gene 6000 machine (Corbett Research) with TaqMan primers and probe designed to detect the TSPY gene
(fwd 5 ' -TCCTTGGGCTCTTC ATTATTCTTAAC-3 ' (Seq ID No: 3); rev 5 ' -G AGAACC ACGTTGGTTTGAGATG-3 ' ( Seq ID No: 4); probe 6FAM- TCCTGGATCAGAGTGGCTTACCCAGG-TAMRA (Seq ID No: 5); Applied Biosystems). Standard curves were obtained by mixing male and female DNA from non-treated control mice. Samples were standardized against a mouse GAPDH genomic primer/probe set (Applied Biosystems). Samples were calibrated against DNA from male non treated control mouse.
RNA extraction and quantitative real-time PCR. Total RNA was extracted from cells ( lxl O6) using a RNeasy Mini Kit (Qiagen). cDNA was synthesized from equivalent amounts of RNA with AffinityScript reverse transcriptase and oligo(dT) primer (Stratagene). This was followed by quantitative real-time PCR in a Corbett Rotor-gene 6000 machine (Corbett Research) with TaqMan primer sets for mouse tenascin-C (Mm00495662_m l ), TNF-oc (Mm99999068_m l ), IL-6 (Mm00446190_m l ), CXCL 1 (Mm00433859_m l ), IL- 10 (Mm00439614_m l ), CD l lb (Mm00434455_ml ), CD68 (Mm00839636_gl ), F4/80 (Mm00802529_m l ) and HPRT 1 (Mm00446968_m l ) (Applied Biosystems). For miRNA analysis, total RNA including small RNA was extracted from cells (2xl 06) using Trizol (Invitrogen). For mature miRNA detection, RNA was reverse transcribed using the Taqman miRNA reverse transcription kit, including the miRNA-specific primers, followed by real-time PCR with individual miRNA TaqMan assays for the endogenous reference RNA RNU6B, miR- 155, miR- 146a and miR-21 (Applied Biosystems). For pri-miRNA detection, total RNA was reverse transcribed with AffinityScript reverse transcriptase and random primers (Stratagene), followed by real-time PCR with TaqMan primer sets for mouse pri- miR155 (Mm03306395_pri) and HPRT1 (Applied Biosystems). Changes in expression were calculated by the change-in-threshold (AACT) method with HPRT 1 and RNU6B as endogenous controls for gene-expression and miRNA analysis respectively and were normalized to results obtained with untreated cells.
miRNA array. The expression profile of 375 miRNAs was analyzed with TaqMan Low Density Arrays in an ABI 7900HT (Applied Biosystems). Total RNA was extracted from cells with Trizol. RNA integrity was analyzed using an Agilent RNA 6000 Nano kit and an Agilent 2100 bioanalyzer (Agilent Technologies). cDNA was synthesized with a TaqMan microRNA reverse transcription kit and Megaplex RT primers and was followed by real-time PCR with a TaqMan universal PCR master mix and TaqMan array rodent microRNA cards (Applied Biosystems). Data were analyzed with SDS Relative Quantitation software (Applied Biosystems).
Transient transfection. For transfection of miRNA, 2xl 06 tnc-/- BMDMs were transfected with negative control precursor or miR- 155 precursors at a final concentration of 5nM with siPORT NeoFX transfection agent (Ambion) for 8 h. Cells were allowed to recover for 24 h before treatment with LPS for 8 h.
Statistical analysis. Statistical analysis was performed using Student' s T-test, oneway ANOVA with Dunnett' s multiple comparison post-test or two-way ANOVA with Bonferroni post-test where appropriate; correlation was assessed with Spearman's rho test (Prism 5; GraphPad Software).
Clinical evaluation of septic mice. Mice were observed during a period of 8 h upon LPS injection. Pictures of mice were taken to record uveitis at 0, 4 and 8 h after LPS injection. Uveitis was considered mild when eyes were watery, moderate when one or two eyes displayed pus and severe when one or two eyes were closed. Fur ruffling was recorded at 0, 1 .5, 4 and 8 h after LPS injection and was scored as 0, 1 , 2 or 3 for absent, mild, moderate or severe, respectively.
Flow cytometry. For surface staining, peritoneal macrophages and BMDMs were stained for 20 min at 4°C with anti-F4/80-PE (Caltag Medsystems), anti-CD 1 l b-APC, anti-MHC II (I-A/I-E)-PE, anti-CD40-APC, anti-CD80-PE, anti-CD86-FITC, anti- TLR4/MD-2-APC and appropriate isotype controls (ebioscience). For intracellular staining, cells were fixed with 4% paraformaldehyde in PBS for 20 min, were made permeable with PBS containing 2% (vol/vol) BSA, 2mM EDTA, 0.02% NaN3 and 0.05% (vol/vol) saponin and were stained with anti-CD68-APC (AbD Serotec). Samples were analyzed on a FACSCanto II (BD Bioscience) and data were analyzed with FlowJo software (TreeStar). Treatment of BMDMs with soluble tenascin-C. To assess whether addition of exogenous tenascin-C to tnc-/- BMDMs can rescue defects in cytokine synthesis in response to LPS, recombinant human tenascin-C, was synthesized and purified as described previously (Midwood et al., 2009), or commercially purified human tenascin-C (IBL, Japan) was used. l xl O5 tnc+/+ and tnc-/- BMDMs were stimulated for 24 h with l OOng/ml LPS without or with 1 ng/ml to ^g/ml recombinant purified tenascin-C. Cell supernatants were analysed by ELISA to quantify secreted TNF-a and IL-6 (R&D). Viability of the cells throughout the experimental time period was examined by the MTT cell viability assay (Sigma). Cell viability was not affected by treatment with tenascin-C. Addition of tenascin-C to tnc-/- and tnc+/+ BMDMs in the absence of LPS stimulated cytokine synthesis (data not shown).

Claims

1 . An agent which reduces the level and/or activity of tenascin-C and/or miR- 155 for use in the treatment of pathogen induced inflammation.
2. Use of an agent that reduces the level of tenascin-C and/or miR- 155 for the preparation of a medicament for the prevention or treatment of pathogen induced inflammation.
3. A method of treating or preventing pathogen induced inflammation comprising administering to a subject in need thereof an effective amount of an agent according to claim 1 .
4. The agent of claim 1 , the use of claim 2 or the method of claim 3 wherein the pathogen induced inflammation if bacterial sepsis.
5. The agent, use or method of any preceding claim wherein the pathogen induced inflammation is caused by lipopolysaccharide (LPS).
6. The agent, use or method of any preceding claim wherein the agent acts directly to reduce the level and/or activity of tenascin-C.
7. The agent, use or method of any preceding claim wherein the agent acts directly to reduce the level and/or activity of miR- 155.
8. The agent, use or method of any preceding claim wherein the agent acts on tenascin-C to reduce the level and/or activity of miR- 155.
9. The agent, use or method of any preceding claim wherein the agent acts to reduce the level or activity of cell associated tenascin-C.
10. The agent, use or method of any preceding claim wherein the agent acts to reduce the level of tenascin-C and/or miR- 155 to less than about 80% the level or activity of tenascin-C and/or miR- 155 observed in a reference sample.
1 1. The agent, use or method of any preceding claim wherein the agent acts to prevent, inhibit or reduce interaction between tenascin-C and miR- 155.
12. A pharmaceutical composition comprising an agent according to any of claims 1 and 4 to 1 1 and a pharmaceutically acceptable excipient.
13. A method for determining the efficacy of a treatment for pathogen induced inflammation comprising the steps of:
i) determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample from a subject;
ii) administering said treatment to the subject:
iii) determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample from said mammalian subject at a time following administration of said treatment
wherein a reduction in the level and/or activity of tenascin-C and/or miR- 155 following administration of the treatment is indicative of said treatment being a therapy for pathogen induced inflammation.
14. An in vivo method of screening agents/compositions for efficacy in the treatment of pathogen induced inflammation comprising the steps of:
i) determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample from a subject, the subject may be known to be suffering from pathogen induced inflammation;
ii) administering said agent/composition to the subject:
iii) determining the level and/or activity of tenascin-C and/or miR- 155 in a biological sample taken from the subject at a time following administration of said agent/composition;
wherein a reduction in the level and/or activity of tenascin-C and/or miR- 155 following administration of the agent/composition is indicative of said agent/composition being a therapy for pathogen induced inflammation.
15. An in vitro method of screening agents/compositions for efficacy in the treatment of pathogen induced inflammation comprising the steps of:
i) providing a biological sample obtained from a subject; ii) determining the level and/or activity of tenascin-C and/or miR- 155 in the biological sample;
iii) treating the biological sample with said agent/composition in vitro:
iv) determining the level and/or activity of tenascin-C and/or miR- 155 in the biological sample at a time following administration of said agent/composition;
wherein a reduction in the level and/or activity of tenascin-C and/or miR- 155 following administration of the agent/composition is indicative of said agent/composition being a therapy for pathogen induced inflammation.
16. An agent/composition identified by the method of any of claims 13 to 15
PCT/GB2013/052276 2012-08-30 2013-08-29 Prevention of the interaction between tenascin-c and mir-155 to treat sepsis Ceased WO2014033463A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1215414.2 2012-08-30
GBGB1215414.2A GB201215414D0 (en) 2012-08-30 2012-08-30 Composition and use

Publications (1)

Publication Number Publication Date
WO2014033463A1 true WO2014033463A1 (en) 2014-03-06

Family

ID=47074954

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2013/052276 Ceased WO2014033463A1 (en) 2012-08-30 2013-08-29 Prevention of the interaction between tenascin-c and mir-155 to treat sepsis

Country Status (2)

Country Link
GB (1) GB201215414D0 (en)
WO (1) WO2014033463A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080300211A1 (en) * 2007-05-16 2008-12-04 David Baltimore Microrna inhibition for the treatment of inflammation and myeloproliferative disorders
WO2011011775A1 (en) * 2009-07-24 2011-01-27 The Regents Of The University Of California Methods and compositions for treating and preventing disease associated with avb5 integrin
EP2395019A1 (en) * 2009-02-06 2011-12-14 Tokyo University Of Science Educational Foundation Administrative Organization Remedy for chronic inflammation and antibody to be used therein

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20080300211A1 (en) * 2007-05-16 2008-12-04 David Baltimore Microrna inhibition for the treatment of inflammation and myeloproliferative disorders
EP2395019A1 (en) * 2009-02-06 2011-12-14 Tokyo University Of Science Educational Foundation Administrative Organization Remedy for chronic inflammation and antibody to be used therein
WO2011011775A1 (en) * 2009-07-24 2011-01-27 The Regents Of The University Of California Methods and compositions for treating and preventing disease associated with avb5 integrin

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
BERNDT A ET AL: "Reorganisation of the caecal extracellular matrix upon Salmonella infection-Relation between bacterial invasiveness and expression of virulence genes", VETERINARY MICROBIOLOGY, vol. 133, no. 1-2, 1 January 2009 (2009-01-01), ELSEVIER BV, NL, pages 123 - 137, XP025655323, ISSN: 0378-1135, [retrieved on 20080704], DOI: 10.1016/J.VETMIC.2008.06.025 *
DATABASE BIOSIS [online] BIOSCIENCES INFORMATION SERVICE, PHILADELPHIA, PA, US; 2013, PICCININI ANNA M ET AL: "Cross-talk between endogenous danger signals and microRNAs: tenascin-C fine-tunes the immune response to infection via induction of miR-155", XP002716886, Database accession no. PREV201300707226 *
INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE, vol. 32, no. Suppl. 1, 2013, 18TH WORLD CONGRESS ON ADVANCES IN ONCOLOGY / 16TH INTERNATIONAL SYMPOSIUM ON MOLECULAR MEDICINE; CRETE, GREECE; OCTOBER 10 -12, 2013, pages S9, ISSN: 1107-3756(print) *
PICCININI A M ET AL: "Endogenous control of immunity against infection: tenascin-C regulates TLR4-mediated inflammation via microRNA-155", CELL REPORTS, vol. 2, no. 4, 25 October 2012 (2012-10-25), ELSEVIER INC, US, pages 914 - 926, XP002696661, ISSN: 2211-1247, [retrieved on 20121019], DOI: 10.1016/J.CELREP.2012.09.005 *
TILI ESMERINA ET AL: "Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock", JOURNAL OF IMMUNOLOGY, vol. 179, no. 8, October 2007 (2007-10-01), pages 5082 - 5089, XP002716885, ISSN: 0022-1767 *

Also Published As

Publication number Publication date
GB201215414D0 (en) 2012-10-17

Similar Documents

Publication Publication Date Title
US12121525B2 (en) Methods for treating GI syndrome and graft versus host disease
Luo et al. LL37 inhibits Aspergillus fumigatus infection via directly binding to the fungus and preventing excessive inflammation
Zou et al. Ginsenoside Rg1 improves survival in a murine model of polymicrobial sepsis by suppressing the inflammatory response and apoptosis of lymphocytes
KR102433847B1 (en) Use of ginsenoside m1 for treating iga nephropathy
Sun et al. Cytoprotective effects of galacto-oligosaccharides on colon epithelial cells via up-regulating miR-19b
Meng et al. Innate immune cells in acute and chronic kidney disease
Höhne et al. High mobility group box 1 prolongs inflammation and worsens disease in pneumococcal meningitis
AU2023208109B2 (en) Novel therapy
EP3220908B1 (en) Compositions and methods for treating endometriosis
Wang et al. Tracheal epithelial cell-exosome-derived MiR-21-5p inhibits alveolar macrophage pyroptosis to resist pulmonary bacterial infection through PIK3CD-autophagy pathway
Attia et al. Alleviation of pulmonary fibrosis by the dual PPAR agonist saroglitazar and breast milk mesenchymal stem cells via modulating TGFß/SMAD pathway
Wang et al. Isoferulic acid facilitates effective clearance of hypervirulent Klebsiella pneumoniae through targeting capsule
Wang et al. Simultaneous functional disruption of the iron acquisition system and type VI secretion system results in complete suppression of virulence in Acinetobacter baumannii
US20170128459A1 (en) Pharmaceutical composition containing sirt2 inhibitor
JPWO2014157380A1 (en) Wound or fibrosis treatment
US20230390373A1 (en) A live strain of staphylococcus aureus and uses thereof
WO2014033463A1 (en) Prevention of the interaction between tenascin-c and mir-155 to treat sepsis
Tian et al. Human beta defensin-2 protects the epithelial barrier during methicillin-resistant Staphylococcus aureus infection in chronic rhinosinusitis with nasal polyps
US20250223555A1 (en) Reprogramming of immune-enhancing neutrophils by subclinical low-dose endotoxin for the treatment of cancer
US20130225629A1 (en) Targeting pi3k/mtor signalling and neutrophil recruitment for treatment of enteritis
Pi et al. Exosomal co-delivery of CircRNA-TRAPPC6B and rifampicin for enhanced immunotherapy against tuberculosis
Kuhn New Paradigms in E. coli Hemolysin Function and Pathogenesis
US20220354872A1 (en) Pharmaceutical composition and use thereof for relieving progression of chronic kidney disease or preventing thereof
CN116472342A (en) A live strain of Staphylococcus aureus and its application

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13767057

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13767057

Country of ref document: EP

Kind code of ref document: A1