WO2014010900A1 - Composition for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives - Google Patents

Composition for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives Download PDF

Info

Publication number
WO2014010900A1
WO2014010900A1 PCT/KR2013/006061 KR2013006061W WO2014010900A1 WO 2014010900 A1 WO2014010900 A1 WO 2014010900A1 KR 2013006061 W KR2013006061 W KR 2013006061W WO 2014010900 A1 WO2014010900 A1 WO 2014010900A1
Authority
WO
WIPO (PCT)
Prior art keywords
composition
hair
chemical formula
alkyl
growth
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/KR2013/006061
Other languages
French (fr)
Other versions
WO2014010900A9 (en
Inventor
Tae Sun Park
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Industry Academic Cooperation Foundation of Yonsei University
Original Assignee
Industry Academic Cooperation Foundation of Yonsei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Industry Academic Cooperation Foundation of Yonsei University filed Critical Industry Academic Cooperation Foundation of Yonsei University
Priority to JP2014542261A priority Critical patent/JP6145106B2/en
Priority to US14/356,162 priority patent/US9636289B2/en
Publication of WO2014010900A1 publication Critical patent/WO2014010900A1/en
Publication of WO2014010900A9 publication Critical patent/WO2014010900A9/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/30Cosmetics or similar toiletry preparations characterised by the composition containing organic compounds
    • A61K8/60Sugars; Derivatives thereof
    • A61K8/602Glycosides, e.g. rutin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders
    • A61P17/14Drugs for dermatological disorders for baldness or alopecia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q7/00Preparations for affecting hair growth

Definitions

  • the present invention relates to a composition and a method for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives.
  • the numbers of patients of 'hair loss diseases' are estimated at 103,000 people in 2001, at 142,000 people in 2005 and at 165,000 people in 2008. It has increased by 60% for seven years.
  • the number of patients in 20s to 40s is estimated at 114,000 people and it is accounted for 69.5% of whole patients.
  • the number of patients in 10s is estimated at more than 22,000 people.
  • the numbers of patients are estimated at 84,000 people in male, and at 80,000 people in female.
  • the numbers of patients of hair loss disease in 2008 Korean Health Insurance treatment are alopecia areata (130,000 people), cicatricial alopecia (20,000 people), androgenetic alopecia (9,000 people) and other nonscarring hair loss (8,000 people) in order.
  • hair loss patients are 250 million people, and prevalence rate of hair loss patients between the ages of twenty-four and fifty years old is 30-65%.
  • the number of hair loss patients is 300 million people in 2008. 30% of 30s and 50% of 50s in male show signs of hair loss, and the number of hair loss patients are increased by 10-15% every year.
  • prevalence rate of hair loss is 26.5%, and the number of hair loss patients is estimated at 12.93 million people.
  • Minoxidil has been recognized as drug available to purchase without a doctor's prescription in safety and efficacy, and it has been firstly approved as spread drugs for treating hair loss from the U.S. FDA in December 1997. It improves blood circulation and opens potassium channels to promote hair growth. However, it has side effects such as itching, rash and frequent pulse.
  • Quasi-products for hair loss prevention and hair growth functions approved from Korea Food & Drug Administration include 'Mobalryeok confidence (CJ lion)', 'Hair Tonic (Moracle)' and 'Moaenmoah (LG Household & Health Care)'. Products of cosmetics and shampoos have been sold to maintain or promote health of skin and hair.
  • the anagen is the active growth phase of hair follicles during which the root of the hair is diving rapidly, adding to the hair shaft.
  • the life span of hairs in the anagen stage ranges from 3 to 6 years. Hairs in the anagen phase accounts for 80-90% of the entire hair. In hair loss in progress, shorter anagen and longer catagen lead to reduce the proportion of anagen in the entire hair.
  • catagen stage after anagen stage the metabolism of hairs becomes to be slower with maintaining the shape of hairs and hair grows slowly. The catagen stage continues for 1-1.5 months and occupies 1% of total hairs.
  • telogen phase hair follicle is gradually contracted, and the hair root is pushed upward to be finally removed. This phase lasts for about 3-4 month, and accounts for 4-14% of total hairs.
  • hair bulbs which is surrounded by hair follicles in the anagen stage, combines with hair papilla to induce the formation of new hairs. Afterwards, the new hairs push upward and naturally remove old hairs in the talogen stage.
  • Oleuropein contained in large quantities in olive leaf and olive oil is a secoiridoid compound with slightly bitter scent of olive leaf.
  • Oleuropein has a molecular formula of C25H32O13 and a molecular weight of 540.514, represented by the following chemical formula:
  • Biological activity of oleuropein is known to be effective in antioxidant, antiviral, anticancer, antibacterial, antiobesity and improvement of non-alcoholic fatty liver.
  • oleuropein there is no toxicity of oleuropein in mouse treated with 1 g/kg (body weight) of oleuropein for 7 days, and LD 50 of oleuropein may not be calculated through various experiments. Therefore, it is suggested that oleuropein is a substance with a significant high safety.
  • the present inventors have made intensive researches to develop novel compounds or derivatives thereof derived from natural substances having therapeutic efficacies for preventing or treating hair loss or promoting hair growth. As a result, they have found out that secoiridoid glucoside derivatives ⁇ e.g., oleuropein) contained in plant belonging to the family Oleaceae simulate hair growth and prevent hair loss with high efficiency through various tests.
  • secoiridoid glucoside derivatives ⁇ e.g., oleuropein
  • a pharmaceutical composition for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives, more specifically oleuropein, or hydrolysate thereof.
  • Fig. 1 represents the results on hair re-growth with the lapse of time of hair restorer injection in mouse model removed hair.
  • Fig. 2 represents the graph of grown hair length during the experimental period in mouse subcutaneously injected with hair restorers. The results are represented as mean ⁇ SEM (standard error) of values obtained from eighty four (84) mice. The characters above the bars indicate significant difference among dietary groups by one-way analysis of variance (ANOVA) test and Duncan's multiple range test (P ⁇ 0.05).
  • ANOVA analysis of variance
  • Fig. 3 represents the results on histological analysis in the back skin of mouse subcutaneously injected with hair restorer for 6 weeks. The results are represented as mean ⁇ SEM (standard error) of values obtained from four (4) mice. The characters above the bars indicate significant difference among dietary groups by one-way analysis of variance (ANOVA) test and Duncan's multiple range test (P ⁇ 0.05).
  • ANOVA analysis of variance
  • Fig. 4 represents the results on expression changes of hair growth -related proteins in the back skin of mouse subcutaneously injected with hair restorer.
  • Fig. 5 represents the results on expression changes of hair growth-related genes in the back skin of mouse subcutaneously injected with hair restorer.
  • the characters above the bars indicate significant difference among dietary groups by one-way analysis of variance (ANOVA) test and Duncan's multiple range test (P ⁇ 0.05).
  • a pharmaceutical composition for preventing or treating hair loss or promoting hair growth comprising administering to a mammalian subject in need thereof a therapeutically effective amount of a composition comprising a secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient:
  • Ri and R 2 is independently C C 4 alkyl; R 3 -R 7 are independently hydrogen, hydroxy or C1-C4 alkyl; m is an integer of 1 to 3; and n is an integer of 1 to 4.
  • the present inventors have made intensive researches to develop hovel compounds or derivatives thereof derived from natural substances having therapeutic efficacies for preventing or treating hair loss or promoting hair growth. As a result, they have found out that secoiridoid glucoside derivatives ⁇ e.g., oleuropein) contained in plant belonging to the family Oleaceae simulate hair growth and prevent hair loss with high efficiency through various tests.
  • secoiridoid glucoside derivatives ⁇ e.g., oleuropein
  • oleuropein converts hairs of the telogen to hairs of the anagen, and increases the number of hair follicles and expressions of growth factors related hair growth in skin tissue such that ultimately, hair density per unit skin area significantly increased.
  • elenolic acid in which glycosyl group of secoiridoid glucoside derivatives is hydrolyzed to form, shows same or similar level of biological activity of oleuropein (U.S. Patent Nos. 6,117,844 and 6,455,580). This elenolic acid may be also formed when secoiridoid glucoside derivatives are metabolized in vivo. Therefore, it is apparent that hydrolysates of secoiridoid glucoside derivatives may also show similar efficacies to oleuropein for preventing or treating hair loss or promoting hair growth, to those skilled in this art.
  • alkyl refers to a saturated hydrocarbon radical, which may be straight or branched. For example, it includes methyl, ethyl, propyl, isobutyl, pentyl or hexyl.
  • Ci-G alkyl means an alkyl group having an alkyl unit of 1-4 carbon atoms. When the Q.G, alkyl is substituted, the number of carbons in the substituent is not included.
  • Ri and R 2 in the Chemical Formula 1 is independently Q-C 2 alkyl; R 3 -R 7 are independently hydrogen or hydroxy; m is 1; and n is 2.
  • the secoiridoid glucoside derivative in the Chemical Formula 1 is a compound represented by the Chemical Formula 2:
  • the compound represented by the Chemical Formula 2 is oleuropein.
  • Plant belonging to the family Oleaceae containes a lot of oleuropein in fruits, roots, stems, particularly, leaves, and includes approximately more than 600 species in 24 of genus.
  • the plant belonging to the family Oleaceae used in the present invention is not particularly limited as long as it contains secoiridoid glucoside derivative including oleuropein, and preferably olive tree (Olea europaea), plant from genus Ligustrum, plant from genus Syringa, plant from genus Fraxinus, plant from genus Jasminum or plant from genus Osmahthus.
  • the extract of plant belonging to the family Oleaceae containing secoiridoid glucoside derivative may be obtained using conventional extraction solvents, and preferably the extraction solvent used in this invention includes (a) absolute or hydrous lower alcohol containing 1-4 carbon atoms e.g., methanol, ethanol, propanol, butanol, n-propanol, iso-propanol and n-butanol), (b) mixture of lower alcohol and water, (c) acetone, (d) ethyl acetate, (e) chloroform, (f) 1,3-butyleneglycol, (g) hexane, (h) diethylether, (i) butyl acetate or (j) water.
  • the extraction solvent used in this invention includes (a) absolute or hydrous lower alcohol containing 1-4 carbon atoms e.g., methanol, ethanol, propanol, butanol, n-propanol, iso-propan
  • the fraction of plant belonging to the family Oleaceae containing secoiridoid glucoside derivative refers to a isolated/purificated form obtained by additional separation/purification to the extract of plant belonging to the family Oleaceae.
  • active fractions obtained using a variety of additional purification methods such as an ultrafiltration with defined molecular weight cut-off value and various chromatography (designed for purification dependent upon size, charge, hydrophobicity and affinity) are included in the present extracts.
  • the secoiridoid glucoside derivative may be synthesized chemically.
  • a method for synthesizing oleuropein is described accurately in PCT Application Publication NO. WO96/14064.
  • the present composition increases expressions of IGF-1 (Insulin-like growth factor 1), VEGF (vascular endothelial growth factor), HGF (hepatocyte growth factor), KGF (keratocyte growth facfor) or ⁇ -Catenin.
  • IGF-1 Insulin-like growth factor 1
  • VEGF vascular endothelial growth factor
  • HGF hepatocyte growth factor
  • KGF keratocyte growth facfor
  • the present inventors have made various researches to verify that the present composition simulates hair growth in the molecular level. As a result, they have found out that the present composition significantly increases expression levels of ⁇ -catenin as well as IGF1, VEGF, HGF and KGF as growth factors which influence on promotion of hair growth, whereby ⁇ -catenin signaling pathway is activated. It has been known that ⁇ -catenin signaling pathway play a pivotal role in hair follicle generation and hair growth. Therefore, the present composition may be applied to an effective hair restorer composition having various and stable efficacies for promoting hair growth.
  • the present composition may be prepared to a pharmaceutical composition for preventing or treating hair loss.
  • the pharmaceutical composition of the present disclosure may comprise a pharmaceutically acceptable carrier.
  • the pharmaceutical composition may contain a pharmaceutically acceptable carrier.
  • the pharmaceutically acceptable carrier may be conventional one for formulation, including lactose, dextrose, sucrose, sorbitol, mannitol, starch, rubber arable, potassium phosphate, arginate, gelatin, potassium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methyl cellulose, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and mineral oils, but not limited to.
  • the pharmaceutical composition according to the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, and a preservative. Details of suitable pharmaceutically acceptable carriers and formulations can be found in Remington's Pharmaceutical Sciences (19th ed., 1995), which is incorporated herein by reference.
  • the pharmaceutical composition of this invention may be preferably administered orally or parenterally, more preferably subcutaneously injection.
  • a suitable dose of the pharmaceutical composition of the present invention may vary depending on pharmaceutical formulation methods, administration methods, the patient's age, body weight, sex, severity of diseases, diet, administration time, administration route, an excretion rate and sensitivity for a used pharmaceutical composition. Physicians of ordinary skill in the art can determine an effective amount of the pharmaceutical composition for desired treatment. Generally, the pharmaceutical composition of the present invention may be administered with a daily dose of 0.001-100 mg/kg (body weight).
  • the pharmaceutical composition may be formulated with pharmaceutically acceptable carrier and/or vehicle as described above, finally providing several forms including a unit dose form and a multi-dose form.
  • the formulation may be in the form of a solution in oily or aqueous medium, a suspension, a syrup, a emulsion, an extract, an elixir, a powder, a granule, a tablet or a capsule, and may further include a dispersant or stabilizer.
  • a cosmetic composition for improving hair loss or promoting hair growth comprising secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient.
  • the present cosmetic composition includes the secoiridoid glucoside derivative or its hydrolysate the Chemical Formula 1 as an active ingredient, and also the components that are generally used in the cosmetic composition, in which the components include for example, general adjurvants, such as an antioxidant, a stabilizer, a dissolving agent, vitamins, pigments, and flavouring, and carriers.
  • general adjurvants such as an antioxidant, a stabilizer, a dissolving agent, vitamins, pigments, and flavouring, and carriers.
  • the cosmetic compositions of this invention may be formulated in a wide variety of forms, for example, including a solution, a suspension, an emulsion, a paste, an ointment, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a powder foundation, an emulsion foundation, a wax foundation and a spray.
  • the cosmetic compositions of this invention may be formulated in the form of skin softner, nutrient liquid, nutrient cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.
  • the cosmetic composition is in the form of paste, cream or gel, it may comprise animal and vegetable fats, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silica, talc, zinc oxide or mixtures of these substances.
  • powder or spray it may comprise lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder and mixtures of these substances.
  • Spray may additionally comprise the customary propellants, for example, chlorofluorohydrocarbons, propane/butane or dimethyl ether.
  • the formulation of solution and emulsion may comprise solvent, solubilizer and emulsifier, for example water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol, oils, glycerol fatty esters, polyethylene glycol and fatty acid esters of sorbitan.
  • solvent solubilizer and emulsifier
  • solubilizer and emulsifier for example water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol, oils, glycerol fatty esters, polyethylene glycol and fatty acid esters of sorbitan.
  • the formulation of suspension may comprise liquid diluents, for example water, ethanol or propylene glycol, suspending agents, for example ethoxylated isosteary alcohols, polyoxyethylene sorbitol esters and poly oxyethylene sorbitan esters, micocrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth.
  • liquid diluents for example water, ethanol or propylene glycol
  • suspending agents for example ethoxylated isosteary alcohols, polyoxyethylene sorbitol esters and poly oxyethylene sorbitan esters, micocrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth.
  • the formulation of cleansing compositions with surfactant may comprise aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosucinnate monoester, isothinate, imidazolium derivatives, methyltaurate, sarcocinate, fatty acid amide ether sulfate, alkyl amido betain, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanoline derivatives or ethoxylated glycerol fatty acid ester.
  • a functional food composition for improving hair loss or promoting hair growth comprising secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient.
  • the food composition of the present disclosure may comprise, in addition to the secoiridoid glucoside derivative or its hydrolysate the Chemical Formula i of the present disclosure as the active ingredient, ingredients commonly added for preparation of food.
  • ingredients commonly added for preparation of food For example, proteins, carbohydrates, fats, nutrients, seasoning or flavors may be added.
  • the carbohydrate may be, for example, a sugar such as a monosaccharide, e.g. glucose, fructose, etc., a disaccharide, e.g. maltose, sucrose, oligosaccharide, etc. or a polysaccharide, e.g. dextrin, cyclodextrin, etc.
  • the flavor may be a natural flavor [thaumatin, stevia extract ⁇ e.g. rebaudioside A, glycyrrhizin, etc.)] or a synthetic flavor (saccharin, aspartame, etc.).
  • the food composition of the present disclosure when prepared as a drink, it may further comprise, in addition to nonenal of the present disclosure as the active ingredient, citric acid, high-fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, eucommia extract, jujube extract, licorice extract, or the like.
  • a method for preventing or treating hair loss or promoting hair growth comprising administering to a mammalian subject in need thereof a therapeutically effective amount of a composition comprising a secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient:
  • the present invention provides a pharmaceutical composition for preventing or treating hair loss, comprising a secoiridoid glucoside derivative or its hydrolysate as an active ingredient.
  • the present invention provides a cosmetic composition or functional food composition for improving hair loss or promoting hair growth, comprising a secoiridoid glucoside derivative or its hydrolysate as an active ingredient.
  • the present invention not only includes natural compounds as an active ingredient without side effects of the long-term treatment in a chronic disease hair loss, but also shows excellent effects for simulating hair growth with stable efficacy. Therefore, the present composition may be used as an effective cosmetic or functional food composition for treating hair loss or promoting hair growth.
  • Example 1 Efficacy of oleuropein for promoting hair growth
  • Corn oil used as the vehicle and minoxidil used as the control group were purchased from Sigma-Aldrich.
  • the test substance oleuropein was purchased from Extrasynthese.
  • mice in telogen were used for test. Hairs of their back were removed using a clipper for mouse. They were subcutanedusly injected with 0.1 ml. of sample at the part, everyday. Before subcutaneous injection, the test substance oleuropein (0.8 mg/0.1 mL) and the control drug minoxidil were dissolved in corn oil to use. The negative control group was subcutaneously injected with only vehicle (com oil). The application was performed once, every P.M. 4:00 for 6 weeks. At 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks and 6 weeks after the application, mice were anaesthetized with ether to take pictures of their back in order to verify hair growth state. To assess level of hair grdwth, the hair length was measured using ruler.
  • Body weight was measured weekly during entire test period, from the point before the subcutaneous injection of the hair restorers to the end point of the subcutaneous injection of the hair restorers. There are no significant differences between the negative control group (Con), the test group (Ole) and the positive control group (MXD) in the body weights at 6 weeks as well as the initial body weights.
  • mice injected subcutaneously with corn oil hairs were rarely grown after 6 weeks.
  • mice injected subcutaneously with oleuropein hairs were grown at 3 weeks.
  • hairs were vigorously grown at 6 weeks. Accordingly, it would be determined that oleuropein has more excellent effect for promoting hair growth than that of the minoxidil (Fig. 1).
  • mice were sacrificed. Their back skin tissue samples were isolated using scissors and forceps and fixed by formalin. After dehydration with serial alcohol and xylene, the tissues were paraffinized. Paraffinized tissues were sectioned using a microtomb in a thickness of 5 pm and used alcohol and xylene to remove paraffin. Then, the tissues were stained with hematoxyline/eosin, followed by observation of histological changes in hair follicles under an optical microscope. The hair growth cycles in the tissues were pathologically diagnosed by specialists, and quantity and diameter of hair follicle were measured under an optical microscope.
  • the measurement results of the number of hair follicles under an optical microscope of 40X magnification are shown in Fig 3.
  • the number of hair follicles in the Ole group and the MXD group was significantly increased as compared to the negative control group.
  • the diameter of the hair follicles in the Ole group and the MXD group was significantly increased as compared to the negative control group.
  • Example 2 Expression controls of hair growth-related genes and proteins by oleuropein
  • each primary antibody to IGF1 and ⁇ -catenin was diluted to 1:50, added to tissue sections, and incubated for 12 hours at room temperature.
  • the primary antibody was diluted with the mixture of 0.1% normal goat serum (Vector Laboratories Inc.) and 0.3% Triton X-100 (Sigma) in 0.1 M phosphate buffer solution (PB).
  • PB phosphate buffer solution
  • the tissue sections were washed twice at room temperature for 15 minutes in 0.1M PB.
  • secondary antibody biotinylated anti-rabbit IgG (Vector Laboratories Inc.)] was diluted to 1:200, added to the tissue sections, and incubated for 1 hour at room temperature.
  • tissue sections were washed twice at room temperature for 15 minutes in 0.1M PB, soaked in peroxidase-labeled ABC solution, and incubated for 1 hour at room temperature.
  • the tissue sections were washed twice at room temperature for 15 minutes in 0.1M PB.
  • the tissue sections were reacted for 5 min with a solution in which 30 mg of 3-3' diaminobenzidine was dissolved in 150 ml of 0.1M PB, added with concentration of 0.005% of hydrogen peroxide, and reacted for 5 min to occur color reaction.
  • the tissue sections were washed several times at room temperature in 0.1M PB.
  • the tissues were counterstained with hematoxyline for 20 sec, dehydrated, transparentized and mounted, followed by observation under an optical microscope.
  • RNA sample concentration was measured at a wavelength of 260 hm and 280 nrh using a UV/VIS spectrophotometer (Beckman coulter, DU730) and the integrity of RNA sample was verified by agarose gel electrophoresis.
  • RNA sample obtained was trasnscribed using oligo dT primer and Superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) to synthesize cDNA.
  • the PCR amplification was performed using the cDNA as templates and primers complementary to cDNA 5' and 3' flanking sequence.
  • the primers were synthesized by Bioneer Inc. to use and the sequences of the primers used are presented in Table 2.
  • PCR reaction was conducted in the final volume of 50 pL containing 5 pL of 10X reaction buffer solution [lOOmM KCL, 20 mM Tris-HCL (pH 8.0), 2.5 mM MgCI 2 ], 4 ⁇ 1_ of 10 mM dNTP, each 1 pL of 0.2 ⁇ sense and antisense primer, 2 ⁇ _ of cDNA, 2.5 unit of Tag polymerase (Takara, Japan) and distilled water.
  • the PCR condition was set for 4 min at 95°C, 30 sec at 94°C, 30 cycles of 30 sec at 52°C and 45 sec at 72°C, and 10 min at 72°C.
  • 1 ⁇ _ of the amplified product was resolved oh agarose gel electrophoresis.
  • CAGCAU 1 I CAGCACTCTGC
  • GPDH enase
  • IGF1 insulin-like growth factor 1
  • VEGF vascular endothelial growth factor
  • HGF hepatocyte growth factor
  • KGF keratocyte growth facfor
  • oleuropein not only activates hair follicle to return to the anagen by accelerating length growth of hair follicles, but also increases expressions of IGF1, HGF, VEGF and KGF to stimulate hair re-growth.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Dermatology (AREA)
  • Molecular Biology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Birds (AREA)
  • Cosmetics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)

Description

COMPOSITION FOR PREVENTING OR TREATING HAIR LOSS OR PROMOTING HAIR GROWTH COMPRISING SECOIRIDOID GLUCOSIDE
DERIVATIVES
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims priority from Korean Patent Application No. 10-2012- 0074407, filed on 09 July 2012, in the Korean Intellectual Property Office, the disclosure of which is incorporated herein by reference.
BACKGROUND OF THE INVENTION FIELD OF THE INVENTION
The present invention relates to a composition and a method for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives.
DESCRIPTION OF THE RELATED ART
According to the report of National Health Insurance Corporation from 2001 to 2008, the numbers of patients of 'hair loss diseases' are estimated at 103,000 people in 2001, at 142,000 people in 2005 and at 165,000 people in 2008. It has increased by 60% for seven years. The number of patients in 20s to 40s is estimated at 114,000 people and it is accounted for 69.5% of whole patients. In addition, the number of patients in 10s is estimated at more than 22,000 people. The numbers of patients are estimated at 84,000 people in male, and at 80,000 people in female. The numbers of patients of hair loss disease in 2008 Korean Health Insurance treatment are alopecia areata (130,000 people), cicatricial alopecia (20,000 people), androgenetic alopecia (9,000 people) and other nonscarring hair loss (8,000 people) in order.
In abroad, according to data in June 2003 International Hair and Beauty Studies, hair loss patients are 250 million people, and prevalence rate of hair loss patients between the ages of twenty-four and fifty years old is 30-65%. In China, the number of hair loss patients is 300 million people in 2008. 30% of 30s and 50% of 50s in male show signs of hair loss, and the number of hair loss patients are increased by 10-15% every year. In Japan, prevalence rate of hair loss is 26.5%, and the number of hair loss patients is estimated at 12.93 million people.
Currently, drugs for treating hair loss are classified as pharmaceutical medicines, quasi-drugs and cosmetics. Prescription drug on the doctor's is 'Propecia' developed by Merck (U.S.), and its active ingredient Finasteride has been approved as drugs for treating hair loss from the U.S. FDA in December 1997. Finasteride inhibits 5-a-reductase which converts testosterone to dihydrotestosterone (DHT), whereby it results in growth of thick and long hair. Although it has an effect for alleviating hair loss in the short term, side effects such as impotence, sexual dysfunction and male breast enlargement have been reported. Minoxidil has been recognized as drug available to purchase without a doctor's prescription in safety and efficacy, and it has been firstly approved as spread drugs for treating hair loss from the U.S. FDA in December 1997. It improves blood circulation and opens potassium channels to promote hair growth. However, it has side effects such as itching, rash and frequent pulse.
Quasi-products for hair loss prevention and hair growth functions approved from Korea Food & Drug Administration include 'Mobalryeok confidence (CJ lion)', 'Hair Tonic (Moracle)' and 'Moaenmoah (LG Household & Health Care)'. Products of cosmetics and shampoos have been sold to maintain or promote health of skin and hair.
Hair production occurs in phases, including growth (anagen), cessation (catagen), and rest (telogen) phases. The anagen is the active growth phase of hair follicles during which the root of the hair is diving rapidly, adding to the hair shaft. The life span of hairs in the anagen stage ranges from 3 to 6 years. Hairs in the anagen phase accounts for 80-90% of the entire hair. In hair loss in progress, shorter anagen and longer catagen lead to reduce the proportion of anagen in the entire hair. In catagen stage after anagen stage, the metabolism of hairs becomes to be slower with maintaining the shape of hairs and hair grows slowly. The catagen stage continues for 1-1.5 months and occupies 1% of total hairs. In the telogen phase, hair follicle is gradually contracted, and the hair root is pushed upward to be finally removed. This phase lasts for about 3-4 month, and accounts for 4-14% of total hairs. Lastly, at the new anagen, hair bulbs which is surrounded by hair follicles in the anagen stage, combines with hair papilla to induce the formation of new hairs. Afterwards, the new hairs push upward and naturally remove old hairs in the talogen stage.
Oleuropein contained in large quantities in olive leaf and olive oil is a secoiridoid compound with slightly bitter scent of olive leaf. Oleuropein has a molecular formula of C25H32O13 and a molecular weight of 540.514, represented by the following chemical formula:
Figure imgf000004_0001
Biological activity of oleuropein is known to be effective in antioxidant, antiviral, anticancer, antibacterial, antiobesity and improvement of non-alcoholic fatty liver. In addition, there is no toxicity of oleuropein in mouse treated with 1 g/kg (body weight) of oleuropein for 7 days, and LD50 of oleuropein may not be calculated through various experiments. Therefore, it is suggested that oleuropein is a substance with a significant high safety.
However, the efficacy of oleuropein related to promotion of hair growth or improvement of hair loss has been not known so far. Throughout this application, various patents and publications are referenced and citations are provided in parentheses. The disclosure of these patents and publications in their entities are hereby incorporated by references into this application in order to more fully describe this invention and the state of the art to which this invention pertains.
SUMMARY OF THE INVENTION
The present inventors have made intensive researches to develop novel compounds or derivatives thereof derived from natural substances having therapeutic efficacies for preventing or treating hair loss or promoting hair growth. As a result, they have found out that secoiridoid glucoside derivatives {e.g., oleuropein) contained in plant belonging to the family Oleaceae simulate hair growth and prevent hair loss with high efficiency through various tests.
Accordingly, it is an object of this invention to provide a pharmaceutical composition for preventing or treating hair loss or promoting hair growth, comprising secoiridoid glucoside derivatives, more specifically oleuropein, or hydrolysate thereof.
It is another object of this invention to provide a cosmetic composition for preventing or treating hair loss or promoting hair growth, comprising secoiridoid glucoside derivatives, more specifically oleuropein, or hydrolysate thereof.
It is still another object of this invention to provide a functional food composition for preventing or treating hair loss or promoting hair growth, comprising secoiridoid glucoside derivatives, more specifically oleuropein, or hydrolysate thereof.
It is further object of this invention to provide a method for preventing or treating hair loss or promoting hair growth, comprising secoiridoid glucoside derivatives, more specifically oleuropein, or hydrolysate thereof.
Other objects and advantages of the present invention will become apparent from the detailed description to follow taken in conjugation with the appended claims and drawings. BRIEF DESCRIPTION OF THE DRAWINGS
Fig. 1 represents the results on hair re-growth with the lapse of time of hair restorer injection in mouse model removed hair.
Fig. 2 represents the graph of grown hair length during the experimental period in mouse subcutaneously injected with hair restorers. The results are represented as mean ± SEM (standard error) of values obtained from eighty four (84) mice. The characters above the bars indicate significant difference among dietary groups by one-way analysis of variance (ANOVA) test and Duncan's multiple range test (P < 0.05).
Fig. 3 represents the results on histological analysis in the back skin of mouse subcutaneously injected with hair restorer for 6 weeks. The results are represented as mean ± SEM (standard error) of values obtained from four (4) mice. The characters above the bars indicate significant difference among dietary groups by one-way analysis of variance (ANOVA) test and Duncan's multiple range test (P < 0.05).
Fig. 4 represents the results on expression changes of hair growth -related proteins in the back skin of mouse subcutaneously injected with hair restorer.
Fig. 5 represents the results on expression changes of hair growth-related genes in the back skin of mouse subcutaneously injected with hair restorer. The characters above the bars indicate significant difference among dietary groups by one-way analysis of variance (ANOVA) test and Duncan's multiple range test (P < 0.05).
DETAILED DESCRIPTION OF THIS INVETNION
In one aspect of the present invention, there is provided a pharmaceutical composition for preventing or treating hair loss or promoting hair growth, comprising administering to a mammalian subject in need thereof a therapeutically effective amount of a composition comprising a secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient:
Figure imgf000007_0001
wherein Ri and R2 is independently C C4 alkyl; R3-R7 are independently hydrogen, hydroxy or C1-C4 alkyl; m is an integer of 1 to 3; and n is an integer of 1 to 4.
The present inventors have made intensive researches to develop hovel compounds or derivatives thereof derived from natural substances having therapeutic efficacies for preventing or treating hair loss or promoting hair growth. As a result, they have found out that secoiridoid glucoside derivatives {e.g., oleuropein) contained in plant belonging to the family Oleaceae simulate hair growth and prevent hair loss with high efficiency through various tests.
As demonstrated in the following Examples, oleuropein converts hairs of the telogen to hairs of the anagen, and increases the number of hair follicles and expressions of growth factors related hair growth in skin tissue such that ultimately, hair density per unit skin area significantly increased.
Having described efficacies for preventing or treating hair loss or promoting hair growth of oleuropein as representative of secoiridoid glucoside derivatives in Examples, it is apparent to one of skill in the art that secoiridoid glucoside derivatives encompassed by the Chemical Formula 1 and showing similar levels of biological activities to oleuropein may also show similar efficacies to oleuropein for preventing or treating hair loss or promoting hair growth.
In addition, it has been known that elenolic acid, in which glycosyl group of secoiridoid glucoside derivatives is hydrolyzed to form, shows same or similar level of biological activity of oleuropein (U.S. Patent Nos. 6,117,844 and 6,455,580). This elenolic acid may be also formed when secoiridoid glucoside derivatives are metabolized in vivo. Therefore, it is apparent that hydrolysates of secoiridoid glucoside derivatives may also show similar efficacies to oleuropein for preventing or treating hair loss or promoting hair growth, to those skilled in this art.
There is no intended distinction between the terms used herein "for preventing hair loss", "for treating hair loss", "for improving hair loss" or "for promoting hair growth" , and these terms will be used interchangeably. In additin, these terms have the same meaning with the term "promotion of hair growth" used in this art.
The term used herein "alkyl" refers to a saturated hydrocarbon radical, which may be straight or branched. For example, it includes methyl, ethyl, propyl, isobutyl, pentyl or hexyl. Ci-G, alkyl means an alkyl group having an alkyl unit of 1-4 carbon atoms. When the Q.G, alkyl is substituted, the number of carbons in the substituent is not included.
According to a preferred embodiment, Ri and R2 in the Chemical Formula 1 is independently Q-C2 alkyl; R3-R7 are independently hydrogen or hydroxy; m is 1; and n is 2.
More preferably, the secoiridoid glucoside derivative in the Chemical Formula 1 is a compound represented by the Chemical Formula 2:
Chemical Formula 2
Figure imgf000008_0001
According to the present invention, the compound represented by the Chemical Formula 2 is oleuropein. Plant belonging to the family Oleaceae containes a lot of oleuropein in fruits, roots, stems, particularly, leaves, and includes approximately more than 600 species in 24 of genus.
The plant belonging to the family Oleaceae used in the present invention is not particularly limited as long as it contains secoiridoid glucoside derivative including oleuropein, and preferably olive tree (Olea europaea), plant from genus Ligustrum, plant from genus Syringa, plant from genus Fraxinus, plant from genus Jasminum or plant from genus Osmahthus.
The extract of plant belonging to the family Oleaceae containing secoiridoid glucoside derivative may be obtained using conventional extraction solvents, and preferably the extraction solvent used in this invention includes (a) absolute or hydrous lower alcohol containing 1-4 carbon atoms e.g., methanol, ethanol, propanol, butanol, n-propanol, iso-propanol and n-butanol), (b) mixture of lower alcohol and water, (c) acetone, (d) ethyl acetate, (e) chloroform, (f) 1,3-butyleneglycol, (g) hexane, (h) diethylether, (i) butyl acetate or (j) water.
The fraction of plant belonging to the family Oleaceae containing secoiridoid glucoside derivative refers to a isolated/purificated form obtained by additional separation/purification to the extract of plant belonging to the family Oleaceae. For instance, it could be appreciated that active fractions obtained using a variety of additional purification methods such as an ultrafiltration with defined molecular weight cut-off value and various chromatography (designed for purification dependent upon size, charge, hydrophobicity and affinity) are included in the present extracts.
A method for obtaining oleuropein using Olea europaea leaf extract is described accurately in U.S Patent Application Publication No. 2003-0017217.
In addition, the secoiridoid glucoside derivative may be synthesized chemically. A method for synthesizing oleuropein is described accurately in PCT Application Publication NO. WO96/14064.
According to a preferred embodiment, the present composition increases expressions of IGF-1 (Insulin-like growth factor 1), VEGF (vascular endothelial growth factor), HGF (hepatocyte growth factor), KGF (keratocyte growth facfor) or β-Catenin.
The present inventors have made various researches to verify that the present composition simulates hair growth in the molecular level. As a result, they have found out that the present composition significantly increases expression levels of β-catenin as well as IGF1, VEGF, HGF and KGF as growth factors which influence on promotion of hair growth, whereby β-catenin signaling pathway is activated. It has been known that β-catenin signaling pathway play a pivotal role in hair follicle generation and hair growth. Therefore, the present composition may be applied to an effective hair restorer composition having various and stable efficacies for promoting hair growth.
According to the present invention, the present composition may be prepared to a pharmaceutical composition for preventing or treating hair loss. When the composition of the present disclosure is prepared as a pharmaceutical composition, the pharmaceutical composition of the present disclosure may comprise a pharmaceutically acceptable carrier. The pharmaceutical composition may contain a pharmaceutically acceptable carrier. In the pharmaceutical compositions of this invention, the pharmaceutically acceptable carrier may be conventional one for formulation, including lactose, dextrose, sucrose, sorbitol, mannitol, starch, rubber arable, potassium phosphate, arginate, gelatin, potassium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrups, methyl cellulose, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and mineral oils, but not limited to. The pharmaceutical composition according to the present invention may further include a lubricant, a humectant, a sweetener, a flavoring agent, an emulsifier, a suspending agent, and a preservative. Details of suitable pharmaceutically acceptable carriers and formulations can be found in Remington's Pharmaceutical Sciences (19th ed., 1995), which is incorporated herein by reference.
The pharmaceutical composition of this invention may be preferably administered orally or parenterally, more preferably subcutaneously injection.
A suitable dose of the pharmaceutical composition of the present invention may vary depending on pharmaceutical formulation methods, administration methods, the patient's age, body weight, sex, severity of diseases, diet, administration time, administration route, an excretion rate and sensitivity for a used pharmaceutical composition. Physicians of ordinary skill in the art can determine an effective amount of the pharmaceutical composition for desired treatment. Generally, the pharmaceutical composition of the present invention may be administered with a daily dose of 0.001-100 mg/kg (body weight).
According to the conventional techniques known to those skilled in the art, the pharmaceutical composition may be formulated with pharmaceutically acceptable carrier and/or vehicle as described above, finally providing several forms including a unit dose form and a multi-dose form. The formulation may be in the form of a solution in oily or aqueous medium, a suspension, a syrup, a emulsion, an extract, an elixir, a powder, a granule, a tablet or a capsule, and may further include a dispersant or stabilizer.
In another aspect of the present invention, there is provided a cosmetic composition for improving hair loss or promoting hair growth, comprising secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient.
Since the secoiridoid glucoside derivative used in the present invention is described as above, the common descriptions between them are omitted in order to avoid undue redundancy leading to the complexity of this Specification.
The present cosmetic composition includes the secoiridoid glucoside derivative or its hydrolysate the Chemical Formula 1 as an active ingredient, and also the components that are generally used in the cosmetic composition, in which the components include for example, general adjurvants, such as an antioxidant, a stabilizer, a dissolving agent, vitamins, pigments, and flavouring, and carriers.
The cosmetic compositions of this invention may be formulated in a wide variety of forms, for example, including a solution, a suspension, an emulsion, a paste, an ointment, a gel, a cream, a lotion, a powder, a soap, a surfactant-containing cleanser, an oil, a powder foundation, an emulsion foundation, a wax foundation and a spray. Specifically, the cosmetic compositions of this invention may be formulated in the form of skin softner, nutrient liquid, nutrient cream, massage cream, essence, eye cream, cleansing cream, cleansing foam, cleansing water, pack, spray or powder.
Where the cosmetic composition is in the form of paste, cream or gel, it may comprise animal and vegetable fats, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silica, talc, zinc oxide or mixtures of these substances.
In the formulation of powder or spray, it may comprise lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder and mixtures of these substances. Spray may additionally comprise the customary propellants, for example, chlorofluorohydrocarbons, propane/butane or dimethyl ether.
The formulation of solution and emulsion may comprise solvent, solubilizer and emulsifier, for example water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylglycol, oils, glycerol fatty esters, polyethylene glycol and fatty acid esters of sorbitan.
The formulation of suspension may comprise liquid diluents, for example water, ethanol or propylene glycol, suspending agents, for example ethoxylated isosteary alcohols, polyoxyethylene sorbitol esters and poly oxyethylene sorbitan esters, micocrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth.
The formulation of cleansing compositions with surfactant may comprise aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosucinnate monoester, isothinate, imidazolium derivatives, methyltaurate, sarcocinate, fatty acid amide ether sulfate, alkyl amido betain, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, lanoline derivatives or ethoxylated glycerol fatty acid ester.
In still another aspect of the present invention, there is provided a functional food composition for improving hair loss or promoting hair growth, comprising secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient.
Since the secoiridoid glucoside derivative used in the present invention is described as above, the common descriptions between them are omitted in order to avoid undue redundancy leading to the complexity of this Specification.
When the composition of the present disclosure is prepared as a functional food composition, the food composition of the present disclosure may comprise, in addition to the secoiridoid glucoside derivative or its hydrolysate the Chemical Formula i of the present disclosure as the active ingredient, ingredients commonly added for preparation of food. For example, proteins, carbohydrates, fats, nutrients, seasoning or flavors may be added. The carbohydrate may be, for example, a sugar such as a monosaccharide, e.g. glucose, fructose, etc., a disaccharide, e.g. maltose, sucrose, oligosaccharide, etc. or a polysaccharide, e.g. dextrin, cyclodextrin, etc. or a sugar alcohol such as xylitol, sorbitol, erythritol, etc. The flavor may be a natural flavor [thaumatin, stevia extract {e.g. rebaudioside A, glycyrrhizin, etc.)] or a synthetic flavor (saccharin, aspartame, etc.).
For example, when the food composition of the present disclosure is prepared as a drink, it may further comprise, in addition to nonenal of the present disclosure as the active ingredient, citric acid, high-fructose corn syrup, sugar, glucose, acetic acid, malic acid, fruit juice, eucommia extract, jujube extract, licorice extract, or the like.
In further aspect of the present invention, there is provided a method for preventing or treating hair loss or promoting hair growth, comprising administering to a mammalian subject in need thereof a therapeutically effective amount of a composition comprising a secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient:
Since the secoiridoid glucoside derivative used in the present invention is described as above, the common descriptions between them are omitted in order to avoid undue redundancy leading to the complexity of this Specification.
The features and advantages of this invention will be summarized as follows:
(a) The present invention provides a pharmaceutical composition for preventing or treating hair loss, comprising a secoiridoid glucoside derivative or its hydrolysate as an active ingredient. In addition, the present invention provides a cosmetic composition or functional food composition for improving hair loss or promoting hair growth, comprising a secoiridoid glucoside derivative or its hydrolysate as an active ingredient.
(b) The present invention not only includes natural compounds as an active ingredient without side effects of the long-term treatment in a chronic disease hair loss, but also shows excellent effects for simulating hair growth with stable efficacy. Therefore, the present composition may be used as an effective cosmetic or functional food composition for treating hair loss or promoting hair growth.
The present invention will now be described in further detail by examples. It would be obvious to those skilled in the art that these examples are intended to be more concretely illustrative and the scope of the present invention as set forth in the appended claims is not limited to or by the examples.
EXAMPLES
Example 1: Efficacy of oleuropein for promoting hair growth
Animal model
(1) Preparation of sample
Corn oil used as the vehicle and minoxidil used as the control group were purchased from Sigma-Aldrich. The test substance oleuropein was purchased from Extrasynthese. (2) Maintenance of test animals
12 of 6-week-old male C57BL/6N mice (Orientbio) were adapted to the environment for 2 weeks. Then, they were divided into total 3 groups, the negative control group (Con), the positive control group (MXD) and oleuropein group (Ole), and used for test. The environment for animals were maintained at 21 ±2.0°C and relative humidity 50 ± 5% under 12 hours light/dark cycle. They were fed a food (chow) and water with free access.
(3) Subcutaneous injection of hair restorers and visual observation thereof
In order to verify an effect for promoting hair growth, 8-week-old mice in telogen were used for test. Hairs of their back were removed using a clipper for mouse. They were subcutanedusly injected with 0.1 ml. of sample at the part, everyday. Before subcutaneous injection, the test substance oleuropein (0.8 mg/0.1 mL) and the control drug minoxidil were dissolved in corn oil to use. The negative control group was subcutaneously injected with only vehicle (com oil). The application was performed once, every P.M. 4:00 for 6 weeks. At 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks and 6 weeks after the application, mice were anaesthetized with ether to take pictures of their back in order to verify hair growth state. To assess level of hair grdwth, the hair length was measured using ruler.
Measurement on changes in body weight
Body weight was measured weekly during entire test period, from the point before the subcutaneous injection of the hair restorers to the end point of the subcutaneous injection of the hair restorers. There are no significant differences between the negative control group (Con), the test group (Ole) and the positive control group (MXD) in the body weights at 6 weeks as well as the initial body weights.
Measurement on changes in hair growth state and hair length (1) Visual characteristics in hair growth
Mice injected subcutaneously with the samples for 6 weeks were weekly took pictures of their back to verify hair growth state. Body surface of mice in the telogen showed pink color after the hair removal. Body surface color turned to black as the test was carried out, indicating that the telogen returns to the anagen in hair cycle.
In mice injected subcutaneously with corn oil, hairs were rarely grown after 6 weeks. In contrast, in mice injected subcutaneously with oleuropein, hairs were grown at 3 weeks. Moreover, hairs were vigorously grown at 6 weeks. Accordingly, it would be determined that oleuropein has more excellent effect for promoting hair growth than that of the minoxidil (Fig. 1).
(2) changes in hair length
Hair length in mice injected subcutaneously with the samples for 6 weeks were weekly measured. In oleuropein group, hair length was significantly increased (p < 0.05) at 3 weeks. In addition, it was significantly increased by 62% at 6 weeks, compared to the negative control group. However, there was no significant difference between the positive control group MXD and the negative control group in hair length after 4 weeks, although hair length was increased at 5 weeks (Fig. 2). Accordingly, it would be determined that oleuropein has an excellent effect for stimulating hair growth than that of the minoxidil as conventional hair restorer.
Histological analysis of the back skin
(1) Histological method
At 6 weeks after subcutaneous injection, mice were sacrificed. Their back skin tissue samples were isolated using scissors and forceps and fixed by formalin. After dehydration with serial alcohol and xylene, the tissues were paraffinized. Paraffinized tissues were sectioned using a microtomb in a thickness of 5 pm and used alcohol and xylene to remove paraffin. Then, the tissues were stained with hematoxyline/eosin, followed by observation of histological changes in hair follicles under an optical microscope. The hair growth cycles in the tissues were pathologically diagnosed by specialists, and quantity and diameter of hair follicle were measured under an optical microscope.
(2) Histological analysis
The results as described above are shown in Table 1. All hair growth cycles measured before administration of the test substance (non-treatment) were observed to telogen. Therefore, it would be considered that 8 week-old animals used in the present test were qualified as a model of the hair growth efficacy evaluation. As a result, the anagen phases were observed in the negative group (1 case), the MXD group (1 case) and the Ole group (2 cases), respectively.
[Table 1] Histological diagnosis
Figure imgf000017_0001
The measurement results of the number of hair follicles under an optical microscope of 40X magnification are shown in Fig 3. The number of hair follicles in the Ole group and the MXD group was significantly increased as compared to the negative control group. As a result of image analysis, the diameter of the hair follicles in the Ole group and the MXD group was significantly increased as compared to the negative control group. In addition, there is a phenomenon that hair follicles in the Ole group and the MXD group became longer and they were expressed into skin. It would be considered that this phenomenon is related to effects of the two substances for simulating hair growth.
Example 2: Expression controls of hair growth-related genes and proteins by oleuropein
Immunohistochemical test on skin tissue
(1) Immunohistochemical method
In order to verify expression amounts of IGF1 and β-catenin related with hair growth in skin tissue, each primary antibody to IGF1 and β-catenin was diluted to 1:50, added to tissue sections, and incubated for 12 hours at room temperature. The primary antibody was diluted with the mixture of 0.1% normal goat serum (Vector Laboratories Inc.) and 0.3% Triton X-100 (Sigma) in 0.1 M phosphate buffer solution (PB). The tissue sections were washed twice at room temperature for 15 minutes in 0.1M PB. Then, secondary antibody [biotinylated anti-rabbit IgG (Vector Laboratories Inc.)] was diluted to 1:200, added to the tissue sections, and incubated for 1 hour at room temperature. The tissue sections were washed twice at room temperature for 15 minutes in 0.1M PB, soaked in peroxidase-labeled ABC solution, and incubated for 1 hour at room temperature. The tissue sections were washed twice at room temperature for 15 minutes in 0.1M PB. Then, the tissue sections were reacted for 5 min with a solution in which 30 mg of 3-3' diaminobenzidine was dissolved in 150 ml of 0.1M PB, added with concentration of 0.005% of hydrogen peroxide, and reacted for 5 min to occur color reaction. The tissue sections were washed several times at room temperature in 0.1M PB. Then, according to the conventional methods, the tissues were counterstained with hematoxyline for 20 sec, dehydrated, transparentized and mounted, followed by observation under an optical microscope.
(2) Immunohistochemical analysis
It has been identified that intracellular signaling active factors such as Wnt/β- catenin, in addition to male hormones and growth hormones, play a role in hair growth and loss. In the development of drugs for inhibiting hair loss and simulating hair growth, screening for efficacies of the Wnt/ -catenin signaling molecules as target have been researched. In the present invention, the present inventors have made intensive researches to develop substances for activating Wnt/ -catenin signaling which is known to play a pivotal role in hair follicle generation and hair growth, and to apply as a material of products for inhibiting hair loss and simulating hair growth.
In order to verify changes on expressions of hair growth-related proteins by subcutaneous injection of test substances for 6 weeks in skin tissue, immunohistochemical test was carried out. To determine whether Wnt/ -catenin signaling related to simulate hair growth is activated, protein expression level of β- catenin was measured by immunohistochemical method in skin tissue. As a result, it could be observed that protein expression level of β-catenin in the Ole group was much more highly detected than that in the negative group. In addition, protein expression level of IGF1 as growth factor for stimulating hair growth was measured by immunohistochemical method in skin tissue. As a result, It could be observed that protein expression level of IGF1 in the Ole group was much more highly detected than that in the negative group. Accordingly, it would be determined that oleuropein has more excellent effect for increasing protein expression levels of β-catenin and IGF1 than that of the minoxidil (Fig. 4).
Expression control of hair growth-related genes in skin tissue
(1) RNA extraction
After adding 1 ml_ of Trizol agent to 50-100 mg of test animal skin tissues, the mixture was homogenized and centrifuged at 12,000 x g for 10 min at 4°C. The supernatant was transferred to a new tube to remove fat layer. Then, 200 pi of chloroform was added to the tube, followed by vortexing. The same procedure was repeated twice and then the supernatant was transferred to a new tube, followed by addition of isopropanol and the supernatant at 1:1 ratio. The mixture was vigorously shaken 10 times and then incubated for 10 min at room temperature, followed by centrifugatidn at 12,000 x g for 10 min at 4°C to remove the supernatant. After adding 1 mL of 70% ethanol to the remaining pellet, it was centrifuged at 7,500 x g for 5 min at 4°C. After removing the ethanol, the RNA pellet contained in the tube was dried for 5 min at 4°C and dissolved in riuclease-free water. The RNA sample concentration was measured at a wavelength of 260 hm and 280 nrh using a UV/VIS spectrophotometer (Beckman coulter, DU730) and the integrity of RNA sample was verified by agarose gel electrophoresis.
(1) RT-PCR (Reverse Transcription-Polymerase Chain ReactionVmethod
The RNA sample obtained was trasnscribed using oligo dT primer and Superscript reverse transcriptase (GIBCO BRL, Gaithersburg, MD, USA) to synthesize cDNA. The PCR amplification was performed using the cDNA as templates and primers complementary to cDNA 5' and 3' flanking sequence. The primers were synthesized by Bioneer Inc. to use and the sequences of the primers used are presented in Table 2.
PCR reaction was conducted in the final volume of 50 pL containing 5 pL of 10X reaction buffer solution [lOOmM KCL, 20 mM Tris-HCL (pH 8.0), 2.5 mM MgCI2], 4 μ1_ of 10 mM dNTP, each 1 pL of 0.2 μΜ sense and antisense primer, 2 μΙ_ of cDNA, 2.5 unit of Tag polymerase (Takara, Japan) and distilled water. The PCR condition was set for 4 min at 95°C, 30 sec at 94°C, 30 cycles of 30 sec at 52°C and 45 sec at 72°C, and 10 min at 72°C. 1 μΙ_ of the amplified product was resolved oh agarose gel electrophoresis.
[Table 2] Primer sequences used for RT-PCR
Figure imgf000020_0001
reverse
CCTCGTGTAGAACTTCCTCC
primer
Low-density forward
AAGGGTCCACAAGGTCAAGG
lipoprotein receptor- primer
55 520 related protein 5 reverse
AGAAGCACAGATGGCTGCAC
(LRP5) primer
forward
TGTGTGAGGAACAGAACTCA
Glycogen synthase primer
48 244 kinase 3p(GSK3P) reverse
CCTACAGCCCTAGTCATCAG
primer
forward
TGCAGAGTCCCAAAATGAATG
primer
Axin 55 108 reverse
GAGCCTGTCCTTGTGTAC
primer
forward
ATGGCTACTCAAGCTGAC
primer
β-catenin 55 298 reverse
CAGCAU 1 I CAGCACTCTGC
primer
forward
TCAACAAGCCCACAGGGTAT
Insulin-like growth primer
60 280 factor(IGFl) reverse
ACTCGTGCAGAGCAAAGGAT
primer
forward
CGAGGCCATGGTGCTATACT
Hepatocyte growth primer
54 290 factor (HGF) reverse
ACACCAGGGTGATTGAGACC
primer
forward
Vascular endothelial TCTTCAAGCCATCCTGTGTG
primer
growth 60 165 reverse
factor(VEGF) GCGAGTCTGTG 1 1 1 1 I GCAG
primer
forward
GACATGGATCCTGCCAACTT
Keratocyte growth primer
54 686 facfor (KGF) reverse
AATTCCAACTGCCACTGTCC
primer
forward
Glyceraldehyde-3- AGAACATCATCCCTGCATCC
primer
phosphatedehydrog 60 321 reverse
enase (GAPDH) TCCACCACCC I U I I GCTGTA
primer
(3) Result on expression control of hair growth-related genes
In order to evaluate changes on expressions of hair growth-related genes by subcutaneous injection of test substances for 6 weeks in mouse back skin tissue, RT- PCR was carried out. To determine whether expressions of Wnt/ -catenin signaling molecules known as mechanism to simulate hair growth are changed, gene expression levels were measured. As a result, gene expression levels of WntlOb and its receptor FZDR (frizzled receptor 1), and LRP5 (low-density lipoprotein receptor- related protein 5) in the Ole group were significantly increased as compared to the negative control group. For this reason, gene expression levels of GSK3 (glycogen synthase kinase 3β) and Axin inhibited by WntlOb were significantly decreased as compared to the negative control group. As activation of Wnt/(3-catenin signaling, gene expression level of β-catenin was significantly increased as compared to the negative control group.
In addition, in order to verify mechanism for stimulating hair growth by oleuropein, changes on gene expressions of endocrine system factors which influence on hair growth were evaluated. Gene expression levels of IGF1 (insulin-like growth factor 1), VEGF (vascular endothelial growth factor), HGF (hepatocyte growth factor) and KGF (keratocyte growth facfor) which are growth factors to influence on stimulating hair growth were measured in back skin tissues. As a result, all expression levels of these genes in the Ole group were significantly increased as compared to the negative control group (Fig. 5). Accordingly, it would be understood that oleuropein not only activates hair follicle to return to the anagen by accelerating length growth of hair follicles, but also increases expressions of IGF1, HGF, VEGF and KGF to stimulate hair re-growth.
Having described a preferred embodiment of the present invention, it is to be understood that variants and modifications thereof falling within the spirit of the invention may become apparent to those skilled in this art, and the scope of this invention is to be determined by appended claims and their equivalents.

Claims

What is claimed is:
1. A pharmaceutical composition for preventing or treating hair loss or promoting hair growth, comprising a secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient:
Figure imgf000023_0001
wherein and R2 is independently CrQ alkyl; R3-R7 are independently hydrogen, hydroxy or Ci-C4 alkyl; m is an integer of 1 to 3; and n is an integer of 1 to 4.
2. The composition according to claim 1, wherein Rj and R2 in the Chemical Formula 1 is independently Q-Q, alkyl; R3-R7 are independently hydrogen or hydroxy; m is 1; and n is 2.
3. The composition according to claim 1, wherein the secoiridoid glucoside derivative is a compound represented by the Chemical Formula 2:
Figure imgf000023_0002
4. The composition according to claim 1, wherein the composition increases expressions of IGF-1 (Insulin-like growth factor 1), VEGF (vascular endothelial growth factor), HGF (hepatocyte growth factor), KGF (keratocyte growth facfor) or β-catenin.
5. A cosmetic composition for improving hair loss or promoting hair growth, comprising a secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient:
Figure imgf000024_0001
wherein Ri and R2 is independently Ci-C4 alkyl; R3-R7 are independently hydrogen, hydroxy or Q-G, alkyl; m is an integer of 1 to 3; and n is an integer of 1 to 4.
6. The composition according to claim 5, wherein i and R2 in the Chemical Formula 1 is independently CrC2 alkyl; R3-R7 are independently hydrogen or hydroxy; m is 1; and n is 2.
7. The composition according to claim 5, wherein the secoiridoid glucoside derivative is a compound represented by the Chemical Formula 2:
Figure imgf000024_0002
(2)
8. A functional food composition for improving hair loss or promoting hair growth, comprising a secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient:
Figure imgf000025_0001
wherein Ri and R2 is independently Ci-G, alkyl; R3-R7 are independently hydrogen, hydroxy or d-C4 alkyl; m is an integer of 1 to 3; and n is an integer of 1 to 4.
9. The composition according to claim 8, wherein Ri and R2 in the Chemical Formula 1 is independently CrC2 alkyl; R3-R7 are independently hydrogen or hydroxy; m is 1; and n is 2.
10. The composition according to claim 8, wherein the secoiridoid glucoside derivative is a compound represented by the Chemical Formula 2:
Figure imgf000025_0002
11. A method for preventing or treating hair loss or promoting hair growth, comprising administering to a mammalian subject in need thereof a therapeutically effective amount of a composition comprising a secoiridoid glucoside derivative or its hydrolysate represented by the Chemical Formula 1 as an active ingredient:
Figure imgf000026_0001
wherein Rx and R2 is independently CrQ alkyl; R3-R7 are independently hydrogen, hydroxy or d-C4 alkyl; m is an integer of 1 to 3; and n is an integer of 1 to 4.
12. The method according to claim 11, wherein Ri and R2 in the Chemical Formula 1 is independently Ci-C2 alkyl; R3-R7 are independently hydrogen or hydroxy; m is 1; and n is 2.
13. The method according to claim 11, wherein the secoiridoid glucoside derivative is a compound represented by the Chemical Formula 2:
Figure imgf000026_0002
14. The method according to claim 11, wherein the composition increases expressions of IGF-1 (Insulin-like growth factor 1), VEGF (vascular endothelial growth factor), HGF (hepatocyte growth factor), KGF (keratocyte growth facfor) or β-catenin.
15. The method according to claim 11, wherein the composition is a pharmaceutical, a cosmetic or a functional food composition.
PCT/KR2013/006061 2012-07-09 2013-07-08 Composition for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives Ceased WO2014010900A1 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
JP2014542261A JP6145106B2 (en) 2012-07-09 2013-07-08 Hair growth promoting agent, IGF-1 expression increasing agent, VEGF expression increasing agent, HGF expression increasing agent, KGF expression increasing agent, and β-catenin expression increasing agent comprising a purified secoiridoid glucoside derivative
US14/356,162 US9636289B2 (en) 2012-07-09 2013-07-08 Composition for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR20120074407A KR101269490B1 (en) 2012-07-09 2012-07-09 Composition for preventing or treating hair loss or stimulating hair sprouting comprising secoiridoid glucoside derivatives as active ingredients
KR10-2012-0074407 2012-07-09

Publications (2)

Publication Number Publication Date
WO2014010900A1 true WO2014010900A1 (en) 2014-01-16
WO2014010900A9 WO2014010900A9 (en) 2014-02-20

Family

ID=48667199

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2013/006061 Ceased WO2014010900A1 (en) 2012-07-09 2013-07-08 Composition for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives

Country Status (4)

Country Link
US (1) US9636289B2 (en)
JP (1) JP6145106B2 (en)
KR (1) KR101269490B1 (en)
WO (1) WO2014010900A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT201600120528A1 (en) * 2016-11-29 2018-05-29 Solosale Srl Composition containing bioavailable glutathione and oleuropein to prevent hair loss or promote hair growth
US11160750B2 (en) * 2017-08-03 2021-11-02 Zivmas Llc Composition and method for promoting hair growth

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TWI634896B (en) * 2015-09-10 2018-09-11 三活水生物科技股份有限公司 Uses of osmanthus fragrans extracts for manufacturing a composition for enhancing hair growth and a composition for wound healing
KR101725461B1 (en) * 2015-12-29 2017-04-10 연세대학교 산학협력단 Composition for Preventing or Treating Hair Loss or Stimulating Hair Sprouting or Hair Growth Comprising Diosmin as Active Ingredients
KR101733065B1 (en) * 2016-10-13 2017-05-08 연세대학교 산학협력단 Composition comprising Decanal or as active ingredients for preventing hair loss or stimulating hair growth
KR102093708B1 (en) * 2019-05-28 2020-03-27 주식회사 티에스트릴리온 A cosmetic composition using Fraxini cortex extract
CN116019821B (en) * 2023-01-17 2025-12-23 杭州至墨生物科技有限公司 Compound for preventing and treating alopecia and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005179353A (en) * 2003-11-26 2005-07-07 J-Oil Mills Inc Catecholamine inducer and lipid metabolism improvement and slimming method using the same
KR20080026017A (en) * 2006-09-19 2008-03-24 권 제임스 Composition consisting mainly of olive leaf extract containing oleuropine and its manufacturing method
KR20100070665A (en) * 2008-12-18 2010-06-28 연세대학교 산학협력단 Composition for preventing or treating of obesity comprising secoiridoid derivatives as active ingredients
KR20120052894A (en) * 2010-11-16 2012-05-24 한국생명공학연구원 A composition for prevention of hair loss and promotion of hair growth comprising extracts of eclipta prostrata, fractions thereof, terthienyl derivatives or pharmaceutically acceptable salts thereof

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPS6299318A (en) * 1985-10-25 1987-05-08 Nonogawa Shoji:Kk hair tonic
US4828837A (en) * 1987-03-30 1989-05-09 Liposome Technology, Inc. Non-crystalline minoxidil composition, its production and application
FR2613222B1 (en) * 1987-04-03 1991-06-14 Guigon Nadine COMPOSITION FOR LOCAL SKIN CARE, ESPECIALLY SCALP
JP3432848B2 (en) * 1993-01-25 2003-08-04 富山化学工業株式会社 Hair restorer
WO1996014064A1 (en) * 1994-11-07 1996-05-17 Strecker, Robert, B. Method and composition for antiviral therapy
JPH11246361A (en) * 1997-01-17 1999-09-14 Ryoji Arai Hair grower
FR2808191B1 (en) * 2000-04-28 2004-03-05 Oreal PLANT EXTRACT OF THE SPECIES OLEA EUROPAEA AS NO-SYNTHASE INHIBITOR AND USES
PT1397105E (en) * 2001-05-23 2006-12-29 Hamdi K Hamdi Compositions for inhibiting angiogenesis
US20070184003A1 (en) * 2006-02-09 2007-08-09 Gaunitz William F V Apparatus and method for optimizing hair growth
US20110217260A1 (en) * 2010-03-04 2011-09-08 Shantha Totada R Method of enhancing eyelash and eye brow hair growth

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2005179353A (en) * 2003-11-26 2005-07-07 J-Oil Mills Inc Catecholamine inducer and lipid metabolism improvement and slimming method using the same
KR20080026017A (en) * 2006-09-19 2008-03-24 권 제임스 Composition consisting mainly of olive leaf extract containing oleuropine and its manufacturing method
KR20100070665A (en) * 2008-12-18 2010-06-28 연세대학교 산학협력단 Composition for preventing or treating of obesity comprising secoiridoid derivatives as active ingredients
KR20120052894A (en) * 2010-11-16 2012-05-24 한국생명공학연구원 A composition for prevention of hair loss and promotion of hair growth comprising extracts of eclipta prostrata, fractions thereof, terthienyl derivatives or pharmaceutically acceptable salts thereof

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
IT201600120528A1 (en) * 2016-11-29 2018-05-29 Solosale Srl Composition containing bioavailable glutathione and oleuropein to prevent hair loss or promote hair growth
WO2018100510A1 (en) * 2016-11-29 2018-06-07 Solosale S.R.L. Composition comprising glutathion tioester and secoiridoids of the plant olea europea for treating hair loss
US11160750B2 (en) * 2017-08-03 2021-11-02 Zivmas Llc Composition and method for promoting hair growth

Also Published As

Publication number Publication date
WO2014010900A9 (en) 2014-02-20
JP2014533688A (en) 2014-12-15
KR101269490B1 (en) 2013-05-30
JP6145106B2 (en) 2017-06-07
US20150119347A1 (en) 2015-04-30
US9636289B2 (en) 2017-05-02

Similar Documents

Publication Publication Date Title
US9636289B2 (en) Composition for preventing or treating hair loss or promoting hair growth comprising secoiridoid glucoside derivatives
JP5635226B2 (en) Hair papilla cell growth promoter
JP6339189B2 (en) Composition for promoting hair growth and hair growth
EP2512488A1 (en) Composition containing at least one c7 sugar for alopecia treatment, cosmetic treatment of hair and nails, and care of hair, eyelashes, or nails
US10617612B2 (en) Composition comprising decanal or as active ingredients for preventing hair loss or stimulating hair growth
KR101957849B1 (en) Composition for promoting hair growth or restoration and anti-inflammatory composition
JP6860558B2 (en) Hair growth and / or hair growth promoting composition containing soyasaponin
KR101725461B1 (en) Composition for Preventing or Treating Hair Loss or Stimulating Hair Sprouting or Hair Growth Comprising Diosmin as Active Ingredients
KR102115666B1 (en) Composition comprising nonanal for preventing hair loss or stimulating hair growth
KR101935492B1 (en) Composition comprising yarayara for preventing hair loss or stimulating hair growth
US10265299B2 (en) Composition for promoting hair growth and/or hair restoration containing psoralidin
KR102061716B1 (en) Composition for promoting hair growth or restoration containing 21-o-angeloyltheasapogenol e3
KR20190046697A (en) Composition comprising irone for preventing hair loss or stimulating hair growth
WO2012169860A2 (en) Composition for preventing hair loss or promoting hair restoration, comprising soy extract
KR101587612B1 (en) Composition for Preventing or Treating Hair Loss or Stimulating Hair Sprouting or Hair Growth Comprising Pinocarveol as Active Ingredients
KR100784163B1 (en) Hair loss prevention or hair growth promoting composition
JP2004359554A (en) Age resister and external preparation for skin
KR102182710B1 (en) Compositions for Skin Moisture Comprising Extract of Plectranthus tomentosa or Complex Extract thereof
JP6161953B2 (en) Hair restorer, muscle activator and energy production promoter
KR100733324B1 (en) Hair loss prevention or hair growth promoting composition
KR20180041046A (en) Composition comprising Linallol or as active ingredients for preventing hair loss or stimulating hair growth
JP2012167063A (en) Dopa oxidase activity inhibitor and whitening agent
KR20190088207A (en) Composition for treating hair loss and promoting hair growth

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13816021

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2014542261

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 14356162

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13816021

Country of ref document: EP

Kind code of ref document: A1