WO2014011177A1 - Antisense p53 phosphorodiamidate morpholino composititons, methods and indications - Google Patents

Abstract

Compositions and methods for down-modulating p53 expression for the treatment of disease are disclosed.

Description

Antisense p53 Phosphorodiamidate Morpholino Compositions, Methods and

Indications

This application claims priority to US Provisional Application No. 61/506,899 filed July 12, 201 1 , which is incorporated herein by reference as though set forth in full.

Field of the Invention This invention relates to the fields of oncology and medicine. More specifically, the invention provides compositions, methods and indications involving the inhibition of p53 with phosphorodiamidate morpholino antisense oligonucleotides (oligos).

Background of the Invention

Numerous publications and patent documents, including both published applications and issued patents, are cited throughout the specification in order to describe the state of the art to which this invention pertains. Each of these citations is incorporated herein by reference as though set forth in full.

Phosphorodiamidate morpholino oligomers (PMOs) comprise single-stranded antisense oligomers in which the ribose sugar is replaced by a six-membered morpholine ring and the phosphorodiester linkage is replaced with a phosphorodiamidate linkage. PMOs contain a neutral backbone that lessens non-specific interactions, increases resistance to enzyme degradation and enhances affinity for target RNA sequences compared with some oligonucleotides with a charged backbone (lversen, 2001 ).

Unlike conventional antisense oligonucleotide-based strategies that inhibit gene expression by triggering RNase H-mediated cleavage of RNA:DNA duplexes, PMOs act by inducing steric hindrance of certain key processes related to mRNA such as blocking ribosomal assembly thereby interfering with translation initiation or blocking intron-exon splice junctions interfering with pre-mRNA splicing.

A recent and important development to improve delivery of PMOs into cells in culture involves conjugation to certain basic amino acid-rich peptides. PMOs conjugated to cell penetrating peptides (PPMOsPPMO) do not require transfection reagent, membrane permeabilization or scrape loading to enter target cells. PPMOs have been reported to inhibit the expression of endogenous genes as well as the replication of pathogenic human viruses in cell culture and in mouse models (Abes et al., 2008).

Summary of the Invention

In accordance with the present invention, at least one phosphorodiamidate mopholino oligomer operably linked to a cell penetrating peptide (CPP) which is effective to down modulate expression of p53 and splice variants thereof, wherein said oligomer has a sequence selected from the group consisting SEQ ID NO: 1 , SEQ ID NO: 2 and SEQ ID NO: 9 is provided. Also disclosed are compositions comprising the aforementioned oligomer(s) in a biologically acceptable carrier. In one embodiment the composition comprises SEQ ID NO: 1 and SEQ ID NO: 2. Also preferred is a CPP is selected from the group consisting of polyarginine, (RXR)4XB and (RXRRBR^XB where R is arginine, X is 6-aminohexanoic acid and B is beta-alanine.

In another embodiment a method for inhibiting expression of p53 and splice variants thereof in a target cell is provided. An exemplary method comprises administration of an effective amount of the composition the invention, wherein the oligomers) hybridizes with a p53 encoding nucleic acid and thereby inhibits expression of p53 and splice variants thereof relative to cells not treated with the composition.

Brief Description of the Drawings

Figure 1. PPMOs Interfere with p53 Expression in Non-stressed MCF7 Cells and Give Rise to p53 Isoforms. Western blot analysis of p53 expression in MCF7 cells. MCF7 cells were treated with increasing concentrations (0, 1 , 3, 10 μΜ) of PPMOs or with PMOs for 2 hr. Cells were collected 24 hr after treatment and protein extracts were analyzed by Western blot analysis using 4 antibodies against p53. The PPMOs consisted of (RX)sB conjugated to the 5'-end and are indicated by the addition of "-CP" to the name of the corresponding PMO.. Figure 2. PPMOs Interfere with p53 Expression and Prevent Induction of p21 in

Stressed and Non-stressed Cells. (A) Western blot analysis of p53 and p21 expression in H460 cells treated with doxorubicin (200 ng/ml) for 24 hr. (B) Western blot analysis of p53 and p21 expression in HCT1 16 cells treated with 5-FU (50 μg/ml) for 24 hr. (C) Western blot analysis of p53 and p21 expression in OCI/AML3 and OCI/AML4 cells 5 hr after γ- irradiation (5 Gy). Cells were pre-treated with the indicated PPMOs (3 μΜ) for 2 hr prior to irradiation or drug treatment. The PPMOs consisted of (RX)gB conjugated to the 5'-end of the PMOs. p53 was detected with PAbl 801.

Figure 3. p53 Isoforms Showing Antibody Binding Epitopes.

Figure 4. The effect of various Cell Penetrating Peptides (CCPs) on the effectiveness of PPMO-M1 or PPMO-E10 to p53. Western blot analysis of p53 and p21 expression in H460 cells treated with doxorubicin (200 ng/ml) for 24 hr. Cells were pre-treated with the indicated PPMOs for 2 hr prior to doxorubicin treatment. PPMO-E l 0 has little effect on p53 or p21 expression and is included as a control. (B) Western blot analysis of p53 and p21 expression in HCT1 16 cells treated with 5-FU (50 μ /ηιΙ) for 24 hr. (C) Western blot analysis of p53 and p21 expression in OCI/AML3 and OCI/AML4 cells 5 hr after γ- irradiation (5 Gy). Cells were pre-treated with the indicated PPMOs (3 μΜ) for 2 hr prior to irradiation or drug treatment. The PPMOs consisted of (RX)sB conjugated to the 5 '-end of the PMOs. p53 was detected with PAbl 801.

Figure 5. The Effect of Various PPMOs that Target p53 pre-mRNA Splicing. Western blot analysis of p53 and p21 expression in H460 cells treated with doxorubicin (200 ng/ml) for 24 hr. Cells were pre-treated with the indicated PPMOs for 2 hr prior to doxorubicin treatment.

Figure 6. PPMOs Ml and E10SA Disrupt the Apoptotic and Cell Cycle Arrest Functions of p53. (A) HCT1 16 p53+/+ cells were treated with 5-FU (50 μg/ml) for 48 hr with or without prior treatment with PPMOsEl O, M l or E l OS A for 2 hr. After drug treatment, cells were collected, fixed, stained with propidium iodide and analyzed by flow cytometry. Cells with sub-G l DNAcontent, indicative of apoptosis, are indicated. HCT1 16 p53-/- are included in the bottom panel as a control. (B) H460 cells were treated with doxorubicin (200 ng/ml) for 48 hr with or without prior treatment with PPMOs Ml (3 μΜ) or E 10SA (3 μΜ) for 2 hr. Cells were analyzed by flow cytometry after staining with propidium iodide. Figure 7. The Combined Use of CP-MI and CP-M40 Blocks p53 Expression. (A)

Western blot analysis of p53 and p21 expression in H460 cells treated with doxorubicin (200 ng/ml) for 24 r. Cells were pre-treated with increasing amounts of CP-M40 for 2 hr prior to doxorubicin treatment. The arrowhead points to a 35 kDa polypeptide that is detected with DOl . (B) Western blot analysis of p53 expression in H460 cells treated with doxorubicin (200 ng/ml) for 24 hr. Cells were pre-treated with PPMOs, each at a concentration of 5 μΜ. The membranes were probed with 3 antibodies against p53 (PAbl 801 , DOl and FL393) and with antibodies that recognize , p21 or mdm2. β-actin expression serves as a protein loading control. Arrowheads point to a 35 kDa polypeptide recognized with DOl and FL393 in cells treated with M40, and to a smaller polypeptide of about 33 kDa recognized by FL393 in cells treated with 1 and M40.

Figure 8. Inhibition of p53 Expression Sensitizes H460 Cells to Doxorubicin-induced Apoptosis. (A) H460 cells were treated with doxorubicin (200 ng/ml) for 72 hr with or without prior treatment with PPMOs Ml (5 μΜ) and/or M40 (5μΜ) for 2 hr. After drug treatment, cells were collected, fixed, stained with propidium iodide and analyzed by flow cytometry. Apoptotic cells with sub-Gl DNA content are indicated. (B) The histogram shows the proportion of cells with sub-Gl DNA content after treatment as in (A). The mean values from 3 independent experiments are shown +/- S.E.M. (C) H460 cells were treated with doxorubicin (200 ng/ml) for 72 hr with or without prior treatment with M l (5 μΜ) and/or M40 (5μΜ) for 2 hr. Both PPMOs contained (RXR)₄XB. After drug treatment, cells were collected and analyzed for caspase-3 activity using a flow cytometric assay. The histogram shows the proportion of cells with caspase-3 activity determined in 3 independent experiments. The mean values are shown +/- S.E.M.

Figure 9. CP-MI and CP-M40 Inhibit Mutant p53 Expression in MDA-MB-468 Breast Cancer Cells. Western blot analysis of p53 expression in human breast cancer MDA-MB- 468 cells. Cells were treated with PPMOs as indicated for 2 hr. Cells were collected 24 hr after treatment and protein extracts were analyzed by Western blotting with antibodies to p53 (PAbl 801 ) or β-actin as a loading control.

Detailed Description of the Invention

In this study, various PPMOs conjugated with arginine-rich CPPs were designed to target the translational start codon in p53 mRNA and splicing sites in p53 pre- mRNA. These were screened and evaluated for their effectiveness at repressing p53 expression and function. The p53 tumour suppressor gene encodes a transcription factor that is commonly mutated in human cancer. When mutated its ability to induce apoptosis is lost. In response to many forms of stress including DNA damage and replicative stress, wild type p53 can promote the expression of genes that block cell cycle progression or promote apoptosis enabling p53 to eliminate premalignant cells that could give rise to cancer. In cancers with wild type p53 the induction of p53-dependent apoptosis is inhibited sometimes as a result of limiting the amount of p53 that gets made. As a result, much effort is directed at activating the ability or mutant p53 to induce apoptosis by forcing it into a wild type conformation or increasing the levels of wild type p53 expression in tumour cells for example by inhibiting its interaction with mdm2. p53, however, can also promote the survival of damaged cells through a large number of mechanisms including DNA repair (Kim et al., 2009; Vousden and Prives, 2009). The dual function of p53 in promoting death or survival raises many important questions regarding the determinants that govern the cellular response to p53 activation. The dual function of p53 must also be considered in the treatment of tumours that retain wild-type p53 alleles. Thus, in certain clinical settings where the predominant tumour response to drug-induced p53 activation is survival rather than death, the repression of p53 may increase sensitivity to chemotherapeutic drugs (Bunz et al., 1999; McGill and Fisher, 1999). The identification of PPMOs that effectively inhibit p53 expression in human tumour cells allowed us to test the effect of p53 repression on drug sensitivity. The definitions set forth below are provided to better describe the subject matter regarded as the invention.

"Conventional antisense oligos" are single stranded oligos that inhibit the expression of the targeted gene by one of the following mechanisms: (1 ) steric hindrance - e.g., the antisense oligo interferes with some step in the sequence of events leading to gene expression resulting in protein production by directly interfering with the step. For example, the antisense oligo may bind to a region of the RNA transcript of the gene that includes a start site for translation which is most often an AUG sequence (other possibilities are GUG, UUG, CUG, AUA, ACG and CUG) and as a result of such binding the initiation of translation is inhibited; (2) induction of enzymatic digestion of the RNA transcripts of the targeted gene where the involved enzyme is not Argonaute 2. Most often the enzyme involved is RNase H. "RNase H" recognizes DNA/RNA or certain DNA analog RNA duplexes (not all oligos that are DNA analogs will support RNase H activity) and digests the RNA adjacent to the DNA or DNA analog hybridized to it; and (3) combined steric hindrance and the capability for inducing RNA digestion in the manner just described.

"Cell penetrating peptides" (CPPs) are peptides that promote cell penetration. CPPs may be naturally occurring protein domains or they may be designed based on the naturally occurring versions. CPPs typically share a high density of basic charges and are

approximately 10 - 30 amino acids in length. CPPs useful in the oligonucleotides of the invention are described further hereinbelow.

"Chemotherapeutic agents" are compounds that exhibit anticancer activity and/or are detrimental to a cell by causing damage to critical cellular components, particularly the genome (e.g., by causing strand breaks or other modifications to DNA). In anti-cancer applications, it may be desirable to combine administration of the oligos described herein with administration of chemotherapeutic agents, radiation or biologies. Suitable

chemotherapeutic agents for this purpose include, but are not limited to: alkylating agents (e.g., nitrogen mustards such as chlorambucil, cyclophosphamide, isofamide,

mechlorethamine, melphalan, and uracil mustard; aziridines such as thiotepa;

methanesulphonate esters such as busulfan; nitroso ureas such as carmustine, lomustine, and streptozocin; platinum complexes such as cisplatin and carboplatin; bioreductive alkylators such as mitomycin, procarbazine, dacarbazine and altretamine); DNA strand-breakage agents (e.g., bleomycin); topoisomerase II inhibitors (e.g., amsacrine, dactinomycin, daunorubicin, idarubicin, mitoxantrone, doxorubicin, etoposide, and teniposide); DNA minor groove binding agents (e.g., plicamydin); antimetabolites (e.g., folate antagonists such as methotrexate and trimetrexate; pyrimidine antagonists such as fluorouracil,

fluorodeoxyuridine, CB3717, azacitidine, cytarabine, and floxuridine; purine antagonists such as mercaptopurine, 6-thioguanine, fludarabine, pentostatin; asparginase; and ribonucleotide reductase inhibitors such as hydroxyurea); tubulin interactive agents (e.g., vincristine, vinblastine, and paclitaxel (Taxol)).

In a particular embodiment, the chemotherapeutic agent is selected from the group consisting of: pacitaxel (Taxol®), cisplatin, docetaxol, carboplatin, vincristine, vinblastine, methotrexate, cyclophosphamide, CPT- 1 1 , 5-fluorouracil (5-FU), gemcitabine, estramustine, carmustine, adriamycin (doxorubicin), etoposide, arsenic trioxide, irinotecan, and epothilone derivatives.

As used herein, the term "treatment" refers to the application or administration of an oligo or other therapeutic agent to a patient, or application or administration of an oligo or other drug to an isolated tissue or cell line from a patient, who has a medical condition, e.g., a disease or disorder, a symptom of disease, or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve, or affect the disease, the symptoms of disease, or the predisposition toward disease. In an alternative embodiment, tissues or cells or cell lines from a normal donor may also be "treated".

As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of an oligo, optionally other drug(s), and a pharmaceutically acceptable carrier. As used herein, "pharmacologically effective amount," "therapeutically effective amount" or simply "effective amount" refers to that amount of an agent effective to produce a commercially viable pharmacological, therapeutic, preventive or other commercial result. For example, if a given clinical treatment is considered effective when there is at least a 25% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 25% reduction in that parameter.

The term "pharmaceutically acceptable carrier" refers to a carrier or diluent for administration of a therapeutic agent. Pharmaceutically acceptable carriers for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington's Pharmaceutical Sciences, AR Gennaro (editor), 1 8^th edition, 1990, Mack Publishing, which is hereby incorporated by reference herein. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.

Morpholino oligos are commercially available from Gene Tools LLC. Morpholino oligo characteristics and synthesis include but are not limited to those presented in the following: Summerton and Weller, Antisense Nucleic Acid Drug Dev 7: 187, 1997;

Summerton, Biochim Biophys Acta 1489: 141 , 1999; Iversen, Curr Opin Mol Ther 3: 235, 2001 ; US6784291 , US5185444, US5378841 , US5405938, US5034506, US5142047, US5235033. Morpholino oligos for the purposes of the present invention may have the uncharged and/or at least one cationic linkages between the nucleoside analogs made up of a morpholino ring and a normal base (guanine, uracil, thymine, cytosine or adenine) or a unnatural base as described herein. The preferred linkage for morpholino oligos is phosphorodiamidate which is an uncharged linkage. In some embodiments it may be modified as discussed below to provide a positive charge.

In one embodiment, the morpholino subunit has the following structure:

Schematic of a Morpholino Subunit

(i)

where Pi is a base-pairing moiety, and the linkages depicted above connect the nitrogen atom of (i) to the 5' carbon of an adjacent subunit. The base-pairing moieties Pi may be the same or different, and are generally designed to provide a sequence which binds to a target nucleic acid.

The use of embodiments of linkage types (bl), (b2) and (b3) above to link morpholino subunits may be illustrated graphically as follows:

Schematic of Linkages for Morpholio Subunit

Preferably, at least 5% of the linkages in an oligo are selected from cationic linkages (bl), (b2), and (b3); in further embodiments, 10% to 35% of the linkages are selected from cationic linkages (bl), (b2), and (b3). As noted above, all of the cationic linkages in an oligo are preferably of the same type or structure.

In further embodiments, the cationic linkages are selected from linkages (bl ') and

(bl") as shown below, where (bl") is referred to herein as a "Pip" linkage and (bl") is referred to herein as a "GuX" linkage:

In the structures above, W is S or O, and is preferably O; each of R l and R2 is independently selected from hydrogen and lower alkyl, and is preferably methyl; and A represents hydrogen or a non-interfering substituent on one or more carbon atoms in (bl ') and (bl"). Preferably, each A is hydrogen; that is, the nitrogen heterocycle is preferably unsubstituted. In further embodiments, at least 10% of the linkages are of type (bl ') or (bl"); for example, 20% to 80%, 20% to 50%, or 20% to 30% of the linkages may be of type (bl ') or (bl"). In other embodiments, the oligo contains no linkages of type (bl '). Alternatively, the oligo contains no linkages of type (bl) where each R is H, R³ is H or CH3, and R⁴ is H, CH3, or an electron pair.

In still further embodiments, the cationic linkages are of type (b2), where L is a linker up to 1 2 atoms in length having bonds selected from alkyl (e.g. -CH₂-CH₂-), alkoxy (-C-0-), and alkylamino (e.g. -CH₂-NH-), with the proviso that the terminal atoms in L (e.g., those adjacent to carbonyl or nitrogen) are carbon atoms.

The morpholino subunits may also be linked by non-phosphorus-based intersubunit linkages, as described further below, where at least one linkage is modified with a pendant cationic group as described above. For example, a 5 'nitrogen atom on a morpholino ring could be employed in a sulfamide linkage or a urea linkage (where phosphorus is replaced with carbon or sulfur, respectively) and modified in a manner analogous to the 5 '-nitrogen atom in structure (b3) above.

The subject oligo may also be conjugated to a peptide transport moiety which is effective to enhance transport of the oligo into cells. The transport moiety is preferably attached to a terminus of the oligo.

Schematic of Attachment of a Cell Penetrating Peptide

to Morpholino Backbone

(bl ')

In the structures above, W is S or O, and is preferably O; each of R and R is independently selected from hydrogen and lower alkyl, and is preferably methyl; and A represents hydrogen or a non-interfering substituent on one or more carbon atoms in (b ) and (bl "). Preferably, each A is hydrogen; that is, the nitrogen heterocycle is preferably unsubstituted. In further embodiments, at least 10% of the linkages are of type (bl ') or (bl "); for example, 20% to 80%, 20% to 50%, or 20% to 30% of the linkages may be of type (bl') or (bl"). In other embodiments, the oligo contains no linkages of type (bl '). Alternatively, the oligo contains no linkages of type (bl) where each R is H, R³ is H or CH₃, and R⁴ is H, CH₃, or an electron pair.

In still further embodiments, the cationic linkages are of type (b2), where L is a linker up to 12 atoms in length having bonds selected from alkyl (e.g. -CH2-CH2-), alkoxy (-C-0-), and alkylamino (e.g. -CH2-NH-), with the proviso that the terminal atoms in L (e.g., those adjacent to carbonyl or nitrogen) are carbon atoms.

The morpholino subunits may also be linked by non-phosphorus-based intersubunit linkages, as described further below, where at least one linkage is modified with a pendant cationic group as described above. For example, a 5 'nitrogen atom on a morpholino ring could be employed in a sulfamide linkage or a urea linkage (where phosphorus is replaced with carbon or sulfur, respectively) and modified in a manner analogous to the 5 '-nitrogen atom in structure (b3) above.

The subject oligo may also be conjugated to a peptide transport moiety which is effective to enhance transport of the oligo into cells. The transport moiety discussed further hereinbelow and is preferably attached to a terminus of the oligo.

For the purposes of this invention, the preferred carriers, particularly for in vivo use, make use of peptides that promote cell penetration. These cell penetrating peptides (CPPs) typically share a high density of basic charges and are approximately 10 - 30 amino acids in length. Such peptides may be conjugated to the oligos directly or by means of a linker. The following materials and methods are provided to facilitate the practice of the present invention.

Cell Culture

The human colon carcinoma cell lines HCT1 16 and HCT1 16 p53-/- were kiridly provided by Dr. B. Vogelstein (Sidney Kimmel Comprehensive Cancer Center, Baltimore D) and were cultured in McCoy's 5a Medium; the human lung cancer cell line H460 was cultured in RPMl 1640 medium; the human breast cancer cell line MDA-MB-468 was cultured in DMEM (high glucose) medium; the human breast cancer cell line MCF7 and the human leukemia cell lines OCI/AML3 and OCI/AML4 were cultured in a-MEM. All media were supplemented with 10% fetal bovine serum (FBS, Hyclone) and antibiotics. The medium for OCI/AML4 cells was supplemented with 10% conditioned medium from the bladder carcinoma cell line 5637 (Wang et al., 1989). All cells were cultured at 37°C in a 5% CO2 incubator.

PMO Design and Treatment PMOs were synthesized by methods previously described (Summerton and Weller,

1997). The cell penetrating peptides (RXR)₄XB and (RXRRBR)₂XB (where R = arginine, X = 6-aminohexanoic acid and B = β-alanine) were covalently conjugated to the 3'-end of each PMO and (RX)₈B was covalently conjugated to the 5'-end of each PMO through a noncleavable piperazine linker by methods previously described (Wu et al., 2007).

Lyophilized PMOs and PPMOs were dissolved in sterile water to a concentration of 2 mM and stored in the dark at 4°C. Immediately before use, the PMOs were diluted to 0.2 mM in sterile water. Cells were seeded in 10-cm dishes and treated with PMOs for 2 hr in 3 ml of RPMl 1640 medium lacking antibiotics and FBS. At the end of this period, the medium was removed, the cells were washed with RPMI 1640 medium, and the cells were placed in fresh growth medium containing antibiotics and FBS. The cells were then exposed to drug or γ- irradiated as described in the text. Flow Cytometry for Cell Cycle Analysis and Apoptosis

Cells were fixed on ice in cold 70% ethanol, washed twice with PBS containing 1 % BSA, incubated with 100 μg/ml RIMase A for 30 min at 37°C, and resuspended in PBS containing 50 μg/ml propidium iodide. Cell cycle distribution was examined by flow cytometry using a FACScalibur flow cytometer (Becton Dickinson). Apoptosis was assessed by flow cytometry using sub-G l DNA content and by caspase activity using a cell membrane-permeable fluorogenic caspase 3 substrate in non-fixed cells as described by the manufacturer (Biotium, Inc., #30029).

Western Blot Analysis Cells in 10-cm dishes were washed once with PBS (minus calcium and magnesium) and lysed in 1 % NP40 Lysis Buffer (50 mM Tris pH 8.0, 5 mM EDTA, 150 mM NaCl, 1 % NP40 and protease inhibitors). Total protein (40 μg), in the presence of 0.1 % bromophenol blue was loaded onto a 12% polyacrylamide gel containing SDS, subjected to electrophoresis and transferred onto a PVDF membrane. Membranes were blocked in TBST (TBS with 0.05% Tween-20) containing 5% skim milk for 1 hr before incubation with primary antibodies in TBST containing 5% milk for 1 hr at room temperature. Membranes were then washed twice for 10 min in TBST before incubation with secondary antibodies in TBST containing 1 % skim milk for 1 hr.

The following antibodies to p53 were used: DO- 1 (Santa Cruz), FL393 (Santa Cruz), PAbl 801 (Banks et al., 1986) and PAb421 (Harlow et al., 1981 ). Antibodies to p21 and Mdm2 were obtained from Santa Cruz and to β-actin from Sigma. Anti-rabbit and anti- mouse secondary antibodies were conjugated with HRP and blots were visualized using enhanced chemiluminescence (Perkin Elmer).

The following example is provided to illustrate certain embodiments of the invention. It is not intended to limit the invention in any way. EXAMPLE I

Inhibition of p53 expression by peptide-conjugated phosphorodiamidate morpholino oligomers sensitizes human cancer cells to doxorubicin

PPMOs Block p53 Expression and Generate p53 Isoforms

To investigate the effectiveness of PMOs in blocking p53 expression, wild-type p53 expressing breast cancer MCF7 cells were treated with PMOs and PPMOs targeting the translation initiation site of p53 mRNA (Ml ), the splice acceptor site of exon 10 (EI OSA) and the coding region within exon 10 (E10) (Table I ). The CCP used was (RX)gB where R = arginine, X = 6-aminohexanoic acid, and B = β alanine. No overt indications of cellular toxicity were observed during the duration of the experiments at the concentrations of PPMOs tested. A rabbit polyclonal antibody (FL393) was used to evaluate p53 expression by Western immunobiotting (Figure 1 ). EI OSA PPMO interfered with the expression of p53 and produced a smaller stable polypeptide of approximately 48 kDa (p48); an even smaller polypeptide was observed at higher doses of EIOSA. Ml PPMO interfered with p53 expression and produced a stable polypeptide of approximately 44 kDa (p44). The corresponding PMOs without conjugation to the cell penetrating peptide had no effect. E10 targets neither translation initiation nor splicing sites and had no effect on p53 expression regardless of CPP conjugation.

Table 1

PPMO target regions and sequences

PPMO p53 region PPMO sequence 5' - 3'

Ml AUG start codon GCGGCTCCTCCATGGCAGTGAC (1)

M 0 Met 40 codon CATCAAATCATCCATTGCTTGG (2)

E2SD exon 2 AGTTTCCATAGGTCTGAAAA (3)

E4SA intron 3/exon 4 GIIIACTGTAGATGIGTGAA (4)

E6SA exon 6 CGGATAAGATGCTGAGGAGG (5)

E7SA exon 7 GTTGTAGTGGATGGTGGTA (6)

E7SD exon 7 CTGGAGTCTTCCAGTGTGAT (7)

E9SD exon 9 AAGIGTGAAATATTCTCCATC (8)

EIOSA intron 9/exon 10 GCGCTCACGCCCACGGATC (9) E10 exon 10 (internal) CCCTGCTCCCCCCTGGCTCC (10)

Control scrambled control TGCCATCAACATATCTTGATCG (11)

SD, slice donor

SA, splice acceptor; numbers in parentheses are SEQ ID NOS .

To characterize the smaller, p53-related polypeptides further, an immunoblot was carried out using with antibodies directed to specific epitopes of p53 : D01 (aa 1 1 -21 ), PAbl 801 (aa 46-55) and PAb421 (aa 372-382). D01 recognized full length p53 and p48 but not p44; PAbl 801 recognized full length p53, p48 and p44; and PAb421 recognized full length p53, albeit very weakly, and p44 strongly but not p48 (Figure 2). These epitope mapping results indicate that p44 is missing sequences at the N-terminus and that p48 is missing sequences at the C-terminus of the molecule (Figure 3). Moreover, they indicate that p44 and p48 are very stable relative to full length p53.

p44 likely corresponds to ΔΝ-ρ53 (also referred to as p47 or p53/p47), a previously identified stable isoform of p53 that is produced by internal initiation of translation at codon 40 in human p53 mRNA (Bourdon et al., 2005; Courtois et al., 2002;Ghosh et al., 2004;Ray et al., 2006;Yin et al., 2002) and at codon 41 in mouse p53 mRNA. Mouse p44 was initially detected in an erythroleukemia cell line with a deletion of p53 exon 2 that removed the normal translation initiation site (Rovinski et al., 1987). ΔΝ-ρ53 lacks the N-terminal Mdm2 binding site and as a result will not undergo Mdm2-mediated ubiquitination and degradation. p48 likely corresponds to ρ53β (also named p53i9) or ρ53γ, two C-terminally truncated p53 variants produced by alternative splicing of exon 9 to one of two sites in intron 9 (Bourdon et al., 2005;Flaman et al., 1996). Both ρ53β and ρ53γ terminate at Gln331 of p53 and lack amino acids 332-393 that include the oligomerization domain of p53; ρ53β has 10 additional amino acids and ρ53γ has 15 additional amino acids derived from intron 9 sequences. These two p53 variants could not be distinguished between. The elevated level of ρ53β/γ in unstressed cells suggests that the last 62 amino acids of p53 contain key lysine residues for ubiquitination. These results demonstrate that two distinct endogenous p53 isoforms can be expressed at the protein level in MCF7 cells when PPMOs are used to interfere with translation initiation at codon 1 or with splicing at the splice acceptor site of exon 10. PPMOs Block p53 Expression and p21 Induction after DNA Damage

To investigate the expression and function of p44 (ΔΝ-ρ53) and p48 (ρ53β/γ) isoforms in a broader range of cells under stress conditions that activate p53, human H460 lung cancer cells were treated with doxorubicin, human HCT I 16 colon cancer cells with 5- FU, and human OCI/AML-3 and OCI/AML-4 leukemia cells with γ-radiation. All of these human cancer cell lines express wild-type p53 and respond to DNA damage by increasing p53 protein levels and activating expression of the p53-target gene, p21 (Figure 2). Pre- treatment for 2 hr with CP-conjugated Ml or E I OSA prior to DNA damage led to the production of ΔΝ-ρ53 and ρ53β/γ, respectively, as seen previously in MCF7 cells. The levels of these stable p53 isoforms did not increase further after DNA damage. Both M l and

EI OSA interfered with the accumulation of full-length p53 and with the induction of p21 after DNA damage. This was most evident in the OC1/AML cells and in the HCTI 16 cells. The reduced level of p21 induction in doxorubicin-treated H460 cells exposed to E I OSA likely represents the effect of residual full length p53 protein. CP-conjugated E10 had no effect on p53 expression or p21 induction. Together, these results indicate that ΔΝ-ρ53 and ρ53β/γ lack transcriptional activity at the p21 promoter.

Interestingly, when H460 cells were pre-treated with both CP-M I to block translation initiation at Metl and CP-E l OS A to block splicing from exon 9 to exon 10, a novel variant of about 35 kDa was detected. This variant is predicted to be missing N-terminal and C- terminal regions of p53 (ΔΝ-ρ53β/γ) and that it should be missing the N-terminal transactivation domain as well as the C-terminal oligomerization domain of p53. This stable variant was present at similar levels in both doxorubicin-treated and untreated cells that had been pre-treated with l and E I OSA.

Evaluation of Different Cell Penetrating Peptides The arginine-rich peptide that is conjugated to the PMOs facilitates entry into cells

(Nelson et al., 2005). To evaluate whether different arginine-rich peptides might improve the efficiency of the M l PPMO to block translation of p53 mRNA from codon 1 , two different arginine-rich peptides were conjugated to M l and compared these with the original M l PMO containing the (RX)gB sequence at the 5' end. The CCPs tested contained (RXR)₄XB and ( XRRBR)₂XB (R = arginine, X = 6-aminohexanoic acid, and B = β alanine) at the 3 ' end. At least in H460 cells, there was little if any detectable difference in the efficiency of the 3 arginine-rich peptides to repress translation from the targeted codon 1 of the p53 transcript (Figure 4).

Evaluation ofPPMOs that Target p53 mRNA Splicing

In the next series of experiments, a panel of PPMOs that target splice sites in exons 2, 4, 6, 7 and 9 of the human p53 gene were tested (Table 1 ). With the exception of E2SD that targets the splice donor site of exon 2, the remaining PPMOs exhibited variable effectiveness in suppressing p53 protein expression in H460 cells, revealed no new isoforms and did not block expression of p21 in response to doxorubicin (Figure 5). E2SD produced a 44 kDa isoform that resembled ΔΝ-ρ53 and prevented the induction of p21 in response to doxorubicin treatment. These results are consistent with those of Ghosh et al. (2004) who reported that ΔΝ-ρ53 can arise through a naturally occurring, but low abundant, alternatively spliced p53 transcript in which intron 2 sequences are not removed. The alternatively spliced transcript contains an intron 2-derived in-frame termination codon that arrests translation prematurely and was predicted to produce ΔΝ-ρ53 from codon 40. Our findings suggest that E2SD and M l produce identical truncated ΔΝ-ρ53 proteins through two different mechanisms: alternative splicing of exon 2 and alternative initiation of translation at codon 40.

PPMO-mediated Repression of p53 Disrupts p53-dependent Cell Cycle Arrest in Gl and p53-dependent Apoptosis To determine the consequences of using PPMOs to repress p53 expression, the ability of p53 to block cell cycle progression and to promote apoptosis in response to DNA damage was examined. First, a pair of isogenic colon cancer cell lines, HCTl 16 p53+/+ and HCTl 16 p53-/-, with 5-FU (50 μg/ml) were treated for 48 hr and subjected the cells to flow cytometry. A proportion of the p53-+/+ cells but not the p53-/- cells had a sub-G l DNA content characteristic of apoptotic cells (Figure 6A). This confirmed that HCTl 16 cells undergo p53- dependent apoptosis in response to 5-FU (Bunz et al., 1999). Next, the effect of E 10 PPMO, which is unable to block p53 expression, was compared with M l and E l OS A PPMOs on the apoptotic response of HCTl 16 p53+/+ cells to 5-FU. Pre-treatment of these cells with M l or E10SA but not E 10 blocked p53-dependent apoptosis in these cells (Figure 6A). These results also indicate that ΔΝ-ρ53 (produced in response to M l ) and ρ53β/γ (produced in response to E l OS A) are defective in promoting apoptosis in H460 cells. In contrast to HCT 1 16 cells treated with 5-FU, H460 lung cancer cells treated with doxorubicin (200 ng/ml) for 48 hr undergo predominantly cell cycle arrest in G l and G2 M and not cell death (Figure 6B). In the absence of doxorubicin, M l and E10SA had no effect on the cell cycle profile of H460 cells. In the presence of doxorubicin, however, both M l and E 10SA reduced the proportion of cells undergoing G l arrest with no detectable effect on G2/M arrest (Figure 6B). This indicates that H460 cells undergo p53-dependent G 1 arrest. In addition, these results indicate that ΔΝ-ρ53 and ρ53β/γ are defective at promoting cell cycle arrest. Together, these assays using 5-FU-treated HCT1 16 ceils and doxorubicin- treated H460 cells indicate that M l and E 10SA independently suppress p53-dependent cellular responses.

Complete Repression of p53 Expression with PPMOs that Target the Translational Start Codon (Metl) and Met40

Because the inhibition of stress-induced p53 expression has potential clinical use in various pathologies including cancer, it is important to identify PPMOs that effectively block p53 expression. Although M l and E2SD prevent expression of full length p53 and allow the expression of ΔΝ-ρ53 protein that lacks transcriptional activity at the p21 promoter, that the N-terminally truncated p53 protein might retain transcriptional activity on other promoters or that it might possess novel and unanticipated functions (Harms and Chen, 2006). Moreover, ΔΝ-ρ53 retains the oligomerization domain of p53 and might, therefore, function as a trans- dominant repressor of p53 family members including p63 or p73. Transgenic mice generated by microinjection of the genomic fragment encoding mouse p44 show early signs of aging and reduced body size and interestingly, this phenotype is dependent on p53 (Maier et al., 2004). Because ΔΝ-ρ53 can form hetero-tetramers with p53, it is likely that these hetero- tetramers are responsible for the mouse phenotype. Maier et al. (2004) reported that mouse p44 has both positive and negative effects on the transcription regulatory functions of p53 depending on the specific target gene. They concluded that p44 has both dominant and dominant-negative effects on the function of full-length p53. These findings raise substantive concerns with any intervention strategy that produces ΔΝ-ρ53. E 10SA also prevents expression of full-length p53 but gives rise to ρ53β/γ. Although ρ53β/γ lacks the oligomerization domain and was reported to lack transcriptional activity, it retains the ability to bind certain p53-response elements on DNA (Bourdon et al., 2005). To begin to address these concerns, a PPMO-based strategy to block translation from codon 1 and codon 40 (within exon 4) was designed. When the methionine codons at positions 1 are 40 are bypassed, the next available methionine codon bearing a ozak consensus sequence for translation initiation occurs in codon 160 (within exon 5). A p53 mRNA variant that initiates in intron 4 from an internal promoter was previously identified and predicted to initiate translation at codon 133 giving rise to Δ1 33p53 (Bourdon et al., 2005). Whether either of the predicted variants (initiation from codon 133 or codon 160) is expressed at the protein level under physiological or stress conditions is not known. A PPMO that targets codon 40 of p53 mRNA (M40) was designed and tested its ability to repress p53 expression. When used alone, M40 repressed expression of full length p53 in a dose-dependent manner presumably through steric hindrance of the translation elongation machinery, and produced a novel polypeptide of about 35 kDa that was recognized by DO l and FL393 but not PAbl 801 (Figure 7A and 7B). This variant has not been characterized further but could reflect translation of a splicing variant that contains exon 2 sequences (DO l epitope) and is missing exon 4 sequences (Pabl 801 epitope). p21 expression was suppressed but not eliminated by M40 even when used at high concentration ( 10 μΜ). When M40 was used together with M l , however, complete suppression of p53 and ΔΝ-ρ53 (Figure 7B) was observed. This result confirms that ΔΝ-ρ53 initiates from codon 40. A smaller polypeptide of about 33 kDa was detected very weakly by FL393 (and not by Pab l 801 or DO l ) in H460 cells treated with M l and M40. This could represent a p53 translation product initiating from codon 133 (Δ 133ρ53) or codon 160. The Western blot presented in Figure 6B confirms that M l prevents induction of p21 after DNA damage and additionally shows that M l prevents induction of another p53 target gene, Mdm2. The combination of Ml and M40 prevented p21 and Mdm2 induction. Thus, the combined use of Ml and M40 PPMOs provides an effective strategy to block both full-length p53 and ΔΝ-ρ53 protein expression and p53 transcriptional activity in human cells.

PPMO-mediated Repression of p53 Sensitizes H460 cells to Doxorubicin-induced

Apoptosis The role of p53 in determining the cellular response to chemotherapeutic drug treatment is complex and is dependent on cell type and the drug used (Bunz et al., 1999). In some experimental models, p53-deficiency is associated with resistance to DNA damaging agents, whereas in other models p53-deficiency leads to enhanced drug sensitivity (McGill and Fisher, 1999). It remains unclear how p53 determines strikingly different cellular responses to DNA damage and how these responses affect drug sensitivity in a clinical setting. p53-dependent cell cycle arrest in response to DNA damage could provide cells with time to repair the damage prior to DNA synthesis or cell division. In addition, p53 can regulate the expression of anti-oxidant genes, metabolic genes and DNA repair genes that may influence drug sensitivity and cell survival (Vousden and Prives, 2009). The pro- survival function of p53 could mitigate the effects of chemotherapy on tumour cells with wild-type p53 (Kim et al., 2009).

To determine if p53 plays a role in determining the sensitivity of H460 cells to doxorubicin, PPMOs were used to repress p53 expression prior to treatment with doxorubicin. H460 cells were pre-treated with M l alone, M40 alone or both M l and M40 prior to treatment with doxorubicin (200 ng/ml) for 72 hr. Apoptosis was measured using propidium iodide staining and flow cytometry to identify cells with sub-G l DNA content (Figures 8A and 8B) or by using a highly sensitive assay that measures caspase 3 activation (Figure 8C). In the previous experiments reported in Figure 6B, H460 cells were treated with doxorubicin for 48 hr and observed predominantly cell cycle arrest. After longer treatment (72 hr), a small proportion of apoptotic cells could be detected (Figure 8). Both apoptotic assays indicated a significant enhancement (3-fold) of doxorubicin-induced apoptosis when M l was used to block p53 expression. The combined use of M l and M40 was not more effective than M l alone in sensitizing H460 cells to doxorubicin-induced cell death indicating that ΔΝ-ρ53 (produced by Ml ) is defective in promoting survival. These results unmask a pro-survival function of full-length wild-type p53 in H460 cells that limits the effectiveness of doxorubicin in killing these cancer cells. Hence, in certain tumour cells where the predominant response to p53 activation is not apoptosis but rather survival, the inhibition of p53 's protective function may render these cells sensitive to drugs that promote cell death through p53-independent processes.

The Combined Use of Ml and M40 Blocks Mutant p53 Expression in MDA-MB-468 Breast Carcinoma Cells Unlike mutations in other tumour suppressor genes, most p53 mutations in human cancer are missense mutations that lead to the synthesis of stable p53 protein that has lost its normal functions. The retention of mutant p53 in human tumours rather than complete loss of p53 could reflect a gain of function for mutant p53. The generation of mutant p53 knock- in mice that display aggressive and metastatic tumours not seen in p53-null mice provides strong support for this idea (Lang et al., 2004; Olive et al., 2004) . Additional support has been provided by a computational study of p53 mutation hotspots in clinical samples (Koonin et al., 2005). Moreover, mutant p53 expression has been associated with increased cell proliferation, migration, invasion and metastasis through the suppression of p63 (Adorno et al., 2009). These findings suggest that targeting mutant p53 in highly aggressive human tumours could have therapeutic potential.

To test the ability of Ml and M40 to inhibit mutant p53 expression, the breast carcinoma cell line MDA-MB-468 that expresses mutant (R273H) p53 was tested. M l treatment inhibited full length p53 expression and produced ΔΝ-ρ53. When used together, M l and M40 reduced full length p53 without producing ΔΝ-ρ53. These data indicate that M l and M40 are effective at blocking mutant p53 expression in human tumour cells. See Figure 9.

Much of the evidence for the various p53 isoforms is theoretical and based on RT- PCR analysis and ectopic expression of cD As constructs. Endogenous expression of only a few of the reported human p53 isoforms has been detected unambiguously at the protein level. The PPMOs described in this study provide valuable reagents to investigate the structure and function of p53 isoforms that arise naturally upon targeted disruption of splicing or translation. An important finding is the resiliency of p53 expression in response to various efforts to block its expression. It is notable that truncated p53 variants observed in this study are more stable than full-length p53 in unstressed cells including ΔΝ-ρ53, ρ53β/γ, and the smaller ΔΝ-ρ53β/γ and putative Δ133ρ53.

The N-terminus of p53 is reported to contain two independent transcription activation (TA) domains, TA 1 (residues 1 -40) and TA2 (residues 43-63). ΔΝ-ρ53 is missing TA 1 but retains TA2. Previous studies (Yin et al., 2002; Zhu et al., 1998) reported that ectopic expression of ΔΝ-ρ53 activates a subset of p53 target genes including Mdm2 and Bax through TA2; moreover, ΔΝ-ρ53 retains the ability to induce apoptosis. In contrast, our results show that endogenously expressed ΔΝ-ρ53 lacks the ability to activate p21 and Mdm2 expression in stressed or unstressed cells and lacks the ability to promote apoptosis in response to DNA damage.

A number of strategies have been proposed to exploit the defective G l checkpoint status of cancer cells with mutant p53 (Wang and El-Deiry, 2004; Wiman, 2006). Our studies suggest that these strategies could be applied more broadly to include cancers that retain wild-type p53 alleles through the use of PMOs to block p53 expression in these tumours.

Transient p53 repression may be beneficial not only in tumour cells but also as a means of limiting normal tissue damage in response to irradiation or chemotherapy.

Reducing p53 induction may also be therapeutically beneficial in a wide variety of medical disorders that involve p53-dependent programmed cell death such as during ischemia or during subsequent reperfusion injury and in various neurodegenerative diseases.

REFERENCES

Abes, R., Arzumanov, A., Moulton, H., Abes, S., Ivanova, G., Gait, M.J., Iversen, P. and Lebleu, B. (2008). Arginine-rich cell penetrating peptides: design, structure-activity, and applications to alter pre-mRNA splicing by steric-block oligonucleotides. J. Pept. Sci. 4, 455- 460. Adorno, M., Cordenonsi, M., ontagner, M., Dupont, S., Wong, C, Hann, B., Solari, A., Bobisse, S., Rondina, M.B., Guzzardo, V. et al . (2009). A mutant-p53/Smad complex opposes p63 to empower TGFp-induced metastasis. Cell /, 87-98.

Banks, L., Matlashewski, G. and Crawford, L. (1986). Isolation of human-p53-specific monoclonal antibodies and their use in the studies of human p53 expression. Eur. J. Biochem. 3, 529-534.

Bourdon, J.C., Fernandes, K., Murray-Zmijewski, F., Liu, G., Diot, A., Xirodimas, D.P., Saville, M. . and Lane, D.P. (2005). p53 Isoforms can Regulate p53 Transcriptional Activity. Genes Dev. 18, 2122-2137.

Bunz, F., Hwang, P.M., Torrance, C, Waldman, T., Zhang, Y., Dillehay, L., Williams, J., Lengauer, C, Kinzler, K.W. and Vogelstein, B. (1999). Disruption of p53 in human cancer cells alters the responses to therapeutic agents. J. Clin. Invest. 3, 263-269.

Courtois, S., Verhaegh, G., North, S., Luciani, M.G., Lassus, P., Hibner, U., Oren, M. and Hainaut, P. (2002). DeltaN-p53, a natural isoform of p53 lacking the first transactivation domain, counteracts growth suppression by wild-type p53. Oncogene 44, 6722-6728. Flaman, J.M., Waridel, F., Estreicher, A., Vannier, A., Limacher, J.M., Gilbert, D., Iggo, R. and Frebourg, T. (1996). The human tumour suppressor gene p53 is alternatively spliced in normal cells. Oncogene 4, 813-818.

Ghosh, A., Stewart, D. and Matlashewski, G. (2004). Regulation of human p53 activity and cell localization by alternative splicing. Mol. Cell. Biol. 18, 7987-7997.

Harlow, E., Crawford, L.V., Pim, D.C. and Williamson, N.M. ( 1981 ). Monoclonal antibodies specific for simian virus 40 tumor antigens. J. Virol. 3, 861 -869.

Harms, K.L. and Chen, X. (2006). The functional domains in p53 family proteins exhibit both common and distinct properties. Cell Death Differ. 6, 890-897. Iversen, P.L. (2001 ). Phosphorodiamidate morpholino oligomers: favorable properties for sequence-specific gene inactivation. Curr. Opin. Mol. Ther. 3, 235-238.

Kim, E., Giese, A. and Deppert, W. (2009). Wild-type p53 in cancer cells: when a guardian turns into a blackguard. Biochem. Pharmacol. 1, 1 1 -20.

Koonin, E.V., Rogozin, I.B. and Glazko, G.V: (2005). p53 gain-of-function: tumor biology and bioinformatics come together. Cell Cycle 5, 686-688.

Lang, G.A., Iwakuma, T., Suh, Y.A., Liu, G., Rao, V.A., Parant, J.M., Valentin-Vega, Y.A., Terzian, T., Caldwell, L.C., Strong, L.C., El-Naggar, A.K. and Lozano, G. (2004). Gain of function of a p53 hot spot mutation in a mouse model of Li-Fraumeni syndrome. Cell 6, 861 - 872. Maier, B., Gluba, W., Bernier, B., Turner, T., Mohammad, K., Guise, T., Sutherland, A.,

Thorner, M. and Scrable, H. (2004). Modulation of mammalian life span by the short isoform of p53. Genes Dev. 3, 306-319. cGill, G. and Fisher, D.E. ( 1999). p53 and cancer therapy: a double-edged sword. J. Clin. Invest. 3, - 223-225. Nelson, M.H., Stein, D.A., Kroeker, A.D., Hatlevig, S.A., Iversen, P.L. and Moulton, H.M. (2005). Arginine-rich peptide conjugation to morpholino oligomers: effects on antisense activity and specificity. Bioconjug. Chem. 4, 959-966. Olive, .P., Tuveson, D.A., Ruhe, Z.C., Yin, B., Willis, N.A., Bronson, R.T., Crowley, D. and Jacks, T. (2004). Mutant p53 gain of function in two mouse models of Li-Fraumeni syndrome. Cell 6, 847-860.

Ray, P.S., Grover, R. and Das, S. (2006). Two internal ribosome entry sites mediate the translation of p53 isoforms. EMBO Rep. 4, 404-410.

Rovinski, B., Munroe, D., Peacock, J., Mowat, M., Bernstein, A. and Benchimol, S. ( 1987). Deletion of 5'-coding sequences of the cellular p53 gene in mouse erythroleukemia: a novel mechanism of oncogene regulation. Mol. Cell. Biol. 2, 847-853.

Summerton, J. and Weller, D. (1997). Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev. 3, 187- 195.

Vousden, .H. and Prives, C. (2009). Blinded by the light: the growing complexity of p53. Cell 5, 41 3-431 .

Wang, C, Curtis, J.E., Minden, M.D. and McCulloch, E.A. ( 1989). Expression of a retinoic acid receptor gene in myeloid leukemia cells. Leukemia 4, 264-269. Wang, S. and El-Deiry, W.S. (2004). The p53 pathway: targets for the development of novel cancer therapeutics. Cancer Treat. Res. 175-187.

Wiman, K.G. (2006). Strategies for therapeutic targeting of the p53 pathway in cancer. Cell Death Differ. 6, 921 -926.

Wu, R.P., Youngblood, D.S., Hassinger, J.N., Lovejoy, C.E., Nelson, M.H., Iversen, P.L. and Moulton, H.M. (2007). Cell-penetrating peptides as transporters for morpholino oligomers: effects of amino acid composition on intracellular delivery and cytotoxicity. Nucleic Acids Res. 15, 5182-5191.

Yin, Y., Stephen, C.W., Luciani, M.G. and Fahraeus, R. (2002). p53 Stability and activity is regulated by Mdm2-mediated induction of alternative p53 translation products. Nat. Cell Biol. 6, 462-467.

Zhu, J., Zhou, W., Jiang, J. and Chen, X. ( 1998). Identification of a novel p53 functional domain that is necessary for mediating apoptosis. J. Biol. Chem. 21, 13030- 13036. While certain of the preferred embodiments of the present invention have been described and specifically exemplified above, it is not intended that the invention be limited to such embodiments. It will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the scope of the present invention, as set forth in the following claims.

Claims

What is claimed is:

1. A phosphorodiamidate mopholino oligomer operably linked to a cell penetrating peptide (CPP) which is effective to down modulate expression of p53 and splice variants thereof, wherein said oligomer has a sequence selected from the group consisting SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 9.

2. A composition comprising at least one oligomer of claim 1 in a biologically acceptable carrier.

3. The composition of claim 2, comprising SEQ ID NO: 1 and SEQ ID NO: 2.

4. The oligomer of claim 1, wherein said CPP is selected from the group consisting of polyarginine, (RXR)4XB and (RXRRBR^XB where R is arginine, X is 6-aminohexanoic acid and B is beta-alanine.

5. The oligomer of claim 4, wherein said CPP is conjugated at the 3 ' end of said sequence.

6. The oligomer of claim 4, wherein said CPP is conjugated at the 5 'end of said sequence.

7. A method for inhibiting expression of p53 and splice variants thereof in a target cell, comprising administration of an effective amount of the composition of claim 1, wherein said oligomer hybridizes with a p53 encoding nucleic acid and thereby inhibits expression of p53 and splice variants thereof relative to cells not treated with said composition.

8. The method of claim 7, wherein SEQ ID NO: 1 and SEQ ID NO: 2 are

administered to said target cell.

9. The method of claim 8, wherein said target cell is a cancer cell.

10. The method of claim 9, further comprising administration of a chemotherapeutic agent.

11. The method of claim 9, further comprising exposing said cell to radiation.

12. The method of claim 7, wherein said inhibition of p53 expression is transient and limits normal tissue damage in response to radiation or chemotherapy.