WO2014025254A1

WO2014025254A1 - Ebv markers and systemic lupus erythematosus

Info

Publication number: WO2014025254A1
Application number: PCT/NL2013/050581
Authority: WO
Inventors: Dirk Michiel PEGTEL
Original assignee: Stichting Vu-Vumc
Priority date: 2012-08-10
Filing date: 2013-08-06
Publication date: 2014-02-13
Also published as: WO2014025254A9

Abstract

The present invention relates to an in vitro method for diagnosis and/or determining severity of Systemic Lupus Erythematosus. The method determines presence and/or quantity of at least one EBV marker, preferably EBV-EBER and/or antibody against EBV antigen, in a sample obtained from a subject. The method may further be used to discriminate between Systemic Lupus Erythematosus, and rheumatoid arthritis.

Description

Title of the invention

EBV markers and Systemic Lupus Erythematosus Technical field

The present invention relates to an in vitro method for diagnosis and/or determining severity of Systemic Lupus Erythematosus. The method determines presence and/or quantity of specific markers in a sample obtained from a subject.

Background of the invention

Systemic Lupus Erythematosus (SLE) is a heterogeneous disease characterized by multisystem autoimmunity, that may lead to an array of different clinical presentations (see e.g. Buyon JP. Systemic Lupus Erythematosus. Primer on the Rheumatic Diseases 2008, 303-338). SLE patients experience serious and burdensome tissue damage in multiple organs, significantly affecting quality of life. Of these, kidney damage is one of the most serious manifestations. With lupus nephritis, the SLE attacks the kidney which may lead to kidney failure. To date, it is still unclear what triggers the immune deregulation in SLE.

Healthcare specialists are challenged by SLE as the diagnosis, monitoring, prognosis, and treatment options are diverse and highly complex. A series of tests need to be run searching for a set of SLE diagnostic criteria. The most significant test measures antinuclear antibodies (ANA) which are present in virtually all SLE patients. These antinuclear antibodies can bind endogenous targets within the nucleus of the body's own cells. However, specificity of ANA is low since ANA can be present in a number of different clinical conditions and even in normal controls, and ANA is not considered useful for monitoring SLE (Sinico et al. J Nephrol. 2002 Nov-Dec;15 Suppl 6:S20-7). Acknowledging the complexity of this disease, the American College of Rheumatology (ACR) has designated 1 1 diagnostic criteria (Hochberg, M.C. Updating the American college of rheumatology revised criteria for the classification of systemic lupus erythematosus, Arthritis & Rheumatism Volume 40, Issue 9, page 1725, September 1997). These criteria reflect the major clinical features of the disease (such as skin rash, sores in the mouth, arthritis in multiple joints, protein in the urine, seizures, low white blood cell counts/ low platelet counts) and incorporate the associated laboratory findings (e.g. blood tests). The presence of four or more criteria is indicative for SLE. However, they need not be present simultaneously: a single criterion such as arthritis or diagnosis can be confirmed by the appearance of additional features. Moreover, there is incomplete agreement among healthcare specialists as to whether these criteria are adequate in a practical setting (Buyon JP. Systemic Lupus Erythematosus. Primer on the Rheumatic Diseases 2008, 303-338).

In addition, a number of other diseases may be confused with (early) SLE, because they represent clinical and laboratory features similar to those seen in SLE. This applies in particular to rheumatoid arthritis (RA) (Majithia V, Geraci SA (2007). "Rheumatoid arthritis: diagnosis and management". Am. J. Med. 120 (1 1 ): 936-9), but may also apply to Multiple Sclerosis (MS) and Sjogren's syndrome. These difficulties make diagnosis, monitoring, and prognosis difficult and thereby complicate the choice of treatment, while SLE management options include the administration of drugs with seriously adverse side effects. Currently, corticosteroids and antimalarials are among the most widely used drug classes for treating SLE. In addition biologies such as Rituxan and immunosuppressants such as CellCept are also used. Without going into detail, these drug classes are related to adverse side effects and doubtful efficacy. Reliable diagnosis and prognosis is thus crucial for steering towards desired clinical outcome and minimizing exposure to toxic agents. This is affirmed by a 2008 survey by Datamonitor involving 180 rheumatologists from the US, France, Germany, U.K., Japan, Italy and Spain. A favorable situation would be the availability of an adequate tool for early patient stratification in the decision for treatment.

There remains a need for new methodology for diagnosis and monitoring SLE, which is less burdensome and/or more reliable in comparison with prior art methods. The present invention fulfils at least part of these and other needs. Summary of the invention

The present inventors surprisingly found an association between markers of Epstein Barr Virus (EBV) and Systemic Lupus Erythematosus (SLE).

In short, it was found that levels of EBV markers, in particular EBV non-coding RNAs (EBV- EBERs) and anti-EBV antibodies, are elevated in samples from SLE patients if compared to healthy individuals and rheumatoid arthritis patients. In addition, presence of EBV-EBERs in circulation and deposits in SLE nephritis tissue samples was found, suggesting that severity.

Together, these findings show that EBV markers can advantageously be used to determine presence and/or severity of SLE and/or SLE nephritis in a patient. Furthermore, these findings show that EBV marker levels can be used for monitoring SLE, i.e. determining progression /severity of SLE over time, which, for example, can be of help in determining success or failure of a particular treatment for SLE. In addition, it might be useful in establishing the best available treatment option(s). EBV marker levels can thus be used as a prognostic marker for Systemic Lupus Erythematosus (SLE) disease progression. EBV marker levels may be compared to standard values determined by analysing various samples, or may be compared to reference samples of patients known not to suffer from SLE (for example confirmed rheumatoid arthritis patients). As such, EBV marker levels can be used as an indicator predicting (or determining) presence and/or state of SLE in a patient. In addition, EBV marker levels can be used for distinguishing patients suffering from SLE from patients suffering from e.g. rheumatoid arthritis (RA).

The Epstein-Barr virus (EBV), also called human herpesvirus 4 (HHV-4), is a virus of the herpes family and is one of the most common viruses in humans. It is best known as the cause of infectious mononucleosis (see for further information on EBV Maeda et al 2009 Jpn J Radiol 27 (1 ): 4-19). Without being bound by any theory, the present inventors believe that EBV persistence is directly related to SLE pathogenesis. It is thought that EBV-EBERs bind to small nuclear ribonucleoproteins (snRNP) to form EBER-snRNP complexes, which may break the tolerance to these snRNPs. The EBER-snRNP complexes may activate pattern recognition receptors (PRRs) leading to the production of autoantibodies which in turn leads to interferon activation and SLE pathogenesis. PRRs are innate immune receptors that normally discriminate between self and non-self molecules, but aberrant activation can lead to auto-immunity.

As a result of exhausted T cell responses to EBV antigens, the level of circulating virus infected B cells may increase, leading to an increased presence and/or quantity of EBV (markers) which thereby directly relates to SLE progression. Detailed description of the invention

The present teaching relates to a method for diagnosis of Systemic Lupus Erythematosus (SLE), the method comprising: marker in a sample obtained from a subject, wherein said presence is indicative of a positive diagnosis of SLE and/or said quantity as compared to a reference value associated with non- SLE is indicative of a positive diagnosis of SLE.

In the method, determining presence and/or quantity of at least one EBV marker thus preferably refers to determining if the quantity of at least one EBV marker in a sample obtained from a subject is higher, preferably at least 1 %, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 40%, 50%, 75%, or 90% higher than the quantity of at least one EBV marker in an identical sample (e.g. in volume) obtained from a control subject (known as) not having SLE, or if compared to a reference value or standard based on measurements of multiple samples known to be (substantially) non-SLE. Alternatively, presence of at least one EBV marker may be established if the quantity of at least one EBV marker as determined in a sample obtained from a subject is beyond the measurement threshold, for example by using a method described in the Examples, or presence may be determined if the absolute quantity found in the sample is higher than e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, or 20 ng of at least one EBV marker per 250 μΙ (or mg) sample). The EBV marker may for example be chosen from the group consisting of EBV-EBER, and antibody against EBV antigen. The reference value associated with non-SLE as referred to in the method described above can be derived from samples from healthy, rheumatoid arthritis (RA), Multiple Sclerosis (MS) and/or Sjogren syndrome subjects, and increased presence of at least one EBV marker as compared to such reference value may be indicative of a positive diagnosis for SLE and at the same time a negative diagnosis for RA, MS, and/or Sjogren's syndrome.

The method according to the present teaching can thus advantageously be used to discriminate between Systemic Lupus Erythematosus (SLE), rheumatoid arthritis (RA), multiple sclerosis (MS), and/or Sjogren's syndrome. In this respect, presence and/or quantity of at least one EBV marker indicative of a positive diagnosis of SLE may also be considered as a negative diagnosis for RA, MS, and/or Sjogren's syndrome. Preferably, the present method can be used to discriminate between SLE and RA. Of course the method may at the same also be used to rule out SLE in case of absence of the at least one EBV marker (or lower presence compared to presence in reference samples obtained from SLE patients). The present teaching also can be used to diagnose severity of SLE and thus further relates to a method for determining severity of Systemic Lupus Erythematosus (SLE), the method comprising: subject, wherein said quantity as compared with at least one reference value associated with a particular SLE severity is indicative of (the degree of) severity of SLE. It was found that in fact the quantity of at least one EBV marker can indicate disease severity. In this respect, quantity may be the quantity of at least one EBV marker found in a sample obtained from a subject, as compared to an identical sample (e.g. in volume) taken from a control subject (known as) not having SLE, or to standards obtained my measuring multiple samples known to be related to specific disease severities. In this respect, a higher quantity as compared to for example the references stated above may be determined which may then be expressed such as 1 %, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50%, or 60% increased as compared to such reference, and an increased quantity of at least one EBV marker can indicate an increased SLE severity. The quantity may be expressed, for example as the number of EBV marker molecules per volume of sample, or concentration of at least one EBV marker in a sample, e.g. ng per 250 ml sample obtained from a subject, which may then be compared with reference value(s) linked to particular disease severities. The EBV marker may for example be chosen from the group consisting of EBV-EBER, and antibody against EBV antigen. Severity of SLE refers to the degree of underlying disease progression. Patients with SLE may perceive worsening of disease symptoms when the quantity of at least one EBV marker in their system increases. For example, perceived fatigue, or skin rash, or joint pain, lupus nephritis, or any other symptom related to SLE may increase (get worse). In line with this, patients with SLE may perceive relief of symptoms when the quantity of at least one EBV marker in their system decreases. However, the quantity of EBV marker(s) need not necessarily be directly related to perceived SLE symptoms, but they likely are.

In other words, the present teaching relates to a method for diagnosis and/or determining severity of Systemic Lupus Erythematosus (SLE), the method comprising determining presence/quantity (e.g. concentration or number) of at least one EBV marker (e.g. EBV- EBER, or antibody against EBV antigen) in a sample obtained from a subject, such as a human. The sample may be a nephritic (kidney) sample (which may be obtained such as described by Hergesell et al. 1998 Nephrol Dial Transplant 13:975-977), or preferably, as it is more practical, a body fluid sample such as a blood sample, blood plasma sample, blood serum sample, or a urine sample. A blood serum sample is particularly preferred because serum may better suit RNA extraction methods and/or (q)RT-PCR. Of course such a sample may be prepared to allow proper analysis or may be treated in any other way that still allows one EBV marker in the analyzed sample, for example with a method described in the Examples, can indicate the patient is or may be suffering from SLE. Comparably, the quantity of the at least one EBV marker in the analyzed sample may be indicative of severity of SLE.

In another aspect, the present teaching relates to a method for diagnosis of SLE nephritis, the method comprising:

a) determining presence and/or quantity of at least one Epstein Barr Virus (EBV) marker (e.g. EBV-EBER, or antibody against EBV antigen) in a nephritic or urine sample obtained from a subject, wherein said presence is indicative of a positive diagnosis of SLE nephritis and/or said quantity as compared to a reference value associated with non-SLE nephritis is indicative of a positive diagnosis of SLE nephritis.

SLE nephritis (or lupus nephritis) is a serious manifestation of SLE. The symptoms of lupus nephritis are generally related to hypertension, proteinuria, and renal failure. The World Health Organization has divided lupus nephritis into five classes based on the biopsy. This classification was defined in 1982 and revised in 1995 (Weening et al 2004 Am. Soc. Nephrol. 15 (2): 241-50):

- Class I is minimal mesangial glomerulonephritis which is histologically normal on light microscopy but with mesangial deposits on electron microscopy.

- Class II is based on a finding of mesangial proliferative lupus nephritis. This form typically responds completely to treatment with corticosteroids.

- Class III is focal proliferative nephritis and often successfully responds to treatment with high doses of corticosteroids.

- Class IV is diffuse proliferative nephritis. This form is mainly treated with corticosteroids and immunosuppressant drugs.

- Class V is membranous nephritis and is characterized by extreme edema and protein loss.

The present teaching also provides severity of SLE nephritis to be diagnosed and thus further relates to a method for determining severity of SLE nephritis, the method comprising:

a) determining quantity of at least one EBV marker (e.g. EBV-EBER, or antibody against EBV antigen) in a nephritic or urine sample obtained from a subject, wherein said quantity as compared with at least one reference value associated with a particular SLE nephritis severity is indicative of (the degree of) severity of SLE nephritis.

Severity of SLE nephritis refers to the degree of underlying progression of SLE nephritis. Patients with SLE nephritis may perceive worsening of disease symptoms when the quantity said quantity decreases. However, the quantity of EBV marker(s) need not necessarily be directly related to perceived SLE nephritis symptoms, but they likely are. Within the context of the present teaching, the (degree of) severity of SLE (nephritis) may be expressed as a (relative) quantity (or concentration) of at least one EBV marker found in a sample obtained from a subject. For example, if a reference value associated with early stage SLE (nephritis) is set at 100%, and the quantity of at least one EBV marker found in a sample obtained from a subject is 20, 30, 40, 50, 60, 70, 80, or 90% it may be concluded that SLE severity in said subject is less severe as compared to early stage SLE (nephritis).

However, if the quantity of at least one EBV marker found in a sample obtained from a subject is 120, 130, 140, 150, 160, 170, 180, or 190% it may be concluded that SLE

(nephritis) severity in said subject is more severe as compared to early stage SLE (nephritis). The term "EBV marker" as used herein is defined as any molecule (e.g. protein) that is produced in the human body as a specific result of EBV infection/replication. Such molecules may include, amongst others, EBV gene products, EBV (structural) proteins, EBV antigens, antibodies against EBV antigens, and EBV RNA. It is however preferred that the EBV marker is chosen from the group consisting of EBV-EBER (and nucleic acids having at least 80% sequence identity therewith), and antibody against EBV antigen. Depending on the EBV marker to be measured, the skilled person knows how to determine presence and/or quantity thereof using conventional methods known in the art.

EBV-EBER (or EBER) encompass EBV-encoded RNA 1 (EBER1 , set forth in SEQ ID NO: 1 ) and/or EBV-encoded RNA 2 (EBER2, set forth in SEQ ID NO:2) (see also Fok et al. The Journal of Cell Biology, Vol 173, No. 3, May 8, 2006 319-325), and nucleic acid sequences having at least 80% sequence identity therewith. EBERs are non-polyadenylated small (-170 nt) RNAs and may form stemloops by intramolecular base pairing giving rise to a double- stranded RNA structure. The physiological role of EBERs has remained unclear. EBERs have been associated with cellular transformation in various systems, and inhibition of apoptosis that is induced by a interferon. These activities have been attributed to the binding and inhibition of the double-stranded RNA-dependent protein kinase R (Takada K and Nanbo A. 2001 Semin. Cancer Biol. 1 1 :461 -467; Yajima M et al 2005 J Virol 79:4298-4307; Nanbo A et al. 2002 EMBO J. 21 :954-965; Ruf IK et al. 2005 J Virol 79:14562-14569; Sharp TV et al. 1993 Nucleic Acids Res 21 :4483-4490). However, no association with SLE has been reported or suggested in the art. EBV antigens from the following five groups of EBV antigens (see for further details of these different groups e.g. EP 0649904):

A. The group of antigens which are expressed during a state of viral latency (EBNAs and LMPs).

B. The group of antigens which are responsible for genome activation and initial induction of viral replication (IEA).

C. The group of antigens which are induced by lEA-gene products and which are required for replication of viral DNA; these antigens are mostly viral enzymes (EA). Two distinct EAs are designated diffuse (EAd) and restricted (EAr) based on the distribution of immunofluorescent staining in EBV-infected cells. Antibody to EAd causes diffuse staining of the nucleus and cytoplasm in both acetone- and methanol-fixed cells. In contrast, EAr staining is restricted to the cytoplasm in acetone-fixed cells and is not present in methanol-fixed cells.

D. The group of antigens which are structural components of the viral particle and are expressed late in the viral replication cycle (VCA), after initiation of viral DNA-synthesis.

E. The group of antigens which are expressed in the cell membrane of the infected cell (MA).

Although within the context of the present teaching antibodies against any EBV antigen may be used, preference is given to antibodies against EBV antigens from group C (also referred to as early EBV antigens). Group C antigens are specifically targeted by antibody responses in SLE patients with active (acute or chronic) EBV infection and are virtually absent in healthy EBV carriers. Therefore anti-EA Ab-responses can be used for diagnosis of aberrant

(re)active EBV infection. Well defined components of the EA complex are the EAd (p47/54) protein encoded by BMRF1 gene, the p138 protein encoded by the BALF2 gene, the viral DNA polymerase encoded in the BALF5 gene, the DNAse (p55) encoded by the BGLF5 gene and the Thymidine Kinase encoded by the BXLF1 gene. The Ead reactivity is defined by the P17 BHRF1 gene and the large and small subunits of a ribonucleotide reductase gene. Even more preference is given to antibody(y)(ies) against EBV antigens EAd and/or Zebra. Further details on EAd can be found in e.g. US4879213 and/or Baer et al., Nature, 310, 207 (1984). Zebra is an EBV transcription factor and contains three functional domains consisting of the amino-terminal part of a transactivator domain, a DNA binding domain and in the carboxy- terminal part of the protein, a dimerization domain. Further details on Zebra can be found in e.g. WO20091 12497 and/or Speck et al, Trends Microbiol. 1997 Oct;5(10):399-405.

The presence and/or quantity of antibodies against EBV antigens may be determined for example by analyzing samples (e.g. sera) for antibody responses against EBV-antigens, such as performed in Example 3. For example, EBV antigens are obtained from HH514.C16 cells (see e.g. Middeldorp et al. Virol Methods 1988;21 :133-46) and used in immunoblot example described in Ream and Field (1999, Molecular Biology Techniques, an intense laboratory course, Academic Press, ISBN-13 978-0-12-583990-7). The presence and/or quantity of at least one EBV-EBER in a sample (such as body fluid, preferably blood, blood plasma, or blood serum) obtained from a subject, preferably a human, may be determined for example by quantitative RT-PCR, such as described in Example 1. Total RNA may be extracted from a serum sample, and transcribed into cDNA, followed by PCR using EBV-EBER specific primers (e.g. forward EBER1 RT-primer

5'AGGACCTACGCTGCCCTAGA (SEQ ID NO:3); reverse EBER1 RT-primer

5'AAAACATGCGGACCACC (SEQ ID NO:4); forward EBER2 RT-primer 5'

AGGACAGCCGTTGCCCTAGTGGTTTC (SEQ ID NO:5); and reverse EBER2 RT-primer 5' AAAAATAGCG G ACAAG CCG AATACC (SEQ ID NO:6)). Quantitative RT-PCR methods are known to the skilled person and for example described in Wayne and Nakamura 2009 (Wayne WG., Nakamura, 2009 RM Molecular diagnostics: techniques and applications for the clinical laboratory). Alternatively, presence and/or quantity of at least one EBV-EBER in a sample may be done through determining presence/quantity of at least one EBV-EBER sequence of distinguishable length, e.g. of at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120 contiguous nucleotides or more, preferably of EBER1 (SEQ ID NO:1 ), or of EBER2 (SEQ ID NO:2).

It may be that part, such as 1 , 2, 3, 4, 5, 10, 25, 50, 75, 90, 99% by weight, of the EBV- EBER(s) in a sample obtained is contained in vesicles. In this respect, a vesicle is a membrane-encapsulated compartment of typically 200-1000 nm in size. The membrane typically is a phospholipid (bi)layer. To improve detection a method according to the present teaching is provided, wherein prior to determining presence of at least one EBV-EBER and/or determining quantity of at least one EBV-EBER, the sample is prepared so as to disrupt vesicles containing EBV-EBER, preferably by ultrasound techniques, thereby releasing EBV- EBER that is contained in said vesicles. The skilled person knows how this can be achieved, for example by disruption of the vesicles through ultrasound (Luque de Castro and Priego Capote (2007) Analytical applications of ultrasound, Elsevier, ISBN-13 978-0-444-52825-4).

A skilled person will understand that other EBV marker numbers and levels may be obtained using other methods available in the art, e.g. those with (slight) modifications in comparison to the method disclosed in the Examples. He will understand that in such case, other levels may be determined. However, the relative quantity (e.g. concentration) as compared to a reference will likewise be indicative for the presence and severity of SLE (nephritis). present teaching will be evident to the skilled worker. The practice of conventional techniques in molecular biology, biochemistry, computational chemistry, cell culture, recombinant DNA, bioinformatics, genomics, sequencing and related fields are well-known to those of skill in the art and are discussed, for example, in the following literature references: Sambrook et al. ., Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989; Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987 and periodic updates; and the series Methods in Enzymology, Academic Press, San Diego.

In a preferred embodiment of the method according to the present teaching, the EBV-EBER is a nucleic acid sequence having over its entire length at least 80%, preferably 90%, more preferably 95%, most preferably 99% or 100% identity with a nucleic acid sequence chosen from the group consisting of SEQ ID No:1 and SEQ ID No:2. Preferably the nucleic acid has a length of at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 150, 170 nucleotides, and preferably at most 1000, 900, 800, 500, 300, 200 nucleotides. Also encompassed in the term EBV-EBER are nucleic acids with a sequence corresponding to SEQ ID NO:1 or SEQ ID NO:2 but with 1 , 2, 3, 4, 5, 6, or 7 nucleotides that do not correspond, which nucleotides thus are additions, deletions, or substitutions.

"Identity" in this respect has an art-recognized meaning and can be calculated using published techniques. See, e.g.: (COMPUTATIONAL MOLECULAR BIOLOGY, Lesk, A. M., ed., Oxford University Press, New York, 1988; BIOCOMPUTING: INFORMATICS AND GENOME PROJECTS, Smith, D. W., ed., Academic Press, New York, 1993; COMPUTER ANALYSIS OF SEQUENCE DATA, PART I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; SEQUENCE ANALYSIS IN MOLECULAR BIOLOGY, von Heinje, G., Academic Press, 1987; and SEQUENCE ANALYSIS PRIMER; Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 ). While there exist a number of methods to measure identity between two polynucleotide or polypeptide sequences, the term "identity" is well known to skilled artisans (Carillo, H., and Lipton, D., SIAM J. Applied Math (1988) 48:1073). Methods commonly employed to determine identity or similarity between two sequences include, but are not limited to, those disclosed in GUIDE TO HUGE COMPUTERS, Martin J. Bishop, ed., Academic Press, San Diego, 1994, and Carillo, H., and Lipton, D., SIAM J. Applied Math (1988) 48: 1073. Methods to determine identity and similarity are codified in computer programs. Preferred computer program methods to determine identity and similarity between two sequences include, but are not limited to, GCS program FASTA (Atschul, S. F. et al., J. Molec. Biol. (1990) 215:403).

In general, the sequences are aligned so that the highest order match is obtained. As an illustration, by a polynucleotide having a nucleotide sequence having at least, for example, 95% "identity" to a reference nucleotide sequence encoding a polypeptide of a certain sequence it is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference polypeptide sequence. In other words, to obtain a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted and/or substituted with another nucleotide, and/or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted (or deleted) with respect to the reference sequence. These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence, or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.

While determining presence and/or quantity of one type of EBV-EBER can be sufficient, determining presence of multiple EBERs such as both EBER1 (SEQ ID NO:1 ) and EBER2 (SEQ ID NO:2) is preferred in the method according to the present teaching, as this may add to the reliability of the method.

It is to be understood that by the term EBV-EBER or EBERs, also encompassed is such EBER or EBERs in an EBER-snRNP complex. snRNPs, or small nuclear ribonucleoproteins, are RNA-protein complexes which in their natural function may combine with unmodified pre- mRNA and various other proteins to form a spliceosome, a large RNA-protein molecular complex upon which splicing of pre-mRNA occurs. EBER(s) may bind snRNP to form an EBER-snRNP complex. Part, such as 1 , 2, 3, 4, 5, 10, 50% by weight of the EBER(s) present in a sample obtained from a subject may thus be present in the form of an EBER-snRNP complex. As such, determining presence and/or quantity of at least one EBER, or EBERs, according to the present teaching, can also involve determining presence and/or quantity of EBER(s) in an EBER-snRNP complex. Hence, in the method according to the present teaching the at least one EBER may be in an EBER-snRNP complex.

In the method according to the present teaching, it is possible, in addition to determining presence/quantity of at least one EBV marker, to further determine presence of antinuclear a positive diagnosis of SLE. At present, such presence of ANA is one of the most significant SLE diagnostic criteria. The present teaching can thus advantageously be combined with the existing ANA test (see for further details on ANA test Meroni and Schur 2012 Ann Rheum Dis 69:1420-1422).

Within the method of the present teaching it is also envisaged that, at least at two different time points, a sample is obtained from the subject, and wherein the quantity of at least one EBV marker in the samples is compared, preferably wherein at least one sample is obtained before and at least one sample is obtained after at least one treatment of the subject. It is however not necessary, although possible and advantageous, that the two or more samples are taken around a particular treatment to evaluate the effect of that treatment (such as (potential or new) treatment for SLE). For example, the treatment of the subject comprises anti-interferon alpha therapy, in which case the present teaching allows for predicting therapeutic response to the anti-interferon alpha therapy. Such anti-interferon alpha therapy may comprise administration to the subject of a compound chosen from the group consisting of:

- rontalizumab (McBride et al 2012, Arthritis & Rheumatism, DOI: 10.1002/art.34632; from Genentech),

- Hydroxychloroquine (Petri, LUPUS June 1996 vol. 5 no. 1 suppl S16-S22; from Assistance Publique— Hopitaux de Paris & Sanofi-Synthelab),

- Sifalimumab (La Cava Immunotherapy July 2010, Vol. 2, No. 4, Pages 575-582; from Medimmune, Inc.),

- AGS-009 (Lichtman, Clinical Immunology Volume 143, Issue 3, June 2012, pages 210-221 ; from Argos Therapeutics),

- IFN Kinoid (Lichtman Clinical Immunology Volume 143, Issue 3, June 2012, pages 210- 221 ; from Neovacs),

- IMO-3100 (Basith et al Expert Opinion on Therapeutic Patents, June 201 1 , Vol. 21 , No. 6 , Pages 927-944; from Idera Pharmaceuticals), or

- DV1 179 (Lichtman, Clinical Immunology Volume 143, Issue 3, June 2012, pages 210-221 ; from Dynavax Technologies, GlaxoSmithKline, or National Institutes of Health).

There has been considerable interest in therapies aimed at blocking interferon alpha (see e.g. Niewold et al 2010 J of Biomed and Biotech Article ID 948364). One published study describes a phase I trial of a fully human monoclonal antibody that binds to the majority of subtypes of human interferon alpha (Yao et al. 2009 Arthritis and Rheumatism vol. 60(6) pp1785-1796). may be taken at day 1 , and a second, third, fourth, fifth sample (or more samples) may be taken at different time points such as at day 2, 3, 4, 5, or 6, or after 1 , 2, 3, 4, or 5 weeks, or after 1 , 2, 3, 4, 5, 6, 7, 8, 9 , 10, or 1 1 months, or after 1 , 2, or 3 years. Comparably, the quantity of at least one EBV marker found in the sample obtained from a subject may be compared with reference value(s) obtained from the same subject at different time point(s). Determining EBV-marker presence/quantity over time may provide useful information as to whether the disease (e.g. SLE or SLE nephritis) has become more or less severe in time. This can thus be used as a more objective measure for SLE (nephritis) severity as compared to disease symptoms severity as perceived by the subject. As such, the method according to the present teaching may be repeated over time, thereby monitoring severity of SLE or SLE nephritis over time.

The method according to the present teaching may thus be performed during, for example in between separate medication intakes of a particular treatment, or after, such as immediately after, or 1-60 minutes, 1-24 hours, or 1 -6 days, or 1 -6 weeks, or 1 -6 months after at least one treatment of the subject, thereby determining effect on severity of SLE of said at least one treatment. As such, provided is a method according to the present teaching, wherein at least two samples are obtained from the subject, at least one before (e.g. 1 -60 minutes, 1-24 hours, 1 -5 weeks before) and at least one after (e.g. 1 -60 minutes, 1 -24 hours, 1 -5 weeks after) at least one treatment of the subject, and wherein the concentrations of at least one EBV marker in the at least two samples are compared, thereby determining effect on severity of SLE of said at least one treatment For example, if prior to a particular treatment such as corticosteroid treatment the EBV marker(s), the level (quantity) as measured in a sample obtained from a subject is set at 100%, and after the treatment, e.g. 1 , 2, 3, 4 weeks after the treatment, the EBV marker(s) is reduced to for example 60%, 70%, 80% with respect to said 100%, one may conclude that the treatment has had effect and has reduced severity of SLE. Before the current teaching was made, it was very difficult to determine success or failure of a particular treatment, because there was a lack of objective measures and subjective symptoms of SLE fluctuate (change) over time irrespective of treatment.

The method according to the present teaching can thus be repeated over time, thereby monitoring severity of SLE or SLE nephritis over time. For example the method may be performed every 1 , 2, 3, 4, 5, 6 days or every 1 , 2, 3, 4, 5, 6 weeks, or every 1 , 2, 3, 4, 5, 6 months for example in order to evaluate disease progression. An increase in the indicative for increasing severity of the disease. In line with this, a decrease in the concentration of EBV marker(s) found in samples obtained from the subject may be indicative for decreasing severity of the disease. For example, if the EBV marker(s) level as measured in a sample obtained from a subject initially is set at 100%, and after 4 weeks it is 1 10%, and subsequently after 4 weeks 125%, one may conclude SLE is becoming more severe.

The quantity of EBV marker(s) in the samples may be compared to a reference quantity value, or compared to the first sample taken, and may be put in a graph to visualize EBV marker(s) quantity relative to said reference over time, which may be indicative of SLE progression/severity over time. For example if the quantity of EBV marker(s) in the first sample is set at 100%, and the subsequently taken samples contain 96%, 92%, 85%, 76%, 50% of EBV marker(s) expressed relatively to the first sample, one may conclude that EBV marker(s) levels in said subject are decreasing, which may be indicative of SLE becoming less severe/worse.

As such, the EBV marker(s) level over time may be analyzed to uncover trends, such as an increase or decrease of the EBV marker(s) level over time, which may for example indicate whether an early stage SLE develops in the direction of late stage SLE. Fluctuations in EBV marker(s) levels may also be compared with life style behavior to evaluate whether particular behavior such as periods with much or few exercise / rest has influenced EBV marker(s) levels. In the art, different methods are known that can suitably be used in determining presence and/or quantity of at least one EBV marker and/or determining concentration of at least one EBV marker. For example, qualitative and/or quantitative analysis of EBV marker(s), in accordance with the present teaching, may be performed by such common methods including, but not limited to quantitative T-PCR, Northern blotting, Western blotting, ELISA, or microarray, all well known to the skilled person. Such techniques are discussed, for example, in the following literature references: Sambrook et al. ., Molecular Cloning. A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989; Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1987 and periodic updates; and the series Methods in Enzymology, Academic Press, San Diego.

The method according to the present teaching is preferably performed ex vivo. as defined herein, for diagnosing Systemic Lupus Erythematosus (SLE) and/or determining severity of SLE. In other words, the current teaching provides that the presence and/or quantity (e.g. number, concentration or amount) of EBV marker(s) are indicative for the presence and/or severity of SLE. By using EBV-EBER(s) in a sample from a subject as an indicator, presence and/or severity of SLE can thus be determined for said subject.

In yet another embodiment, the present teaching relates to the use of at least one EBV marker as defined herein (e.g. as determined in a sample obtained from a subject), for distinguishing between Systemic Lupus Erythematosus (SLE) and a disease chosen from the group consisting of rheumatoid arthritis, multiple sclerosis, and/or Sjogren's syndrome. In this respect, detection of at least one EBV marker in a sample obtained from a subject suspected of having either SLE, rheumatoid arthritis, multiple sclerosis or Sjogren's disease, or detection of a higher presence, such as 1 , 5, 10% higher, of EBV marker(s) in said sample if compared to a sample taken from a healthy individual, may rule out, or makes it unlikely, that the subject suffers from rheumatoid arthritis, multiple sclerosis, and/or Sjogren's disease. Such detection or higher presence is however indicative of SLE. On the other hand, no detection of EBV marker(s), or detection of EBV marker(s) presence within predetermined margins, such as within 1 , 2, 3, 4, 5% deviation, of EBV marker(s) presence in healthy individuals may at least indicate absence of SLE in said subject./pct

Rheumatoid arthritis is a chronic, systemic inflammatory disorder that may affect many tissues and organs, but principally attacks synovial joints. In 2010 the 2010 ACR / EULAR Rheumatoid Arthritis Classification Criteria were introduced (Aletaha D, Neogi T, Silman AJ, et al. (September 2010). Ann. Rheum. Dis. 69 (9): 1580-8).

Multiple sclerosis is an inflammatory disease in which the fatty myelin sheaths around the axons of the brain and spinal cord are damaged, leading to demyelination and scarring as well as a broad spectrum of signs and symptoms (Compston A, Coles A (October 2008). "Multiple sclerosis". Lancet 372 (9648): 1502-17).

Sjogren's disease is a systemic autoimmune disease in which immune cells attack and destroy the exocrine glands that produce tears and saliva (Delaleu N, Immervoll H, Cornelius J, Jonsson R (2008). "Biomarker profiles in serum and saliva of experimental Sjogren's syndrome: associations with specific autoimmune manifestations". Arthritis Res. Ther. 10 (1 ): R22). marker as defined herein (e.g. as determined in a sample obtained from a subject), for diagnosing SLE nephritis and/or determining severity of SLE nephritis. Brief description of Figures

Figure 1 - A) RT-PCR analysis showed that EBER transcripts were present in serum samples derived from patients with clinically confirmed SLE and all samples showed GAPDH signals. Size-analysis of the PCR products with gel electrophoresis confirms they are EBERs. B) Sera samples from rheumatoid arthritis (RA) patients and (serum+plasma) samples from healthy controls, were EBER transcripts negative. Although a PCR product appeared for healthy control 2, it was confirmed by size analysis and melting temperature analysis that this PCR product is non-EBER (see PCR product indicated by asterisk).

Figure 2 - EBER-ISH staining of paraffin embedded SLE nephritis biopsies from 2 individual patients. A) Small EBER particles (arrows) are present near the nuclei of proximal and distal tubular epithelium (40x) but not glomeruli (G). B) Close examination of the staining pattern suggests that EBERs are within tubular epithelial cells possibly endosomes or lysosomal compartments.

Sequences herein referred to

SEQ ID NO: 1 (EBER1 )*:

5'AGGACCUACG CUGCCCUAGA GGUUUUGCUA GG GAG GAG AC GUGUGUGGCU GUAGCCACCC GUCCCGGGUA CAAGUCCCGG GUGGUGAGGA CGGUGUCUGU GGUUGUCUUC CCAGACUCUG CUUUCUGCCG UCUUCGGUCA AGUACCAGCU GGUGGUCCGC AUGUUUU

SEQ ID NO:2 (EBER2V:

5'AGGACAGCCG UUGCCCUAGU GGUUUCGGAC ACACCGCCAA CGCUCAGUGC GGUGCUACCG ACCCGAGGUC AAGUCCCGGG GGAGGAGAAG AGAGGCUUCC CGCCUAGAGC AUUUGCAAGU CAGGAUUCUC UAAUCCCUCU GGGAGAAGGG UAUUCGGCUU GUCCGCUAUU UUU

SEQ ID NO:3 (EBER1 specific forward RT-primer):

5'AGGACCTACGCTGCCCTAGA SEQ ID NO:4 (EBER1 specific reverse RT-primer):

5'AAAACATGCGGACCACC 5'AGGACAGCCGTTGCCCTAGTGGTTTC

SEQ ID NO:6 (EBER2 specific reverse TR-primer):

5'AAAAATAGCGGACAAGCCGAATACC

*Primer binding sites are underlined.

Example 1

Circulating EBV-EBERs in SLE patients

To investigate the presence of circulating poly III transcripts from the EBV genome (EBERs) in SLE patients we analyzed a total of 28 serum samples derived from 20 patients with clinically confirmed SLE for the presence of EBERs, using sensitive semi-quantitative RT- PCR. To this end we isolated total RNA from 250ul serum of which the average yield was approximately 700ng of each sample (Figure 1 ). The RNA was largely degraded since no ribosomal peaks could be determined by the Agilent Bioanalyzer... We prepared cDNA from 500ng total RNA of each sample of which a small proportion was subjected to PCR analysis using full-length EBER specific primers (forward EBER1 RT-primer 5'AGGACCTACGCTGCCCTAGA (SEQ ID NO:3); reverse EBER1 RT-primer 5'AAAACATGCGGACCACC (SEQ ID NO:4); forward EBER2 RT-primer 5' AGGACAGCCGTTGCCCTAGTGGTTTC (SEQ ID NO:5); and reverse EBER2 RT-primer 5' AAAAATAGCGGACAAGCCGAATACC (SEQ ID NO:6)). Simultaneously we analyzed for GAPDH mRNA or fragments thereof as a 'loading' and internal quality control. Serially diluted cDNA from EBV-infected cells was used as a standard to estimate relative abundance in each sample. The sensitivity for the EBER PCR assay was estimated at 1/20th of 1 EBV- infected B cell and for GAPDH 1/40th of one cell. The semi-quantitative qRT-PCR approach is outlined in figure 1. RT-PCR analysis showed that EBER transcripts were present in serum samples derived from patients with clinically confirmed SLE and all samples showed GAPDH signals. The PCR products were confirmed as EBERs, by randomly sequencing the products of multiple samples and further characterization by size-analysis of the PCR products with gel electrophoresis (Figure 1 ). To ensure we did not amplify EBER products from contaminating DNA, we also performed EBER-PCR on isolated RNA from 6 SLE samples directly (i.e. without the Reverse Transcriptase step). Of these, none revealed DNA contamination. To establish that 'free' circulating EBERs is an abnormality in the sera of SLE patients only, we patients and 12 (serum+plasma) samples from healthy controls, all of these were EBER transcripts negative (Figure 1 ). Example 2

EBV-EBERS in Lupus-Nephritis tissue

Lupus Nephritis (LN) is one of the most serious complications in SLE patients. It was hypothesized that circulating EBV-EBERs may be part of immune-complexes that are deposited in nephritis (kidney) biopsies. We performed sensitive EBER-ISH stainings using a highly specific commercially available hybridization probe (Dako, PNA ISH Detection Kit (Code K5201 ) on LN biopsy tissues from 9 advanced SLE patients. Interestingly, in 8 of the LN tissues we observed extra-glomerular EBER staining in cells that appear as tubular epithelium.

To establish that the positive EBER-ISH signals in the LN tissues are derived from intact EBV-EBERs, we isolated RNA from 9 LN biopsy specimens and performed qRT-PCR (as described in Example 1 ). In 8 LN specimens we detected strong specific signals for full- length EBERs.

As these results show that EBER presence in nephritic tissue is associated with SLE nephritis, which is one of the most serious complications of SLE, it is plausible that the quantity of EBV markers in patient samples is related to SLE severity. In addition, these results strongly suggest that EBV markers may advantageously be used to determine presence and/or severity of SLE nephritis in a patient.

Example 3

SLE patients have deregulated EBV serology suggestive of EBV-reactivation

We analyzed a medium-sized panel (n=60) of ANA+/dsDNA+ SLE sera for antibody- responses against EBV-antigens with established diagnostic methodologies as described below. Sera from healthy EBV+ individuals and from patients with rheumatoid arthritis (RA) were included as controls (n=36). HH514.C16 cells (40 μg/mL), induced to express high levels of EBV antigens upon treatment with butyrate and tetradecanoyl phorbol acetate (see for further details Middeldorp et al. J. Virol Methods 1988;21 : 133-46) were used as source of EBV antigens in immunoblot assays. [wt/vol] SDS, 10% glycerol, 5% [vol/vol] β-mercaptoethanol, and 0.001 % [wt/vol] bromophenol blue) and boiled for 5 min. The EBV antigens were separated by SDS-PAGE, using a stacking gel of 3% acrylamide and a linear separation gel of 10% acrylamide (Mini- Protean II Electrophoresis system; Bio-Rad, Hercules, CA). Polypeptides were transferred to 0.2-μιτι nitrocellulose (Schleicher & Schuell, 's Hertogenbosch, The Netherlands) by Western blotting (Mini Trans-Blot Cell; Bio-Rad) using standard techniques. Nonspecific binding sites on the nitrocellulose were saturated with blocking buffer (5% nonfat milk powder and 5% horse serum in PBS). Subsequently, human sera (1 :40-1 :100) was added and incubated for 1 h at room temperature. After three washes with PBS-T (0.05% Tween in PBS), specifically bound IgG was detected with horseradish peroxidase (HRP)— conjugated second antibody, diluted in blocking buffer. After two washes in PBS-T and two washes in PBS HRP, activity was visualized with 0.06% 4-chloro-l-naphtol and 0.03% H202 in PBS. The bands of the immunoblots indicated elevated reactivity of IgG antibodies against EBV associated antigens in SLE compared with the control groups. In particular a distinctive reactivity against EBV antigens EAd and Zebra for SLE was shown. Thus from representative immunoblots elevated responses against EBV antigens, in particular early (lytic) antigens (EAd and Zebra), are observed in SLE compared with the control groups.

These results suggest that EBV markers, such as antibodies against EBV antigens, associate with SLE presence and/or severity.

Claims

1. Method for diagnosis of Systemic Lupus Erythematosus (SLE), the method comprising: a) determining presence and/or quantity of at least one Epstein Barr Virus (EBV) marker in a sample obtained from a subject, wherein said presence is indicative of a positive diagnosis of SLE and/or said quantity as compared to a reference value associated with non- SLE is indicative of a positive diagnosis of SLE.

2. Method according to claim 1 , wherein the method is for discriminating between Systemic Lupus Erythematosus (SLE), rheumatoid arthritis and/or multiple sclerosis.

3. Method according to claim 1 , wherein severity of Systemic Lupus Erythematosus (SLE) is diagnosed by determining quantity of at least one EBV marker in a sample obtained from a subject, wherein said quantity as compared with at least one reference value associated with a particular SLE severity is indicative of severity of SLE.

4. Method according to any one of the previous claims, wherein the sample is a nephritic sample or a body fluid sample, wherein the body fluid sample preferably is chosen from the group consisting of blood sample, blood plasma sample, blood serum sample, and urine sample.

5. Method for diagnosis of SLE nephritis, the method comprising:

a) determining presence and/or quantity of at least one Epstein Barr Virus (EBV) marker in a nephritic or urine sample obtained from a subject, wherein said presence is indicative of a positive diagnosis of SLE nephritis and/or said quantity as compared to a reference value associated with non-SLE nephritis is indicative of a positive diagnosis of SLE nephritis.

6. Method according to claim 5, wherein severity of SLE nephritis is diagnosed by

determining quantity of at least one EBV marker in a nephritic or urine sample obtained from a subject, wherein said quantity as compared with at least one reference value associated with a particular SLE nephritis severity is indicative of severity of SLE nephritis.

7. Method according to any one of the previous claims, wherein the EBV marker is chosen from the group consisting of EBV-EBER, and antibody against EBV antigen, more preferably an antibody against EBV antigens EAd and/or Zebra. least 80%, preferably 90%, more preferably 95%, most preferably 99 or 100% identity with a nucleic acid sequence chosen from the group consisting of SEQ ID No:1 and SEQ ID No:2. 9. Method according to any one of the previous claims, wherein the method further determines presence of antinuclear antibodies (ANA) in a sample obtained from a subject, wherein said presence is indicative of a positive diagnosis of SLE.

10. Method according to any one of the previous claims, wherein, at least at two different time points, a sample is obtained from the subject, and wherein the quantity of at least one

EBV marker in the samples is compared, preferably wherein at least one sample is obtained before and at least one sample is obtained after at least one treatment of the subject.

1 1. Method according to claim 10, wherein the treatment of the subject comprises anti- interferon alpha therapy, preferably wherein the anti-interferon alpha therapy comprises administration to the subject of a compound chosen from the group consisting of

rontalizumab, Hydroxychloroquine, Sifalimumab, AGS-009, IFN Kinoid, IMO-3100, or DV1 179. 12. Method according to any one of the previous claims, wherein the method is repeated over time, thereby monitoring severity of SLE or SLE nephritis over time.

13. Method according to any one of the previous claims, wherein determining presence of at least one EBV marker and/or determining quantity of at least one EBV marker is performed by using quantitative RT-PCR, Northern blotting, Western blotting, ELISA, or microarray.

14. Method according to any one of the previous claims, wherein the method is performed ex vivo. 15. Use of at least one EBV marker as defined in any of claims 1 -14, for diagnosing Systemic Lupus Erythematosus (SLE) and/or determining severity of SLE.

16. Use of at least one EBV marker as defined in any one of claims 1 -14, for distinguishing between Systemic Lupus Erythematosus (SLE) and a disease chosen from the group consisting of rheumatoid arthritis and multiple sclerosis. nephritis and/or determining severity of SLE nephritis.