WO2013174859A1 - Procédés de criblage pour identifier des composés interférant avec coup-tfii (nr2f2) ou coup-tfi (nr2f1) - Google Patents

Procédés de criblage pour identifier des composés interférant avec coup-tfii (nr2f2) ou coup-tfi (nr2f1) Download PDF

Info

Publication number
WO2013174859A1
WO2013174859A1 PCT/EP2013/060493 EP2013060493W WO2013174859A1 WO 2013174859 A1 WO2013174859 A1 WO 2013174859A1 EP 2013060493 W EP2013060493 W EP 2013060493W WO 2013174859 A1 WO2013174859 A1 WO 2013174859A1
Authority
WO
WIPO (PCT)
Prior art keywords
coup
selecting
antagonist compound
compound
epithelial cells
Prior art date
Application number
PCT/EP2013/060493
Other languages
English (en)
Inventor
Laurence GIROLDI
Pierre-Paul BRINGUIER
Original Assignee
Centre Leon Berard
Hospices Civils De Lyon
Centre National De La Recherche Scientifique (Cnrs)
Universite Claude Bernard Lyon 1
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Centre Leon Berard, Hospices Civils De Lyon, Centre National De La Recherche Scientifique (Cnrs), Universite Claude Bernard Lyon 1 filed Critical Centre Leon Berard
Publication of WO2013174859A1 publication Critical patent/WO2013174859A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity

Definitions

  • the present invention relates to methods for identifying agonists and antagonists of orphan nuclear receptors COUP-TFs and particularly to methods for identifying novel compounds for use in the treatment of pathologies such as cancer or fibrosis by inhibition of abnormal Epithelio-Mesenchymal Transition (EMT) features induced by COUP-TFII (nuclear receptor subfamily 2 group F number 2, NR2F2 according to HUGO gene nomenclature committee).
  • EMT Epithelio-Mesenchymal Transition
  • COUP-TFII is a mesenchymal molecule playing key roles in development. In adult tissues, high expression of COUP-TFII is restricted to venous and capillary endothelial cells and to smooth muscle cells. Lin et al. (2011) discuss the physiological importance of COUP-TFII in cell-fate specification, organogenesis, angiogenesis and metabolism, as well as its pathological implications. In particular, physiological expression of COUP-TFII is required for normal angiogenesis but also favors tumor growth and metastasis by allowing tumor angiogenesis. Therefore, W098/57647 suggests that antagonists of COUP- TFII may be used for treating cancers by inhibiting neovascularization in tumors.
  • EMT Epi-Mesenchymal Transition
  • Physiological EMTs underlie many key developmental steps such as gastrulation and neurulation and also allow tissue repair in adult organisms.
  • Pathological EMTs lead to fibrosis and cancer invasion/metastasis (Yang and Weinberg 2008).
  • EMT Christiansen and Rajasekaran 2006.
  • a hallmark of EMT is the loss of the major epithelial intercellular adhesion molecule E-cadherin (CDH1 according to HUGO) and the subsequent cell scattering leading to migration of/invasion by isolated cells.
  • COUP-TFII can act as an oncogene (i.e. a gene which participates in cell transformation), since induction of COUP-TFII expression induces a set of transformations typical of an EMT in MDCK II cells. It is not a canonical EMT that is induced since E-cadherin expression is conserved but importantly the cells become invasive. As COUP-TFII protein is abnormally expressed in certain carcinoma cells, this finding reveals COUP-TFII as a previously unsuspected player in cell transformation.
  • oncogene i.e. a gene which participates in cell transformation
  • COUP-TFII induction of invasion capacity in MDCK II cells is associated with morphological changes, reorganisation of actin filaments accompanied by activation of the small GTPase RACl, production of fibronectin (FNl) and proteases, and abolition of cadherin-6 (CDH6) expression.
  • an epithelial cadherin (cadherin-6) is down regulated by COUP-TFII, we showed in another cell line that COUP-TFII positively regulates the expression of cadherin-11 (CDH11), a mesenchymal cadherin, providing evidence that COUP-TFII can be involved in cadherin switching.
  • COUP-TFII in the EMT context is particularly attractive because not like all of other known motility/invasion inducing transcription factors, it is a nuclear receptor and using nuclear receptors as therapeutic targets has well known and successful precedents with hormonal and anti hormonal therapeutic drugs.
  • the present invention describes methods using cells engineered to express COUP- TFII to screen for molecules interfering with COUP-TFII especially antagonists preventing EMT features and invasion.
  • COUP-TFII is a very close relative of COUP-TFII with a highly similar structure (84% identity, 87% homology) and DNA binding. In particular, their two ligand binding domains respectively present 96% and 100% homology.
  • COUP-TFI and II exert different biological functions because they are differentially (and complementarily) expressed but all data available indicate that they probably can compensate each other's function as demonstrated by similar in vitro functional assays. Accordingly, we found that also COUP-TFI induces MDCK II invasion, up-regulation of fibronectin and down- regulation of cadherin-6.
  • the present invention is related to an in vitro method for selecting an antagonist compound of COUP-TF comprising the following steps:
  • the antagonist compound of COUP-TF is selected for treatment of cancer or fibrosis.
  • the transfected mammalian epithelial cells are canine kidney MDCK II cells.
  • the COUP-TF polypeptide is selected from the polypeptide of SEO I D No. 1 and the polypeptide of SEO ID No. 2.
  • step d) comprises monitoring cell invasion of said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if cell invasion is inhibited.
  • step d) comprises monitoring morphological changes such as elongation and/or spreading of said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if elongation and/or spreading of said transfected cells are inhibited.
  • monitoring the oncogenic effect of COUP-TF on said transfected mammalian epithelial cells is performed by optical microscopy.
  • monitoring the oncogenic effect of COUP-TF on said transfected mammalian epithelial cells is performed by phase contrast microscopy.
  • step d) comprises monitoring fibronectin expression in said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if induction of fibronectin expression is inhibited.
  • step d) comprises monitoring vimentin expression in said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if the increase of vimentin expression is inhibited.
  • step d) comprises monitoring cadherin-6 expression in said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if cadherin 6 expression is maintained.
  • step d) comprises monitoring the cell cycle of said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if accumulation of cells in the G0/G1 phase is inhibited.
  • step d) comprises monitoring reorganization of apical actin belts to stress fibers in said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if reorganization of apical actin belts to stress fibers is inhibited.
  • step d) comprises monitoring RAC1 activation in said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if RAC1 activation is inhibited.
  • step d) comprises monitoring proteases secretion of said transfected mammalian epithelial cells and selecting said candidate compound as an antagonist compound if proteases secretion is inhibited.
  • SEQ ID No. 2 Human COUP-TFI polypeptide
  • COUP-TFII has a direct oncogenic effect in epithelial cells and in particular induces cell invasion.
  • COUP-TF induces cell transformation into an invasive phenotype.
  • This oncogenic effect includes induction of epithelio-mesenchymal transition (EMT) features and is accompanied by a decrease in cell proliferation recalling failsafe mechanisms observed upon induction of oncogene expression.
  • EMT epithelio-mesenchymal transition
  • the present invention relates to methods for selecting and identifying compounds specifically interfering with the oncogenic effect of COUP-TF in epithelial cells.
  • the present invention particularly relates to methods for selecting and identifying compounds specifically interfering with induction of epithelio-mesenchymal transition (EMT) features or failsafe mechanisms features induced by COUP-TFII in epithelial cells.
  • EMT epithelio-mesenchymal transition
  • the present invention relates to in vitro methods for selecting an antagonist or agonist compound of COUP-TF comprising the following steps:
  • the candidate compound is a small molecule capable of diffusing into a cell such as a lipophilic compound or a peptide.
  • the candidate compound is an antagonist of COUP-TFII which binds the described putative ligand pocket (Kruse et al 2008).
  • COUP-TF refers to both COUP-TFII and COUP-TFI.
  • COUP- TFII refers to the "chicken ovalbumin upstream promoter transcription factor II" gene or polypeptide.
  • the official name of the gene is NR2F2 and, in human, the polypeptide is encoded by the mRNA identified by GenBank number NM_021005 (29-JAN-2012).
  • COUP-TFI refers to the "chicken ovalbumin upstream promoter transcription factor I" gene or polypeptide.
  • the official name of the gene is NR2F1 and, in human, the polypeptide is encoded by the mRNA identified by GenBank number NM_005654 (20- NOV-2011).
  • genes and polypeptides are designated according to their nomenclature in human but refer also to orthologs in other species.
  • the present invention relates to methods for selecting antagonist or agonist compounds of COUP-TFII.
  • the experimental data shows that antagonists of COUP-TFII are useful for treatment of cancer and fibrosis.
  • the present invention relates to methods for selecting compounds for treatment of cancer or fibrosis.
  • the methods of the present invention are for selecting compounds for treatment of cancer in particular treatment of bladder carcinoma or colon carcinoma as several bladder and colon carcinoma cell lines display abnormally high COUP-TFII expression (see examples).
  • the assays of the present invention are based on transfected epithelial cells expressing a COUP-TF polypeptide under the control of an inducible promoter.
  • the present invention shows that experimentally induced expression of COUP-TF polypeptides is deleterious in some cell lines such as mammalian epithelial cell lines.
  • the COUP-TFII gene is therefore expressed under the control of an inducible promoter.
  • any suitable mammalian epithelial cells or cell lines may be used in the methods of the present invention.
  • Immortalized cell lines are preferred in the methods of the present invention.
  • the cells are MDCK II cells.
  • the transfected mammalian epithelial cells are canine kidney MDCK II cells (ECACC: 00062107) which are commercially available. Cells are transfected according to known techniques.
  • the transfected cells express a COUP-TF polypeptide under the control of an inducible promoter.
  • COUP-TF polypeptides refer to the COUP-TFII polypeptide of SEO I D No. 1, the COUP-TFI polypeptide of SEO ID No.2, to polypeptides having at least 80%, 85%, 90%, 95%, 98% and preferably at least 99 % identity with the polypeptide of SEO ID No.l and to polypeptides having at least 80%, 85%, 90%, 95%, 98% and preferably at least 99 % identity with the polypeptide of SEO ID No.2.
  • the polypeptides having at least 80%, 85%, 90%, 95%, 98% and preferably at least 99 % identity with the COUP-TFII polypeptide of SEO ID No.l are naturally occurring variants found in mammals or in the human population.
  • the polypeptides having at least 80%, 85%, 90%, 95%, 98% and preferably at least 99 % identity with the COUP-TFI polypeptide of SEO ID No.2 are naturally occurring variants found in mammals or in the human population.
  • the variants of the polypeptides described above retain the properties of the polypeptides from which they are derived.
  • the invention thus relates to variants of the polypeptides described above presenting at least 80%, 85%, 90%, 95%, 98% and preferably at least 99% identity with these polypeptides.
  • These polypeptides can have a deletion, addition or substitution of at least one amino acid with respect to the reference polynucleotide.
  • identical polypeptides refers to polypeptides with no variation or changes between their sequences.
  • the degree of identity between two sequences, quantified by a score, is based on the percentage of identities and/or changes in the sequences.
  • the methods for measuring and identifying the degree of identity between amino acid sequences are well known to the person skilled in the art.
  • the Basic Local Alignment tool available on the NCBI web site http://blast.ncbi.nlm.nih.gov/Blast.cgi
  • the default parameters are used.
  • COUP-TF is expressed in the transfected epithelial cells under the control of an inducible promoter. Any inducible promoters and any factors activating them known to the skilled person may be used in the methods of the present invention.
  • the inducible promoter is under the control of a repressor that can be inhibited with doxycyclin.
  • COUP-TF is cloned in inducible systems such as Invitrogen ® T-REx system (Invitrogen ® Ref K102001 or derivatives) or Clontech ® Tet-on or Tet-off system (ref 631168 or derivatives).
  • COUP-TFII can be cloned under the control of any suitable inducible promoter such as the metallothionein promoter (Wang et al., 1992).
  • COUP-TF is induced in the transfected epithelial cells when the factor/inducer is added to the culture medium and turned off upon retrieval of the inducer (or the converse if the Tet-off system is used).
  • Expression of COUP-TFII triggers an oncogenic effect in the transfected epithelial cells including Epithelio-Mesenchymal Transition (EMT) and failsafe mechanisms features.
  • EMT Epithelio-Mesenchymal Transition
  • COUP-TF expression or overexpression of COUP-TF is induced in the presence of the candidate compound.
  • a COUP-TF antagonist inhibition/reduction of the induction of the oncogenic effect including Epithelio-Mesenchymal Transition and failsafe mechanisms features by the candidate compound, is measured by monitoring directly the oncogenic effect.
  • a COUP-TF agonist enhancement of the induction of the oncogenic effect including Epithelio-Mesenchymal Transition and failsafe mechanisms features by the candidate compound, is measured by monitoring directly the oncogenic effect. Any feature related to the oncogenic effect, EMT or failsafe mechanisms, can be used in the methods of the present invention.
  • Candidate compounds inhibiting or enhancing the oncogenic effect of COUP-TF in epithelial cells including Epithelio-Mesenchymal Transition features and failsafe mechanisms features are selected in the methods of the present invention.
  • the methods of the present invention rely on simple assays to monitor the effect of the candidate compound on the oncogenic effect of COUP-TF including EMT and failsafe mechanisms features.
  • the effect of the candidate compound on induced cells is compared with the effect obtained on control cells in which COUP-TF expression is not induced.
  • oncogenic effect refer to effects observed after expression of genes promoting cell transformation therefore called oncogenes. They include effects contributing to autonomous cell proliferation, enhancing genomic instability or increasing cancer cells dissemination and aggressiveness (e.g. triggering an epithelio-mesenchymal transition). Pending on the cellular context, oncogenes can also trigger a set of morphological, biological and biochemical transformations through which cells potentially deleterious for the organism are neutralized. These transformations, called failsafe mechanisms, include cell cycle arrest and induction of senescence and/or apoptosis. These transformations are well documented and known to the person skilled in the art.
  • EMT Epi-Mesenchymal Transition
  • the oncogenic effect triggered by expression or overexpression of a COUP-TF polypeptide in epithelial cells typically includes EMT features and failsafe mechanism features.
  • monitoring the oncogenic effect of COUP-TF refers to at least one of the following: monitoring morphological changes such as elongation and/or spreading of cells; monitoring reorganization of actin filaments to stress fibers; monitoring RACl activation; monitoring the production of matrix degrading enzymes; monitoring expression of cadherin-6, vimentin and fibronectin; monitoring cell invasion and /or monitoring cell cycle.
  • candidate compounds inhibiting or enhancing motility and invasion capacity of the transfected cells upon induction of the expression of COUP-TFII are selected in the methods of the present invention.
  • morphological changes such as elongation and/or spreading.
  • morphological/phenotypic changes are monitored by optical microscopy either after fixation and staining or by phase contrast microscopy on living cells.
  • elongation and/or spreading of the transfected cells are monitored.
  • a candidate compound is selected as an antagonist compound if elongation and/or spreading of said transfected cells is reduced and selected as an agonist compound if elongation and/or spreading of said transfected cells is enhanced.
  • Induction of the expression of COUP-TF in the transfected cells triggers the development of an invasive phenotype.
  • the invasion capacity of the transfected cells is monitored.
  • a candidate compound is selected as an antagonist compound if cell invasion is inhibited or selected as an agonist compound if cell invasion is enhanced.
  • the methods of the present invention comprise monitoring cell invasion and selecting a candidate compound if cell invasion is inhibited.
  • Cell invasion may be monitored or measured by any known method such as transwell cell migration assays (Boyden chamber).
  • invasion is evaluated using a transwell migration assay through MatrigelTM, a reconstituted basement membrane matrix from BD Biosciences®. These assays are commonly used to study the migratory/invasion response of cells and are well known to the skilled person.
  • the methods of the present invention comprise monitoring fibronectin expression in the transfected cells.
  • fibronectin refers to any polypeptide encoded by the FN1 gene through alternative splicing. Expression of fibronectin in the transformed cells may be monitored by any suitable method known to the person skilled in the art such as for example immunostaining or western blot. In a preferred embodiment fibronectin expression is monitored using the monoclonal antibody clone 10 from BD Transduction laboratories®. Candidate compounds are selected as antagonist compounds if fibronectin expression is reduced and selected as an agonist compounds if fibronectin expression is enhanced.
  • vimentin can be monitored and used in the same way.
  • vimentin refers to the product of the VIM gene encoded in human by the mRNA identified by GenBank number NM_003380.3 (31-MAR-2012).
  • the methods of the present invention comprise monitoring vimentin expression in the transfected cells. Expression of vimentin in the transformed cells may be monitored by any suitable method known to the person skilled in the art such as for example immunostaining or western blot. Candidate compounds are selected as antagonist compounds if vimentin expression is reduced and selected as an agonist compounds if vimentin expression is enhanced.
  • the methods of the present invention comprise monitoring cadherin-6 expression in the transfected cells.
  • cadherin-6 refers to any polypeptide encoded by the CDH6 gene through alternative splicing, even though only one mRNA is mentioned in Genbank (NM_004932.3; 13-AUG-2011).
  • Expression of cadherin-6 in the transformed cells may be monitored by any suitable method known to the person skilled in the art such as immunostaining, western blot, northern blot and RT- PCR.
  • Candidate compounds are selected as antagonist compounds if cadherin-6 expression is enhanced and selected as agonist compounds if cadherin-6 expression is reduced.
  • Induction of the expression of a COUP-TF polypeptide in the transfected cells triggers accumulation of cells in the G0/G1 phase of the cell cycle.
  • the methods of the present invention comprise monitoring the cell cycle of the transfected cells.
  • the cell cycle of the transfected cells may be monitored by any suitable method known to the person skilled in the art such as flow cytometry.
  • Candidate compounds are selected as antagonist compounds if accumulation of cells in the G0/G1 phase is reduced and as agonist compounds if accumulation of cells in the G0/G1 phase is enhanced.
  • the methods of the present invention comprise monitoring reorganization of apical actin belts to stress fibers in the transfected cells.
  • Actin organization is monitored by specific fluorescent labeling for instance using labeled phalloidin. These methods are commonly used and are well known to the skilled person.
  • Candidate compounds are selected as antagonist compounds if reorganization is reduced and selected as agonist compounds if reorganization of apical actin belts to stress fibers is enhanced.
  • the methods of the present invention comprise monitoring RAC1 activation in the transfected cells.
  • RAC1 refers to products of the RAC1 gene which are encoded in human by mRNAs identified by GenBank numbers NM_018890.3 and NM_006908.4 (01-APR-2012).
  • RAC1 activation is measured using for example a pull-down assay with p21 protein Cdc42/Rac-activated kinase 1 (PAK1) binding domain. These methods are commonly used and are well known to the skilled person.
  • Candidate compounds are selected as antagonist compounds if RAC1 activation is reduced and selected as agonist compounds if RAC1 activation is enhanced.
  • the methods of the present invention comprise monitoring proteases secretion by the transfected cells. Any suitable method may be used for measuring proteases secretion such as radial caseinolysis.
  • Candidate compounds are selected as antagonist compounds if proteases secretion is reduced and selected as agonist compounds if proteases secretion is enhanced.
  • Figures Figure 1 Invasion assays on a clone expressing a control polypeptide (LacZ) and several clones expressing COUP-TFII. Right column: invasion in basal condition, left column: invasion after polypeptide induction. EXAM PLES
  • Example 1 evidence that COUP-TFII triggers EMT features in MDCK II cells
  • COUP-TFII coding sequence was PCR generated using the following primers (GGACGCAGCCCCCATAGAT; AGGAAATTAAGCAAACAAACCAG) and cloned into pcDNA4/TO (I nvitrogen®) either alone (pcDNA4/TO-ON R) or with an N-terminal Xpress tag (pcDNA4/TO-Xpress-ONR).
  • COUP-TFI I The expression of COUP-TFI I was induced with O ⁇ g/ml doxycycline and revealed by western blotting using an anti-Xpress antibody (I nvitrogen®) or a rabbit polyclonal antibody raised against the SOASOAPPVPGPPPG peptide specific for COUP-TFI I or a COUP-TFI I monoclonal antibody (Clone H7147).
  • an anti-Xpress antibody I nvitrogen®
  • a rabbit polyclonal antibody raised against the SOASOAPPVPGPPPG peptide specific for COUP-TFI I or a COUP-TFI I monoclonal antibody (Clone H7147).
  • Anti-cadherin-6 from Sigma (HPA007456) diluted 1/500 for western blot and 1/150 for immunofluorescence; Anti-N- cadherin (clone 32, BD transduction laboratories®, 1/5000); anti-fibronectin (clonelO, BD transduction laboratories®, 1/10 000) and anti-vimentin (Dako®, 1/1000) for western blot. Actin was stained using phalloidin FITC (I nvitrogen®) according to manufacturer instructions.
  • RNA Three micrograms RNA were treated with DNase (RQ.1 DNase, Promega®). Half of it was kept as negative control and half was retro-transcribed using Superscript II (Invitrogen) and random primers.
  • RT-PCR was carried out on a Lightcycler (Roche®) using LightCycler FastStart DNA Master SYBER Green I (Roche®). Cyclophillin A was used as control gene. Rho GTPase activation assays
  • Rho GTPases Rho, Racl and Cdc42 The activation of Rho GTPases (Rho, Racl and Cdc42) was assessed by pull-down assay with the Cell Biolabs Inc® kit according to the manufacturer's instructions.
  • Invasion chambers (BD biosciences®) were coated with Matrigel (BD biosciences®) and 2 10 5 cells in 0.8% serum-RPMI were seeded. Chambers were incubated overnight in 10% serum-RPMI. Cells that crossed the filter were fixed with 3% formaldehyde and stained with toluidin blue in 1% borax. Radial caseinolysis
  • COUP-TFII expression Upon induction of either tagged or untagged COUP-TFII, a striking morphological change is seen.
  • COUP-TFII expression triggers disturbance of the cobblestone epithelial appearance and the flattening, elongation and enlargement of the cells.
  • COUP-TFII expression On sparsely seeded cells, COUP-TFII expression elicits appearance of numerous lamellipodia typical of motile cells. Importantly, the cells become invasive through Matrigel as assessed by transwell assay (Fig 1).
  • M DCK II cells culture and transfection were realised as previously described. After induction, cells were processed for flow cytometry using the Cycletest plus kit (BD bioscience®) according to the manufacturer instructions. Cell cycle analysis was performed using a BD FACSCanto I I flow cytometer. Two days after induction of COUP- TFI I, M DCK II cells accumulate in GO-Gl phase (67.5% ⁇ 9.2 for induced cells versus 45 ⁇ 7.1 for control cells; p ⁇ 5%).
  • Colon cancer cell lines were cultured in DM EM high glucose. Bladder cancer cell lines were cultured in RPM I . Western blots were performed as previously described. Paraffin embedded tumour samples were cut at 4 ⁇ and processed for immunoperoxydase staining. A rabbit polyclonal antibody raised against the SOASOAPPVPGPPPG peptide specific for COUP-TFII and a COUP-TFII monoclonal antibody (Clone H7147) were used as primary antibodies. They were diluted 1/100 for immunohistochemistry and 1/500 for western blot. For immunoperoxydase, an ABC kit (Vector) was used after biotinylated secondary antibodies (Vector®, 1/300). Results:
  • COUP-TFII can act as an inducer of EMT. It is thus logical to wonder about its role in cancer.
  • COUP-TFII expression in nuclear extracts of 22 colon and 17 bladder carcinoma cell lines available in the laboratory.
  • 3 colon and 6 bladder cell lines display a robust expression of COUP-TFII which is unexpected since COUP-TFII is a developmental ⁇ expressed mesenchymal molecule with expression restricted to some endothelial cells and smooth muscle cells of adult tissues. Expression in cell lines is not a mere culturing a rtefact, since expression in carcinoma but not in normal epithelium, can be evidenced by immunohistochemistry of pathological specimens.
  • Example 4 Evidence that a molecule highly homologous to COUP-TFII has the same effect when expressed in MDCK II cells
  • COUP-TFI shows extensive homology to COUP-TFII we tested whether it would also trigger EMT features in MDCK II cells.
  • COUP-TFI cDNA was cloned into pcDNA4TO together with an Xpress tag and transfected into MDCK II cells as previously described.
  • EMT features such as morphological changes, induction of invasion, induction of fibronectin expression and repression of cadherin-6 were seen upon induction of COUP-TFI expression.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Toxicology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • Cell Biology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé in vitro permettant de choisir un composé agoniste de COUP-TF, consistant à fournir au moins un composé candidat, à fournir des cellules épithéliales de mammifère transfectées exprimant polypeptide de COUP-TF ayant une identité d'au moins 80% avec le polypeptide SEQ ID N° 1 sous le contrôle d'un promoteur inductible, induire l'expression dudit polypeptide COUP-TF dans lesdites cellules transfectées en présence dudit au moins un composé candidat, contrôler l'effet oncogène du COUP-TF sur lesdites cellules transfectées, et choisir ledit composé candidat comme composé antagoniste si l'effet oncogène est réduit.
PCT/EP2013/060493 2012-05-22 2013-05-22 Procédés de criblage pour identifier des composés interférant avec coup-tfii (nr2f2) ou coup-tfi (nr2f1) WO2013174859A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP12305558.4 2012-05-22
EP12305558 2012-05-22

Publications (1)

Publication Number Publication Date
WO2013174859A1 true WO2013174859A1 (fr) 2013-11-28

Family

ID=48576964

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/060493 WO2013174859A1 (fr) 2012-05-22 2013-05-22 Procédés de criblage pour identifier des composés interférant avec coup-tfii (nr2f2) ou coup-tfi (nr2f1)

Country Status (1)

Country Link
WO (1) WO2013174859A1 (fr)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998041648A2 (fr) * 1997-03-20 1998-09-24 Variagenics, Inc. Genes cibles pour medicaments specifiques d'alleles
WO1998057647A1 (fr) 1997-06-18 1998-12-23 Baylor College Of Medicine Recepteur nucleaire orphelin, coup-tfii, necessaire a l'angiogenese

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998041648A2 (fr) * 1997-03-20 1998-09-24 Variagenics, Inc. Genes cibles pour medicaments specifiques d'alleles
WO1998057647A1 (fr) 1997-06-18 1998-12-23 Baylor College Of Medicine Recepteur nucleaire orphelin, coup-tfii, necessaire a l'angiogenese

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
CHRISTIANSEN JJ; RAJASEKARAN AK, CANCER RES, vol. 66, 2006, pages 8319 - 8326
DARNELL JE JR, NAT REV CANCER, vol. 2, 2002, pages 740 - 749
E MORE: "Activation of the MAP kinase pathway induces chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII) expression in human breast cancer cell lines", JOURNAL OF ENDOCRINOLOGY, vol. 176, no. 1, 1 January 2003 (2003-01-01), pages 83 - 94, XP055037944, ISSN: 0022-0795, DOI: 10.1677/joe.0.1760083 *
GIROLDI L ET AL., INT J CANCER, vol. 82, 1999, pages 70 - 76
KRUSE ET AL., PLOS BIOL, vol. 6, 2008, pages 2002 - 2015
LIN FJ ET AL., ENDOCR REV, vol. 32, 2011, pages 404 - 421
NAGASAKI S ET AL., CANCER SCI, vol. 100, 2009, pages 639 - 645
NAVAB ET AL., CANCER RES, vol. 64, 2004, pages 5097 - 5105
SHIN SW ET AL., ONCOL REP, vol. 21, 2009, pages 101 - 106
WANG Q ET AL., GENE, vol. 119, 1992, pages 155 - 161
YANG J; WEINBERG RA, DEV CELL, vol. 14, 2008, pages 818 - 829
YILMAZ M; CHRISTOFORI G, MOL CANCER RES, vol. 8, 2010, pages 629 - 642

Similar Documents

Publication Publication Date Title
Wang et al. Oct-4 and Nanog promote the epithelial-mesenchymal transition of breast cancer stem cells and are associated with poor prognosis in breast cancer patients
Nguyen et al. Cross-regulation between Notch and p63 in keratinocyte commitment to differentiation
Ji et al. Decreased expression of LATS1 is correlated with the progression and prognosis of glioma
Han et al. RNA interference-mediated silencing of NANOG reduces cell proliferation and induces G0/G1 cell cycle arrest in breast cancer cells
Michl et al. CUTL1 is a target of TGFβ signaling that enhances cancer cell motility and invasiveness
Marani et al. Role of Bim in the survival pathway induced by Raf in epithelial cells
Zhang et al. Negative regulation of YAP by LATS1 underscores evolutionary conservation of the Drosophila Hippo pathway
Yu et al. miR-190 enhances endocrine therapy sensitivity by regulating SOX9 expression in breast cancer
O'Malley et al. TOB suppresses breast cancer tumorigenesis
Chiappetta et al. PATZ1 acts as a tumor suppressor in thyroid cancer via targeting p53-dependent genes involved in EMT and cell migration
Licciulli et al. Pirin inhibits cellular senescence in melanocytic cells
Chowdhari et al. miR-4516, a microRNA downregulated in psoriasis inhibits keratinocyte motility by targeting fibronectin/integrin α9 signaling
Bharathy et al. Cancer-associated transforming growth factor β type II receptor gene mutant causes activation of bone morphogenic protein-Smads and invasive phenotype
Chen et al. β-catenin/Tcf-4 complex transcriptionally regulates AKT1 in glioma
Boutet et al. Taf1 regulates Pax3 protein by monoubiquitination in skeletal muscle progenitors
Du et al. The tumour suppressive role of metastasis suppressor-1, MTSS1, in human kidney cancer, a possible connection with the SHH pathway.
Ghosh et al. PD-L1 recruits phospholipase C and enhances tumorigenicity of lung tumors harboring mutant forms of EGFR
Reimer et al. E2F3a is critically involved in epidermal growth factor receptor–directed proliferation in ovarian cancer
Bordonaro et al. The Notch ligand Delta-like 1 integrates inputs from TGFbeta/Activin and Wnt pathways
Kaowinn et al. Cancer upregulated gene (CUG) 2 elevates YAP1 expression, leading to enhancement of epithelial-mesenchymal transition in human lung cancer cells
Haider et al. Breast cancer bone metastases are attenuated in a Tgif1-deficient bone microenvironment
Rao et al. Induction of heparanase-1 expression by mutant B-Raf kinase: role of GA binding protein in heparanase-1 promoter activation
Wencong et al. FOXK1 promotes proliferation and metastasis of gallbladder cancer by activating AKT/mTOR signaling pathway
US9879325B2 (en) Method for predicting the responsiveness a patient to a treatment with an anti-CD20 antibody
Mancino et al. Regulation of human cripto‐1 gene expression by TGF‐β1 and BMP‐4 in embryonal and colon cancer cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13727079

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13727079

Country of ref document: EP

Kind code of ref document: A1