WO2014031594A2

WO2014031594A2 - Modulating voltage-operated calcium channels on immune cells

Info

Publication number: WO2014031594A2
Application number: PCT/US2013/055711
Authority: WO
Inventors: Jean-Pierre Kinet; Huiyun Wang; Albert HSIA
Original assignee: Beth Israel Deaconess Medical Center, Inc.; Lucena Medicines
Priority date: 2012-08-20
Filing date: 2013-08-20
Publication date: 2014-02-27
Also published as: WO2014031594A3

Abstract

The invention features methods and compositions relevant to modulating voltage-operated calcium channels, in particular CaV3.1 calcium channels, active in or on immune cells (e.g., lymphocytes such as T cells and in particular nave T cells and Th17 cells).

Description

MODULATING VOLTAGE-OPERATED CALCIUM CHANNELS ON IMMUNE CELLS

Cross-Reference to Related Applications

[0001] This application claims priority to U.S. Provisional Application Serial No. 61/691,006, filed on August 20, 2012, and U.S. Provisional Application Serial No. 61/739,861, filed on December 20, 2012, the disclosures of which are hereby incorporated in their entirety.

Government License Rights

[0002] This invention was made with government support under Grant No. 5R37GM53950, awarded by the National Institutes of Health. The government has certain rights in the invention.

Background of the Invention

[0003] Undesirable or inappropriate lymphocyte activity contributes to a variety of diseases, disorders, and conditions, including particularly various inflammatory, infectious, and/or proliferative diseases, disorders, and/or conditions such as autoimmune disorders and cancer. There is a need to identify therapeutic modalities effective for the treatment of such diseases, disorders, and/or conditions, as well as a need for technologies that can identify, characterize, monitor and/or evaluate relevant lymphocyte components and/or activities.

Summary

[0004] The present invention encompasses the finding that T-type voltage-gated calcium channels operate on immune cells (e.g., T lymphocytes). The present invention further demonstrates that modulation of such T-type voltage-gated calcium channels can impact immune cell development, differentiation, and/or activity.

[0005] Among other things, the invention provides systems (e.g., compositions and methods) for identifying, characterizing, and/or using appropriate modulating agents that are selective T-type calcium channel modulators. In some embodiments, such modulating agents modulate T-type calcium channels active in or on immune cells.

[0006] In some embodiments, modulating agents are selective for (e.g., exhibit preferential activity with respect to) T-type calcium channels in cells when membrane potential is relatively depolarized. For example, in some embodiments, such modulating agents exhibit preferential activity for cells when membrane potential is above about -70 mV, for example in the range of about -55 mV to about -65 mV, or about -55 mV to about -60 mV, as is observed with resting T cells whose average resting membrane potentials can range from -60 mV to -55 mV, a range which is depolarized relative to the approximate average resting potential of neurons (-70 mV) and cardiac muscle (-90 mV).

[0007] In some embodiments, modulating agents are selective and/or specific for T-type calcium channels (e.g., for one or more of Cav3.1, Cav3.2, or Cav3.3 channels) as compared with other calcium channels, and/or for T-type calcium channels on immune cells as compared with T-type calcium channels on other cell types. In some embodiments, modulating agents are selective and/or specific for a particular T-type calcium channel as compared with other T-type calcium channels (e.g., for Cav3.1 channels as compared with Cav3.2 and/or Cav3.3 channels), even in some instances as compared with other T-type calcium channels in or on immune cells. In some embodiments, modulating agents are or comprise inhibitors.

[0008] In some embodiments, the invention provides methods identifying and/or characterizing one or more agents for activity as a selective T-type calcium channel modulator by contacting the agent with a system comprising a T-type calcium channel active on lymphocyte cells; and detecting a selective and/or specific effect (e.g., relative to absence of the agent and/or to level or type of activity of the agent with respect to one or more other calcium channels and/or to one or more calcium channels on other cell types) of the agent on level or activity of the T-type channel. In some such embodiments, the system comprises lymphocyte cells on which the T-type calcium channel is active.

[0009] In some embodiments, relevant immune cells are or comprise T lymphocytes (i.e, T cells). In some particular embodiments, relevant immune cells are or comprise Thl7 cells. In some particular embodiments, relevant immune cells are or comprise naive T cells. In some embodiments, the relevant immune cells (e.g., T cells) are present in a tissue or organ. In some such embodiments, the tissue or organ is or comprises the spleen. In some such embodiments, the tissue or organ is or comprises bone marrow.

[0010] The present invention provides compositions comprising modulating agents as described herein, as well as methods of using them (e.g., including diagnostic and/or therapeutic methods), or of otherwise diagnosing, monitoring, and/or treating certain lymphocyte -related diseases, disorders, and/or conditions. In some embodiments, such diseases, disorders, and/or conditions may be selected from inflammatory, autoimmune, infectious, and/or proliferative diseases, disorders, or conditions.

[0011] In some embodiments, the invention features a method of treating a subject suffering from or susceptible to a relevant lymphocyte -related diseases, disorder, or condition, the method including administering to the subject a selective T-type calcium channel modulator in an amount sufficient to treat the disease, disorder, or condition. In some embodiments, the lymphocyte-related disease, disorder, or condition (and/or those aspects of it treated by administration of a T-type calcium channel modulator [e.g., a selective T-type calcium modulator] as described herein) involves cells, tissues, organs and/or systems other than the CNS; in some such embodiments, it does not significantly involve CNS cells, tissues, organs and/or systems. In some particular embodiments, neurons are not involved.

[0012] In some embodiments, provided methods reduce the frequency of clinical exacerbations, and/or delay or prevent disease progression, rather than reduce the degree (e.g., severity and/or frequency of incidence of) of pain or of other clinical manifestations (e.g., fatigue) associated with the particular relevant disease, disorder, or condition.

[0013] In some embodiments, provided treatment methods further include administering to the subject a second agent, wherein the selective T-type calcium channel modulator and the second agent together are present in an amount sufficient to treat the condition. In some embodiments, provided treatment methods further include administering to the subject a second agent that reduces the frequency or severity, and/or delays onset, of one or more symptoms or manifestations of the disease, disorder, or condition that is not significantly affected by administration of the selective T-type calcium channel modulator alone; in some such embodiments, the one or more symptoms or manifestations is or comprises pain.

[0014] In some embodiments, the invention features a method for assessing development, progression and/or treatment of a relevant lymphocyte-associated disease, disorder or condition, in a subject, for example by determining level and/or activity of a T-type calcium channel in or on immune cells (e.g., T cells such as Thl7 cells) and/or of Thl7 cells in the subject by analyzing a sample obtained from the subject. In some embodiments, the sample is obtained prior to, concurrent with, or subsequent to administration of one or more doses of a T-type calcium channel modulator as described herein. In some embodiments, such analyzing is performed on a plurality of samples from the subject, wherein different samples in the plurality were obtained at different points in time. In some embodiments, one or more doses of a T-type calcium channel modulator as described herein may be administered between such different points in time. In some embodiments, a decrease in level and/or activity of the relevant T-type calcium channel (e.g., of a CaV3.1 channel) and/or of Thl7 cells is indicative of slowed progression and/or effective treatment of the disease, disorder, or condition. In some embodiments, the invention provides methods for assessing the treatment of a lymphocyte-associated disease, disorder, or condition as described herein, by administering a selective T-type calcium channel modulator to a subject suffering from or susceptible to the disease, disorder, or condition and determining whether, after such

administering, the frequency and/or severity of clinical exacerbations was reduced, extent of disease progression was delayed or prevented, and/or frequency and/or magnitude of one or more doses of a concomitant therapy (e.g., of another selective T-type calcium channel modulator, antioxidant, immunosuppressant, or anticancer agent) was reduced.

[0015] As noted above, in some embodiments, the present invention contemplates combination therapy of a modulating agent (e.g., a T-type calcium channel blocker, and particularly a selective T-type calcium channel modulator as described herein) with at least one additional therapeutic agent (i.e., at least one second agent). In some embodiments of the invention, the second agent is or comprises another selective T-type calcium channel modulator, an antioxidant, an immunosuppressant, or an anticancer agent. In some embodiments, the second agent is or comprises a pain reliever (e.g., an analgesic).

[0016] In some embodiments, the antioxidant is selected from the group consisting of: vitamin

D, calcitriol, calcidiol, or other vitamin D receptor binder, quercetin or other flavonoid, resveratrol or other sirtuin modulator.

[0017] In some embodiments, the immunosuppressant is selected from the group consisting of: a calcineurin inhibitor, tacrolimus, an mTor inhibitor, fingolimod, myriocin, alemtuzumab, rituximab, an anti-CD4 monoclonal antibody, an anti-LFAl monoclonal antibody, an anti-LFA3 monoclonal antibody, an anti-CD45 antibody, an anti-CD 19 antibody, monabatacept, belatacept, indolyl-ASC; azathioprine, lymphocyte immune globulin and anti-thymocyte globulin [equine], mycophenolate mofetil,

mycophenolate sodium, daclizumab, basiliximab, cyclophosphamide, prednisone, prednisolone, leflunomide, FK778, FK779, 15-deoxyspergualin, busulfan, fludarabine, methotrexate, 6-mercaptopurine, 15-deoxyspergualin, LF 15-0195, bredinin, brequinar, and muromonab-CD3.

[0018] In some embodiments, the anticancer agent is selected from the group consisting of: a chemotherapeutic agent, an antiangiogenic agent, a mitotic inhibitor, a nucleoside analog, a DNA intercalating agent, and a topoisomerase analog.

[0019] Alternatively or additionally, in some embodiments, a modulating agent (e.g., a T-type calcium channel modulator, and particularly a selective T-type calcium modulator) is administered in combination with a pain reliever such as, for example, acetaminophen/paracetomol, one or more nonsteroidal anti-inflammatory drugs, COX-2 inhibitors, opiates, morphinomimetics, flupirtine, tricyclic antidepressants, (e.g., amitriptyline), nefopam, anticonvulsants (e.g., carbamazepine, gabapentin, pregabalin), dual LOX/COX inhibitors, cannabinoid receptor antagonists, neurokinin antagonists, PAR2 receptor antagonists, iNOS inhibitors, vanilloid/TRPVl/capsaicin receptor antagonists, calcitonin gene- related antagonists, COX3 inhibitors, glycine antagonists, N-acetylcholine receptor antagonists, enkephalinase inhibitors, FAAH inhibitors, and/or other T-type calcium channel inhibitors.

[0020] In some embodiments of the invention, the lymphocyte-related disease, disorder or condition is a T cell-mediated disease, disorder, or condition such as, for example, allergic asthma, allergy (e.g., bee venom allergy or food allergy), erythematosus, alopecia areata, atherosclerosis, bipolar disease, graft-versus-host disease, hay fever, rejection of a transplanted organ or tissue, schizophrenia, T cell lymphoma expressing ICOS. In some embodiments, the the lymphocyte-related disease, disorder or condition is a T cell-mediated disease, disorder, or condition such as, for example, allergic asthma, allergy (e.g., bee venom allergy or food allergy), erythematosus, alopecia areata, atherosclerosis, graft-versus- host disease, hay fever, rejection of a transplanted organ or tissue, T cell lymphoma expressing ICOS. In some embodiments, a T cell-mediated disease, disorder or condition is a Thl7-mediated autoimmune disease.

[0021] In some such embodiments, the lymphocyte-related disease, disorder or condition is an autoimmune disease, for example selected from the group consisting of: amyotrophic lateral sclerosis, multiple sclerosis, rheumatoid arthritis, systemic lupus, psoriasis, diabetes mellitus type 1 , sympathetic ophthalmia, thrombocytopenia, inflammatory bowel disease (Crohn's disease, ulcerative colitis), Grave's disease, Hajimoto's thyroiditis, Sjogren's syndrome, autoimmune aplastic anemia, autoimmune cardiomyopathy, autoimmune enteropathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune myocarditis, autoimmune peripheral neuropathy, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune urticaria, and autoimmune uveitis, acute disseminated encephalomyelitis, ankylosing spondylitis, dermatomyositis, eosinophilic fasciitis, fibromyalgia, Goodpasture's syndrome, Guillain-Barre syndrome, Miller-Fisher syndrome, Hashimoto's

encephalopathy, idiopathic thrombocytopenic purpura, inflammatory myopathy, Kawasaki's disease, Lambert-Eaton myasthenic syndrome, myasthenia gravis, neuromyelitis optica (Devic's disease), neuromyotonia, osteoarthritis, pemphigus vulgaris, pernicious anaemia, polymyositis, primary biliary cirrhosis, progressive inflammatory neuropathy, psoriatic arthritis, Raynaud phenomenon, relapsing polychondritis, restless leg syndrome, sarcoidosis, scleroderma, stiff person (man) syndrome, temporal (giant cell) arteritis, transverse myelitis, undifferentiated connective tissue disease, vasculitis, vitiligo, Wegener's granulomatosis, and combinatios thereof.

[0022] In some embodiments, the lymphocyte -related disease, disorder or condition is an infectious disease, for example selected from the group consisting of: lower respiratory infections, HIV/AIDS, diarrheal diseases, tuberculosis, malaria, measles, pertussis, tetanus, meningitis, syphilis, hepatitis B, tropical diseases, and combinations thereof.

[0023] In some embodiments, the lymphocyte -related disease, disorder or condition is a, for example selected from multiple myeloma, T cell leukemia and T cell lymphoma. [0024] In some embodiments, the modulating agent is or comprises a selective T-type calcium channel modulator that selectively targets T-type calcium channels. In some embodiments, the selective T-type calcium channel modulator selectively targets CaV3.1. In some embodiments, the selective T-type calcium channel modulator selectively targets CaV3.1 in T cells.

[0025] In some embodiments, the modulating agent is or comprises a selective T-type calcium channel modulator that modulates T cell differentiation.

[0026] In some embodiments, the modulating agent is or comprises a selective T-type calcium channel modulator that does not preferentially cross the blood-brain barrier (i.e., the T-type calcium channel modulator has a CSF:plasma concentration ratio less than one). In some embodiments, the modulating agent is or comprises a selective T-type calcium channel modulator that does not substantially cross the blood brain barrier (e.g., the T-type calcium channel modulator is not detected above background in a CNS sample such as a CSF sample). In some embodiments, the modulating agent is or comprises a selective T-type calcium channel modulator that is preferentially distributed to part or all of the immune system, such as for example to bone marrow, thymus, lymphatic system, lymph nodes, spleen, and/or mucosal and cutaneous lymphoid tissues in the gastrointestinal tract, respiratory system, genitourinary system, and/or skin.

[0027] In some embodiments, modulating agent is or comprises a selective T-type calcium channel modulator selected from the group consisting of: ethosuximide, phensuximide, and

methsuximide, methyl-phenyl-succinimide, R isomer of efonidipine, trimethadione, dimethadione, mibefradil, TTA-A2, TTA-A8, TTA-Pl, TTA-P2, TTA-Q3, TTA-Q6, MK-8998, Z941, Z944, ABT-639, TTL-1 177, KYSO5044, N C 55-0396 dihydrochloride, kurtoxin, and combinations thereof.

[0028] In some embodiments of the invention, the modulating agent is or comprises a selective

T-type calcium channel modulator that is an anti-T-type calcium channel antibody, an RNAi agent, a small molecule modulator, or peptide modulator. In some particular embodiments, the modulating agent is a selective T-type calcium channel blocker that is administered according to a dosing regimen that is sufficient to treat a particular lymphocyte-related disease, disorder or condition (e.g., multiple sclerosis) in that its use in a population of subjects suffering from multiple sclerosis shows a statistically significant correlation with a reduction in the frequency and/or severity, and/or with a delay in onset, of one or more symptoms or manifestations of the disease, disorder, or condition, across the population. Definitions

[0029] Activator: By "activator" is meant an agent whose presence in a system comprising a T- type calcium channel or gene correlates with increased expression and/or activity of the T-type calcium channel as compared with that observed under otherwise comparable conditions in its absence. In some embodiments, an activator acts by direct interaction (i.e., binding) with a T-type calcium channel. In some embodiments, an activator acts by indirect effect (e.g., on expression or activity of a gene or transcript encoding a T-type calcium channel, or on a protein regulator thereof. In some embodiments, activators can include reversible activators (e.g., that reversibly interact with a T-type calcium channel or regulator thereof). In some embodiments, inhibitors can comprise irreversible inhibitors, for example which covalently modify the T-type calcium channel or regulator thereof. In some embodiments, activators can be agonists and/or positive allosteric regulators of T-type calcium channels or regulators thereof.

[0030] Administration: As used herein, the term "administration" refers to the administration of a composition to a subject. Administration may be by any appropriate route. For example, in some embodiments, administration may be bronchial (including by bronchial instillation), buccal, enteral, interdermal, intra-arterial, intradermal, intragastric, intramedullary, intramuscular, intranasal, intraperitoneal, intrathecal, intravenous, intraventricular, mucosal, nasal, oral, rectal, subcutaneous, sublingual, topical, tracheal (including by intratracheal instillation), transdermal, vaginal and vitreal.

[0031] Amino acid: As used herein, the term "amino acid," in its broadest sense, refers to any compound and/or substance that can be incorporated into a polypeptide chain, e.g., through formation of one or more peptide bonds. In some embodiments, an amino acid has the general structure H2N- C(H)(R)-COOH. In some embodiments, an amino acid is a naturally-occurring amino acid. In some embodiments, an amino acid is a synthetic amino acid; in some embodiments, an amino acid is a D-amino acid; in some embodiments, an amino acid is an L-amino acid. "Standard amino acid" refers to any of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Nonstandard amino acid" refers to any amino acid, other than the standard amino acids, regardless of whether it is prepared synthetically or obtained from a natural source. In some embodiments, an amino acid, including a carboxy- and/or amino-terminal amino acid in a polypeptide, can contain a structural modification as compared with the general structure above. For example, in some embodiments, an amino acid may be modified by methylation, amidation, acetylation, and/or substitution as compared with the general structure. In some embodiments, such modification may, for example, alter the circulating half life of a polypeptide containing the modified amino acid as compared with one containing an otherwise identical unmodified amino acid. In some embodiments, such modification does not significantly alter a relevant activity of a polypeptide containing the modified amino acid, as compared with one containing an otherwise identical unmodified amino acid. As will be clear from context, in some embodiments, the term "amino acid" is used to refer to a free amino acid; in some embodiments it is used to refer to an amino acid residue of a polypeptide.

[0032] Amount sufficient: By "amount sufficient" of an agent (e.g., a modulating agent) it is meant an amount of the agent sufficient to effect a beneficial or desired result (e.g., treatment of a relevant disease, disorder or conditionas described herein). In some embodiments, the beneficial or desired result is or comprises increase or reduction in level and/or activity of T-type calcium channels on immune cells and/or of Thl7 cells and/or of iNKT cells, as compared to that observed under otherwise comparable conditions absent the agent. In some embodiments, an amount sufficient is an amount that, when administered to a population suffering from or susceptible to a disease, disorder, and/or condition in accordance with a therapeutic dosing regimen, is effective to achieve treatment of the disease, disorder, and/or condition (e.g., is effective to reduce the incidence and/or severity of, and/or delays onset of, one or more symptoms of the disease, disorder, and/or condition). Those of ordinary skill in the art will appreciate that an amount can be considered to be an "amount sufficient" even when it does not in fact achieve successful treatment upon administration to a particular individual. Rather, so long as the relevant amount provides a particular desired outcome in a significant number of subjects when administered to a population thereof, it may be considered an "amount sufficient". It is specifically understood that particular subjects may, in fact, be "refractory" to therapy so that the desired outcome is not observed even after administration of the amount sufficient. To give but one example, a refractory subject may have a low bioavailability such that clinical efficacy is not obtainable. In some

embodiments, reference to amount sufficient may be a reference to an amount as measured in one or more relevant tissues (e.g., a tissue affected by the disease, disorder or condition) or fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc). Those of ordinary skill in the art will appreciate that, in some embodiments, an amount sufficient may be formulated and/or administered in a single dose. In some embodiments, an amount sufficient may be formulated and/or administered in a plurality of doses, for example, as part of a therapeutic regimen.

[0033] Analog: As used herein, the term "analog" refers to a substance that shares one or more particular structural features, elements, components, or moieties with a reference substance. Typically, an "analog" shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, an analog a substance that can be generated from the reference substance by chemical manipulation of the reference substance. In some embodiemnts, an analog is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance. In some embodiments, an analog is or can be generated through performance of a synthetic process different from that used to generate the reference substance.

[0034] Animal: As used herein, the term "animal" refers to any member of the animal kingdom.

In some embodiments, "animal" refers to humans, at any stage of development. In some embodiments, "animal" refers to non-human animals, at any stage of development. In some embodiments, the non- human animal is a mammal (e.g., a rodent, a mouse, a rat, a rabbit, a monkey, a dog, a cat, a sheep, cattle, a primate, and/or a pig). In some embodiments, animals include, but are not limited to, mammals, birds, reptiles, amphibians, fish, and/or worms. In some embodiments, an animal may be a transgenic animal, genetically-engineered animal, and/or a clone.

[0035] Antibody: As used herein, the term "antibody" refers to a polypeptide that includes canonical immunoglobulin sequence elements sufficient to confer selective and/or specific binding to a particular target antigen. As is known in the art, intact antibodies as produced in nature are approximately 150 kD tetrameric agents comprised of two identical heavy chain polypeptides (about 50 kD each) and two identical light chain polypeptides (about 25 kD each) that associate with each other into what is commonly referred to as a "Y-shaped" structure. Each heavy chain is comprised of at least four domains (each about 1 10 amino acids long) an amino-terminal variable (VH) domain (located at the tips of the Y structure), followed by three constant domains: CHI, CH2, and the carboxy-terminal CH3 (located at the base of the Y's stem). A short region, known as the "switch", connects the heavy chain variable and constant regions. The "hinge" connects CH2 and CH3 domains to the rest of the antibody. Two disulfide bonds in this hinge region connect the two heavy chain polypeptides to one another in an intact antibody. Each light chain is comprised of two domains - an amino-terminal variable (VL) domain, followed by a carboxy-terminal constant (CL) domain, separated from one another by another "switch". Intact antibody tetramers are comprised of two heavy chain-light chain dimers in which the heavy and light chains are linked to one another by a single disulfide bond; two other disulfide bonds connect the heavy chain hinge regions to one another, so that the dimers are connected to one another and the tetramer is formed.

Naturally-produced antibodies are also glycosylated, typically on the CH2 domain. Each domain in a natural antibody has a structure characterized by an "immunoglobulin fold" formed from two beta sheets (e.g., 3-, 4-, or 5-stranded sheets) packed against each other in a compressed antiparallel beta barrel. Each variable domain contains three hypervariable loops known as "complement determining regions" (CDRl, CDR2, and CDR3) and four somewhat invariant "framework" regions (FR1, FR2, FR3, and FR4). When natural antibodies fold, the FR regions form the beta sheets that provide the structural framework for the domains, and the CDR loop regions from both the heavy and light chains are brought together in three- dimensional space so that they create a single hypervariable antigen binding site located at the tip of the Y structure. Amino acid sequence comparisons among antibody polypeptide chains have defined two light chain (κ and λ) classes, several heavy chain (e.g., μ, γ, α, ε, δ) classes, and certain heavy chain subclasses (al, a2, γΐ, γ2, γ3, and γ4). Antibody classes (IgA [including IgAl, IgA2], IgD, IgE, IgG [including IgGl, IgG2, IgG3, IgG4], IgM) are defined based on the class of the utilized heavy chain sequences. For purposes of the present invention, in certain embodiments, any polypeptide or complex of polypeptides that includes sufficient immunoglobulin domain sequences as found in natural antibodies can be referred to and/or used as an "antibody", whether such polypeptide is naturally produced (e.g., generated by an organism reacting to an antigen), or produced by recombinant engineering, chemical synthesis, or other artificial system or methodology.. In some embodiments, an antibody is monoclonal; in some embodiments, an antibody is monoclonal. In some embodiments, an antibody has constant region sequences that are characteristic of mouse, rabbit, primate, or human antibodies. In some embodiments, an antibody sequence elements are humanized, primatized, chimeric, etc, as is known in the art.

Moreover, the term "antibody" as used herein, will be understood to encompass (unless otherwise stated or clear from context) can refer in appropriate embodiments to any of the art-known or developed constructs or formats for capturing antibody structural and functional features in alternative presentation. For example, in some embodiments, the term can refer to bi- or other multi-specific (e.g., zybodies, etc) antibodies, Small Modular ImmunoPharmaceuticals ("SMIPsTM"), single chain antibodies, cameloid antibodies, and/or antibody fragments. In some embodiments, an antibody may lack a covalent modification (e.g., attachment of a glycan) that it would have if produced naturally. In some embodiments, an antibody may contain a covalent modification (e.g., attachment of a glycan, a payload [e.g., a detectable moiety, a therapeutic moiety, a catalytic moiety, etc], or other pendant group [e.g., poly-ethylene glycol, etc]

[0036] Antibody fragment: As used herein, an "antibody fragment" includes a portion of an intact antibody, such as, for example, the antigen-binding or variable region of an antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; triabodies; tetrabodies; linear antibodies; single-chain antibody molecules; and CDR-containing moieties included in multi-specific antibodies formed from antibody fragments. Those skilled in the art will appreciate that the term "antibody fragment" does not imply and is not restricted to any particular mode of generation. An antibody fragment may be produced through use of any appropriate methodology, including but not limited to cleavage of an intact antibody, chemical synthesis, recombinant production, etc.. [0037] Anticancer: By "anticancer" is meant an agent or compound that reduces, prevents, or interferes with uncontrolled growth of cells, invasion and/or metastasis.

[0038] Anti-T-t pe Calcium Channel Antibody: By "anti-T-type calcium channel antibody" is meant an antibody (e.g., murine monoclonal antibody, chimeric, humanized monoclonal antibody, or human monoclonal antibody) that selectively and/or specifically binds to a T-type calcium channel. In some embodiments, an anti-T-type calcium channel antibody may prevent binding of the T-type calcium channel to its natural ligand, preventing downstream signaling events, and/or stimulate the immune system to attack the T-type calcium channel to which it is bound, including in some embodiments by killing cells that express the T-type calcium channel.

[0039] Approximately: As used herein, the term "approximately" and "about" is intended to encompass normal statistical variation as would be understood by those of ordinary skill in the art as appropriate to the relevant context. In certain embodiments, the term "approximately" or "about" refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 1 1%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).

[0040] Associated with: Two events or entities are "associated" with one another, as that term is used herein, if the presence, level and/or form of one is correlated with that of the other. For example, a particular entity (e.g., polypeptide) is considered to be associated with a particular disease, disorder, or condition, if its presence, level and/or form correlates with incidence of and/or susceptibility of the disease, disorder, or condition (e.g., across a relevant population). In some embodiments, two or more entities are physically "associated" with one another if they interact, directly or indirectly, so that they are and remain in physical proximity with one another. In some embodiments, two or more entities that are physically associated with one another are covalently linked to one another; in some embodiments, two or more entities that are physically associated with one another are not covalently linked to one another but are non-covalently associated, for example by means of hydrogen bonds, van der Waals interaction, hydrophobic interactions, magnetism, and combinations thereof.

[0041] Biologically active: As used herein, the phrase "biologically active" refers to a substance that has activity in a biological system (e.g., in a cell (e.g., isolated, in culture, in a tissue, in an organism), in a cell culture, in a tissue, in an organism, etc.). For instance, a substance that, when administered to an organism, has a biological effect on that organism, is considered to be biologically active. It will be appreciated by those skilled in the art that often only a portion or fragment of a biologically active substance is required (e.g., is necessary and sufficient) for the activity to be present; in such circumstances, that portion or fragment is considered to be a "biologically active" portion or fragment.

[0042] Characteristic sequence element: As used herein, the phrase "characteristic sequence element" refers to a sequence element found in a polymer (e.g., in a polypeptide or nucleic acid) that represents a characteristic portion of that polymer. In some embodiments, presence of a characteristic sequence element correlates with presence or level of a particular activity or property of the polymer. In some embodiments, presence (or absence) of a characteristic sequence element defines a particular polymer as a member (or not a member) of a particular family or group of such polymers. A

characteristic sequence element typically comprises at least two monomers (e.g., amino acids or nucleotides). In some embodiments, a characteristic sequence element includes at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, or more monomers (e.g., contiguously linked monomers). In some embodiments, a characteristic sequence element includes at least first and second stretches of continguous monomers spaced apart by one or more spacer regions whose length may or may not vary across polymers that share the sequence element.

[0043] Combination therapy: As used herein, the term "combination therapy" refers to those situations in which a subject is simultaneously exposed to two or more therapeutic agents. In some embodiments, such agents are administered simultaneously; in some embodiments, such agents are administered sequentially; in some embodiments, such agents are administered in overlapping regimens.

[0044] Comparable: The term "comparable", as used herein, refers to two or more agents, entities, situations, sets of conditions, etc that may not be identical to one another but that are sufficiently similar to permit comparison therebetween so that conclusions may reasonably be drawn based on differences or similarities observed. Those of ordinary skill in the art will understand, in context, what degree of identity is required in any given circumstance for two or more such agents, entities, situations, sets of conditions, etc to be considered comparable.

[0045] Corresponding to: As used herein, the term "corresponding to" is often used to designate the position/identity of a residue in a polymer, such as an amino acid residue in a polypeptide or a nucleotide residue in a nucleic acid. Those of ordinary skill will appreciate that, for purposes of simplicity, residues in such a polymer are often designated using a canonical numbering system based on a reference related polymer, so that a residue in a first polymer "corresponding to" a residue at position 190 in the reference polymer, for example, need not actually be the 190^th residue in the first polymer but rather corresponds to the residue found at the 190^th position in the reference polymer; those of ordinary skill in the art readily appreciate how to identify "corresponding" amino acids, including through use of one or more commercially-available algorithms specifically designed for polymer sequence comparisons. [0046] Decreased Level of Activity: By "decreased level of activity" of CaV3.1 is meant a decrease in CaV3.1 gene expression, protein expression, or activity (e.g., permeability to Ca²⁺, channel opening, and/or up-regulation of gene expression), as compared to a control or reference (e.g., from a normal cell or normal tissue). In some embodiments, such decrease is at least 2-fold, e.g., from about 2- fold to about 150-fold, e.g., from 5-fold to 150-fold, from 5-fold to 100-fold, from 10-fold to 150-fold, from 10-fold to 100-fold, from 50-fold to 150-fold, from 50-fold to 100-fold, from 75-fold to 150-fold, or from 75-fold to 100-fold, as compared to a control or a normal reference sample. Decrease level of activity of ion channels can be determined using any useful methods known in the art.

[0047] Derivative: As used herein, the term "derivative" refers to a structural analogue of a reference substance. That is, a "derivative" is a substance that shows significant structural similarity with the reference substance, for example sharing a core or consensus structure, but also differs in certain discrete ways. In some embodiments, a derivative is a substance that can be generated from the reference substance by chemical manipulation. In some embodiemnts, a derivative is a substance that can be generated through performance of a synthetic process substantially similar to (e.g., sharing a plurality of steps with) one that generates the reference substance.

[0048] Designed: As used herein, the term "designed" refers to an agent (i) whose structure is or was selected by the hand of man; (ii) that is produced by a process requiring the hand of man; and/or (iii) that is distinct from natural substances and other known agents.

[0049] Docking: As used herein, the term "docking" refers to orienting, rotating, translating a chemical entity in the binding pocket, domain, molecule or molecular complex or portion thereof based on distance geometry or energy. Docking may be performed by distance geometry methods that find sets of atoms of a chemical entity that match sets of sphere centers of the binding pocket, domain, molecule or molecular complex or portion thereof. See Meng et al. J. Comp. Chem. 4: 505-524 (1992). Sphere centers are generated by providing an extra radius of given length from the atoms (excluding hydrogen atoms) in the binding pocket, domain, molecule or molecular complex or portion thereof. Real-time interaction energy calculations, energy minimizations or rigid-body minimizations (Gschwend et al., J. Mol.

Recognition 9: 175- 186 (1996)) can be performed while orienting the chemical entity to facilitate docking. For example, interactive docking experiments can be designed to follow the path of least resistance. If the user in an interactive docking experiment makes a move to increase the energy, the system will resist that move. However, if that user makes a move to decrease energy, the system will favor that move by increased responsiveness. (Cohen et al., J. Med. Chem. 33:889-894 (1990)). Docking can also be performed by combining a Monte Carlo search technique with rapid energy evaluation using molecular affinity potentials. See Goodsell and Olson, Proteins: Structure, Function and Genetics 8: 195-202 (1990). Software programs that carry out docking functions include but are not limited to MATCHMOL (Cory et al., J. Mol. Graphics 2: 39 (1984); MOLFIT (Redington, Comput. Chem. 16: 217 (1992)) and DOCK (Meng et al., supra).

[0050] Dosage form: As used herein, the term "dosage form" refers to a physically discrete unit of a therapeutic agent for administration to a subject. Each unit contains a predetermined quantity of active agent. In some embodiments, such quantity is a unit dosage amount (or a whole fraction thereof) appropriate for administration in accordance with a dosing regimen that has been determined to correlate with a desired or beneficial outcome when administered to a relevant population (i.e., with a therapeutic dosing regimen).

[0051] Dosing regimen: As used herein, the term "dosing regimen" refers to a set of unit doses

(typically more than one) that are administered individually to a subject, typically separated by periods of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, a dosing regimen comprises a plurality of doses each of which are separated from one another by a time period of the same length; in some embodiments, a dosing regimen comprises a plurality of doses and at least two different time periods separating individual doses. In some embodiments, a dosing regimen is correlated with a desired or beneficial outcome when administered across a relevant population (i.e., is a therapeutic dosing regimen).

[0052] Engineered: In general, the term "engineered" refers to the aspect of having been manipulated by the hand of man. For example, a polynucleotide is considered to be "engineered" when two or more sequences, that are not linked together in that order in nature, are manipulated by the hand of man to be directly linked to one another in the engineered polynucleotide. For example, in some embodiments of the present invention, an engineered polynucleotide comprises a regulatory sequence that is found in nature in operative association with a first coding sequence but not in operative association with a second coding sequence, is linked by the hand of man so that it is operatively associated with the second coding sequence. Comparably, a cell or organism is considered to be "engineered" if it has been manipulated so that its genetic information is altered {e.g., new genetic material not previously present has been introduced, for example by transformation, mating, somatic hybridization, transfection, transduction, or other mechanism, or previously present genetic material is altered or removed, for example by substitution or deletion mutation, or by mating protocols). As is common practice and is understood by those in the art, progeny of an engineered polynucleotide or cell are typically still referred to as "engineered" even though the actual manipulation was performed on a prior entity.

[0053] Expression: As used herein, "expression" of a nucleic acid sequence refers to one or more of the following events: (1) production of an RNA template from a DNA sequence {e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and/or 3' end formation); (3) translation of an RNA into a polypeptide or protein; and/or (4) post-translational modification of a polypeptide or protein.

[0054] Fragment: A "fragment" of a material or entity as described herein has a structure that includes a discrete portion of the whole, but lacks one or more moieties found in the whole. In some embodiments, a fragment consists of such a discrete portion. In some embodiments, a fragment consists of or comprises a characteristic structural element or moiety found in the whole. In some embodiments, a polymer fragment comprises or consists of at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 1 10, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more monomeric units (e.g., residues) as found in the whole polymer. In some embodiments, a polymer fragment comprises or consists of at least about 5%, 10%, 15%, 20%, 25%, 30%, 25%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more of the monomeric units (e.g., residues) found in the whole polymer. The whole material or entity may in some embodiments be referred to as the "parent" of the whole.

[0055] Homology: As used herein, the term "homology" refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be "homologous" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. In some embodiments, polymeric molecules are considered to be "homologous" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar (e.g., containing residues with related chemical properties at corresponding positions). For example, as is well known by those of ordinary skill in the art, certain amino acids are typically classified as similar to one another as "hydrophobic" or "hydrophilic"amino acids, and/or as having "polar" or "non-polar" side chains. Substitution of one amino acid for another of the same type may often be considered a

"homologous" substitution. Typical amino acid categorizations are summarized below:

Alanine Ala A nonpolar neutral 1.8

Arginine Arg R polar positive -4.5

Asparagine Asn N polar neutral -3.5 Aspartic acid Asp D polar negative -3.5

Cysteine Cys C nonpolar neutral 2.5

Glutamic acid Glu E polar negative -3.5

Glutamine Gin Q polar neutral -3.5

Glycine Gly G nonpolar neutral -0.4

Histidine His H polar positive -3.2

Isoleucine He [ nonpolar neutral 4.5

Leucine Leu L nonpolar neutral 3.8

Lysine Lys K polar positive -3.9

Methionine Met M nonpolar neutral 1.9

Phenylalanine Phe F nonpolar neutral 2.8

Proline Pro P nonpolar neutral -1.6

Serine Ser S polar neutral -0.8

Threonine Thr Γ polar neutral -0.7

Tryptophan Trp w nonpolar neutral -0.9

Tyrosine Tyr Y polar neutral -1.3

Valine Val V nonpolar neutral 4.2

Ambiguous Amino Acids 3-Letter 1-Letter

Asparagine or aspartic acid Asx B

Glutamine or glutamic acid Glx Z

Leucine or Isoleucine Xle J Unspecified or unknown amino acid Kaa

As will be understood by those skilled in the art, a variety of algorithms are available that permit comparison of sequences in order to determine their degree of homology, including by permitting gaps of designated length in one sequence relative to another when considering which residues "correspond" to one another in different sequences. Calculation of the percent homology between two nucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-corresponding sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position; when a position in the first sequence is occupied by a similar nucleotide as the corresponding position in the second sequence, then the molecules are similar at that position. The percent homology between the two sequences is a function of the number of identical and similar positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. Representative algorithms and computer programs useful in determining the percent homology between two nucleotide sequences include, for example, the algorithm of Meyers and Miller (CABIOS, 1989, 4: 1 1 - 17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent homology between two nucleotide sequences can, alternatively, be determined for example using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.

[0056] Identity: As used herein, the term "identity" refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and/or RNA molecules) and/or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be "substantially identical" to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. As will be understood by those skilled in the art, a variety of algorithms are available that permit comparison of sequences in order to determine their degree of homology, including by permitting gaps of designated length in one sequence relative to another when considering which residues "correspond" to one another in different sequences. Calculation of the percent identity between two nucleic acid sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second nucleic acid sequences for optimal alignment and non-corresponding sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. The nucleotides at corresponding nucleotide positions are then compared. When a position in the first sequence is occupied by the same nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.

Representative algorithms and computer programs useful in determinng the percent identity between two nucleotide sequences include, for example, the algorithm of Meyers and Miller (CABIOS, 1989, 4: 1 1- 17), which has been incorporated into the ALIGN program (version 2.0) using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. The percent identity between two nucleotide sequences can, alternatively, be determined for example using the GAP program in the GCG software package using an NWSgapdna.CMP matrix.

[0057] Immune Cells: As will be understood by those skilled in the art, immune cells are cells involved in the immune system. In many embodiments, immune cells consist of or comprise

lymphocytes (e.g., T lymphocytes or B-lymphocytes). In many embodiments, immune cells consist of or comprise T lymphocytes (i.e., T cells). In some embodiments, immune cells relevant to the present invention consist of or comprise Thl7 cells. In some embodiments, immune cells relevant to the present invention consist of or comprise naive T cells. In some embodiments, immune cells relevant to the present invention consist of or comprise iNKT cells. In some embodiments, immune cells are utilized in vitro. In some embodiments, immune cells are utilized in vivo. In some embodiments, immune cells are provided and/or utilized in context of a tissue or organ. In some embodiments, such a tissue or organ is or comprises a primary lymphoid organ (e.g., spleen), for example in which T- cell differentiation occurs. In some embodiments, such a tissue or organ is or comprises bone marrow. In some embodiments, immune cells consist of or comprise peripheral immune cells. In some embodiments, immune cells are not and/or do not include peripheral immune cells.

[0058] Immunosuppressant: By "immunosuppressant" is meant an agent or compound that induces immunosuppression, (i.e., it reduces, e.g., prevents or interferes with the development of an immunological response, e.g., cellular or humoral). [0059] Inhibitor: By "inhibitor" is meant an agent whose presence in a system comprising a T- type calcium channel or gene correlates with reduced expression and/or activity of the T-type calcium channel as compared with that observed under otherwise comparable conditions in its absence. In some embodiments, an inhibitor acts by direct interaction (i.e., binding) with a T-type calcium channel. In some embodiments, an inhibitor acts by indirect effect (e.g., on expression or activity of a gene or transcript encoding a T-type calcium channel, or on a protein regulator thereofln some embodiments, inhibitors can include reversible inhibitors (e.g., competitive inhibitors, uncompetitive inhibitors, mixed inhibitors, non-competitive inhibitors). In some embodiments, inhibitors can comprise irreversible inhibitors, for example which covalently modify the T-type calcium channel or regulator thereof.

[0060] Ion Channel Blocker: By "ion channel blocker" is meant an agent or compound that disrupts the movement of ions (e.g., Na²⁺, Ca²⁺, K⁺, and CI^") through ion channels (e.g., voltage-gated calcium channels, e.g., L-type, P-type/Q-type, N-type, R-type, or T-type, e.g., ligand-gated calcium channels, e.g., IP₃ receptor, ryanodine receptor, two-pore channels, cation channels of sperm, or store- operated channels, e.g., voltage-gated potassium channels, calcium-activated potassium channels, two- pore domain potassium channels, voltage-gated sodium channels, and/or chloride channels).

[0061] Isolated: As used herein, the term "isolated" refers to a substance and/or entity that has been (1) separated from at least some of the components with which it was associated when initially produced (whether in nature and/or in an experimental setting), and/or (2) designed, produced, prepared, and/or manufactured by the hand of man. Isolated substances and/or entities may be separated from about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% of the other components with which they were initially associated. In some embodiments, isolated agents are about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99% pure. As used herein, a substance is "pure" if it is substantially free of other components. In some embodiments, as will be understood by those skilled in the art, a substance may still be considered "isolated" or even "pure", after having been combined with certain other components such as, for example, one or more carriers or excipients (e.g., buffer, solvent, water, etc.); in such embodiments, percent isolation or purity of the substance is calculated without including such carriers or excipients. In some embodiments, isolation involves or requires disruption of covalent bonds (e.g., to isolate a polypeptide domain from a longer polypeptide and/or to isolate a nucleotide sequence element from a longer oligonucleotide or nucleic acid). [0062] Isomer: As is known in the art, many chemical entities (in particular many organic molecules and/or many small molecules) can exist in a variety of structural and/or optical isomeric forms. In some embodiments, as will be clear to those skilled in the art from context, depiction of or reference to a particular compound structure herein is intended to encompass all structural and/or optical isomers thereof. In some embodiments, as will be clear to those skilled in the art from context, depiction of or reference to a particular compound structure herein is intended to encompass only the depicted or referenced isomeric form. In some embodiments, compositions including a chemical entitiy that can exist in a variety of isomeric forms include a plurality of such forms; in some embodiments such compositions include only a single form. For example, in some embodiments, compositions including a chemical entity that can exist as a variety of optical isomers (e.g., stereoisomers, diastereomers, etc) include a racemic population of such optical isomers; in some embodiments such compositions include only a single optical isomer and/or include a plurality of optical isomers that together retain optical activity.

[0063] Modulator: The term "modulator" is used to refer to an entity whose presence in a system in which an activity of interest is observed correlates with a change in level and/or nature of that activity as compared with that observed under otherwise comparable conditions when the modulator is absent. In some embodiments, a modulator is an activator, in that activity is increased in its presence as compared with that observed under otherwise comparable conditions when the modulator is absent. In some embodiments, a modulator is an inhibitor, in that activity is reduced in its presence as compared with otherwise comparable conditions when the modulator is absent. In some embodiments, a modulator interacts directly with a target entity whose activity is of interest. In some embodiments, a modulator interacts indirectly (i.e., directly with an intermediate agent that interacts with the target entity) with a target entity whose activity is of interest. In some embodiments, a modulator affects level of a target entity of interest; alternatively or additionally, in some embodiments, a modulator affects activity of a target entity of interest without affecting level of the target entity. In some embodiments, a modulator affects both level and activity of a target entity of interest, so that an observed difference in activity is not entirely explained by or commensurate with an observed difference in level.

[0064] Modulates T Cell Differentiation: By "modulates T cell differentiation" is meant that the agent or compound affects upstream or downstream signaling events that are involved in

differentiation of na^'ive T cell into T-helper (Th) cells. The agent or compound may affect activation of antigen-presenting cells (APCs), the gene or protein expression of cytokine receptors (e.g., IL23R, IL22R, IL4R, IL12R, or IL17), cytokines (e.g., IL4, IL23, IL22, IL17, or IL12), interferon receptors (e.g., IFNGR1, or IFNGR2), and interferons (e.g., IFN, IL17, etc). Modulation of T cell differentiation may also be an effect on gene or protein expression of STAT4, STAT6, T-bet, or GAT A3. The term modulate can include inhibition or activation of these or other upstream and/or downstream signaling molecules and/or events.

[0065] Nucleic acid: As used herein, the term "nucleic acid," in its broadest sense, refers to any compound and/or substance that is or can be incorporated into an oligonucleotide chain. In some embodiments, a nucleic acid is a compound and/or substance that is or can be incorporated into an oligonucleotide chain via a phosphodiester linkage. As will be clear from context, in some embodiments, "nucleic acid" refers to individual nucleic acid residues (e.g., nucleotides and/or nucleosides); in some embodiments, "nucleic acid" refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, a "nucleic acid" is or comprises RNA; in some embodiments, a "nucleic acid" is or comprises DNA. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleic acid residues. In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleic acid analogs. In some embodiments, a nucleic acid analog differs from a nucleic acid in that it does not utilize a phosphodiester backbone. For example, in some embodiments, a nucleic acid is, comprises, or consists of one or more "peptide nucleic acids", which are known in the art and have peptide bonds instead of phosphodiester bonds in the backbone, are considered within the scope of the present invention. Alternatively or additionally, in some embodiments, a nucleic acid has one or more phosphorothioate and/or 5'-N-phosphoramidite linkages rather than phosphodiester bonds. In some embodiments, a nucleic acid is, comprises, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine). In some embodiments, a nucleic acid is, comprises, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5- methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5- fluorouridine, C5-iodouridine, C5 -propynyl-uridine, C5 -propynyl-cytidine, C5-methylcytidine, 2- aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)- methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, a nucleic acid comprises one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'- deoxyribose, arabinose, and hexose) as compared with those in natural nucleic acids. In some embodiments, a nucleic acid has a nucleotide sequence that encodes a functional gene product such as an RNA or protein. In some embodiments, a nucleic acid includes one or more introns. In some embodiments, nucleic acids are prepared by one or more of isolation from a natural source, enzymatic synthesis by polymerization based on a complementary template (in vivo or in vitro), reproduction in a recombinant cell or system, and chemical synthesis. In some embodiments, a nucleic acid is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more residues long.

[0066] Peptide modulator: By "peptide modulator" is meant an peptide that modulates T-type calcium channel active in lymphocyte cells as described herein, sometimes compared to a control or reference (e.g., baseline). In some embodiments, a peptide modulator is or comprises an endogenous or synthetic peptide that has structural homology or conserved sequences to the subunits of the T-type calcium channel (e.g., al, α2δ, β, and/or γ subunit(s)) and/or transmembrane domains of the T-type calcium channel (e.g., TM1, TM2, TM3, TM4, TM5, and TM6) that are effective in activating and/or inhibiting T-type calcium channel activity (e.g., low voltage-activated calcium current, high voltage- activated calcium current, calcium flux across the plasma membrane, and alteration of surface expression).

[0067] Pharmaceutically acceptable: The term "pharmaceutically acceptable" as used herein, refers to agents that, within the scope of sound medical judgment, are suitable for use in contact with tissues of human beings and/or animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

[0068] Pharmaceutical composition: By "pharmaceutical composition" is meant a composition containing an active agent as described herein, formulated with a pharmaceutically acceptable excipient, and manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a mammal. Pharmaceutical compositions can be formulated, for example, for oral administration in unit dosage form (e.g., a tablet, capsule, caplet, gel cap, or syrup); for topical administration (e.g., as a cream, gel, lotion, or ointment); for intravenous administration (e.g., as a sterile solution free of particulate emboli and in a solvent system suitable for intravenous use); or in any other formulation described herein.

[0069] Polypeptide: The term "polypeptide", as used herein, generally has its art-recognized meaning of a polymer of at least three amino acids, linked to one another by peptide bonds. In some embodiments, the term is used to refer to certain functional classes of polypeptides, such as, for example, autoantigen polypeptides, nicotinic acetylcholine receptor polypeptides, alloantigen polypeptides, etc. For each such class, the present specification provides several examples of amino acid sequences of known exemplary polypeptides within the class; in some embodiments, such known polypeptides are reference polypeptides for the class. In such embodiments, the term "polypeptide" refers to any member of the class that shows significant sequence homology or identity with a relevant reference polypeptide. In many embodiments, such member also shares significant activity with the reference polypeptide. For example, in some embodiments, a member polypeptide shows an overall degree of sequence homology or identity with a reference polypeptide that is at least about 30-40%, and is often greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more and/or includes at least one region (i.e., a conserved region, often including a characteristic sequence element) that shows very high sequence identity, often greater than 90% or even 95%, 96%, 97%, 98%, or 99%. Such a conserved region usually encompasses at least 3-4 and often up to 20 or more amino acids; in some embodiments, a conserved region encompasses at least one stretch of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15 or more contiguous amino acids. In some embodiments, a useful polypeptide as described herein may comprise or consist of a fragment of a parent polypeptide. In some embodiments, a useful polypeptide as described herein may comprise or consist of a plurality of fragments, each of which is found in the same parent polypeptide in a different spatial arrangement relative to one another than is found in the polypeptide of interest (e.g., fragments that are directly linked in the parent may be spatially separated in the polypeptide of interest or vice versa, and/or fragments may be present in a different order in the polypeptide of interest than in the parent), so that the polypeptide of interest is a derivative of its parent polypeptide.

[0070] Protein: As used herein, the term "protein" refers to a polypeptide (i.e., a string of at least two amino acids linked to one another by peptide bonds). Proteins may include moieties other than amino acids (e.g., may be glycoproteins, proteoglycans, etc.) and/or may be otherwise processed or modified. Those of ordinary skill in the art will appreciate that a "protein" can be a complete polypeptide chain as produced by a cell (with or without a signal sequence), or can be a characteristic portion thereof. Those of ordinary skill will appreciate that a protein can sometimes include more than one polypeptide chain, for example linked by one or more disulfide bonds or associated by other means. Polypeptides may contain L-amino acids, D-amino acids, or both and may contain any of a variety of amino acid modifications or analogs known in the art. Useful modifications include, e.g., terminal acetylation, amidation, methylation, etc. In some embodiments, proteins may comprise natural amino acids, non- natural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to a polypeptide having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, proteins are antibodies, antibody fragments, biologically active portions thereof, and/or characteristic portions thereof.

[0071] Reference: The term "reference" is often used herein to describe a standard or control agent or value against which an agent or value of interest is compared. In some embodiments, a reference agent is tested and/or a reference value is determined substantially simultaneously with the testing or determination of the agent or value of interest. In some embodiments, a reference agent or value is a historical reference, optionally embodied in a tangible medium. Typically, as would be understood by those skilled in the art, a reference agent or value is determined or characterized under conditions comparable to those utilized to determine or characterize the agent or value of interest.

[0072] Refractory: As used herein, the term "refractory" refers to any subject that does not respond with an expected clinical efficacy following the administration of provided compositions as normally observed by practicing medical personnel.

[0073] RNAi Agen By "R Ai agent" is meant any agent or compound that exerts a gene silencing effect by hybridizing a target nucleic acid. RNAi agents include any nucleic acid molecules that are capable of mediating sequence-specific RNAi (e.g., under stringent conditions), for example, a short interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically- modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and Dicer-substrate RNA

(DsiRNA).

[0074] Sample: As used herein, the term "sample" typically refers to a biological sample obtained or derived from a source of interest, as described herein. In some embodiments, a source of interest comprises an organism, such as an animal or human. In some embodiments, a biological sample comprises biological tissue or fluid. In some embodiments, a biological sample may be or comprise bone marrow; blood; blood cells; ascites; tissue or fine needle biopsy samples; cell-containing body fluids; free floating nucleic acids; sputum; saliva; urine; cerebrospinal fluid, peritoneal fluid; pleural fluid; feces; lymph; gynecological fluids; skin swabs; vaginal swabs; oral swabs; nasal swabs; washings or lavages such as a ductal lavages or broncheoalveolar lavages; aspirates; scrapings; bone marrow specimens; tissue biopsy specimens; surgical specimens; feces, other body fluids, secretions, and/or excretions; and/or cells therefrom, etc. In some embodiments, a biological sample is or comprises cells obtained from an individual. In some embodiments, obtained cells are or include cells from an individual from whom the sample is obtained. In some embodiments, obtained cells are or include microbial cells of an individual's microbiome. In some embodiments, a sample is a "primary sample" obtained directly from a source of interest by any appropriate means. For example, in some embodiments, a primary biological sample is obtained by methods selected from the group consisting of biopsy (e.g., fine needle aspiration or tissue biopsy), surgery, collection of body fluid (e.g., blood, lymph, feces etc.), etc. In some embodiments, as will be clear from context, the term "sample" refers to a preparation that is obtained by processing (e.g., by removing one or more components of and/or by adding one or more agents to) a primary sample. For example, filtering using a semi-permeable membrane. Such a "processed sample" may comprise, for example nucleic acids or proteins extracted from a sample or obtained by subjecting a primary sample to techniques such as amplification or reverse transcription of mRNA, isolation and/or purification of certain components, etc.

[0075] Selective: An agent that is "selective" is one that produces a desired effect on one target entity and/or in one cell, one compartment of the body, while to a lesser degree influencing and/or creating adverse effects on other potential target entities (in some embodiments including subtype and/or variants of the target entity) and/or in other cells, tissues, organs, and/or compartments of the body. In some embodiments, a selective agent is an agent that acts specifically and/or preferentially on a particular target or set of targets. In some embodiments, selectivity can be determined by binding kinetics (e.g., degree of interaction between an agent with its target and/or with a particular cell, cell type, tissue, organ, and/or compartment of the body). In some embodiments, an agent is selective if it shows an elevated affinity and/or decreased dissociation constant (K_D) of 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 30- fold, 100-fold, or 200-fold for its target (and/or for a particular cell, cell type, tissue, organ, and/or compartment of the body) as compared with for a non-target competitor. In some embodiments, an agent is selective if it exerts a particular biologic effect on its target (and/or on or in a particular cell, cell type, tissue, organ, and/or compartment of the body) at a dose that is lower (e.g., by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more) than is required for the agent to exert an analogous effect on a potential alternative target (or particular cell, cell type, tissue, organ, and/or compartment of the body ), and/or for an alternative comparable reference agent to exhibit an analogous effect on the target (and/or on or in the particular cell, cell type, tissue, organ, and/or compartment of the body). In some embodiments, selectivity can also be a measure of local accumulation of an agent in association with the target entity and/or on or in the particular cell, cell type, tissue, organ, and/or compartment of the body compared to accumulation in association with other potential target entities and/or target and/or cells, cell types, tissues, organs, and/or compartments of the body. In some embodiments, a selective agent demonstrates an increase in accumulation that is 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% at or with the target entity and/or on or in the particular cell, cell type, tissue, organ, and/or compartment of the body as compared with an alternative comparable reference entity and/or cell, cell type, tissue, organ, and/or compartment of the body In some embodiments, selectivity can be based on efficacy and/or potency of an agent. In some embodiments, an agent that is selective shows an efficacy or potency that is at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% more than that of a reference agent with respect to a particular activity or event.

[0076] Small molecule: As used herein, the term "small molecule" means a low molecular weight organic and/or inorganic compound. In general, a "small molecule" is a molecule that is less than about 5 kilodaltons (kD) in size. In some embodiments, a small molecule is less than about 4 kD, 3 kD, about 2 kD, or about 1 kD. In some embodiments, the small molecule is less than about 800 daltons (D), about 600 D, about 500 D, about 400 D, about 300 D, about 200 D, or about 100 D. In some

embodiments, a small molecule is less than about 2000 g/mol, less than about 1500 g/mol, less than about 1000 g/mol, less than about 800 g/mol, or less than about 500 g/mol. In some embodiments, a small molecule is not a polymer. In some embodiments, a small molecule does not include a polymeric moiety. In some embodiments, a small molecule is not a protein or polypeptide (e.g., is not an oligopeptide or peptide). In some embodiments, a small molecule is not a polynucleotide (e.g., is not an oligonucleotide). In some embodiments, a small molecule is not a polysaccharide. In some embodiments, a small molecule does not comprise a polysaccharide (e.g., is not a glycoprotein, proteoglycan, glycolipid, etc.). In some embodiments, a small molecule is not a lipid. In some embodiments, a small molecule is a modulating agent. In some embodiments, a small molecule is biologically active. In some embodiments, a small molecule is detectable (e.g., comprises at least one detectable moiety). In some embodiments, a small molecule is a therapeutic.

[0077] Small Molecule Modulator. By "small molecule modulator" is meant any small molecule (e.g., naturally occurring, or synthesized organic and/or inorganic compound) that modulates a T-type calcium channel active in lymphocyte cells as described herein, sometimes compared to a control or reference (e.g., baseline). In some embodiments, such increase or decrease is by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, as compared to the control or reference. Small molecule modulators can be activators or inhibitors and can be identified and/or characterized by any useful methods or can be known in the art.

[0078] Solid form: As is known in the art, many chemical entities (in particular many organic molecules and/or many small molecules) can adopt a variety of different solid forms such as, for example, amorphous forms and/or crystalline forms (e.g., polymorphs, hydrates, solvates, etc). In some embodiments, such entities may be utilized in any form, including in any solid form. In some embodiments, such entities are utilized in a particular form, for example in a particular solid form.

[0079] Specific: The term "specific", when used herein with reference to an agent or entity having an activity, is understood by those skilled in the art to mean that the agent or entity discriminates between potential targets or states (i.e., acts preferentially with respect to one or more potential target or state as compared with another). For example, an agent is said to bind "specifically" to its target if it binds preferentially with that target in the presence of competing alternative targets. In some

embodiments, the agent or entity does not detectably bind to the competing alternative target under conditions of binding to its target. In some embodiments, the agent or entity binds with higher on-rate, lower off-rate, increased affinity, decreased dissociation, and/or increased stability to its target as compared with the competing alternative target(s).

[0080] Stable: The term "stable," when applied to compositions herein, means that the compositions maintain one or more aspects of their physical structure and/or activity over a period of time under a designated set of conditions. In some embodiments, the period of time is at least about one hour; in some embodiments the period of time is about 5 hours, about 10 hours, about one (1) day, about one (1) week, about two (2) weeks, about one (1) month, about two (2) months, about three (3) months, about four (4) months, about five (5) months, about six (6) months, about eight (8) months, about ten (10) months, about twelve (12) months, about twenty- four (24) months, about thirty-six (36) months, or longer. In some embodiments, the period of time is within the range of about one (1) day to about twenty-four (24) months, about two (2) weeks to about twelve (12) months, about two (2) months to about five (5) months, etc. In some embodiments, the designated conditions are ambient conditions (e.g., at room temperature and ambient pressure). In some embodiments, the designated conditions are physiologic conditions (e.g., in vivo or at about 37 °C for example in serum or in phosphate buffered saline). In some embodiments, the designated conditions are under cold storage (e.g., at or below about 4 °C, -20 °C, or -70 °C). In some embodiments, the designated conditions are in the dark.

[0081] Subject: By "subject" it is meant a mammal (e.g., a human, in some embodiments including prenatal human forms). In some embodiments, a subject is suffering from a relevant disease, disorder or condition. In some embodiments, a subject is susceptible to a disease, disorder, or condition. In some embodiments, a subject displays one or more symptoms or characteristics of a disease, disorder or condition. In some embodiments, a subject does not display any symptom or characteristic of a disease, disorder, or condition. In some embodiments, a subject is someone with one or more features characteristic of susceptibility to or risk of a disease, disorder, or condition. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. In some embodiments, a subject is an individual to whom therapy is administered.

[0082] Substantially: As used herein, the term "substantially" refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and/or proceed to completeness or achieve or avoid an absolute result. The term

"substantially" is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena. [0083] Suffering from: An individual who is "suffering from" a disease, disorder, or condition has been diagnosed with and/or exhibits or has exhibited one or more symptoms or characteristics of the disease, disorder, or condition.

[0084] Susceptible to: An individual who is "susceptible to" a disease, disorder, or condition is at risk for developing the disease, disorder, or condition. In some embodiments, such an individual is known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition does not display any symptoms of the disease, disorder, or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition has not been diagnosed with the disease, disorder, and/or condition. In some embodiments, an individual who is susceptible to a disease, disorder, or condition is an individual who has been exposed to conditions associated with development of the disease, disorder, or condition. In some embodiments, a risk of developing a disease, disorder, and/or condition is a population-based risk (e.g., family members of individuals suffering from allergy, etc.

[0085] Symptoms are reduced: According to the present invention, "symptoms are reduced" when one or more symptoms of a particular disease, disorder or condition is reduced in magnitude (e.g., intensity, severity, etc.) and/or frequency. For purposes of clarity, a delay in the onset of a particular symptom is considered one form of reducing the frequency of that symptom.

[0086] T cells: By "T cells" is meant a group of white blood cells that play a role in immune responses and contain a T cell receptor at the cell surface. T cells maybe of the subset of helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, and/or gamma delta T cells.

[0087] Therapeutic agent: As used herein, the phrase "therapeutic agent" refers to any agent that has a therapeutic effect and/or elicits a desired biological and/or pharmacological effect, when administered to a subject. In some embodiments, an agent is considered to be a therapeutic agent if its administration to a relevant population is statistically correlated with a desired or beneficial therapeutic outcome in the population, whether or not a particular subject to whom the agent is administered experiences the desired or beneficial therapeutic outcome.

[0088] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" means an amount that is sufficient, when administered to a population suffering from or susceptible to a disease, disorder, and/or condition in accordance with a therapeutic dosing regimen, to treat the disease, disorder, and/or condition. In some embodiments, a therapeutically effective amount is one that reduces the incidence and/or severity of, and/or delays onset of, one or more symptoms of the disease, disorder, and/or condition. Those of ordinary skill in the art will appreciate that the term "therapeutically effective amount" does not in fact require successful treatment be achieved in a particular individual. Rather, a therapeutically effective amount may be that amount that provides a particular desired pharmacological response in a significant number of subjects when administered to patients in need of such treatment. It is specifically understood that particular subjects may, in fact, be "refractory" to a "therapeutically effective amount." To give but one example, a refractory subject may have a low bioavailability such that clinical efficacy is not obtainable. In some embodiments, reference to a therapeutically effective amount may be a reference to an amount as measured in one or more relevant tissues (e.g., a tissue affected by the disease, disorder or condition) or fluids (e.g., blood, saliva, serum, sweat, tears, urine, etc). Those of ordinary skill in the art will appreciate that, in some embodiments, a therapeutically effective amount may be formulated and/or administered in a single dose. In some embodiments, a therapeutically effective amount may be formulated and/or administered in a plurality of doses, for example, as part of a dosing regimen.

[0089] Therapeutic regimen : A "therapeutic regimen", as that term is used herein, refers to a dosing regimen whose administration across a relevant population is correlated with a desired or beneficial therapeutic outcome.

[0090] Three dimensional representation: As used herein, the term " three dimensional representation" refers to converting the lists of structure coordinates into structural models or graphical representation in three-dimensional space. In some embodiments, the three dimensional structure may be displayed or used to performing computer modeling or fitting operations. In some embodiments, the structure coordinates themselves, without the displayed model, may be used to perform computer-based modeling and fitting operations.

[0091] Treating: By "treating" it is meant obtaining beneficial or desired results, such as clinical results. Beneficial or desired results can include, but are not limited to, alleviation or amelioration of one or more symptoms or manifestations of a disease, disorder, or condition;

diminishment of extent of disease, disorder, or condition; stabilization (i.e., not worsening) of a state of disease, disorder, or condition; prevention of spread of disease, disorder, or condition; delay or slowing the progress of the disease, disorder, or condition; amelioration or palliation of the disease, disorder, or condition; and remission (whether partial or total), whether detectable or undetectable. In general, treating involves administering an agent as described herein, according to a therapeutic regimen that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of, and/or reduces frequency, incidence or severity of one or more symptoms, features, and/or causes of a relevant disease, disorder, and/or condition. Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition. Alternatively or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. In some embodiments, treatment may be of a subject who has been diagnosed as suffering from the relevant disease, disorder, and/or condition. In some embodiments, treatment may be of a subject who is susceptible to the disease, disorder, or condition in that s/he is known to have one or more susceptibility factors that are statistically correlated with increased risk of development of the relevant disease, disorder, and/or condition.

[0092] T-t pe Calcium Channel Modulator: By "T-type calcium channel modulator" it is meant an agent that increases or decreases a level and/or activity of a T-type calcium channel, for example by altering one or more of gene expression (including transcription, post-transcriptional processing, transcript localization or packaging, etc), protein expression (including translation, folding, degradation, post-translational processing or modification, localization, etc), and/or activity (e.g., ability to transport calcium across the plasma membrane, to achieve membrane polarization, and/or to initiate or maintain downstream signaling), compared to an appropriate control or reference. In some embodiments, such increase or decrease is a change of at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%, as compared to the control or reference. T-type calcium channel modulators include activators or inhibitors of T-type calcium channels. T-type calcium channel modulators can be identified, tested, and/or characterized by any useful methods in the art and/or described herein.

[0093] T-t pe Calcium Channel: By "T-type calcium channel" is meant a type of voltage- operated calcium channel wherein the length of channel activation is transient and the channel contains an l subunit which determines the properties of the channel.

[0094] Voltage-Operated Calcium Channel: By "voltage-operated calcium channel" is meant a calcium channel activated by voltage, distinct from a ligand-gated calcium channel and synonymous with a voltage-activated calcium channel and a voltage-gated calcium channel.

Brief Description of the Drawing

[0095] Figures 1A-1E show CaV3.1 expression in T cells and localization to the plasma membrane. Figures 1A-B show CaV3.1 expression as measured by quantitative RT-PCR in CD4+ T cells isolated from murine lymph nodes, spleen and thymus, in EL-4 T cells, in murine splenic CD4+ T cells, cerebrum, and cerebellum. Figure 1C shows CaV3.1 protein detection in pooled splenic and lymph node CD4+ T cells as a band of the expected size (-250 kD) by cell lysis, immunoprecipitation and immunoblotting with an anti-CaV3.1 antibody (anti-CaV3.1). Figure ID shows CaV3.1 expression at the surface of splenic CD4+ T cells by biotinylation of intacT cells followed by purification on avidin beads, then blotting with anti-CaV3.1 Ab (upper panel) or anti-GATA-3 as control for a strictly intracellular protein (lower panel). B indicates the biotinylated cell surface fraction isolated on avidin beads; N indicates the non-labeled flow-through fraction. Figure IE shows relative expression of the CaV3.1, CaV3.2, and CaV3.3 message in wild-type, CaV3.1 -/- and CaV3.1 ΔΤ mice. CaV3.1 deletion induces compensation with increased expression of CaV3.2 and CaV3.3 in CD4+ T cells, as assessed by quantitative RT-PCR.

[0096] Figures 2A-2E are results showing that the signature current for T-type channels is present in wild-type CD4+ T cells and reduced in constitutively CaV3.1 -/- CD4+ T cells. Figure 2A is a plot showing whole-cell patch clamp recordings of wild-type (WT) CD4+ cells (n= 17) and CaV3.1 -/- CD4+ T cells (n=19). Currents were activated using 10 mV voltage steps lasting 250 ms applied every 2 sec from a holding potential of -90 mV. Average I/V relationships are displayed. Recordings in both cell types were made in the absence or presence of the T-type channel inhibitor, mibefradil (1 μΜ). The bath solution contained 10 mM Ca²⁺. Only seal resistances greater than 16 GO were accepted for initiation of recordings. Figure 2B are representative recordings at the -30 mV voltage step displayed for all conditions. Currents were 13.3 ± 1.38 pA in wild-type versus 6.95 ± 1.10 pA in CaV3.1 -/- cells at -30 mV without mibefradil. Figure 2C is a plot showing the time constant (τ) of voltage-dependent inactivation of currents in CD4+ T cells elicited by voltage steps from a holding potential of -90 mV. Data represent means ± SEM from 7 wild-type and 8 CaV3.1 -/- cells. Figure 2D is a plot showing that store operated Ca²⁺ entry triggered by treatment with thapsigargin (TG; 2 μΜ) is unaffected in CaV3.1 deficient CD4+ cells. Cells were loaded with Fluo-4 AM and analyzed on a Flipr 96-well imaging system (means + SEM from 16 wells for each genotype from 3 independenT cell preparations). Figure 2E is a plot showing that calcium entry induced by TCR engagement is not affected by CaV3.1 deficiency. CD4+ T cells were stimulated with an anti-CD3 antibody and no differences in the amplitude or time course of calcium influx were observed between cells from wild-type and CaV3.1 ΔΤ animals. CD4+ T cells from CaV3.1 ΔΤ and wild-type littermates were loaded with indo-1 AM and biotinylated anti-CD3. The cells were analyzed by flow cytometry at baseline and after activation with streptavidin.

Representative of 3 experiments.

[0097] Figures 3A-3D show that CaV3.1 -/- and CaV3.1 ΔΤ animals are resistant to experimental autoimmune encephalomyelitis (EAE). Eight CaV3.1 -/- mice and seven wild-type littermates were immunized at day 0 with myelin oligodendrocyte glycoprotein (MOG), complete Freund adjuvant, and pertussis toxin. Figure 3A is a plot showing the EAE score and Figure 3B is a plot showing the body weight measured daily (means +/- SEM). Fourteen CaV3.1 ΔΤ mice and 16 wild-type littermates were immunized at day 0. Premature euthanizations of four wild-type littermates of CaV3.1 ΔΤ mice are necessary due to complete paralysis. Figure 3C is a plot showing the EAE score and Figure 3D is a plot showing the body weight measured daily (means +/- SEM).

[0098] Figures 4A-4D show the reduction in Thl7 cell population and in RORyt expression in

CaV3.1 ΔΤ cells. In vitro Thl7 differentiation of splenocytes from wild-type (n=7) and CaV3.1 ΔΤ (n=6) mice after EAE induction. Differentiation entailed a 5-day treatment with Thl7-skewing conditions. Representative data are shown for wild-type in Figure 4A and CaV3.1 ΔΤ in Figure 4B. A summary plot is shown in Figure 4C, p=0.002. Figure 4D shows that RORyt expression induced by Thl7 skewing is decreased in CaV3.1 ΔΤ cells. Whole-cell lysates of pooled splenocytes are collected from wild-type (n=4) and CaV3.1 ΔΤ (n=4) mice. Representative of two experiments.

[0099] Figures 5A-5C shows that anti-CaV3.1 antibody recognizes CaV3.1. Figure 5A are blots showing full-length CaV3.1 or vector control myc -tagged cDNAs transiently transfected into 293 cells. Overexpressed proteins are detected in whole cell lysates via immunoprecipitation and

immunoblotting (IP) and immunobloting (blot) with anti-CaV3.1 or anti-myc. Figure 5B are blots showing the specificity of the anti-CaV3.1 antibody confirmed using cerebellum and cerebrum isolated from CaV3.1 -/- and wild-type littermate mice. Figure 5C is a blot showing that no shorter splice variant is present in cerebellum from CaV3.1 deficient mice. Total protein tissue lysates of cerebellum from wild-type and CaV3.1 -/- cerebellum were analyzed by immunoblotting with anti-CaV3.1 antibody or anti-GAPDH antibodies to verify equal protein loading.

[00100] Figures 6A-6C show the generation of constitutive CaV3.1 -deficient mice. Figure 6A are schematics showing a targeting construct designed to knockout the pore region of CaV3.1 using a neomycin cassette to replace exons 1 1 to 13. Figure 6B shows targeted disruption of the CaV3.1 gene verified by Southern blotting, and Figure 6C shows a PCR gel of genomic DNA isolated from candidate mice.

[00101] Figures 7A-7C show that the signature current for CaV3 channels is present in wild-type

CD4+ T cells and reduced in constitutively CaV3.1 -/- CD4+ T cells. Figures 7A-7B are plots showing the current/voltage (I/V) relationships of currents recorded from 17 wild-type cells and 19 CaV3.1-/- cells. Figure 7C is a graph showing peak currents (means ± SEM) recorded from 17 wild-type cells, and 19 CaV3.1-/- cells.

[00102] Figure 8 shows a plot of the voltage-dependent kinetics of activation. Time constant (τ) of voltage-dependent activation of currents in CD4+ T cells elicited by voltage steps from a holding potential of -90 mV. Data represent means ± SEM from 7 wild-type and 8 CaV3.1 -/- cells. [00103] Figures 9A-9B show that thymic and splenic T cells isolated from CaV3.1 -/- mice display normal development and have similar rates of proliferation compared to wild-type cells.

Thymocytes and splenocytes were isolated from wild-type and CaV3.1 -/- mice and analyzed by flow cytometry for surface expression of various T cell specific antigens. Figure 9A are plots showing that the percent of CD4+ CD8+ and CD4+ CD8- thymocytes are indistinguishable between wild-type and CaV3.1 -/- mice. Figure 9B are plots showing that CD4+ cells from wild-type and CaV3.1 -/-spleens had similar rates of proliferation. Results are representative of 6 wild-type and 6 CaV3.1 -/- mice.

[00104] Figures 10A-10D show that CaV3.1 -/- mice are equally sensitive in an asthma model.

Figure 10A shows an anti-OVA serum IgE response in OVA immunized wild-type and CaV3.1 -/- mice induced with asthma by challenge with OVA or saline. Figure 10B shows pulmonary resistance (PR) after acetylcholine challenge, Figure IOC shows broncho-alveolar lavage cellularity, and Figure 10D shows lung inflammation are similar in wild-type and CaV3.1 -/- mice (n=20 each, of which 10 OVA, 10 saline).

[00105] Figures 11A-11B are histologic analyses of EAE mice showing minimal lesions in

CaV3.1 -deficient mice. Figure 11A is a histologic analysis by hematoxylin and eosin staining of spinal cords (upper panels) and cerebellum (lower panels) in wild- type (left) and CaV3.1 -/- (right) mice.

Figure 1 IB is a histologic analysis of spinal cords in wild-type (left) and CaV3.1 ΔΤ (right) mice.

Within each genotype the panel on the right is an enlarged view of the framed area in the left image. Characteristic perivascular inflammatory infiltrates were observed in both sets of wild-type animals.

[00106] Figure 12 shows a reduction in Thl7 cell population in EAE-na^'ive CaV3.1 ΔΤ animals in in vitro experiments of Thl7 differentiation of naive splenocytes from wild-type and CaV3.1 ΔΤ mice (n=4 each, p=0.02).

[00107] Figure 13 shows an exemplary timecourse of mRNA expression of Cav3.1 during Thl7 differentiation at 3, 6, 12, 24, 48 and 96 hours.

[00108] Figure 14 depicts an exemplary dose response curve showing a T-type calcium channel antagonist, here TTA-A2, inhibiting T-type calcium current as a function of antagonist concentration.

[00109] Figure 15 shows an exemplary graph demonstrating the pharmacological effects of a T- type calcium channel modulator in an animal model of multiple sclerosis, EAE.

Detailed Description of Certain Embodiments

[00110] The present invention encompasses the recognition that the source of a problem in the development of therapeutic modalities for the treatment of lymphocyte-associated diseases, disorders and conditions is the limited knowledge of appropriate druggable targets active on immune (e.g., lymphocyte) cells. The present invention solves this problem by identifying certain T-type calcium channels (e.g., Cav3.1 and/or Cav3.2 and/or Cav3.3 channels) as present and active on particular lymphocytes (e.g., T cells and specifically na^'ive T cells and Thl7 cells). The present invention further specifically demonstrates ability of T-type calcium channel modulators (e.g., selective T-type calcium modulators as described herein) to impact level and/or activity of T-type calcium channels on immune cells in tissues and/or organs (e.g., spleen).

[00111] The present invention encompasses the specific recognition of a problem associated with treating diseases, disorders and conditions associated with activity of Thl7 cells. Thl7 cells are thought to play a key role in autoimmune diseases (such as multiple sclerosis, psoriasis, autoimmune uveitis, juvenile diabetes, rheumatoid arthritis, and Crohn's disease in particular), and specifically to play a role in inflammation and tissue injury in these conditions. Thl7 cell activity can cause severe autoimmune diseases, but is also important for maintaining anti-microbial immunity, particularly at epithelial / mucosal barriers. Thl7 cells produce cytokines (such as interleukin 22) which stimulate epithelial cells to produce anti-microbial proteins to clear out certain types of microbe (such as Candida and

Staphylococcus). Thus, insufficient Thl7 cell activity may leave the host susceptible to opportunistic infections. The present invention encompasses the recognition that one source of a problem associated with treating such diseases, disorders, and conditions associated with Thl7 cell activity is the substantial absence of identified targets involved Thl7 cell differentiation and/or activity. For example, the present invention appreciates that, while the Retinoic Acid Receptor gamma (RORy) transcription factor is known to participate in Thl7 cell differentiation and/or activity, it is difficult target safely and/or effectively. The present recognition defines and appreciates a need for draggable target(s) in or on na^'ive T cells and/or Thl7 cells, preferably on the surface of such cells. The present invention solves this problem and addresses this need by demonstrating, among other things, that certain T-type calcium channels (e.g., Cav3.1 and/or Cav3.2 and/or Cav3.3 channels) are present and active on na^'ive T cells and Thl7 cells, and furthermore are involved in Thl7 cell differentiation. The present invention therefore provides compositions and methods relevant to modulating (e.g., specifically modulating) T-type calcium channels active in na^'ive T cells and Thl7 cells, and therefore unexpectedly provides technologies relevant to Thl7- associated diseases, disorders and conditions including, for example, multiple sclerosis, psoriasis, multiple myeloma, etc.

[00112] The present invention also specifically demonstrates that modulation of T-type calcium channel activity can achieve therapeutically relevant effects in models of lymphocyte-associated diseases disorders and conditions (e.g., in an EAE model of multiple sclerosis). The present disclosure particularly establishes relevance of modulating Cav3.1 channels (whose activity is shown herein to be dominant relative to other T-type calcium channels such as, e.g., Cav3.2 and Cav3.3, at least on lymphocyte cells such as T cells, e.g., na^'ive T cells and/or Thl7 cells).

[00113] Findings of the present invention are particularly surprising in light of the art-established perspective that, to the extent that calcium channels are present and active on T cells, the important calcium channels are calcium release-activated channels (CRAC) channels. CRAC channels are known to play a role in the activity of certain T cells; they are not believed to be involved in helper T cell differentiation (see, for example, Shaw et al Front Biosci (Elite Ed). 2012 Jan 1 ;4:2253, Jan 2012). The activity of CRAC channels is not voltage-dependent.

[00114] The inventive demonstration of T-type calcium channel activity on lymphocyte cells, is particularly valuable and beneficial because, prior to the present disclosure, T-type calcium channel activity was thought to be most relevant in CNS cells and events. Thus, although T-type calcium channel modulators have previously been pursued by others, efforts have typically been focused on agents that cross the blood brain barrier and/or that are effective in the treatment of CNS disorders such as epilepsy and pain (see, for example, Zhang et al Biochim Biophys Acta 1828(7): 1550, July 2013; Uslaner et al., Neuropharmacology 62(3): 1413, March 2012). T-type calcium channel modulators for use in accordance with the present invention, however, need not (and in many embodiments do not, or are administered such that they do not) cross the blood brain barrier and/or have any significant therapeutic effect with respect to pain, epilepsy, schizophrenia, and/or sleep disorders. The present invention therefore surprisingly establishes uses for T-type calcium channel modulators that do not cross the blood- brain barrier and/or do not have any significant therapeutic effect with respect to CNS disorders such as, for example, pain, epilepsy, schizophrenia, and/or sleep disorders. Indeed, in some embodiments, the present invention provides and/or utilizes T-type calcium channel modulators that do not reach and/or are not active with respect to CNS cells, and thus surprisingly teaches compositions and methods specific to non-CNS T-type calcium channels and/or to lymphocyte -related diseases, disorders or conditions that do not involve (or whose features that are treated herein do not involve) neurons and/or CNS cells, tissues, organs and/or systems. The present invention also surprisingly establishes methods and compositions for using T-type calcium channel modulators in non-CNS (e.g., peripheral) and/or non-neuronal settings, including particularly methods and compositions for peripheral (e.g., not-CNS targeted) delivery, including local delivery of such modulators.

[00115] The specific utility demonstrated herein for modulation of only the CaV3.1 subtype of T- type calcium channels is particularly surprising and unexpected in light of prior art focus on Cav3.2 modulation, which is thought to be relevant to treatment of pain, for example. [00116] Still further, the invention surprisingly overcomes various challenges often associated with detection, characterization, and or modulation of voltage-dependent channels, and particularly of T- type voltage-gated calcium channels (e.g., Cav3.1 channels). For example, the technical difficulty that can be associated with electrophysiologically recording activity of such channels in cells is recognized in the field, which includes at least one published report of a researcher driven to fabricate

electrophysiological data, presumably in light of the challenges and significance associated with obtaining it (see Badou et al. Science 307: 1 17, 2005).

[00117] Specific surprising findings exemplified in the present disclosure include, for example the

CaV3.1 channel is expressed and functional as a channel in T cells, carrying the dominant current relative to the other T-type channels, CaV3.2 and CaV3.3. Further surprising findings include that targeted reduction of CaV3.1 channel expression in T cells inhibits the autoimmune response in the experimental autoimmune encephalomyelitis model. Still further surprising findings include that this targeted CaV3.1 deficiency leads to a lower proportion of Thl7 cells and a reduction in the expression of RORyt, a transcription factor critical to Thl7 differentiation, in CaV3.1 -deficient cells stimulated in Thl7-favoring conditions, whereas no effects of CaV3.1 deficiency were observed on TCR-mediated calcium entry. Still further surprising findings include demonstrated effects of T-type channel modulation in immune cells in organs, specifically spleen. These data provide, among other things, the first evidence of T-type calcium channels in immune cells, identify the unanticipated predominance of the CaV3.1 subtype, identify an unanticipated role for CaV3.1 in T cell differentiation into the Thl7 subset, and show the existence of a TCR-independent, CaV3.1 -mediated source of calcium influx in T cells that is active in the range of resting membrane potentials. The present invention thererefore establishes, among other things, that a potential therapeutic approach for autoimmune and other diseases and conditions is through T-type calcium channels of subtype CaV3.1.

Voltage-Gated Calcium Channels

[00118] Innumerable biological processes share calcium as a signaling molecule (e.g., as a second messenger). Calcium crosses cell membranes by passing through either ligand-gated or voltage-gated calcium channels. Voltage-operated calcium channels are subdivided into L, N, P/Q, R, and T types based on their sensitivity to particular blocking agents. T-type calcium channels are known to be preferentially expressed in dendrites, and are believed to be involved in synaptic integration (see, for example, Nelson et al. Curr Pharm. Des. 12:2189, 2006) and nociception (see, for example, Todorovic et al. Br,. J. Pharmacol. 163:484, 2011). Significant effort has been invested therefore in the development of selective T-type calcium channel regulators for the treatment of pain (see summary in Todorovic et al., which is incorporated herein by reference in its entirety).

[00119] T-type calcium channels are uniquely characterized by their low activation thresholds. T- type currents typically activate at about -70 mV, and inactivate rapidly (τ of about 15-30 ms) (see, for example, review by Perez-Reyes Physiol Rev 88 : 1 17, 2003 , incorporated herein by reference in its entirety).

[00120] Most previous work on T-type calcium channels has focused on their roles in neuronal cells and pathways, including in pain signal transmission and in brain rhythms involved in sleep and in certain forms of epilepsy (see review by Cheong and Shin Physiol Rev 93:961, 2013). The present invention, by contrast, encompasses the insight that the T-type calcium channel activation threshold of about -70 mV is near the resting potential of lymphocytes, whose average membrane potential has been measured to be between -60 and -55 mV. The present inventors hypothesized that T-type calcium channels, if present in lymphocytes, could play important roles, potentially independent of T cell receptor engagement, and investigated the presence of, and potential roles for, T-type calcium channels in T cells, with a focus on CaV3.1. As described herein, the present invention establishes, among other things, that T-type calcium channels are in fact present and active on lymphocyte cells, and in particular on T cells such as naive T cells and Thl7 cells. Moreover, the present invention establishes that modulation of T- type calcium receptor activity, and particularly of CaV3.1 activity, is relevant in a certain lymphocyte- associated diseases, disorders and conditions, including particularly in multiple sclerosis.

Lymphocyte-Associated Diseases, Disorders and Conditions

[00121] Those skilled in the art will appreciate that a variety of diseases, disorders and conditions are associated with (e.g., caused by) lymphocyte cell (e.g., T cell) activity. For example, autoimmune diseases are typically attributable to action of lymphocytes against host cells, tissues, or components. Many inflammatory diseases, disorders, or conditions similarly are associated with and/or caused by lymphocyte activity. Certain infectious diseases may also be exacerbated by inappropriate or ineffective lymphocyte action; the same is true for a variety of cancers. For example, some cancers (e.g., T cell cancers) involve aberrant lymphocyte proliferation. Some cancers (as well as other diseases, disorders or conditions as would be appreciated by those skilled in the art) might effectively be inhibited or treated if lymphocytes could be stimulated or otherwise encouraged or supported to attack them. Those skilled in the art will readily recognize a variety of other contexts in which modulation (i.e., increase or decrease) in lymphocyte activity could achieve a desired therapeutic effect with respect to initiation, development, progression, and/or severity of one or more diseases, disorders, or conditions. Any such disease, disorder or condition may be considered to be a lymphocyte-associated disease, disorder, or condition in certain embodiments of the present invention.

[00122] In some embodiments, lymphocyte -related diseases, disorders, or conditions (and/or those aspects of it treated by administration of a T-type calcium channel modulator [e.g., a selective T- type calcium modulator] as described herein) relevant to the present disclosure involve cells, tissues, organs and/or systems other than the CNS; in some such embodiments, such diseases, disorders, or conditions do not significantly involve CNS cells, tissues, organs and/or systems. In some particular embodiments, neurons are not involved. In some embodiments, however, neurons and/or one or more CNS cells, tissues, organs and/or systems is involved. In some embodiments, T-type calcium channel modulators utilized as described herein do not affect, and/or are administered so that an effective amount is not delivered to, neurons and/or to one or more CNS cells, tissues, organs and/or systems. In other embodiments, however, T-type calcium channel modulators utilized as described herein do affect, and/or are administered so that an effective amount is delivered to, neurons and/or to one or more CNS cells, tissues, organs and/or systems.

[00123] In some embodiments, lymphocyte -related diseases, disorders, or conditions (and/or those aspects of it treated by administration of a T-type calcium channel modulator [e.g., a selective T- type calcium modulator] as described herein) relevant to the present disclosure involve immune cells in the spleen.

[00124] In some embodiments, lymphocyte-associated diseases, disorders or conditions relevant to the present disclosure are autoimmune diseases, particularly diseases characterized by or associated with uncontrolled or inappropriate Thl7 activation, such as arthritis, multiple sclerosis, psoriasis, and lupus. Non-limiting examples of autoimmune diseases include, acute disseminated encephalomyelitis (ADEM), Addison's disease, agammaglbulinemia, alopecia areata, amyotrophic lateral sclerosis, ankylosing spondylitis, antiphospholipid syndrome, antisynthetase syndrome, atopic allergy, atopic dermatitis, autoimmune aplastic anemia, autoimmune cardiomyophathy, autoimmune enteropathy, autoimmunehemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune peripheral neuropathy, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune

thrombocytopenic purpura, autoimmune urticaria, autoimmune uveitis, Balo concentric sclerosis, Behcet's disease, Berger's disease, Bickerstaff s encephalitis, Blau syndrome, bullous pemphigoid, Castleman's disease, celiac disease, Chagas disease, chronic inflammatory demyelinating

polyneuropathy, chronic recurrent multifocal osteomyelitis, chronic obstructive pulmonary disease, Churg- Strauss syndrome, cicatricial pemphigoid, Cogan syndrome, cold agglutinin disease, complement component 2 deficiency, contact dermatitis, cranial arteritis, CREST syndrome, Crohn's disease, Cushing's syndrome, cutaneous leukocytoclastic vasculitis, Dego's disease, Dercum's disease, dermatitis herpetiformis, dermatomyositis, diabetes mellitus type 1, diffuse cutaneous systemic sclerosis, Dressier' s syndrome, drug-induced lupus, discoid lupus erythematosus, eczema, endometriosis, enthesitis-related arthritis, eosinophilic fasciitis, eosinophilic gastroenteritis, epidermolysis bullosa acquisita, erythema nodosum, erythroblastosis fetalis, essential mixed cryoglobulinemia, Evan's syndrome, fibrodysplasia ossificans progressive, fibrosing alveolitis, gastritis, gastrointestinal pemphigoid, gianT cell arteritis, glomerulonephritis, Goodpasture's syndrome, Grave's disease, Guillain-Barre syndrome, Hashimoto's encephalopathy, Hashimoto's thyroiditis, Henoch-Schonlein purpura, herpes gestationis, hidradenitis suppurativa, Hughes-Stovin syndrome, hypogammaglobulinemia, idiopathic inflammatory demyelinating diseases, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura, IgA nephropathy, inclusion body myositis, chronic inflammatory demyelinating polyneuropathy, interstitial cystitis, juvenile idiopathic arthritis, Kawasaki's disease, Lambert-Eaton myasthenic syndrome, leukocytoclastic vasculitis, lichen planus, lichen sclerosus, linear IgA disease, lupus erythematosus, Majeed syndrome, Meniere's disease, microscopic polyangiitis, mixed connective tissue disease, morphea, Mucha-Habermann disease, myasthenia gravis, myositis, narcolepsy, neuromyelitis optica, neuromyotonia, ocular cicatricial pemphigoid, opsoclonus myoclonus syndrome, Ord's thyroiditis, palindromic rheumatism, PANDAS, paraneoplastic cerebellar degeneration, paroxysmal nocturnal hemoglobinuria, Parry Romberg syndrome, Parsonage-Turner syndrome, pars planitis, pemphigus vulgaris, pernicious anaemia, perivenous encephalomyelitis, POEMS syndrome, polyarteritis nodosa, polymyalgia rheumatic, polymyositis, primary biliary cirrhosis, primary sclerosing cholangitis, progressive inflammatory neuropathy, psoriatic arthritis, pyoderma gangrenosum, pure red cell aplasia, Rasmussen's encephalitis, raynaud phenomenon, relapsing polychondritis, Reiter's syndrome, restless leg syndrome, retroperitoneal fibrosis, rheumatic fever, Schnitzler syndrome, scleritis, scleroderma, serum sickness, Sjogren's syndrome,

spondyloarthropathy, stiff person syndrome, subacute bacterial endocarditis, Susac's syndrome, Sweet's syndrome, sympathetic ophthalmia, Takayasu's arteritis, temporal arteritis, thrombocytopenia, Tolosa- Hunt syndrome, transverse myelitis, ulcerative colitis, undifferentiated connective tissue disease, undifferentiated spondyloarthropathy, vitiligo, and Wegener's granulomatosis.

[00125] In some embodiments, lymphocyte-associated diseases, disorders or conditions relevant to the present disclosure are not classically considered autoimmune diseases. Non-limiting examples include: allergic asthma, hay fever, bee venom, allergy, food allergy, sarcoidosis, ankylosing, spondylitis, erythematosus, inflammatory bowel disease (e.g., ulcerative colitis), vasculitis, T cell lymphoma expressing ICOS, rejection of a transplanted organ or tissue, alopecia areata, atherosclerosis, bipolar disorder, schizophrenia, and graft-versus-host disease.

[00126] In some embodiments, lymphocyte-associated diseases, disorders or conditions relevant to the present disclosure are infectious diseases. Infectious diseases can be of fungal, viral, bacterial, and/or parasitic in origin. Examples of viral infectious diseases include, but are not limited to: HPV, AIDS, SARS, rabies, rubella, roseola, mumps, measles, norovirus, Lassa fever, yellow fever, poliomyelitis, conjunctivitis, viral hepatitis, dengue fever, common cold, influenza, viral meningitis, West Nile virus, viral pneumonia, viral encephalitis, smallpox, Colorado tick fever, viral gastroenteritis, roseola sixth disease, hepes simplex, cytomegalovirus infection, and Ebola haemorrhagic fever. Examples of bacterial infectious diseases include, but are not limited to: stye, MRS A, E.coli, typhus, plague, tetanus, cholera, anthrax, syphilis, pink eye, impetigo, botulism, tularemia, trachoma, chalazion, listeriosis, diphtheria, gonorrhea, Chlamydia, shigellosis, scarlet fever, tuberculosis, legionellosis, typhoid fever, Lyme disease, bacterial meningitis, and pertussis whopping cough. Examples of fungal infectious diseases include, but are not limited to: candidiasis, aspergillosis, blastomycosis, histoplasmosis, cryptococcosis, tinea cruris, tinea capitis, and tinea pedis. Examples of parasitic infectious diseases include, but are not limited to: malaria, scabies, filariasis, amebiasis, ascariasis, babesiosis, pediculosis, trichinellosis, leishmaniasis, toxoplasmosis, trichomoniasis, Chagas disease, schistosomiasis, trypanosomiasis, and cryptosporidiosis.

[00127] In some embodiments, lymphocyte-associated diseases, disorders or conditions relevant to the present disclosure are cancers. Non-limiting examples of cancers include: bladder cancer, breast cancer, colon and rectal cancer, endometrial cancer, kidney or renal cell cancer, leukemia, lung cancer, melanoma, Non-Hodgkin lymphoma, pancreatic cancer, prostate cancer, and thyroid cancer.

[00128] As discussed herein, the present disclosure specifically exemplifies effectiveness of T- type calcium channel modulation in models of multiple sclerosis. Those of ordinary skill in the art will appreciate that such findings have implications for a variety of other particular lymphocyte-associated diseases, disorders, and conditions including those known to be associated with Thl7 cells such as, for example, inflammatory bowel disease, multiple myeloma (see, for example, Noonan et al Blood

1 16:3554, 2010), and psoriasis, and also including relapsing-remitting multiple sclerosis in particular.

[00129] Those of ordinary skill in the art will also appreciate that animal models are available for a variety of lymphocyte-associated diseases, disorders and conditions; such models can be utilized to identify and/or characterize useful T-type calcium channel modulators as described herein, and particularly to assess their usefulness in treatment of the particular lymphocyte-associated diseases, disorders or conditions to which the particular model is relevant. [00130] To give but a few examples of animal models, the present disclosure exemplifies mouse models for experimental autoimmune encephalomyelitis (EAE). Exemplary other relevant models include, for example, animal models of relapsing-remitting multiple sclerosis (see, for example, McRae et al., J. Neurommunol 38(3):229, June 1992), psoriasis (see, for example, van der Fits et al., J Immunol ; 182:5836, 2009) and inflammatory bowel disease (see, for example, Neurath et al. Cancer. Dig Dis 30(suppl 1):91, 2012).

T-type calcium channel modulators

[00131] The present invention provides, among other things, various methods and compositions that relate to and/or include T-type calcium channel modulators. In some embodiments, such T-type calcium channel modulators are active with respect to T-type calcium channels on immune cells (e.g., on T cells such as na^'ive T cells and Thl7 cells). In some embodiments, such T-type calcium channel modulators are active with respect to T-type calcium channels in one or more primary lymphoid organs (e.g., the spleen). In some embodiments, such T-type calcium channel modulators are active with respect to T-type calcium channels in bone marrow.

[00132] In some embodiments, T-type calcium channel modulators for use in accordance with the present invention are selective T-type calcium channel modulators. In some embodiments, such modulators are selective and/or specific for (e.g., exhibit preferential activity with respect to) T-type calcium channels (e.g., for one or more of Cav3.1, Cav3.2, or Cav3.3 channels) as compared with other calcium channels, and/or for T-type calcium channels on immune cells (e.g., T cells such as na^'ive T cells and/or Thl7 cells) as compared with T-type calcium channels on other cell types (e.g., on CNS cells). In some embodiments, such modulators are selective and/or specific for T-type calcium channels on certain immune cells (e.g., in primary lymphoid organs) as compared with other immune cells (e.g., peripheral immune cells). In some embodiments, such modulators are selective and/or specific for a particular T- type calcium channel as compared with other T-type calcium channels (e.g., for Cav3.1 channels as compared with Cav3.2 and/or Cav3.3 channels), even in some instances as compared with other T-type calcium channels in or on immune cells. In some embodiments, T-type calcium channel modulators are selective for T-calcium channels as compared with other voltage-gated channels (e.g., such as L-type, N- type, P/Q-type, and/or R-type calcium channels).

[00133] In some embodiments, T-type calcium channel modulators are selective for cells, tissues, organs and/or systems other than the CNS; in some such embodiments, T-type calcium channel modulators do not significantly involve CNS cells, tissues, organs and/or systems. In some particular embodiments, T-type calcium channel modulators do not selectively or specifically impact neurons. In some embodiments, however, T-type calcium channel modulators do impact neurons and/or CNS cells, tissues, organs and/or systems if contacted therewith. In some embodiments of the present invention, such T-type calcium channel modulators are delivered to subjects via a route, regimen, modality, or mechanism that does not achieve delivery of an effective amount (e.g., and amount sufficient to alter level and/or activity of a T-type calcium channel therein so that a significant biological effect is observed).

[00134] In some embodiments, T-type calcium channel modulators are or comprise inhibitors. In some embodiments, T-type calcium channel modulators are or comprise activators.

[00135] In some embodiments, T-type calcium channel modulators as described herein have activities and/or are administered such that one or more effects (e.g., analgesia, pain relief) on neurons and/or CNS cells, tissues, organs and/or systems is not observed.

[00136] Among other things, T-type calcium channel modulators for use in accordance with the present invention may be identified and/or characterized with respect to their activity (including, for example, with respect to the specificity, magnitude, and/or nature of their effect(s), for example relative to one or more appropriate references or controls) on T-type calcium channels as described herein. In general, one or more candidate T-type calcium channel modulating agents is contacted with a system comprising in which one or more T-type calcium channels found in or on lymphocyte cells is active, and assessing impact of the agent on level and/or activity of the T-type calcium channel, typically relative to an appropriate reference or control (e.g., absence of the agent, presence of a different known modulator, specificity, magnitude, and/or nature of effect by the agent on a different calcium channel such as a different T-type calcium channel, for example active in or on different cells). Those skilled in the art will be aware of a variety of systems, including those described and/or exemplified herein, appropriate for such analyses.

[00137] In some embodiments, T-type calcium channel modulators are identified from collections or pools of candidate agents, for example including sets of candidate agents that are structural variants of one another. As will be apparent to those skilled in the art, in some embodiments, members of such collections or pools may be designed, for example, to share one or more structural features of a known T- type calcium channel modulator and/or to contain moieties in three dimensional space positioned appropriately for interaction with certain known target moieties (e.g., as determined with reference to three-dimensional structural models for example according to principles of structure based drug design).

[00138] In some embodiments, selective T-type calcium channel modulators may share certain structural attributes with agents or compounds that are not in and of themselves selective for T-type calcium channels. Of course, in many embodiments, agents or compounds that are not themselves selective are nonetheless useful in various embodiments of the invention that require or benefit from selectivity, as such agents may be utilized in a way (e.g., via local delivery) that permits them to perform with appropriate selectivity and/or specificity in context (e.g., because they are not exposed to their own competing targets). Alternatively or additionally, such agents or compounds that are not in and of themselves selective for relevant T-type calcium channels may be used as references in the design, identification, and/or characterization of selective compounds that share one or more structural features with them.

Antibodies

[00139] In some embodiments, T-type calcium modulators in accordance with the present invention are or include antibodies or fragments thereof.

[00140] Antibodies against T-type calcium channels can be made, e.g., using any of the methods for making antibodies to membrane proteins known in the art. In one example, antibodies can be generated by immunization with whole cells over-expressing the target protein. Membrane proteins can be displayed in their native conformation without mechanical or detergent disruption. Typically, stable murine cells expressing a human membrane protein are used to immunize mice. Improvements to this approach can involve selecting cells that have the highest expression level of the membrane protein of interest. Alternatively, membrane proteins can be solubilized and reconstituted in its structurally intact form into phospholipid vesicles and used as an immunogen in mice. In another method, simple peptides can be effective immunogens for deriving antibodies against linear epitopes. A variation to this approach, known as chemical linkage of peptides onto scaffolds (CLIPS), uses peptides to recreate individual conformational epitopes for immunization and is described in Timmerman et al., J Mol Recognit 20:283- 299, 2007. By constraining linear epitope sequences using cysteine linkages to mimic certain structured conformations that better represent the native proteins. Conformational antibodies to, for example, follicle-stimulating hormone (FSH) and G-protein coupled receptor CXCR7 have been generated using this method. As an alternate, Integral Molecular (Philadelphia, PA) has developed a method of presenting native membrane protein immunogens as Lipoparticle (Willis et al., Biochemistry 47:6988-6990, 2008). Lipoparticles are virus-like particles that incorporate high concentrations of target membrane proteins in their native conformation. The particles are produced from mammalian cells by co-expressing the retroviral structural core polyprotein, Gag, along with a desired membrane protein. The lipoparticles are approximately 150 nm in diameter, therefore are readily suspended in aqueous solutions that can be used for inoculation. In any of the above methods monoclonal antibodies can then be produced by standard hybridoma cell production. Once produced, monoclonal antibodies can also be tested for specific recognition by Western blot or immunoprecipitation analysis.

[00141] Antibodies selective and/or specific for the T-type calcium channel can be generated using the approach described in Naylor et al., The Open Drug Discovery Journal 1 :36-42, 2009. Briefly, the target T-type calcium channel (e.g., CaV3.1, Cav3.2, and Cav3.3) is selected and the amino acid sequence of the channel is obtained including information on any splice variants. A peptide, at least 20mer in length (e.g., 20mer, 25mer, 30mer, 35mer, 40mer, etc) based on the extracellular E3 loop, which maintains the position of the ion selectivity filter, is identified. The peptide sequence can be further selected to eliminate antigenicity and cross-species similarities (e.g., by comparing sequences between CaV3.1 , Cav3.2, and Cav3.3). An N- or C-terminal cysteine is added to the peptide if not naturally present in order to conjugate a support (e.g., KLH protein) to aide in affinity purification. The peptide is then used in standard immunization protocol, and antibody titre is determined by ELISA. Functional assays are then used to test the blocking activity of the antibody relative to controls such as preimmune antisera or peptide-adsorbed antibody. Antibodies with blocking effects are then tested for off-target effects on other ion transport mechanisms to validate any effects on cellular or tissue responses using independent methods (e.g., R Ai). Examples of polyclonal antibodies generated using this approach include, but are not limited to polyclonal antibodies targeted to the voltage-gated K⁺ channel Kvl .2 and Kv3.1, NESOpAb, targeted to voltage-gated sodium channel Navl.5, and D-III, pAb targeted to N- and P/Q- type voltage-gated calcium channels. Examples of monoclonal antibodies generated using the above approach include, but are not limited to the monoclonal antibody mAb56 targeted to the voltage-gated K⁺ channel, hEagl, and the anti-STIMl antibody targeted to the ion channel auxiliary protein STIM1.

Humanized antibodies

[00142] In some embodiments, antibodies for use in accordance with the present invention are humanized antibodies. Various methods for humanizing non-human antibodies are known in the art. For example, a humanized antibody can have one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed by substituting hypervariable region sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies, where substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non- human species. In practice, humanized antibodies are typically human antibodies in which at least some hypervariable region residues as well as other variable region residues are substituted by residues from analogous sites in rodent antibodies.

[00143] The choice of human variable domains, both light and heavy, to be used in making the humanized antibodies can be important to reduce antigenicity. According to the so-called "best- fit" method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable-domain sequences. The human sequence which is closest to that of the rodent is then accepted as the human framework for the humanized antibody. Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies.

[00144] In some embodiments, it is further generally desirable that antibodies be humanized with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, according to one method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three-dimensional models of the parental and humanized sequences. Three-dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues in the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the recipient and import sequences so that the desired antibody characteristic, such as increased affinity for the target antigen(s), is achieved. In general, the hypervariable region residues are directly and most substantially involved in influencing antigen binding.

Human antibodies

[00145] In some embodiments, antibodies for use in accordance with the present invention are human antibodies. Human antibodies can be constructed by combining Fv clone variable domain sequence(s) selected from human-derived phage display libraries with known human constant domain sequences(s). Alternatively, human monoclonal antibodies of the invention can be made by the hybridoma method. Human myeloma and mouse-human heteromyeloma cell lines for the production of human monoclonal antibodies have been described.

[00146] It is possible to produce transgenic animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire of human antibodies in the absence of endogenous immunoglobulin production. For example, it has been described that the homozygous deletion of the antibody heavy-chain joining region (JH) gene in chimeric and germ-line mutant mice results in complete inhibition of endogenous antibody production. Transfer of the human germ-line immunoglobulin gene array in such germ- line mutant mice will result in the production of human antibodies upon antigen challenge.

[00147] Gene shuffling can also be used to derive human antibodies from non-human, e.g., rodent, antibodies, where the human antibody has similar affinities and specificities to the starting non- human antibody. According to this method, which is also called "epitope imprinting," either the heavy or light chain variable-region of a non-human antibody fragment obtained by phage display techniques as described herein is replaced with a repertoire of human V domain genes, creating a population of non- human chain/human chain scFv or Fab chimeras. Selection with antigen results in isolation of a non- human chain/human chain chimeric scFv or Fab where the human chain restores the antigen binding site destroyed upon removal of the corresponding non-human chain in the primary phage display clone, i.e., the epitope governs (imprints) the choice of the human chain partner. When the process is repeated in order to replace the remaining non-human chain, a human antibody is obtained. Unlike traditional humanization of non-human antibodies by CDR grafting, this technique provides completely human antibodies, which have no FR or CDR residues of non-human origin.

Antibody fragments

[00148] In some embodiments, antibodies for use in accordance with the present invention are or include anti-T-type calcium channel antibody fragments that comprise a portion of an intact antibody, preferably comprising the antigen binding region and/or one or more complement determining regions (CDRs) thereof. Examples of antibody fragments include Fab, Fab', F(ab')2 , and Fv fragments;

diabodies; linear antibodies; single-chain antibody molecules; and multi-specific antibodies formed from antibody fragments.

[00149] Papain digestion of antibodies produces two identical antigen-binding fragments, called

"Fab" fragments, each with a single antigen-binding site, and a residual "Fc" fragment, whose name reflects its ability to crystallize readily. Pepsin treatment yields an F(ab')2 fragment that has two antigen- combining sites and is still capable of cross-linking antigen.

[00150] Fv is the minimum antibody fragment which contains a complete antigen-binding site. In one embodiment, a two-chain Fv species consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. In a single-chain Fv (scFv) species, one heavy- and one light- chain variable domain can be covalently linked by a flexible peptide linker such that the light and heavy chains can associate in a "dimeric" structure analogous to that in a two-chain Fv species. It is in this configuration that the three hypervariable regions (HVRs) of each variable domain interact to define an antigen-binding site on the surface of the VH-VL dimer. Collectively, the six HVRs confer antigen- binding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three HVRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.

[00151] The Fab fragment contains the heavy- and light-chain variable domains and also contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CHI domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group. F(ab') 2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[00152] Single-chain Fv or scFv antibody fragments comprise the V_H and V_L domains of antibody, where these domains are present in a single polypeptide chain. Generally, the scFv polypeptide further comprises a polypeptide linker between the V_H and V_L domains which enables the scFv to form the desired structure for antigen binding.

[00153] Diabodies are antibody fragments with two antigen-binding sites, which fragments comprise a heavy-chain variable domain (V_H) connected to a light-chain variable domain (V_L) in the same polypeptide chain (V_H-V_L). By using a linker that is too short to allow pairing between the two domains on the same chain, the domains are forced to pair with the complementary domains of another chain and create two antigen-binding sites. Diabodies may be bivalent or bispecific.

[00154] Antibody fragments may be generated by traditional means, such as enzymatic digestion, or by recombinant techniques. In certain circumstances there are advantages of using antibody fragments, rather than whole antibodies. The smaller size of the fragments allows for rapid clearance, and may lead to improved access to solid tumors. Various techniques have been developed for the production of antibody fragments. Traditionally, these fragments were derived via proteolytic digestion of intact antibodies. However, these fragments can now be produced directly by recombinant hosT cells. Fab, Fv, and ScFv antibody fragments can all be expressed in and secreted from E. coli, thus allowing the facile production of large amounts of these fragments. Antibody fragments can be isolated from the antibody phage libraries. Alternatively, Fab'-SH fragments can be directly recovered from E. coli and chemically coupled to form F(ab')2 fragments. In another approach, F(ab')2 fragments are isolated directly from recombinant hosT cell culture. Other techniques for the production of antibody fragments will be apparent to the skilled practitioner. RNAi agents

[00155] In some embodiments, T-type calcium modulators in accordance with the present invention are or include one or more RNAi agent(s) that inhibit T-type calcium channel gene expression and/or activity in a cell in vitro or in vivo (e.g., in a subject). In some embodiments, such RNAi agents can be or include different types of double- stranded molecules that include either RNA:RNA or

RNA:DNA strands. These agents can be introduced to (including by expression within) cells in a variety of structures, including a duplex (e.g., with or without overhangs on the 3 '-terminus), a hairpin loop, or an expression vector that express one or more polynucleotides capable of forming a double-stranded polynucleotide alone or in combination with another polynucleotide.

[00156] Exemplary RNAi agents include siRNA, shRNA, DsiRNA, and miRNA agents.

Generally these agents are about 10 to about 40 nucleotides in length, and preferred lengths for particular RNAi agents include siRNA that are double-stranded RNA molecules of 16 to 30 nucleotides in length (e.g., 18 to 25 nucleotides, e.g., 21 nucleotides); shRNA that are single- stranded RNA molecules in which a hairpin loop structure is present and a stem length is between 19 to 29 nucleotides in length (e.g., 19 to 21 nucleotides or 25 to 29 nucleotides) or a loop size is between 4 to 23 nucleotides in length; DsiRNA that are double-stranded RNA agents of 25 to 35 nucleotides in length; and miRNA that are single- stranded RNA molecules of 17 to 25 nucleotides (e.g., 21 to 23 nucleotides) in length.

[00157] In some embodiments, an RNAi agent can have any useful nucleic acid sequence, including a nucleic acid sequence having one or more DNA molecules, RNA molecules, or modified forms (e.g., a modified backbone composition or 2'-deoxy, or 2'-0-methyl modifications) or

combinations thereof. Alternatively or additionally, in some embodiments an RNAi agent can contain one or more 5'- and/or 3 '-terminal modifications. In some embodiments, an RNAi agent can include blunt nucleotides at one or both termini; in some embodiments, an RNAi agent can include one or more overhanging nucleotides at one or both termini. Exemplary terminal modifications include a 5'- dideoxythymidine overhang, such as for siRNAi; a 3'-UU or 3'-dTdT overhang, such as for shRNA; one or more G-U mismatches between the two strands of the shRNA stem; or a single-stranded nucleotide overhang at the 3 '-terminal of the antisense or sense strand of 1 to 4 nucleotides (e.g., 1 or 2 nucleotides) for DsiRNA.

[00158] Methods of producing antisense and sense nucleotides, as well as corresponding duplexes or hairpin loops, are known in the art and can be readily adapted to produce an antisense oligonucleotide that targets a particular desired target nucleic acid sequence. RNAi agents include at least one antisense nucleotide sequence that is directed to a target nucleic acid (e.g., a target gene, e.g., a T-type calcium channel gene). Antisense nucleotides are single strands of DNA or R A that are complementary to a chosen target sequence. In the case of antisense RNA, they prevent translation of complementary RNA strands by binding to it. Antisense DNA can be used to target antisense nucleotides contain from about 10 to about 40 nucleotides, more preferably about 15 to about 30 nucleotides. The antisense nucleotide can have up to 80%, 85%, 90%, 95%, 99%, or even 100% complementary to the desired target gene.

[00159] RNAi agents can include commercially available agents, such as those available from

OriGene Technologies (Rockville, MD), Santa Cruz Biotechnologies, Inc. (Santa Cruz, CA), Open Biosystems (Lafayette, CO), Invitrogen I (Carlsbad, CA), and Qiagen (Valencia, CA). RNAi agents can be designed to target a particular gene of interest using web-based prediction tools known in the art (e.g., Human siRNA Database (HuSiDa), and Genelink).

Small-molecule modulators

[00160] In some embodiments, T-type calcium modulators in accordance with the present invention are or include small molecules that alter level and/or activity of T-type calcium channels as described herein. In some embodiments, small-molecule modulators can include one or more compound(s) that enhance or inhibit the activity (e.g., membrane polarization, influx of calcium ions into the cell, and downstream signaling) of the channel by binding to the ¾ subunits (e.g., iG, iH, and ail) of various T-type calcium channels (e.g., CaV3.1, CaV3.2, CaV3.3). Alternatively or additionally, in some embodiments, small-molecule modulators can bind to other subunits that may make up the calcium channel, such as, the α2δ, β, and γ subunits, and to different states of the channels (e.g., depolarized (inactivated) state, and polarized (activated) state, hyperpolarized (closed) state, and open state).

[00161] In some embodiments, T-type calcium channel small-molecule modulators may be selected from the group consisting of diphenylbutylpiperidines derivatives (e.g., pimozide, penfluridol, clopimozide, and fluspirilene), butyrophenone derivatives (e.g., haloperidol, droperidol, benperidol, triperidol, melperone, lenperone, azaperone, and domperidone), and phenylpiperazine derivatives (e.g., antrafenine, aripiprazole, ciprofloxacin, dapiprazole, dropropizine, etoperidone, itraconazole, ketoconazole, levodropropizine, mepiprazole, naftopidil, nefazodone, niaprazine, oxypertine, posaconazole, trazodone, urpidil, and vesnarinone). Additional T-type calcium channel small-molecule inhibitors include dihydropyridine derivatives (e.g., manidipine, nilvadipine, benidipine, and efonidipine), flunarizine, anandamide, lomerizine, and phenytoin and zonisamide, and U-92032. [00162] In some embodiments, selective T-type calcium channel small-molecule modulators may be selected from the group consisting of tetralol, tetralol derivatives (e.g., mibefradil), mibefradil derivatives (e.g., N C 55-0396 dihydrochloride described in Quesada et al., Drug Metab Dispos.

36: 1291-9, 2008), those such as the Merck T-type antagonist (TTA) phenyl acetamides TTA-A2 described by Uebele and coworkers (Uebele et al., J Clin Invest. 1 19: 1659-1667, 2009) and TTA-A8, piperidines such as TTA-P1 and 4-aminomethyl-4-fluoropiperidine (TTA-P2) described in Shipe et al., J. Med. Chem. 51 :3692-3695, 2008; Dreyfus et al., J. Neurosci. 30:99-109, 2010, quinazolinones such as TTA-Q3 and TTA-Q6, and MK-8998, and those such as Z941 and Z944 of Zalicus described in Tringham et al., Sci Transl Med 4: 121ra29, 2012. Additional selective T-type calcium channel small-molecule inhibitors include succinimide anticonvulsant derivatives (e.g., ethosuximide, phensuximide, and mesuximide also known as methsuximide, and an active metabolite, N-desmethylmethsuximide also known as (alpha)-methyl-(alpha)-phenyl-succinimide), and R isomer of efonidipine. Other selective T- type calcium channel small-molecule inhibitors include trimethadione, its active metabolite dimethadione, ABT-639 of Abbott, TTL-1 177 of Tau Therapeutics also known as TH-1 177, , KYSO5044, , and, and kurtoxin.

[00163] In some embodiments, T-type calcium channel small-molecule modulators may be selected from the group consisting of those described in the patents and published patent applications listed in Giordanetto et al, "T-type calcium channels inhibitors: a patent review," Expert Opin Ther Pat, 21 :85-101, 201 1 (hereby incorporated by reference), including WO2004035000, WO9304047,

WO2006098969, WO2009009015, WO2007002361, WO2007002884, WO2007120729,

WO2009054982, WO2009054983, WO2009054984, US20090270413, WO2008110008,

WO2009146539, WO2009146540, US8, 133,998, WO2010083264, WO2006023881, and

WO2006023883, and WO2005007124, WO2005009392, US2005245535, WO2007073497,

WO200707852, WO2008033447, WO2008033456, WO2008033460, WO2008033464, WO2008033465, WO2008050200, WO20081 17148, WO2009056934, EP1568695, WO2008007835, KR754325,

US7319098, US20100004286, EP1757590, KR2009044924, US2010094006, WO2009035307,

US20090325979, KR75758317, WO2008018655, US20080293786, and US20100056545, each of which is hereby incorporated by reference.

[00164] As noted above, in some embodiments, T-type calcium channel small-molecule modulators for use in accordance with the present invention may be or include agents or compounds that are not in and of themselves selective for T-type calcium channels. Particular non-limiting examples of such compounds include, for instance, anandamide, antrafenine, benidipine, efonidipine, flunarizidine, fluspiriline, haloperidol, lomerizine, penfluridol, phenytoin, pimozide, U-92032, zonisamide (see, for example, Biton, Clin Neuropharmacol. 30:230, 2007; Matar et al., Epilepsy Res. 83:224, 2009).

Peptides

[00165] In some embodiments, T-type calcium modulators in accordance with the present invention are or include peptides or polypeptides. In some embodiments, such peptides share structural homology (e.g., one or more conserved sequence elements) with one or more subunits of the relevant T- type calcium channel (e.g., al, α2δ, β, and/or γ subunit(s)) and/or transmembrane domains of the T-type calcium channel (e.g., TM1, TM2, TM3, TM4, TM5, and TM6).

[00166] Non-limiting examples of peptide modulators include je TMla, LGLLVAIV; je TMla

SCR, LLILAVGV; γ₄ TMla, LTTAGAFA; γ₆ TMla G42T, LTLLVAIV; γ₆ TMla L41FL43F,

FGFLVAIV; γ₆ TMla V45FI47F, LGLLFAFV; γ₆ TMlb, VGATLAVL; γ₆ TMlb A50L, VGLTLAVL; γι TMla, VTLFFILA; y_l TMla T12GI16A, VGLFFALA and any described in Chen et al., Mol. Pharm. 75: 1042-51, 2009.

Pharmaceutical compositions

[00167] The present invention also relates to pharmaceutical compositions that contain one or more T-type calcium channel modulator(s) or a combination of a T-type calcium channel modulator and a second therapeutic agent (e.g., a combination of a T-type calcium channel modulator and a calcium channel modulator, an immunosuppressant, or an anticancer agent). Such compositions can be formulated for use in a variety of drug delivery systems. One or more physiologically acceptable excipients or carriers can also be included in the composition for proper formulation. Suitable formulations for use in the present invention are found in Remington 's The Science & Practice of Pharmacy, University of the Sciences in Philadelphia, PA, 21st ed., 2005. For a brief review of methods for drug delivery, see, e.g., Langer, Science 249: 1527-1533, 1990.

[00168] In some embodiments, pharmaceutical compositions are formulated for parenteral, intranasal, topical, oral, or local administration, such as by a transdermal means, for prophylactic and/or therapeutic treatment. The pharmaceutical compositions can be administered parenterally (e.g., by intravenous, intramuscular, or subcutaneous injection), or by oral ingestion, or by topical application or intraarticular injection at areas affected by the vascular or cancer condition. Additional routes of administration include intravascular, intra-arterial, intratumor, intraperitoneal, intraventricular, intraepidural, as well as nasal, ophthalmic, intrascleral, intraorbital, rectal, topical, or aerosol inhalation administration. Sustained release administration is also specifically included in the invention, by such means as depot injections or erodible implants or components. Thus, the invention provides compositions for parenteral administration that comprise the above mention agents dissolved or suspended in an acceptable carrier, preferably an aqueous carrier, e.g., water, buffered water, saline, PBS, and the like. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, detergents and the like.

[00169] In some embodiments, pharmaceutical compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. The resulting aqueous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration. The pH of the preparations typically will be between 3 and 1 1 , more preferably between 5 and 9 or between 6 and 8, and most preferably between 7 and 8, such as 7 to 7.5. Resulting

compositions in solid form may be packaged in multiple single dose units, each containing a fixed amount of the above mentioned agent or agents, such as in a sealed package of tablets or capsules. In some embodiments, compositions in solid form can also be packaged in a container for a flexible quantity, such as in a squeezable tube designed for a topically applicable cream or ointment.

[00170] In some embodiments, compositions containing an effective amount (e.g., compositions containing a unit dose amount appropriate for administration in an established effective dosing regimen) can be administered for prophylactic or therapeutic treatments. In prophylactic applications,

compositions can be administered to a patient with a clinically determined predisposition or increased susceptibility to development of an autoimmune disease, an infectious disease, a T cell-mediated disease, or a cancer.

[00171] In some embodiments, a pharmaceutical composition as described herein patient subject according to a dosing regimen that delivers an amount sufficient to delay, reduce, or preferably prevent the onset of clinical disease. In therapeutic applications, compositions are administered to a subject (e.g., a human) already suffering from an autoimmune disease, an infectious disease, other T cell-mediated disease, or a cancer in an amount sufficient to cure or at least partially arrest the symptoms of the condition and its complications. An amount adequate to accomplish this purpose is defined as a

"therapeutically effective dose," an amount of a compound sufficient to substantially improve some symptom associated with a disease or a medical condition. For example, in the treatment of an autoimmune disease, an infectious disease, a T cell-mediated disease, or cancer, an agent or compound which decreases, prevents, delays, suppresses, or arrests any symptom of the disease or condition would be therapeutically effective. A therapeutically effective amount of an agent or compound is not required to cure a disease or condition but will provide a treatment for a disease or condition such that the onset of the disease or condition is delayed, hindered, or prevented, or the disease or condition symptoms are ameliorated, or the term of the disease or condition is changed or, for example, is less severe or recovery is accelerated in an individual.

[00172] The compounds and formulations of the present invention may be used in combination with either conventional methods of treatment or therapy or may be used separately from conventional methods of treatment or therapy. When the compounds and formulations of this invention are administered in combination therapies with other agents, they may be administered sequentially or concurrently to an individual. Alternatively, pharmaceutical compositions according to the present invention include a combination of a compound or formulation of the present invention in association with a pharmaceutically acceptable excipient, as described herein, and another therapeutic or prophylactic agent known in the art.In some embodiments, formulated agents can be packaged together as a kit. Non- limiting examples include kits that contain, e.g., two pills, a pill and a powder, a suppository and a liquid in a vial, two topical creams, etc. In some embodiments, such a kit can include optional components that aid in the administration of the unit dose to patients, such as vials for reconstituting powder forms, syringes for injection, customized IV delivery systems, inhalers, etc. Alternatively or additionally, the unit dose kit can contain instructions for preparation and administration of the compositions. In some embodiments, a kit may be manufactured as a single use unit dose for one patient, multiple uses for a particular patient (at a constant dose or in which the individual compounds may vary in potency as therapy progresses); or the kit may contain multiple doses suitable for administration to multiple patients ("bulk packaging"). The kit components may be assembled in cartons, blister packs, bottles, tubes, and the like.

[00173] In some embodiments, pharmaceutical compositions in accordance with the present invention, and/or active agents included therein, may comprise and/or otherwise be associated with a targeting entity or moiety that assists in localizing the composition and/or agent, after delivery, to a site of interest (e.g., to immune cells having active T-type calcium channels). To give but a few examples, localization may be restricted to the periphery, and/or to non-neuronal and/or non-CNS locations, by which is meant areas of the body outside the blood-brain-barrier. In some embodiments, localization may be confined to a specific organ such as the spleen.

Combination Therapy

[00174] Pharmaceutical compositions of the invention can be administered in combination therapy, i.e., combined with other agents (e.g., immunosuppressants, other ion channel modulators, anticancer agents, anti-inflammatory agents, and/or pain relievers) depending on the condition to be treated.

Immunosuppressants

[00175] In some embodiments of the present invention, useful immunosuppressants include, but are not limited to, calcineurin inhibitors (e.g., cyclosporin A (SANDIMMUNE^®), cyclosporine G tacrolimus (PROGRAF^®, PROTOPIC^®)), mTor inhibitors (e.g., sirolimus (RAPAMUNE^®, NEORAL^®), temsirolimus (TORISEL^®), zotarolimus, and everolimus (CERTICAN^®)), fingolimod (GILENYA™), myriocin, alemtuzumab (CAMPATH^®, MABCAMPATH^®, CAMPATH- 1 H^®), rituximab (RITUXAN^®, MABTHERA^®), an anti-CD4 monoclonal antibody (e.g., HuMax-CD4), an anti-LFAl monoclonal antibody (e.g., CD1 la), an anti-LFA3 monoclonal antibody, an anti-CD45 antibody (e.g., an anti- CD45RB antibody), an anti-CD19 antibody (see, e.g., U.S. Patent Publication 2006/0280738), monabatacept (ORENCIA^®), belatacept, indolyl-ASC (32-indole ether derivatives of tacrolimus and ascomycin), azathioprine (AZASAN^®, IMURAN^®), lymphocyte immune globulin and anti-thymocyte globulin [equine] (ATGAM^®), mycophenolate mofetil (CELLCEPT^®), mycophenolate sodium

(MYFORTIC^®), daclizumab (ZENAPAX^®), basiliximab (SIMULECT^®), cyclophosphamide

(ENDOXAN^®, CYTOXAN^®, NEOSAR™, PROCYTOX™, REVIMMUNE™), prednisone, prednisolone, leflunomide (ARAVA^®), FK778, FK779, 15-deoxyspergualin (DSG), busulfan

(MYLERAN^®, BUSULFEX^®), fludarabine (FLUDARA^®), methotrexate (RHEUMATREX^®,

TREXALL^®), 6-mercaptopurine (PURINETHOL^®), 15-deoxyspergualin (Gusperimus), LF 15-0195, bredinin, brequinar, and muromonab-CD3 (ORTHOCLONE^®).

[00176] Cyclosporine A (CsA; CAS No. 59865- 13-3; U.S. Patent No. 3,737,433) and its analogs may be used as an immunosuppressant. A number of other cyclosporins and their derivatives and analogs that exhibit immunosuppressive activity are known. Cyclosporines and their formulations are described, for example, in 2004 Physicians' Desk Reference^® (2003) Thomson Healthcare, 58th ed., and U.S. Patent Nos. 5,766,629; 5,827,822; 4,220,641 ; 4,639,434; 4,289,851 ; 4,384,996; 5,047,396;

4,388,307; 4,970,076; 4,990,337; 4,822,618; 4,576,284; 5, 120,710; and 4,894,235.

[00177] Tacrolimus (FK506) is a macrolide which exerts effects largely similar to CsA, both with regard to its molecular mode of action and its clinical efficacy (Liu, Immunol. Today 14:290-5, 1993; Schreiber et al., Immunol. Today, 13: 136-42, 1992); however, these effects are exhibited at doses that are 20 to 100 times lower than CsA (Peters et al., Drugs 46:746-94, 1993). Tacrolimus and its formulations are described, for example, in 2004 Physicians' Desk Reference^® (2003) Thomson Healthcare, 58th ed., and U.S. Patent Nos. 4,894,366; 4,929,61 1 ; and 5, 164,495. [00178] Sirolimus (rapamycin) is an immunosuppressive lactam macrolide produceable, for example, by Streptomyces hygroscopicus. Numerous derivatives of sirolimus and its analogs and their formulations are known and described, for example, in 2004 Physicians' Desk Reference^® (2003) Thomson Healthcare, 58th ed., European Patent EP 0467606; PCT Publication Nos. WO 94/02136, WO 94/09010, WO 92/05179, WO 93/1 1 130, WO 94/02385, WO 95/14023, and WO 94/02136, and U.S. Patent Nos. 5,023,262; 5,120,725; 5, 120,727; 5,177,203; 5,258,389; 5, 1 18,677; 5,1 18,678; 5, 100,883; 5,151,413; 5,120,842; and 5,256,790.

Antioxidants

[00179] In some embodiments of the present invention, useful antioxidants include, but are not limited to, vitamin D, calcitriol, calcidiol, or other vitamin D receptor binder, quercetin or other flavonoid, resveratrol or other sirtuin modulator.

Anticancer agents

[00180] In some embodiments of the present invention, useful anticancer agents include, but are not limited to: chemotherapeutic agents (e.g., arsenic trioxide, cisplatin, carboplatin, chlorambucil, melphalan, nedaplatin, oxaliplatin, triplatin tetranitrate, satraplatin, imatinib, nilotinib, dasatinib, and radicicol), immunomodulatory agents (e.g., methotrexate, leflunomide, cyclophosphamide, cyclosporine A, minocycline, azathioprine, antibiotics (e.g., tacrolimus), methylprednisolone, corticosteroids, steroids, mycophenolate mofetil, rapamycin, mizoribine, deoxyspergualin, brequinar, T cell receptor modulators, and cytokine receptor modulators), antiangiogenic agents (e.g., bevacizumab, suramin, and

etrathiomolybdate), mitotic inhibitors (e.g., paclitaxel, vinorelbine, docetaxel, abazitaxel, ixabepilone, larotaxel, ortataxel, tesetaxel, vinblastine, vincristine, vinflunine, and vindesine), nucleoside analogs (e.g., gemcitabine, azacitidine, capecitabine, carmofur, cladribine, clofarabine, cytarabine, decitabine, floxuridine, fludarabine, fluorouracil, mercaptopurine, pentostatin, tegafur, and thioguanine), DNA intercalating agents (e.g., doxorubicin, actinomycin, bleomycin, mitomycin, and plicamycin), topoisomerase inhibitors (e.g., irinotecan, aclarubicin, amrubicin, belotecan, camptothecin, daunorubicin, epirubicin, etoposide, idarubicin, mitoxantrone, pirarubicin, pixantrone, rubitecan, teniposide, topotecan, valrubicin, and zorubicin), folate antimetabolites (e.g., pemetrexed, aminopterin, methotrexate, pralatrexate, and raltitrexed), and other targeting agents (e.g., agents that target particular enzymes or proteins involved in cancer or agents that target particular organs or types of cancers), and combinations thereof. Pain relievers

[00181] In some embodiments of the present invention, useful pain relievers include, but are not limited to: acetaminophen/paracetomol, non-steroidal anti-inflammatory drugs, COX-2 inhibitors, opiates, morphinomimetics, flupirtine, tricyclic antidepressants, (e.g., amitriptyline), nefopam, and

anticonvulsants (e.g., carbamazepine, gabapentin, and pregabalin), dual LOX/COX inhibitors, cannabinoid receptor antagonists, neurokinin antagonists, PAR2 receptor antagonists, iNOS inhibitors, vanilloid/TRPVl/capsaicin receptor antagonists, calcitonin gene -related antagonists, COX3 inhibitors, glycine antagonists, N-acetylcholine receptor antagonists, enkephalinase inhibitors, FAAH inhibitors, and other T-type calcium channel inhibitors.

[00182] As described herein, in some embodiments, T-type calcium modulators (e.g., selective T- type calcium modulators) utilized in accordance with the present invention are not pain relievers (e.g., are not analgesics). In some embodiments, such T-type calcium modulators lack significant effects (relative to an appropriate control) when administered to a model system for pain, and/or to one or more cells, tissues, organs or systems involved in or associated with pain or pain relief.

[00183] In some embodiments, T-type calcium modulators (e.g., selective T-type calcium modulators) utilized in accordance with the present invention do or can have pain relief activity. In some such embodiments, such modulators are administered such that pain relief activity is not observed. For example, in some embodiments, such T-type calcium channel modulators are delivered to subjects via a route, regimen, modality, and/or mechanism that does not achieve delivery of an effective amount (e.g., and amount sufficient to alter level and/or activity of a T-type calcium channel therein so that a significant biological effect is observed). In some embodiments, however, T-type calcium modulators as described herein are utilized to relieve pain.

Identifying Patients and/or Monitoring Therapy

[00184] The discoveries of the present invention provide a variety of technologies relating to identification and/or characterization of subjects in need of and/or receiving therapy for one or more lymphocyte-associated diseases disorders or conditions.

[00185] For example, in some embodiments, the present invention provides methods of identifying patients likely to benefit from therapy with T-type calcium channel modulators as described herein, for example by directly or indirectly determining level and/or activity of a T-type calcium channels active in immune cells (e.g., in lymphocytes such as T cells such as na^'ive T cells and/or Thl7 cells) and/or of a relevant population of immune cells (e.g., lymphocytes and in particular T cells such as Thl7 cells or other cells with active T-type calcium channels) in the subject by analyzing a sample obtained from the subject.

[00186] Analogously, in some embodiments, the present invention provides methods of assessing development, progression and/or treatment (e.g., responsiveness to therapy) of a relevant lymphocyte- associated disease, disorder or condition, in a subject for example by determining level and/or activity of a T-type calcium channel in or on immune cells (e.g., lymphocytes and in particular T cells such as naive T cells and/or Thl7 cells) and/or of Thl7 cells in the subject by analyzing a sample obtained from the subject. In some embodiments, the sample is obtained prior to, concurrent with, or subsequent to administration of one or more doses of a T-type calcium channel modulator as described herein. In some embodiments, such analyzing is performed on a plurality of samples from the subject, wherein different samples in the plurality were obtained at different points in time. In some embodiments, one or more doses of a T-type calcium channel modulator as described herein may be administered between such different points in time. In some embodiments, a decrease in level and/or activity of the relevant T-type calcium channel (e.g., of a CaV3.1 channel) and/or of Thl7 cells is indicative of slowed progression and/or effective treatment of the disease, disorder, or condition. In some embodiments, the invention provides methods for assessing the treatment of a lymphocyte-associated disease, disorder, or condition as described herein, by administering a selective T-type calcium channel modulator to a subject suffering from or susceptible to the disease, disorder, or condition and determining whether, after such

[00187] In some embodiments, a sample obtained from a subject includes peripheral immune cells. In some embodiments, a sample obtained from a subject includes tissue (e.g., spleen, bone marrow). Those of ordinary skill in the art will be aware of appropriate sources of cells or tissue for analysis in different circumstances (e.g., peripheral blood for analysis of proportion of Thl7 cells vs other T cell subsets, for example with respect to inflammatory disease, disorders or conditions; bone marrow for analysis relevant to multiple myeloma, etc).

[00188] Those of ordinary skill in the art will be aware of a variety of technologies useful to obtain and/or process samples from subjects and/or to determine level and/or activity of a T-type calcium channel active in immune cells (e.g., in lymphocytes such as T cells such as na^'ive T cells and/or Thl7 cells) and/or of a relevant population of immune cells in accordance with the present invention. To give but a few examples, well established technologies for determining protein levels include, for example, ELISA assays and/or other direct binding assays. Technologies for determining levels of nucleic acids encoding proteins (e.g., as a proxy for level of encoded proteins) include hybridization-based

technologies, amplification technologies (e.g., using polymerase chain reaction), sequencing technologies (including for example genomic sequencing technologies), etc. Technologies for determining activity of T-type calcium channels include, for example, whole-cell patch-clamp electrophysiology, calcium assays (e.g., FLIPR). Technologies for determining relative populations of Thl7 cells as compared with other T cell subsets, for example, include flow cytometry (FCM, e.g., FACS), measurement of transcription factor (e.g., RORgT) expression levels (e.g., by RT-PCR), detection (e.g., by intracellular staining) of cells producing particular proteins (e.g., the cytokine, IL-17), and assessment (e.g., by ELISA) of secreted protein (e.g., IL-17) levels.

EXAMPLES

Experimental Methods

Generation of Ca V3.1 -/- animals

[00189] A targeting construct was designed to knockout the pore region of CaV3.1 by using neomycin cassette to replace the exons 1 1 to 13. The targeting construct was transfected into 129/SvJ embryonic stem (ES) cells. Targeted ES clones were identified by southern blotting and used in the generation of germline chimeras. Heterozygous germ line mice (129/SvJ) were interbred to obtain homozygous mice. Male germline chimeras were also backcrossed with female C57BL/6 mice for three generations. Homologous recombination was verified by southern blotting, PCR and immunoblotting. Wild type and CaV3.1 knock out littermates (6-8 weeks) were used for phenotypic analysis. Animals were maintained at and the full barrier facility of the Center of Life Sciences which is fully accredited by AAALAC and the U.S. Department of Agriculture.

Generation of CaV3.1 AT animals

[00190] To generate animals with a T cell-specific CaV3.1 deficiency, constitutive CaV3.1 -/- mice were crossed with a transgenic strain expressing Cre under the control of the Lck promoter (B6.Cg- Tg(Lck-cre) 1 Cwi N9 mice from Taconic). The resulting pups that were CaV3.1+/- and transgenic for lck-Cre were crossed with a strain with two floxed 1 G alleles obtained from Matthew Anderson. The resulting pups that were CaV3.1 floxed/- and transgenic for lck-Cre should have a CaV3.1 deficiency limited to T cells. Their littermates negative for Cre were used as control. T cell preparation

[00191] Mouse thymus, spleen and lymph nodes were dissected from wild type and CaV3.1-/- and CaV3.1 ΔΤ mice. Cells in suspension were recovered. T cells were negatively enriched from pooled splenocytes and lymph node cells using a mouse pan T isolation kit (Miltenyi Biotec). CD4+ T cells were enriched using a mouse CD4+ T cell isolation kit (Miltenyi Biotec). All antibodies were purchased from BD Pharmingen. All recombinant cytokines were from PeproTech.

Quantitative real-time RT-PCR

[00192] Total RNA was extracted from different lymphoid tissues and cell types, then reverse transcribed. Multiplex quantitative real-time PCR was performed in ABI Prism 7700 Sequence Detector or 7500 Fast Real Time PCR System (Applied Biosystems). 18S control reagents were used to normalize the quantities of target genes.

Taqman primers and probes sequences

[00193] Mouse CaV3.1 had the following sequences:

5'- TGAGGCCAAGAGTTCCTTTGA -3' (sense) (SEQ ID NO: l)

5'- GAAGCCGACTTGCCATTACAG -3' (anti-sense) (SEQ ID NO:2)

6FAM TCGGAGCTCTGCCTCTGAACACCA TAMRA (probe) (SEQ ID NO: 3)

[00194] Sequences for mouse CaV3.2 were obtained from Life Technologies Mm00445382_ml .

Sequences for mouse CaV3.3 were obtained from Life Technologies MmOl 299033_ml.

Antibody generation

[00195] We designed a unique peptide located in the C terminus, CPGVEGPDSPDSPKPGA.

Rabbit polyclonal antibodies with reactivity to this sequence were generated by Invitrogen. This antibody was tested on human embryonic kidney cells (HEK 293) transfected with either a myc tagged cDNA for CaV3.1, or the empty vector. This anti-CaV3.1, or an anti-myc mAb, immunoprecipitated and immunoblotted a band of the expected size, about 250kD, from HEK293 cells transfected with CaV3.1, but not from HEK293 cells transfected with the empty vector (Figures 5A-5C).

CaV3.1 overexpression

[00196] The full-length cDNA encoding human CaV3.1 was subcloned into the pcDNA4TO- myc-his expression vector and transiently transfected into 293 cells. Control clones were generated in parallel with empty vector. CaV3.1 over-expression was verified by immunoblotting. Immunoblotting and immunoprecipitation

[00197] Cells were lysed in RIPA buffer and protease inhibitors. The lysates were separated by

3-8% SDS-PAGE, then blotted with the polyclonal anti- CaV3.1 antibodies and visualized by ECL detection (GE Healthcare). For immunoprecipitation (IP), polyclonal anti-CaV3.1 antibody or irrelevant rabbit IgG was bound to Dynabeads (Invitrogen) and then incubated with RIPA cell lysates. IPs were resolved on SDS-PAGE gels and proteins were detected by immunoblotting with antibodies as indicated.

Cell surface protein isolation

[00198] Cell surface proteins were isolated and purified with The Cell Surface Protein Isolation

Kit (Thermo Scientific Pierce) according to the manufacturer's suggestions.

Electrophysiology

[00199] Whole-cell patch clamp recordings were carried out using an Axopatch 200B and

Digidata 1440A (Axon Instruments). Only cells with tight seals (>16 GO) were selected to break in. Cells were maintained at a -90 mV holding potential during experiments. Immediately after establishing the whole-cell patch clamp configuration, voltage steps (10 mV increments from a holding potential of - 90 mV up to +50 mV) lasting 250 ms were applied every 2 s. The liquid-junction potential offset was around 4.3 mV and was corrected. Bath solution: 120 mM tetraethylammonium chloride, 10 mM CsCl, 10 mM CaCl₂, 10 mM HEPES (pH adjusted to 7.4 with CsOH). Pipette solution: 105 mM Cs- methanesulfonate, 10 mM Cs- 1 ,2-te-(2-aminophenoxy)ethane-N,N,N,N-tetraacetic acid (Cs-BAPTA), 5 mM CaCl₂, 8 mM MgCl₂, and 10 mM HEPES (pH adjusted to 7.2 with CsOH). Calculated buffered intracellular Ca²⁺ concentration is 150 nM using Maxchel software available online at

http://maxchelator.stanford.edu/. Clampfit 10.1 software was used for data analysis. Pipettes were pulled by a P-97 flaming/brown micropipette puller (Sutter Instrument Company) and polished with DMF1000 (World Precision Instruments). Resistances of filled pipettes ranged 2-3 ΜΩ.

Fluorometric Imaging Plate Reader Assay (FLIPR)

[00200] Cells were stained with fluo4 (4 μΜ) at 37 °C and 5% C0₂ for 1 h in cell culture medium, then washed with HBSS. The plate was then placed in the Fluorometric Imaging Plate Reader (FLIPR) instrument (Molecular Devices, Sunnyvale, CA, USA) where baseline fluorescence was recorded, then thapsigargin followed by calcium were added. Ca²⁺ entry was calculated relative to the baseline- subtracted signal derived from wells in Ca²⁺-free HBSS (F/F0). Flow cytometric measurement of calcium flux

[00201] Splenocytes suspended in HBSS buffer containing 1.25 mM calcium, 1 mM magnesium,

0.5% BSA were loaded with 2 mM Indo-1 mixed with Pluronic F-127 at 37°C for 45 minutes. The cells were washed and resuspended in HBSS buffer containing 1.25 mM Ca, 1 mM Mg and 0.5% BSA, then labeled with anti-CD4-FITC on ice for 30 min, and then washed and loaded with biotinylated anti-CD3 (10 μg/mL). The CD4+ cells were gated and analyzed on a Becton Dickinson LSRII with

FACSDivasoftware using the violet and blue channels. After measuring the baseline for 2 min, streptavidin (20 μg/mL) was added.

Asthma model

[00202] Twenty wild type mice and 20 gender-matched CaV3.1 -/- littermates, aged 6-8 weeks, were immunized intraperitoneally (IP) with 50 mg of ovalbumine (OVA) and 1 mg of alum at day 0, 7 and 14. The mice were challenged intranasally with 100 mg of OVA or buffer at day 21, 22 and 23. At day 24 lung function was measured in anesthetized and ventilated mice using a Scireq FlexiVent pulmonary mechanics analyzer. The parameters measured were pulmonary resistance and dynamic compliance. Mice were then euthanized with an overdose of pentobarbital and bronchoalveolar lavage (BAL) performed with PBS. BAL cells were pelleted, counted, and analyzed after Cytospin and Diff- Quik staining. BAL fluids were analyzed for cytokine content by ELISA. The lungs were harvested and processed for histological analysis.

EAE model

[00203] Wild type and CaV3.1 -/- and CaV3.1 ΔΤ female littermates aged 10- 12 weeks were used. At day 0 they were injected with myelin oligodendrocyte glycoprotein (MOG)/CFA emulsion (Hooke Laboratories) containing 1 mg/mL MOG35-55 and 2 mg/mL killed mycobacterium tuberculosis H37R in an oil emulsion, into two sites in the upper and lower back (100 μΐ per site) subcutaneously. Within 2 hours of these injections the mice were injected IP with pertussis toxin (165 ng in 100 ml PBS). The toxin injection was repeated 24h later. Mice were weighed and score daily using the following standard scale. 0: Normal, no signs of neurological disease. 1 : Flaccid paralysis of the tail; partial or no tail muscle tone. Mouse is unable to curl tail around finger or pencil. No significant gait abnormalities. 2: Hind limb paresis, weak or wobbling gait, impaired righting reflex. 3: Bilateral hind limb paresis. Mouse drags its hind limbs over flat surface. Mouse exhibits incontinence. 4: Hind and forelimb paralysis. Mouse barely moves around. 5: Complete hind and complete front leg paralysis, no movement. Mice were observed up to day 30. Mice were euthanized at the end of the experiment or earlier if they displayed severe paralysis or lost 20% weight, and scored 5 for remainder of experiment. Results from independent experiments were pooled.

Thl 7 cell differentiation

[00204] To skew T cell differentiation towards the Thl 7 phenotype, mouse spleen was dissected from wild type and CaV3.1 ΔΤ mice. Cells in suspension were recovered. Pooled splenocytes were cultured for 5 days in 96-well plates coated with anti-CD3 (145-2cl 1, 10 μg/mL) and soluble anti-CD28 (10 μg/mL) in the presence of 2.5 ng/mL human TGF-beta, 20 ng/mL IL-6, 10 ng/mL IL-23, 10 μg/mL anti-IFN-γ, and 10 μg/mL anti-IL-4 (murine, unless otherwise specified). CD4+ IL-17+ cell counts were performed.

Statistical analyses

[00205] Continuous data were compared between genotypes by the Wilcoxon rank-sum test.

Example 1: CaV3.1 is expressed on the surface of CD4+ T cells

[00206] We first investigated whether CaV3.1 is expressed in T cells. To assess CaV3.1 gene expression, we performed quantitative RT-PCR in primary CD4+ T cells from murine lymph nodes, spleen, and thymus, as well as in the EL-4 T cell lymphoma line. CaV3.1 was expressed in all of these T cell populations (Figure 1A), at expression levels lower than those observed in the brain (Figure IB). To assess CaV3.1 protein expression, we generated an antibody specific to CaV3.1, by selecting for antibodies reactive to a peptide unique to CaV3.1 among voltage-activated calcium channels. The specificity of this antibody was confirmed using multiple cell types from CaV3.1 -/- mice (Figures 5A). This anti-CaV3.1 antibody was used to assay lysates of CD4+ T cells by immunoprecipitation and immunoblotting. CaV3.1 protein was detected as a band of the expected size (-250 kD), which was absent after immunoprecipitation with normal IgG (Figure 1C). Therefore, CaV3.1 message and full- length CaV3.1 protein are indeed expressed in T cells.

[00207] To determine whether CaV3.1 is expressed at the plasma membrane in T cells, we performed surface biotinylation of murine CD4+ T cells followed by purification of biotinylated proteins on an avidin column. In the eluate of the avidin column a band of the expected size for CaV3.1 was identified after blotting with anti-CaV3.1, while blotting with an antibody against the strictly intracellular protein, Gata-3, was negative (Figure ID, lane B). In the flow-through, non-biotinylated fraction of the avidin column, both CaV3.1 and Gata-3 were detected (Figure ID, lane N). These results established that CaV3.1 is present on the surface of CD4+ T cells.

Example 2: Deletion of Ca V3.1 by homologous recombination

[00208] As tools for subsequent studies, we generated two strains of mice. Mice with a constitutive deletion of CaV3.1 were generated by homologous recombination (Figures 5B-5C and

Figures 6A-6C). These CaV3.1-/- mice were born with the expected frequency, did not display any gross abnormalities, developed normally, were of normal fertility, and could reach at least 17 months of age, findings similar to those reported for another strain of CaV3.1 -/- mice⁷. We also generated a mouse strain with a T cell-specific CaV3.1 deficiency ("CaV3.1 ΔΤ") through Cre-lox recombination, with Cre under the control of the Lck promoter. Using quantitative RT-PCR, we found a 60% reduction in CaV3.1 message in CD4+ T cells from CaV3.1 ΔΤ animals, as compared to the complete deficiency of message observed in cells from the constitutive CaV3.1 -/- animals (Figure IE). We found that CaV3.2 channels were also expressed in wild-type splenic CD4+ T cells, and that their expression was increased in CaV3.1 -/- cells; CaV3.3 expression was not detected in wild-type cells, but was detected in CaV3.1 -/- cells (Figure IE).

Example 3: CaV3.1 is a functional calcium channel in T cells [00209] We next assessed whether CaV3.1 in T cells acts as a functional channel, and if so whether it displays similar properties to that of CaV3.1 channels in other tissues. Whole-cell voltage- clamp recordings were conducted in primary splenic CD4+ T cells from wild-type mice. Without exception, currents displayed a uniquely T-type channel profile (summary data in Figure 2A, raw data in Figure 2B, Figure 2C, and Figures 7A-7C), with an activation threshold at -70 mV, a symmetric current/voltage (I/V) relationship, and rapid inactivation. The magnitude of the T-type current is significant, exceeding that of CRAC channels. In cells from CaV3.1 -/- littermates, the current was markedly reduced (Figure 2A). Treatment with mibefradil, a T-type-selective calcium channel inhibitor, almost completely reduced the current in cells from both wild-type and CaV3.1 -/- animals. The incomplete reduction of T-type currents in CaV3.1 -/- cells is likely due to compensatory expression of CaV3.2 and CaV3.3 channels (Figure IE). The slight rightward shift in the current-voltage curve in cells from CaV3.1 -/- cells is consistent with the appearance of CaV3.3 channels, whose peak currents occur at slightly higher potentials. Taken together, these data demonstrate that multiple T-type calcium channel subtypes are expressed and functional as channels in T cells and mediate a substantial current with a low activation threshold. Based on single-channel recordings, we estimate that a population of 200 to 400 T- type channels are expressed per T cells. Given the fast inactivation kinetics of the wild-type current with a time constant less than 30 ms at -40 mV, together with the data generated in CaV3.1 -/- cells, we believe that CaV3.1 is the predominant T-type channel subtype in wild-type T cells (cf. inactivation time constants: CaV3.1 (30 ms); CaV3.2 (47 ms), CaV3.3 (137 ms)).

[00210] We then investigated whether calcium influx via CaV3.1 channels might regulate or mediate signaling downstream of TCRs. We first used a standard method for activating CRAC channels, treatment with thapsigargin, an inhibitor of sarco/endoplasmic reticulum Ca²⁺ ATPase. Calcium influx triggered by thapsigargin was indistinguishable in CD4+ T cells from wild-type and CaV3.1 -/- littermates (Figure 2D). We next stimulated CD4+ T cells with an anti-CD3 antibody and again found no differences in calcium influx between wild-type and CaV3.1 -deficient cells. We therefore observed no role for CaV3.1 in TCR-mediated signaling.

Example 4: Ca V3.1 does not play a role in T cell maturation

[00211] We also explored a potential role for CaV3.1 in T cell maturation. We compared CD4 and CD8 expression profiles between WT and CaV3.1 -/- thymocytes and found no differences in thymic development (Figure 9A). Analysis of CD25+ CD44+ cells among the CD4- CD8- cells, as well as of the TCRaP expression pattern, further indicated normal staging of the maturation of CaV3.1 -/- thymocytes (Table 1). No significant differences in the expression of TCR, T cell co-stimulators, or T cell activation markers, including CD44, CD25, CD69, and CD62L, were observed between wild-type and CaV3.1 -/- CD4+ thymocytes, or in peripheral lymphocytes (Table 1). Nor were differences found in the rates of proliferation of naive CD4+ T cells (Figure 9B). Taken together, these results demonstrate that CaV3.1 does not play a role in the maturation of CD4+ or CD8+ T cells.

Table 1

Example 5: Ca V3.1 deficient mice are protected against experimental autoimmune encephalomyelitis (EAE)

[00212] To further investigate the role of CaV3.1, we conducted in vivo studies using two disease models, the Th2 -mediated asthma model, and the Thl7-mediated experimental autoimmune

encephalomyelitis (EAE) model. In the asthma model, wild-type and CaV3.1 -/- littermates were immunized with OVA and alum and challenged with OVA or saline. No differences were observed between animals across all parameters measured (Figures 10A-10D).

[00213] In the EAE model, animals were immunized with myelin oligodendrocyte glycoprotein peptide and followed for up to 32 days. With this protocol, all but one wild-type animal developed paresis, with some animals displaying remitting and relapsing symptoms. In contrast, CaV3.1 -/- mice were markedly resistant to EAE induction (Figures 3A-3D). In CaV3.1 -/- mice, paresis was delayed or absent (Figure 3A) and weight loss was reduced or did not occur (Figure 3B). Histology in wild-type mice showed multiple foci of inflammatory cells, in particular perivascularly, while such lesions were rare or absent in CaV3.1 -/- mice (Figures 11A-11B).

[00214] To assess whether the protection against EAE in constitutive CaV3.1 -/- mice was due to the absence of CaV3.1 in T cells, we conducted EAE studies using our CaV3.1 ΔΤ mice with the T cell- specific CaV3.1 deficiency. Even with the partial (60%) reduction in CaV3.1 message in CaV3.1 ΔΤ cells, CaV3.1 ΔΤ mice were also found to have markedly reduced EAE signs. In this experiment, it was necessary to prematurely euthanize four of 16 wild-type mice due to complete paralysis.

[00215] As with the CaV3.1 -/- mice, in CaV3.1 ΔΤ mice, paresis was delayed or absent (Figure

3D), weight loss was reduced or did not occur (Figure 3E), and no cases of complete paralysis occurred. Histology in wild-type mice showed multiple foci of inflammatory cells, in particular perivascularly, while such lesions were rare or absent in CaV3.1 ΔΤ mice (Figures 11A-11B). In addition, it was observed that those animals (primarily CaV3.1 -/- mice) that displayed lower levels of EAE signs typically had enlarged spleens. Without wishing to be bound by any particular theory, we propose that one possible explanation for this observation is that inhibition of CaV3.1 channels in lymphocytes in the spleen (and other lymphoid organs) may lead to sequestration of these lymphocytes in these lymphoid organs.

Example 6: CaV3.1 is involved in Th 17 differentiation

[00216] The resistance of both CaV3.1 -/- and CaV3.1 ΔΤ animals to EAE led us to investigate a potential role in Thl7 cells for CaV3.1 channels, since Thl7 cells are considered to be the major effector T cell population in EAE pathogenesis. We used an in vitro system to differentiate splenocytes into Thl7 cells, consisting of TCR ligands, TGFB, IL-6, and other cytokine receptor ligands. From splenocytes harvested from EAE-induced mice, we observed a 71% reduction in the proportion of Thl7 cells in CaV3.1 ΔΤ versus wild-type animals (Figures 4A-4C). Similarly, from splenocytes from EAE-nai^'ve mice, we observed a 47% reduction in the proportion of Thl7 cells in CaV3.1 ΔΤ versus wild-type animals (Figure 12).

[00217] We analyzed the expression in this Thl7 differentiation system of RORyt, a transcription factor critical to Thl7 differentiation. Splenocytes showed lower expression of RORyt in CaV3.1 ΔΤ cells versus wild-type cells (Figure 4D). Together with the lack of any observed interaction between CaV3.1 and either TCR-mediated calcium entry or CRAC channel modulation (Figures 2D-2E), these data suggest that CaV3.1 promotes T cell differentiation into the Thl7 subset, independently of TCR engagement.

[00218] We also assessed the timecourse of mRNA expression of Cav3.1 during the

differentiation of naive T cells in conditions favoring Thl7 differentiation. Naive CD4+ T cells were isolated from 4 WT mice spleen and lymph nodes. The naive CD4+ T cells were skewed to Thl7 cells for 3, 6, 12, 24, 48 and 96 hours. Total RNA was isolated and Cav3.1 was detected by RT-PCR using Taqman primers and probes. As shown in Figure 13, Cav3.1 mRNA levels were observed to drop between 12 and 24 hr following initiation of differentiating naive T cells to Thl7 cells. Without wishing to be bound by any particular theory, we propose that one possible explanation for this observation is that Cav3.1 may play the role of a differentiation "switch."

Example 7: Pharmacological inhibition of T-type calcium channels

[00219] Using a potent and selective T-type calcium channel antagonist known as TTA-A2 (see

Kraus et al J. Pharmacol. Exp Ther. 335(2): 409, 2010), we demonstrated pharmacological effects of such a T-type calcium channel activator on immune cells (specifically, CD4+ T cells).

[00220] In particular, we demonstrated that such a T-type calcium channel antagonist inhibited T- type calcium current as a function of antagonist concentration. As shown in Figure 14,

electrophysiological measurements of T-type calcium current in these cells was potently inhibited by TTA-A2, in a concentration-dependent manner.

[00221] We also demonstrated that such a T-type calcium channel modulator significantly impacted differentiation of Thl7 cells. Naive CD4+ T cells were pre-treated with TTA-A2 for 24 hours. Pre-treated cells were then differentiated to Thl7 cells for 4 days with continued drug treatment for 1 day. Then, after 4 days, intracellular cytokine staining was performed for IL-17F, a marker of Thl7 cell differentiation. We found that 61.4 ± 4.7 percent of untreated cells stained positive for IL-17F, whereas only 33.7 ± 5.8 percent of TT A- A2 -treated cells stained positive. These data showed that TTA-2 significantly inhibited Thl7 cell differentiation.

[00222] Still further, we demonstrated pharmacological effects of such a T-type calcium channel modulator in an animal model of multiple sclerosis, EAE. As shown in Figure 15 (average EAE scores over time: green triangles = Control; blue diamonds = TTA-A2), onset of significant symptoms (as reflected by EAE score) was delayed in animals treated with TTA-A2 (oral route, 10 mg/kg bid).

Moreover, maximum EAE score was dramatically (more than 50%) reduced, and observed score was lower following disease initiation.

[00223] Furthermore, from both groups of these EAE mice, i.e., TT A- A2 -treated and vehicle- treated, splenocytes were surface stained with anti-CD4-FITC, anti-CDld/aGalcer-PE, anti-TCRab-APC, anti-NKl .1 -APC-cy7 to analyze the proportion of invariant NKT (iNKT) cells. We observed that the proportion (in percent) of iNKT cells was higher in EAE mice treated with TTA-A2 (5.81 ± 0.81 1) vs with vehicle (4.03 ± 1.44), p = 0.036. Since iNKT cells have been observed by others to be protective in autoimmune diseases including multiple sclerosis (see, for example, Subleski et al. Immunotherapy 3(10): 1167-1 184. Oct 201 1), without wishing to be bound by any particular theory, enhancement of the iNKT population following T-type calcium channel inhibition could be an additional mechanism contributing to the amelioration of EAE symptoms and potentially of autoimmune diseases in general.

[00224] In conclusion, the data presented in this Example confirm that, as described herein, our results show for the first time that T-type calcium channels are expressed and functional as channels in T cells, in which CaV3.1 is the predominant subtype. Our results also show that CaV3.1 channels play a key role in Thl7 differentiation. The predominance of CaV3.1 in T cells and the marked effects of CaV3.1 inhibition on the autoimmune response in EAE, even in the face of some compensatory expression of other T-type calcium channels, suggest that therapeutic modulation of CaV3.1 -mediated signaling has the potential to rebalance T cell subsets in the context of autoimmune disease.

Other Embodiments

[00225] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure come within known or customary practice within the art to which the invention pertains and may be applied to the essential features hereinbefore set forth.

[00226] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

What is claimed is:

Claims

1. A method comprising steps of:

administering to a subject suffering from or susceptible to a lymphocyte-related disease, disorder, or condition a composition comprising a selective T-type calcium channel modulator in an amount sufficient to treat said disease, disorder, or condition.

2. The method of claim 1, wherein said selective T-type calcium channel modulator selectively targets CaV3.1.

3. The method of claim 1, wherein said selective T-type calcium channel modulator is a selective T- type calcium channel inhibitor which is ethosuximide, phensuximide, methsuximide, methyl- phenyl-succinimide, R isomer of efonidipine, trimethadione, dimethadione, mibefradil, TTA-A2, TTA-A8, TTA-P1, TTA-P2, TTA-Q3, TTA-Q6, MK-8998, Z941, Z944, ABT-639, TTL-1 177, KYSO5044, N C 55-0396 dihydrochloride, kurtoxin, or a derivative thereof, or is a selective T- type calcium channel inhibitor disclosed in Giordanetto F, Knerr L, Wallberg A. T-type calcium channels inhibitors: a patent review. Expert Opin Ther Pat. 21 :85-101, 201 1, or in any of WO2004035000, WO9304047, WO2006098969, WO2009009015, WO2007002361,

WO2007002884, WO2007120729, WO2009054982, WO2009054983, WO2009054984, US20090270413, WO20081 10008, WO2009146539, WO2009146540, US8,133,998,

WO2010083264, WO2006023881, or WO2006023883, or WO2005007124, WO2005009392, US2005245535, WO2007073497, WO200707852, WO2008033447, WO2008033456,

WO2008033460, WO2008033464, WO2008033465, WO2008050200, WO2008117148, WO2009056934, EP1568695, WO2008007835, KR754325, US7319098, US20100004286,

EP 1757590, KR2009044924, US2010094006, WO2009035307, US20090325979, KR75758317, WO2008018655, US20080293786, or US20100056545.

4. The method of claims 2 or 3, wherein said disease, disorder or condition is or comprises multiple sclerosis.

5. The method of claim 1, wherein said disease, disorder or condition is or comprises a Thl7- mediated autoimmune disease.

6. The method of claim 1, wherein said disease, disorder or condition is or comprises psoriasis.

7. The method of claim 1, wherein said disease, disorder or condition is or comprises multiple myeloma.

8. The method of claim 1, wherein said selective T-type calcium channel modulator selectively targets one or more T-type calcium channels in lymphocytes.

9. The method of claim 8, wherein said selective T-type calcium channel modulator selectively targets one or more T-type calcium channels in T cells.

10. The method of claim 8 or claim 9, wherein said selective T-type calcium channel modulator selectively targets CaV3.1.

1 1. The method of claim 9 or claim 10, wherein said selective T-type calcium channel modulator selectively targets one or more T-type calcium channels in naive T cells, Thl7 cells, and/or iNKT cells.

12. The method of any one of claims 9-1 1, wherein said selective T-type calcium channel modulator modulates T cell differentiation.

13. The method of claim 1, wherein said selective T-type calcium channel modulator is or comprises an anti-T-type calcium channel antibody, an RNAi agent, a small molecule, or a peptide.

14. The method of claim 13, wherein said selective T-type calcium channel modulator does not preferentially cross the blood brain barrier.

15. The method of claim 14, wherein said selective T-type calcium channel modulator does not substantially cross the blood brain barrier.

16. The method of claim 13, wherein said selective T-type calcium channel modulator is

preferentially distributed to part or all of the immune system, including bone marrow, thymus, lymphatic system, lymph nodes, spleen, and/or mucosal and cutaneous lymphoid tissues in the gastrointestinal tract, respiratory system, genitourinary system, and/or skin.

17. The method of claim 1, wherein said disease, disorder or condition is an autoimmune disease is selected from the group consisting of: amyotrophic lateral sclerosis, multiple sclerosis, rheumatoid arthritis, systemic lupus, psoriasis, diabetes mellitus type 1 , sympathetic ophthalmia, thrombocytopenia, inflammatory bowel disease (Crohn's disease, ulcerative colitis), Grave's disease, Hajimoto's thyroiditis, Sjogren's syndrome, autoimmune aplastic anemia, autoimmune cardiomyopathy, autoimmune enteropathy, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease, autoimmune lymphoproliferative syndrome, autoimmune myocarditis, autoimmune peripheral neuropathy, autoimmune pancreatitis, autoimmune polyendocrine syndrome, autoimmune progesterone dermatitis, autoimmune urticaria, and autoimmune uveitis, acute disseminated encephalomyelitis, ankylosing spondylitis,

dermatomyositis, eosinophilic fasciitis, fibromyalgia, Goodpasture's syndrome, Guillain-Barre syndrome, Miller- Fisher syndrome, Hashimoto's encephalopathy, idiopathic thrombocytopenic purpura, inflammatory myopathy, Kawasaki's disease, Lambert-Eaton myasthenic syndrome, myasthenia gravis, neuromyelitis optica (Devic's disease), neuromyotonia, osteoarthritis, pemphigus vulgaris, pernicious anaemia, polymyositis, primary biliary cirrhosis, progressive inflammatory neuropathy, psoriatic arthritis, Raynaud phenomenon, relapsing polychondritis, restless leg syndrome, sarcoidosis, scleroderma, stiff person (man) syndrome, temporal (giant cell) arteritis, transverse myelitis, undifferentiated connective tissue disease, vasculitis, vitiligo, Wegener's granulomatosis.

18. The method of claim 1, wherein said disease, disorder or condition is selected from the group consisting of: allergic asthma, hay fever, allergy, erythematosus, T cell lymphoma expressing ICOS, rejection of a transplanted organ or tissue, alopecia areata, atherosclerosis, and graft- versus-host disease.

19. The method of claim 1, wherein said disease, disorder or condition is selected from the group consisting of: erythematosus, T cell lymphoma expressing ICOS, rejection of a transplanted organ or tissue, alopecia areata, atherosclerosis, and graft-versus-host disease.

20. The method of claim 1, wherein said disease, disorder or condition is an infectious disease is selected from the group consisting of: lower respiratory infections, HIV/AIDS, diarrheal diseases, tuberculosis, malaria, measles, pertussis, tetanus, meningitis, syphilis, hepatitis B, and tropical diseases.

21. The method of claim 1 , wherein said disease, disorder or condition is a T cell cancer selected from the group consisting of T cell leukemia and T cell lymphoma.

22. The method of claim 1, wherein said amount sufficient is an amount sufficient to reduce the frequency of clinical exacerbations, and/or delay or prevent disease progression, rather than used to reduce the degree of pain or the degree of other clinical manifestations associated with said diseases or conditions.

23. The method of claim 1, wherein said method further comprises administering to said subject a second agent, and further wherein the amount sufficient is an amount of the selective T-type calcium channel modulator that is sufficient, when administered in combination with said second agent to treat said disease, disorder, or condition, which amount may be less than that required for the selective T-type calcium channel modulator to treat the disease, disorder or condition if administered alone.

24. The method of claim 23, wherein said second agent is or comprises another selective T-type calcium channel modulator, an antioxidant, an immunosuppressant, or an anticancer agent.

25. The method of claim 23, wherein said second agent is or comprises an immunosuppressant that is selected from the group consisting of: a calcineurin inhibitor, tacrolimus, an mTor inhibitor, fingolimod, myriocin, alemtuzumab, rituximab, an anti-CD4 monoclonal antibody, an anti-LFAl monoclonal antibody, an anti-LFA3 monoclonal antibody, an anti-CD45 antibody, an anti-CD 19 antibody, monabatacept, belatacept, indolyl-ASC; azathioprine, lymphocyte immune globulin and anti-thymocyte globulin [equine], mycophenolate mofetil, mycophenolate sodium, daclizumab, basiliximab, cyclophosphamide, prednisone, prednisolone, leflunomide, FK778, FK779, 15- deoxyspergualin, busulfan, fludarabine, methotrexate, 6-mercaptopurine, 15-deoxyspergualin, LF 15-0195, bredinin, brequinar, and muromonab-CD3.

26. The method of claim 23, wherein said second agent is or comprises an antioxidant that is selected from the group consisting of: vitamin D, calcitriol, calcidiol, or other vitamin D receptor binder, quercetin or other flavonoid, resveratrol or other sirtuin modulator.

27. The method of claim 23, wherein said second agent is or comprises an anticancer agent that is selected from the group consisting of: a chemotherapeutic agent, an antiangiogenic agent, a mitotic inhibitor, a nucleoside analog, a DNA intercalating agent, and a topoisomerase analog.

28. A method for assessing development, progression and/or treatment of a relevant lymphocyte- associated disease, disorder or condition in a subject, the method comprising:

determining a level and/or activity of a T-type calcium channel in or on immune cells (e.g., T cells such as naive T cells, Thl7, and/or iNKT cells) and/or of Thl7 cells and/or iNKT cells in the subject by:

analyzing a sample obtained from the subject.

29. The method of claim 28 wherein said immune cells are or comprise T cells.

30. The method of claim 29 wherein said immune cells are or comprise naive T cells, Thl7, and/or iNKT cells.

31. The method of claim 28 wherein said sample is obtained prior to, concurrent with, or subsequent to administration of one or more doses of a T-type calcium channel modulator.

32. The method of claim 28 wherein said step of analyzing is repeatedly performed, on a plurality of samples from the subject, wherein different samples in the plurality were obtained at different points in time.

33. The method of claim 32 further comprising one or more steps of administering a dose of a T-type calcium channel modulator, wherein different such steps of administering are performed between the different points in time.

34. A method for assessing the treatment of a lymphocyte-associated disease, disorder, or condition by: administering a selective T-type calcium channel modulator to a subject suffering from or susceptible to the disease, disorder, or condition; and

determining whether, after such administering, the frequency and/or severity of clinical exacerbations was reduced, extent of disease progression was delayed or prevented, and/or frequency and/or magnitude of one or more doses of a concomitant therapy was reduced.

35. A method for identifying or characterizing an agent for activity as a selective T-type calcium channel modulator by:

contacting the agent with a system comprising lymphocyte cells on which a T-type calcium channel is active; and

detecting a specific effect of the agent on level or activity of the T-type channel.