WO2013170258A2 - Rhg1 mediated resistance to soybean cyst nematode - Google Patents

Description

MiGl MEDIATED RESISTANCE TO SOYBEAN CYST NEMATODE

CROSS-REFERENCE TO RELATED APPLICATIO

This patent, application claims the benefit of priority of United States Provisional Patent Application No. 6.1/646,0.17, filed May 11, 2012, and United States Provisional Patent Application No. 61 /676,854, filed July 27, 2012, and United States Utility

Application No. 13/843,447, filed March 1.5, .2013, all of which are incorporated, herein by reference in their entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

This invention was made with government support under grant numbers 06- CRHF-0-6OS5 and IO-C HF-0-6055 awarded by USDA NIFA. The government has certain rights in the invention. SEQUENCE LISTING

A Sequence Listing accompanies this application and is incorporated herein by reference in its entirety. The Sequence Listing was filed with the application as a text file on May 13, 2013. BACKGROUND

Soybean cyst nematode (SC ) is currently the most economically damaging disease for United State soybean production in most years. Estimates suggest that SCN accounts for over $700 million in reduced soybean, production in the United States annually. SCN also seriously impacts soybean production in other countries such as Brazil, Argentina and China. Soybean varieties with increased resistance to SCN have been identified, but resistance is quantitative and efficac varies depending on nematode genotypes, hence use of the more resistaiit varieties still can result in soybea yield loss due to SCN.

The genetic basis for resistance to SCN has been partially defined, to the level of genetic loci, and appropriate sources of the soybean locus Rhgl make substantial.

contributions to SC resistance. Prior to the present work, the specific genes and gene products controlling Mhgl~m d t&d SCN resistance have not been successfully documented.

SUMMARY

Methods of increasing resistance of a plant to nematodes, i particular increasing resistance of soybeans to SCN are provided herein. Several gene products from the rhgl- b locus are identified and the relationship of the gene products to resistance to SCN in soybeans is demonstrated. These genes and gene products ma also increase resistance of other plants, including but not limited to, sugar beets, potatoes, com, peas, or beans to nematodes, in particular to cyst nematodes.

In one aspect, methods of increasing resistance of a plant to nematodes, suitably cyst-forming nematodes, suitably SCN by increasing the expression of or altering the expression pattern or gene copy number of a polynucleotide encoding a. Glyma 18g02580 polypeptide, a Glym J 8g02590 polypeptide, a Gly.mal ()2610 polypeptide, a polypeptide having 90% or more identity to SEQ ID NO: Ϊ _> SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO:6, or SEQ ID NO: 3, or a homolog or functional variant of an of the aforementioned polypeptides in cells of t he plant are provided. U se of combinations of the polypeptides is envisioned. The polynucleotides encoding these polypeptide sequences may be derived from the Williams 82, PI8S788 or Peking (PI 548402) soybean varieties or other sources of the polynucleotides. The polypeptide sequences are provided and the polymorphisms between the sequences in different varieties are noted. Increased expression of the polynucleotides in ceils of the plant, increases the resistance of the plant to nematodes. Suitably expression is increased in ceils of the root of the plant. Suitably expression of at least, two of the polynucleotides is increased. Su itably, expression of ail three of the polynucleotides is increased..

In another aspect, methods of increasing resistance of a plant to nematodes, suitably cyst-forming nematodes, suitably SCN by altering (increasing or decreasing) the expression in cells in the root of the plant of a polypeptide i dentical or simi lar to at least a portion of SEQ ID NO: i of Glynial 8gQ2580_s SEQ ID NO:2, 5 or 6 of Giyrnal 8gG2590 or SEQ ID NO: 3 of Glymal 8g02610 relative to the expression, in cells in the root o the plant of a polypeptide whose expression can be used as a control, such as Glyma! !g35820, are provided. Suitably expression of at leas two of the polypeptides is increased. Suitably, expression of all three of the polypeptides is increased.

Alternatively or in. addition, expression of the polynucleotides encoding the polypeptides of GIymaI8g026I0, Glyraai8g0259O, and/or Glyma 18g2580 may be increased as well.

In another aspect, methods of identifying plants that exhibit useful levels of resistance of a plant to .nematodes suitably cyst-forming nematodes, suitably SC by identifying plants thai exhibit altered (increased or decreased) expression in cells in the root of the plant of a polypeptide identical or similar to at least a portion of SEQ ID NO: 1 of Glyma 1.8g02580, SEQ I D O:2, 5 or 6 of Glyma 18g02590 or SEQ ID NO: 3 of Glys.na! 8g02610 relative to the expression in cells in the root of the plant of a polypeptide whose expression can be used as a control, such as Glyma 1 ί §35820, are provided. Suitably expression of at least two of the polypeptides is at a higher le vel, than in plants that are more susceptible to SCN, Suitably, expression of all three of the polypeptides is at a higher level. Alternatively or in addition, expression of the polynucleotides encoding the polypeptides of Glyma 18gO261 . Glyma.18g02590, and/or Glyma 1.8g2580 may be at a higher level as well.

In yet another aspect, a construct comprising a promoter operably linked to a polynucleotide encoding at least a portion of Glyraal 8g02580 polypeptide comprising SEQ ID NO: L a Glyma 18gO2590 polypeptide comprising SEQ ID NO: 2, 5 or 6, Glyma 18g02610 polypeptide comprising SEQ ID NO: 3 or a polypeptide having at least 90% identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO; 3_t SEQ ID NO: 5. SEQ ID NO : 6 or a horaolog or functional portion of any of the aforementioned polypeptides or combinations thereof is provided. The construct may be used to generate transgenic plants or seeds.

In still another aspect, a transgenic plant comprising an exogenous or non-native polynucleotide encoding at least a portion ofGlynm^'l.8g02580 polypeptide comprising SEQ ID NO: 1, Glyma! 8g02590 polypeptide comprising SEQ ID NO: 2, 5 or 6, Glyma! 8g026O0 polypeptide comprising SEQ ID NO: 4, Glyraal Sg026.K) polypeptide comprising SEQ ID NO: 3 or a polypeptide having at least 90% identity to SEQ ID NO: 1 , SEQ ID NO; 2, SEQ ID NO; 3, SEQ ID NO; 4, SEQ ID NO;5, SEQ ID NO:6, a horaolog or a functional portion of any of the a forementioned polypeptides or combinations thereof or the polypeptides described herein from, either the Ρ.Ϊ88788 or Peking-source is provided. The transgenic plant has increased resistance to nematodes, suitably cyst-forming nematodes, suitably SCN. Suitably, the transgenic plant comprises at least one polynucleotide encoding at least two or at least three of the polynucleotides encoding the Glymal 8g02580, Glymal 8g025 0, and Glymal.8g026.10 polypeptides.

In a further aspect, a transgenic celt comprising a polynucleotide encoding a polypeptide capable of increasing resistance to nematodes, suitably cyst-forming nematodes, suitably SCN is provided. The polypeptide includes at least a portion of a polypeptide having at least 90% identity to SEQ ID NO: L SEQ ID NO; 2, SEQ ID NO: 3 or similar sequences derived .from P188788 (such as SEQ ID NO: 5) or Peking-source (such as SEQ ID NO: 6) or combinations thereof. Suitably, the polynucleotide includes at least two or three of the polypeptides having at least 90% identity to SEQ ID NO: L SEQ ID NO; 2, SEQ ID NO: 3.

In another aspect, methods of generating a transgenic plant by introducing an. exogenous polynucleotide encoding at least a portion of a Glymal 8g02580 polypeptide having at least 90% identit to SEQ ID NO: 1, Glymal 8g02590 polypeptide having at least 90% identity to SEQ ID NO: 2, 5 or 6, or Glymal 8g02610 polypeptide having at least 90% identity to SEQ ID NO; 3, or homologs or combinations thereof are provided. The transgenic plant has increased expression of Glyma 18g02< 10, Glymal 8g02590, and/or Glymal 8g02580 in a cell i a root of the plant. The transgenic plant has increased resistance to nematodes, suitably cyst-forming nematodes, suitably SCN, as compared to a control plant. Suitably, the transgenic plant has increased expression of at least two of the polynucleotides or ail three of the polynucleotides encoding the Glymal 8g02610, Glymal Sg0259Q, and/or Glymal 8g02580 polypeptides.

In yet a further aspect, methods of identifying molecules that interact with the

RhgJ locus, Glyma 18g02610_T Gfymal8g02590 and/or Glyma !8g02580 RNA transcripts, or the Glymal 8g02610, Glymal 8g02590 and/or Glymal 8g02580 polypeptide are provided. The methods include detecting molecules capable of binding the RhgJ locus, GhmaI8g026!Q, Glyma !8gQ2590 or Glymal 8gi)2$80 RNA transcripts, or

Gtymal8gG26.10, Glymal8gQ2S9G or Glymal 8g02580 polypeptides. In a still further aspec t, methods of identifying the resistance or susceptibility phenotype of a plant, to cyst nematodes are provided. The method, includes detecting a. genetic majrker associated with cyst nematode resistance or susceptibility in a first plant ceil and comparing the genetic marker in the first plant cell to the genetic marker in a second plant cell, with a known resistance or susceptibility phenotype or a control plant cell The genetic marker may be sequence variations, methylation differences, niRNA expression differences, small RNA production or other differences identified herein. Suitably, the genetic marker is associated with characteristics of the Rhg~.i locus, such as those reported herein. Suitably, ihe genetic marker is the genomic copy number of at least one of Gfyma 18g026Q(h Gfyma 1 gi)26l 0, Glymal 8g0259Q or Glymal$g02580. Suitably the plant is a soybean and the nematodes are SCN.

In still a further aspect, methods of increasing resistance of a plant to nematodes comprising expressing a polynucleotide encoding a Glymal 8g0261O polypeptide, a

Glymal 8g02590 polypeptide, or a Glymal 8g02580 polypeptide, a polypeptide having 90% or more identity to SEQ 3D NO: 1 , SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 6 or SEQ ID NO: 3, or a homolog or functional variant or combinations of any of the aforementioned polypeptides in a cell. Suitably, the polynucleotide encodes at least two or all three of the Glymal 8g()2610, Glymal 8g02590 or Glymal 8g02580 polypeptides. The polypeptides or a cell, encoding the polypeptide may then be applied to the plant, seeds of the plant or to soil in which the seeds may be planted. The application increases the resistance of the plant to nematodes.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure i is a pictorial depictio of the lifecycle of SCN.

Figure 2 is a pictorial depiction of one gene silencing strategy that uses artificial mkroRNA sequences to target a gene of interest.

Figure 3 shows a there are three genes at rhgl-b that contribute to SCN resistance. Figure 3 A is a photograph showing representative SCN-.in.fested roots; root vascular cylinder and nematodes stained with acid fuchsin. Fewer nematodes progress from J2 to .13, J4, adult male or egg~.till.ed adult female (cyst) stages in SCN-resIstant roots. Figure 3B is a graph showing that SCN development beyond 52 stage in transgenic roots of soybean variety Fayette with the designated gene silenced, relative to Williams 82 (SCN- susceptible) and non-silenced Fayette (SCN-resistant) controls. Mea ± std, error of mean. *: Fayette (silenced) significantly different from Fayette (not silenced) based on ANOVA p < 0.05. EV: transformed with empty vector.

Figure 4 is a set of graphs showing that nematode de velopment is impacted by level of silencing. Figure 4Aand 4C show thai nematode development on Williams 82 and Fayette roots transformed with empty vector (EV), or Fayette transformed with silencing constructs (2580RNAi or ami2590) was dependent on level of silencing.

Transgenic roots with reduced target transcript abundance ( ) displayed nematode development similar to Williams 82 (SCN -susceptible), while transgenic root with non- silenced transcript level. (~) had nematode development similar to Fayette (SCN- resistant). Figure 4B and 4D show the transcript abundance of target genes in roots from (A) or (C) respectively, measured by qPCR. SKPI6 transcript used as reference and normalized to Fayette~EV. The .results of Figure 4B and 40 were used to place roots in the 'well-silenced' (+) or 'not well-silenced' (-) categories shown in Figure 4A and 4C. Figure 4 A and 4B are Gtyma lSg025S0. Figure 4C and 40 are Giyma I Sg⁽)261 (I Bars represent mean ± std. error of mean.

Figure 5 shows a 3 ! .2 kb repeat tha elevates expression of the encoded genes is present in SCN-resistant haplotypes of the Rhgl locus. Figure 5 A is a schematic of Rhgl locus of Williams 82 (top), and five fosoiid. inserts from rhgl-b haplotype. DNA sequences of soybean reference genome shown for the two designated locations.

Numbers and block icons refer to soybean genes (e.g., Giyma 18g02540), Fosmtds #3, and 5 carry rhgl-b genome segments that span repeat junctions. Figure 5B shows the Rhgl repeat junction sequence from four different sources of SCN resistance (compare to reference genome sequences in (Figure 5 A)), figure 5C is a graph showin the number of whole-genome shotgun sequencing reads corresponding to reference genome region shown in green in Figure 5 A was ten-fold greater than for genome regions adjacent to rhgi-h on chromosome 18 or for ? /-homeologous loci on chromosome 1 1 and 2. Figure SD is a graph showing transcript abundance of genes encoded in the 31 kb repeat region is much greater in roots from SC -resistant soybean varieties relative to SCN- susceptible varieties. Mean -i-. ski error of mean shown for qPCR; results for

GfymaJ8gO2600 were at limit of detection

Figure 6 shows Fiber-FiSH detection of Rhgl copy number variation i widely used soybean lines. Figure 6A is a schematic showing the two adjacent probes isolated from a single P1887-88 (rhgl-b) genomic DNA fosmid clone whose insert spans a repeat junction, generating a 25,2 kb prob (green label) and. an adjacent 9,7 kb probe (red label). DNA. for green-labeled and red-labeled fiber-FISB probes are shown, under the corresponding sequence regions of Williams 82. The 25,2 kb fragment from rhgl-h liap!otype used for green probe was a single continuous DMA. fragment that spans a. repeat junction. Figure 6B shows a composite of four Fiber-FISH images (tour DNA fibers) per genotype, and probe diagram. Alternating pattern of red and green

hybridization on single genomic DNA fibers indicates ten and three direct repeat copies of the 31 kb block at Rhgl locus of SCN-resistant Fayette (rhgl-b derived from PI 88788) and Pekin (PI 548402) respectively, and one copy par Rhgl haplotype in SCN- susceptible Williams 82, White bars - 10

correspond to approximately 32 kb using a 3.21 kb/pm conversion rate.

Figure 7 shows that multiple SCN-resistant varieties contain the DNA junction indicative of a repeat within the Rhgl locus, and exhibit elevated expression of genes fully encoded within the repeat. Figure 7 A is a schematic of PCR primers used in Figure 7B (see also Figure 5). Figure 7B is a photograph of a gel showing the results of PCR using outward-directed oligonucleotide primers shown in Figure 7 that match sequences at the outer edges of the 31 kb segment of Rhgl locus thai is repeated in some soybean varieties. R indicates SCN-resistant and S indicates SCN~suseepS:ibie soybean variety. For primers 81 and 82 see Table 4. Figure 7C shows the DNA Sequence from 1 1 SCN- resistant varieties and reveals identical sequence for the repeat junction indicating a shared origin. Red bar indicates repeat junction (see also Figure 5), Figure 7D is a -graph showing the transcript abundance for genes encoded at Rhgl (normalized to SKP16\ revealing elevated expression of genes fully encoded within the repeats of Rhgl from PI 88788 or Peking sources, relative to expression of the same genes in SCN-susceptible varieties. Bars represent mean std. error of mean, GiymaJ 8g02600 is expressed below 0.01 % of SKP 16 (CT > 35 cycles). Figure 7E is an RNA blot analysis for Glym lSgO2S70 using RNA collected from roots of whole lants of Fayette and Forrest (SCN resistant) and Williams 82 (SCN susceptible). * denotes the band corresponding to the expected transcript size of Giyma 8g025?0 ( 2 kb). The band at l.Skb corresponds to non-specific ribosomal binding. Cultivars Fayette and Forrest (that contain repeats of the 31 kb DNA. segment) display the same banding pattern as. Williams 82 (that contains a single copy of the 3 ikb DNA segment); no alternative transcripts for Giym l8g02$70 were detected as a result of the repeated DMA in. Fayette and Forrest. RACE PCR from plants carrying rkgl-b confirmed full-length transcripts (with transcript ends as annotated in the reference genome) tor Giymal 8g02S80_s -2590 and -2610.

Figure 8 is a graph showing tjFCR for genes in and outside of Rhgl repeat. RNA collected from roots of 3 individual plants grown in pots, 5 days post emrgence. Dark gray bars are estimated to be high copy number lines based on gDN^'A qPCR and cDNA sequencing. Light grey bars are low copy number containing lines that also require Rhg4 for full resistance.

Figure 9 contains ex-ample gel photographs and a table summarizing many experiments showing that resistant and. susceptible cultivars have d ferential DNA tnethylation at or adjacent to the genes in the duplicated region, especially in the promoter regions. In McrBC experiments, methylated genomic DNA is cleaved by McrBC, which reduces the abundance of the PCR product, while in Hpall experiments, methylated genomic DMA is not cleaved by Hpall and it is the non-methylated DNA that is cleaved, leading to reduced abundance of the PCR. product.

Figure 10 is a photograph of a Western blot, showing that an epitope-tagged version of the Glymal 8g026l(⁾ protein, produced from an introduced polynucleotide in transgenic roots, is expressed in both Williams 82 and Fayette transgenic roots and the product are similar in size.

Figure 1 1 A ts a graph showing the quantitative PCR gene expression analysis for genes at the Rhgl locus in susceptible and resistant roots showing that some of these genes not only are more highly expressed in resistant cultivars (as is also ^'shown in Figure 1 1 ), but also exhibit some upregulation after inoculation with SCN. Figure 11B is a graph showing the quantitative PGR gene expression, analysis following methyl jasracmate or water treatment, which reveals that Glymal 8g02610 is expressed more highly in response to elevated levels of methyl jasmonate.

Figure 12 is a set of photographs showing the histochemical staining of romote GO^'S expression in Fayette hairy root with ( , D, F and H) or without (A, C, E, and G) nematode inoculation. A and 8 show GIymai8g025S0. € and D show Ghmal8g02590. E and F show Gfymal8g⁽)26l(l G and B show Gfymal4g06080.

Figure 13 provides the nucleotide and amino acid sequences for Glymal 8g2590 from the indicated varieties.

Fiaivre 14 is a computer enerated schematic of the three-dimensional structure of

Glymal.8g2590 showing the polymorphisms among the varieties in the structure.

Figure 15 is a graph showing elevated SCN resistance conferred by simultaneous overexpression of multiple genes rather than overexpression of individual genes from the 31 kb rkgl-h repeat. SC development beyond J2 stage is reported tor transgenic soybean roots (variety Williams 82) overexpressmg the designated single genes, or overe pressing all genes encoded within the 31 kb repeat (Glyma!8g02580, -2590, -2600 and -2(5/(7), relative to Williams 82 (SCN- usceptible) and Fayette (SCN-resistani) controls. Mean ± std. error of mean for roots transformed with empty vector (EV) or gene overexpression constructs (OX). *: Williams 82 - OX significantly different from

Williams 82 - EV based on ANOVA p < 0.05.

Figure 1 is a set of graphs showing that expressing the native Fayette

Glymal 8gO2590 allele in Williams 82 does not alter SCN development, figure 16A is a graph showing similar nematod development on transgenic roots of Williams 82 expressing empt vector (EV) or Williams 82 expressing the Fayette (riigl-h-typc) allele

of Fayette Giy a l8g02590 promoter sequences

(2590r_a>.t>: :2590p_ay). Williams 82 transformed with either construct allowed a greater proportion of nematodes to advance beyond the .12 stage compared to Fayette-EV. Figure 168 is a graph showing transcript abundance for Gtym I. Hg02590 in .roots- from Figure 16A, measured by qPCR. SKP16 transcript used a reference; data normalized to

Williams 82 ~ EV. Bars in. Figure .1 A and Figure 16B represent mean std. error of mean. Figure 17 is a graph showing that qPCR reveals elevated transcript abundance of the intended genes in roots transformed with the multiple gene simultaneous

overexpression construct of Figure 15, and no significant elevation of PR- 1 expression. Transgenic roots carried either the multiple-gene construct (OX) or empty vector (EV), Similar results obtained i second independent experiment with different transgenic events, except PR-1 abundance was more similar (closer to 1.0) between Williams 82 - EV, Fayette-EV and Williams-OX roots in second experiment. Bars represent mean ± std. error of mean. Data for Gfym ]Sg(} 600 are less dependable for Willianis-E V and Fayette-E because their PCR. signal was at th e l imit of accurate q^'PCR detection (CT > 33).

Figure 18 is a set of graphs showing that overexpression of Glyma 18g2580, Gly.ffia i.8g.2S90 and Giymal8g.26i 0 in combination can confer resistance on a susceptible Williams 82 variety. DETAILED DESCRIPTION

Methods of identifying plants resistant or susceptible to cyst nematodes, such as the soybean cyst nematode (SCN), methods of assessing a plant's level of resistance or suscepiibiiii to nematodes, such as SCN, methods of increasing resistance of a plant or plant cells to cyst nematodes and methods of generating transgenic plant materials, including transgenic cells and plants, are provided herein. In addition, constructs including polynucleotides encoding the Rhgl polypeptides described herein or homologs or variants thereof are provided herein as SEQ ID NO: 1-6, Transgenic plants or transgenic plant cells with increased resistance to cyst nematodes, particularly SCN, carrying a transgene encoding a non-native or exogenous Rhgl derived polynucleotide encoding the polypeptides of SEQ I D NOs: 1-6 are provided herein. Non~transgen.ic plants carrying the polypeptides or bred or otherwise engineered to express increased levels of the polypeptides or the polynucleotides encoding the polypeptides are also disclosed.

SCN is caused, by the nematode Heterodera glycines. The life cycle of the nematode is shown i Figure 1. Once a field is infested with this nematode, .no economically feasible means of eliminating SCN from that field presently exists. Current management of SCN often focuses on crop rotation and planting of SCN -resistant varieties of soybeans to control //. glycines populations across multiple years, as well as use of SCN-resistant and/or SCN-tolerant soybeans to facilitate acceptable yield of the present year's crop. Practitioners have adopted "Race" and "Hg Type" terminologies to describe H. glycines populations according to their ability to overcome known sources of plant SCN-resistance. Several races and Hg Types exist and. soybean resistance to one type may offer little to no protection against another type of the nematode. In addition, //. glycines are outcrossing organisms for which local populations are genetically ^'heterogeneous (and new nematode genotypes can be introduced), hence local populations can undergo shifts in race or Hg Type such that previously effective plant SCN resistance can lose efficacy. Thus, the ability to identify which soybeans are resistant to which H. glycines nematode populations and the further ability to genetically engineer soybean plants with increased resistance to more than one type of nematode population is needed.

Soybeans with increased resistance to SC are available and have been used in cross-breeding experiments to generate soybeans that are more resistant to SCN. The soybean rhgl locus of Peking was previously identified, mapped to a region of chromosome 1.8 (formerly known, as linkage group G), and a gene at that locus encoding a product carrying leucine-rieh repeats and a protein kinase domain (L R-kmase) was hypothesized to account for the increased resistant to SCN. In plants carrying the rhgl-b locus derived from soybean P188788, SCN still penetrate and initiate feeding, but a high, percentage of the syncitia do not persist and undergo th e full, sequence of nematode development (molting through the B and J4 stages to adulthood, sexual fertilization, and female transition to an embryo-filled and environmentally persistent cyst) (Li, Chen et al 2004), (Colgrove and Ntblack 2008). The molecular basis of this partial SC -resistance is not understood. Despite 50 years of research on. SCN, a pathogen causing hundreds of millions of dollars of economic losses in the U.S. annually, there were no confirmed public reports of a cloned soybean SCN resis tance gene prior to the priority application.

Further fine genetic mapping of the rhgl locus, which is also known as the Rhgl locus, or by other more restricted designations such as rhgl-b, was completed in plants carrying the PI8878S source of Rhg.L and new markers associated with the resistance genotype were identified. See Kim, M., D.L. Hyten, A.F. Bent and 8.W. Diers, 2010, Fine mapping of the SCN resistance locus rhgl-b from PI 88788. Plant Genome 3: 1-89, which is incorporated herein by reference in. its entirety. P188788 was chosen, because it Is the source of resistance in many cross-bred lines currently marketed as resistant to SCN. These markers are tightly linked with resistance or susceptibility to SCN and may be useful to identify o predict whether soybean breeding lines are likely to display a SCN-resistant or SCN-sensittve phenotype. The refined map of the rhgl -b locus from ΡΪ88788 suggested that, the L -kiaase gene that is very close to the rhgt-b locus does not make significant contributions to the SCN resistance phenotype. The study of Melito et a.L 2010, which used transgenic roots expressing full-length transcripts or constructs that partially silence the expression of transcripts, also found no evidence to support a role for the rhgl -^-proximal Glymal 8g02680 LRR~kinase in SC resistance. Kim et al. demonstrated thai the rhg.i~h genetic components associated with the SCN

resistance/susceptibility phenotype of PJ887S8 and its derivatives are located within the chromosomal interval defined by the termini BARCSOYSSRJ 8 0090 and

BARCSOYSSR _.18,_..0094. The most recent fine-structure genetic mapping defined an interval for rhgl-b that corresponds to a 67 kb interval carrying 11 predicted, genes in. the sequenced genome of SCN-susceptible Williams 82 soybean (Kim, Hyten et al. 2010), See Figure 5,

Here we report the identification and functional testing of multiple genes in the rhgl-b genetic interval. Within the Rhgl locus, .multiple copies (ten, seven or three copies in. the varieties investigated to date) of a chromosome segment encoding four identified genes within the Rhgl locus are present in SCN-resistant soybean varieties, while only one copy of this segment is present in the tested SCN-susceptible varieties that lack Rhgl alleles derived from the resistant varieties such as PI8S788, PI437654 or Peking. See Figures 5 and 6. Silencing of any one of three genes within the multi-copy gene block using miR A leads to increased susceptibility to SCN in transgenic soybean roots, in transgenic roots from a previously SCN-susceptible soybean variety, simultaneous overexpression of three or four of the hgl-b genes from the multi-copy gene block leads to increased SCN resistance, The genes within this block are expressed at significantly higher levels in. the tested SCN-resistant soybean varieties. Traits-acting factors in Fayette also are not sufficient to drive the elevated expression of transgenic DMAs sequences carrying these -2Kb of Glyma! 8g02590 or Glyma 18gQ2610 promoter

DNA sequence, when those sequences are integrated at loci other than r gl-b in Fayette. D^'NA methylatkra at multiple sites within the Rhgl locus is polymorphic between SCN- resistant and SCN-susceprlbie lines, and this may contribute to the gene expression differences that correlate wit SCN resistanee . The number of copies of this- locus also correlates to the levels of expression of the Glyma 18g2-580, Glyma 18g2590 and

Glyma 1.8g26.l0 polypeptides and mRNAs and to the level of resistance to SCN. Thus gene dosing based on increasing the number of copies of the repeated region of the DNA may be a key f ctor mediating increased expression of the polypeptides and increased resistance to SCN. Many portions of these findings were reported in Cook, D.E., Lee, T.G., Guo. X., elito, S., Wang, K, Bayless, A., Wang, J., Hughes, T.J., Willis, D.K., Clemente. T._s Diets, B.W,, Hudson, M.E. and Bent, A.F. 2012, Copy Number Variation of Multiple Genes at Rhgl Mediates Nematode Resistance in Soybean, Science

338:1206-1209 and the associated Supporting Online Material (Supplementary Materials) found at www.seienceniag.org/conient/sisppl/2012/ 10/ 10/science.1228746.DC 1.html, which are incorporated herein by reference in their entirety.

The resistance or susceptibility phenotype of a plant ca be predicted with, valuable accuracy by comparing a genetic marker in the plant to the same genetic marker or selectable marker in a second plant with known resistance or susceptibility phenotype. Thus methods of screening a first pl ant or plant cell for resistance or susceptibility to cyst nematodes is provided herein. The methods include detecting a generic marker or selectable marker associated with cyst nematode resistance or susceptibility to cyst nematodes in the first plant cell and using thai marker to predict the resistance or susceptibility of the first plant or plant cell to nematodes. Prediction does not mean a 1.00% guarantee of the phenotype regarding resistance or susceptibility of the plant, to cyst nematodes. The predicting step may include comparing the marker in the first plant or plant cell to the marker in a second plant or plant cell with a known resistance or susceptibility phenotype. The marker phenotype or genotype of the second cell is predictive of the cyst nematode resistance phenotype in the first cell., The prediction may be used to select resistant soybeans or .resistant plant cells for use in generating resistant plant lines. The plants include but are not limited to sugar beets, potatoes, corn, peas or beans.

A. plant includes any portion of the plant including but not limited to a whole, plant, a portion of a plam such as a part of a root, leaf, stem, seed, pod, flower, cell, tissue or plant germplasm or any progeny thereof, Germplasm refers to genetic material, from an individual or group of individuals or a clone derived from a line, cuhivar, variety or culture. Plant refers to whole plants or portions thereof including, bu not limited to, plant cells, plant protoplasts, plant tissue culture cells or call!. For example, soybean plant refers to whole soybean plant, or portions thereof including, but not limited, to, soybea plant cells, soybean plant protoplasts, soybean plant tissue culture cells or calli. A. plant cell refers to cells harvested or derived from any portion of the plant or plant tissue culture cells or calli.

The rhgl locus is a chromosomal region identified as a region important for resistance to SCN. A locus is a chromosomal region where one or more trai

determinants, genes, polymorphic nucleic acids, or markers are located. A quantitative trait locus (QTL) refers to a. polymorphic genetic locus where the underlying gene controls a trait that is quantitatively measured and contains at least two alleles that differentially affec expression of a henotype or genotype in at least one genetic background, with said locus accounting for part but not all of the observed variation in the overall phenotypic trait that is being assessed. A genetic marker is a nucleotide sequence or amino acid sequence that may be used to identify a genetically linked locus, such as a QTL. Examples of genetic markers include, but are not limited to, single nucleotide polymorphisms (SNP), simple sequence repeats (SS. ; or microsatellite), a restriction enzyme recognition site change, genomic copy number of specific genes or target sequences or other sequence based differences between a susceptible and. resistant plant.

Genetic or selectable markers can be detected using a variet of analytic methods, including RFLP, AFLP, sequence analysis, hybridization such as allele specific hybridization analysis, differenti l PGR or other methods such as those known to those of skill in. the art. A list of single nucleotide polymorphisms between resistant and susceptible soybeans in the Rhgl .multi-gene copy region is provided in Table 3 in the Examples. In another embodiment, the marker is the genomie copy number, or an estimate of the genomic copy number, of at least one of the genes or DNA sequences found m the replicated region of the resistant lines. In yet another embodiment the marker is the genomic DNA segment carrying the border between the replicated region at GiymaI8g02610 and Gl^'ymaJ g025?0 as shown in Figures 5 and 6. Selection methods may also include analysis of traits, phenotype polymorphisms or selectable markers not defined by DNA or NA sequence differences, such as differences in methylation of a DMA sequence, or polypeptide expression levels or in gene expression levels. As shown in the Examples the soybean SCN resistance Rkgl locus, in particular the promoter regions of Giym l8g026I⁽L Gfymal8g 2590 and Gfymal8g⁽)258CK was highly methylated in the resistant plants as compared to susceptible plants. Methylation distinctions in. and adjacent to these genes, for example in the promoter and upstream regions of the genes, may be used to distinguish between resistant and susceptible lines., hi addition, resistant plants had higher aaRNA levels for Gfynmi8g026]0_}

Gfym l8gO2S90 and Glymal 8g025BQ than susceptible plants. See Figure 5. Thus methods of detecting the gene expression, levels of any of these genes, for example by monitoring niRNf A abundance, may he used in the methods described herein. In another embodiment, the marker may be the protein expression level of at least one of

Olyma 18g02610, Glymal SgC)2590 and. Glyma 18g02580. Any of these differences may be used as a screen to test, whether a plant or plant ceil is likely to be resistant, or susceptible to nematodes.

The markers described above are linked to the phenotype of increased resistance to cyst nematodes or alternatively to susceptibility to cyst nematodes. The methods of detecting may comprise amplifying the marker or a portion thereof to produce an amplified product. The presence of the product may be indicati ve of the marker or the amplified product may be sequenced. The amplified product may also be assessed via differential sensitivity to a. restriction endonuelease. The marker may be detected using allele specific hybridization analysis, quantitative PGR, Northern, blot analysis. Western blot analysis or another methodology. Methods of detecting or evaluating genetic or phenotypic markers of traits such as those described herein are available to those of skill in the art, many such methods are provided in the Examples, and it is anticipated that new methods may he developed m the future to detect the Rhgl polymoi hisms described herein. For example, the markers can be used to detect he presence or absence of the multi-copy Rhgl region during breeding selection processes.

A linked locus describes a situation in which a genetic marker and a trait are closely linked chromosomaliy such that the genetic marker and the trait do not independently segregate and recombination between the genetic marker and the trait does not occur during meiosis with a high frequency. The genetic marker and the trait may segregate independently, but generally do not. For example, a genetic marker for a trait may only segregate independently from the trail 5% of the time; suitably only 5%, 4%, 3%, 2%, 1 %, 0.75%, 0.5%, 0.25%, or less of the time. Genetic markers with closer linkage to the trait-producing locus will serve as better markers because they segregate independently from the trait less often because the genetic marker is more closely linked to the trait Genetic markers that directly detect polymorphic nucleotide sites thai cause variation in. the trait of interest are particularly useful for their accuracy in marker- assisted plant breeding. Thus, the methods of screening provided herein may be used in traditional breeding, recombinant biology or transgenic breeding programs or any hybrid thereof to select or screen for resistant varieties.

in the methods described herein the SON resistance or susceptibility phenotype of a first soybean is identified by comparing the genetic marker in the first soybean to that in a second soybean with a known resistance phenotype. The second soybean may be known to be resistant to SCN. Thus a first soybean having the same genetic marker a the second soybean is likely to also be resistant to SCN. Resistant soybeans are known i the art. and include but are not limited to ΡΪ88788, Peking, Hartwig, Fayette, Forrest,. LD02-5320, i,D02~5025, and LD01-7323 or lines carrying loci that contributed to or were derived from these cultivars such as those provided in. Table 2, In particular, the methods allow identification of soy bean plants having increased resistance to Race 3 SCN and other nematode populations, similar to PI88788. Alternatively, the second soybean may be known to be susceptible to SCN. Thus a first soybean having the same genetic marker as the second soybean is likely to be susceptible to SCN. Susceptible soybeans are known in the art and include, but are not limited to, ⁴ Williams 82% Essex, Thome, Sturdy, LG03-1672, and LG00-3372 or lines carrying loci that contributed to or were derived from one of these eultivars such as those provided in Table 2, lit particular, the methods allow identification of soybean plants having susceptibility to SC simitar to that of ^* Williams 82.' Although resistance to SCN is widely observed to be a quantitative trait, the terms susceptibility and resistance as used in the preceding paragraphs refer to qualitative trails, such that identification as a resistant soybean indicates that the soybean is more resistant than the susceptible soybean, line to which it is being compared

Likewise, identification of a soybean as a susceptible soybean indicates that the soybean is more sensitive than the resistant soybean line to which it is being compared.

Resistance (or susceptibili ty) to SCN can be measured in a variety of ways, several of which are known to those of skill in the art. i n the examples, soybean roots were experimentally inoculated with SCN and the ability of the nematodes to mature (molt and proceed to developmental, stages beyond the. J2) on. the roots was evaluated as compared to a susceptible and/or resistant control plant. A SCN greenhouse test is also described in the Examples and provides an indication of the number of cysts on a plant and is reported as the female index. Increased resistance to nematodes can also be manifested as a shift in the efficacy of resistance wi th respect, to particular nematode populations or genotypes. Additionally but not exclusively, SC -suseeptible soybeans grown on SCN-jnfested fields will have significantly decreased crop yield as compared to a comparable SCN-resistant soybean, improvement of any of these metrics has utility even if all of the above metrics are not altered.

As demonstrated in the Examples a set of three genes found on a tandem! y repeated segment of chromosome 18 were identified whose silencing led to increased susceptibility to SCN in a resistant variety. The three genes are found along with a fourth gene, part of a fifth gene, and other DN A sequences in a chromosome segment approximately 31 kb in length, that, is present in. 10 copies in the soybean varieties that carry the rhg!-h allele or haplotype of RhgS that is in widespread commercial use for control of SCN disease of soybean. Thi s Rhg! chromosome segment is found in at least three copies in all SCN resistant varieties tested to date. Various resistant varieties carry three, seven or ten copies and the higher copy number versions fRhgl express higher levels of transcri ts for the three genes. Higher copy number versions of Rhgl also confer more resistance to SCN on their own (exhibit less eliance on the simultaneous presence of desirable alleles of other SCN resistance QTL such as Rhg4 in order to effectivel confer SCN resistance, relative to Rhgl haplotypes with lower Rhgl repeat copy numbers), In the Examples, over-expression of the three genes in a susceptible variet made roots more resistant to SCN, Methods of increasing resistanc of a plant to cyst nematode by selecting plants carrying genetic markers associated with

Giym 8gi)261(K Giymal8g0259⁽)_f and/or Gfyma18g02580 alleles that are present within the Rhgl. locus are described. As shown, in the Examples, genetic polymorphisms ranging from single nucleotide polymorphisms to gene rearrangements (i.e., gene duplications) and differences in raeth.yla.tion may occur in other Glycine war plant lines and other Glycine species, which may alter the expression or biological impact of one or more genes linked to the Rhgl locus, and careful selection of desirable alleles of particular genes at the .Rhgl locus may be. desirable to allow selection of plants with increased resistance to SCN.

Methods of increasing resistance of a plant to cyst nematodes, including but not limited to SCN, by increasing the expression of or altering the expression pattern of or increasing the copy number of a polynucleotide encoding the Gl.yma.lBg02610 (SEQ ID NC):3), Glymal8g025 0 (SEQ 3D NGs: 2, 5 and 6), and/or Glymal 8g02580 (SEQ ID NO: 1 ) polypeptides or functional fragments or variants thereof in cells of the plant are also provided. The polypeptide may be 80%, 85%, 90%, 95%. 97%, 98%, 99% or 100% identical to the sequences provided. We have sequenced these genes from both resistant and susceptible varieties and found few polymo.rphi.sms within the coding regions and few changes that result in an amino acid change. The GSyma ! 8g2590 polypeptide does have some significant polymorphisms between the resistant and susceptible varieties that appear to be fi ctionalty related to SCN resistance as shown in the Examples.

Sui tably the expression of the polypeptides encoded b GiymaJ8g0 610,

Glym I8.g02590, and/or GIym J8g()258⁽) is increased in a root of the plant. Suitably, the expression of the polypeptides encoded by Gfymal8g02610, Gfy . l8g0259 , and/or Glym l8g0258Q is increased in root cells of the plant. The plant is suitably a soybean plant or portions thereof. The polynucleotides may also be transferred into other non- soybean plants, or faomoiogs of these polypeptides or polynucleotides encoding the polypeptides -from other plants, or synthetic genes encoding product similar to the polypeptides encoded by Glyma 18g(⁾2610, Glyma 18g02590, and/or Glyma] 8g0258Q may be overexpressed. in those plants. Other plants include but are not limited to sugar beets, potatoes, corn, peas, and beans. The overexpression of the genes may increase the resistance of plants from these other species to nematodes and in particular cyst nematodes, such as the soybean cyst nematode Heterodem glycines, the sugar beet cyst nematode Heterodem schacihiL the potato cyst nematodes G bodera pallida and related nematodes that cause similar disease on potato such as Globodera rostochiensis, the com cyst nematode- Heterodem ze e, and the pea cyst nematode Heterodem goettingi na.

The expression of the polynucleotides may be i ncreased by i ncreasing the copy number of the polynucleotide in the plant, in cells of the plant, suitably root cells, or by identifying plants in which this has already occurred. These plants may then be used, in traditional breeding. Suitably, the polynucleotide is present in three, seven, or even, ten copies. Suitably at least two or all three of the polynucleotides encoding the polypeptides or the polypeptides of Glyma 18g026.10, Glyma I8g02590, and Glyma.l 8g0258O are expressed. Alternatively the expression may be increased using recombinant D A technology, e.g., by using a strong promoters to drive increased expression of one or more pol.yriuc leotides.

I addition, methods of increasing resistance of a plant to cyst nematodes may be achieved by cloning sequences upstream, from Glyma.l8g026]0_i Glyma] 8g02590, and/or Gh^!mal8g02580 from resistant lines into susceptible lines. For these methods, nucleotide sequences having at least 60%, 70% or 80% identity to nucleotide sequences that flank the protein-coding region of GfymaJ8g()2610_f Glyma I8g0259⁽) or Glyma 18g0 580 (or sequences Slaving at least 80%, 85%, or 90% identity to those protein-coding regions), said flanking regions including 5" and 3 ^! untranslated regions of the mRNA for these genes, and also including any other genomic DNA sequences that extend from the protein coding region of these genes to the protein coding regions of immediately adjacent -genes may be used.

The increase in expression of Glyma 18g026HK Glyma 18g02590, and/of

Glymal8g02580 in the plant may be measured at the level of expression of the mRNA or at the level, of expression of the po lypeptide encoded by Glymal8g02610,

Glyma 18g02590, and/or Glyma. g02580. The level of expression may be increased relative to the level of expression in a control plant as shown in the Examples. The control plant may be an SCN-susceptible plant or m SCN-resistant. plant. For example, a susceptible plant such as 'Williams 82' may be transformed with an expression vector such that the roots of the transformed plants express increased levels of G!ymal8g026W, Giyma I8g0259il, and/or Gfyinal8g02580 as compared to an. un transformed plant or a plant transformed with a construct thai does not change expression of Gfy aJ8g02610, Gfymal8g02590, and/or Glyma 18g02580, resulting in increased resistance to nematodes. Alternatively, the control may be a plant partially resistant to nematodes and increased expression of Glyma I8g02610_< Giyma 18g02590, and/or Glyma I8g02580 may result in increased resistance to nematodes. Alternatively, the plant may be resistant to nematodes and increasing expression of GfymaI8g0261Q, Giyma 18g0259(h and/or Glyma 18g02580 may result in further increased resistance to nematodes. Alternatively, the plant may be more resistant to certain nematode populations, races, Hg types or strains and less resistant to other nematode populations, races, fig types or strains, and increasing expression of Gfyma!8g026.W_> Giymal8g()259Q, and/or GiymaJ8g02580 may result in increased resistance to certain of these nematode populations, races, Hg types or strains.

In the Examples, a decrease in expression of Glyma.I8gO26I0_> Glyma 18g02590, and/or Giymal8g0258() is shown to increase the susceptibility of a SCN-resistant soybean to SCN maturation. In addition, roots of the susceptible ' Williams 82" soybean are shown to have lower levels of Glyma 18g02610, Glyma 18g0 590, and/or

Gfyn l8g02S80 mRNA as compared to the resistant Fayette Sine. Because low levels of Glymal8g0261(h Giyma 18g⁽)259ih and/or Giymal8g02580 mRNA correlate with nematode susceptibility, and increased levels correlate with resistance, and direct towering of Giyma I 8g026 ^:J H)_t Glymal g02590₁, and/or Glyma 18g02580 mRNA is causally associated with greater nematode susceptibility of previously resistant tissues, increasing the levels of Glyma 8g026}0_t, Glyma 18g0 590, and/or GiymaJ8g02580 in a soybean should, in many instances increase the resistance of the soybean to nematodes, in particular SCN. In Figure 15, increased expression of a combination of

Gfyma 8g02600, Glymal8g02610, GiymaI8g02590_i and Gh ml8g02580 was shown to increase resistance to SCN of a susceptible line. Increased expression of three genes, GlymaI8g0261(K Giyma 18g0259ih and Glyma 18g0 580 was also shown to increase resistance of an SCN susceptible variety in Figure 18, Increased expression of fewer than these three polynucleotides or of the polypeptides encoded by the polynucleotides may be similarly effective to increase resistance.

Expression of Gfymal8g0261( Glymal8g02590, and/or Gfymal8g02580 may be increased in a variety of ways including several, apparent to those of skill in. the art and may include transgenic, non-transgenic and traditional breeding methodologies. For example, the expression of the polypeptide encoded by Glymal8g026l.0

Gfymai 8g0259⁽K and or Gfym .l8g02580 may be increased by introducing a construct including a promoter operational in the plant operably linked to a polynucleotide encoding the polypeptide into cells of the plant. Suitably, the cells are root cells.

Alternatively, the expression of the polypeptide encoded by Gfymai 8g026!0,

Glymal8gO2S90, and/or Gfymai 8g02580 may be increased by introducing a transgene including a promoter operational, in the plant operably linked to a polynucleotide encoding the polypeptide into cells of the plant. The promoter may be a constitutive or inducible promoter capable of inducing expression of a polynucleotide in all or part of the plant, plant roots or plant root cel ls. In another embodiment the expression of

Gfymal8gQ261⁽), Gfyrnal8g^(}259(K and/or Gtymal8g02S80 may be increased by increasing expression of the native polypeptide in a plant or in cells of the plant, such as the plant root cells. In another embodiment, the expression of Gt mal8g026I0_t

GiymaI8g02590, and/or Gfymai 8g02S80 may be increased b increasing expression of the native polypeptide in a plant or in ceils of the plant such as the nematode feeding site,, the syncitium or cells adjacent to the syncitium. In another embodiment; the expression of Gfymai 8g02610, Gfym l8g02590_f and/or G fyma 18g02580 m&y be increased by increasing expression of the native polypeptide in a plant or in cells of the plant such as sites of nematode contact with plant cells, In another embodiment, expression may be increased by increasing the copy number of Gfymai 8g02610, Gfymal8g02590_f and/or Gfym l8g02580, Other mechanisms for increasing the expression of Giymal8g026W, Gfyma 18g02590_t and/or Glymal8g02580 include, but are not limited to, increasing expression of a transcriptional activator, reducing expression of a transcriptional repressor, addition of an enhancer region, capable of increasing expression of

Gfyma 18g02610, Gfymai 8g()259ih and/or Gfymal8g()2580, increasing mRNA stability. altering DNA meihylation, histone acetylation or other epigenetic or chromatin modifications in the vicinity of the relevant genes, or increasing protein o polypeptide stability.

In addition to the traditional use of transgenic technology to introduce additional copies or increase expression of the genes and mediate the increased expression of the polypeptides of GlymaI 8g026! O, Glyraal8g02590, and/or Glymal 8gO2580 in plants, transgenic or non-transgenic technology may he used in other ways to increase expression of the polypeptides. For example, plant tissue culture and regeneration, mutations or altered expression of plant genes other than Glymal 8gG2610,

Glyrnal 8g02590, and/or Glyma 18gQ2S80, or transgenic technologies, can be used to create instability in the RhgJ locus or the plant genome more generally that create changes in Rhgl locus copy number or gene expression behavior. The new copy number or gene expression behavior can then be stabilized, by removal of the variation-inducing mutations or treatments, for example by farther plant propagation or a conventional cross. In one of the examples, although a transgenic plant was used to create the change .in copy number, the result would be a. non-transgenic line (and conceivably regulated as such) with enhanced resistance due to increased copy number of the locus. Examples of transgenic technologies that might, he used in this wa include targeted zinc fingers, ribozyni.es or other sequence-targeted enzymes that create double stranded DNA breaks at or close to the RhgJ locus, the Cre / loxP system from bacteriophage lambda or other similar systems like frt flp, Transcription Activator-Like Effector Nucleases (TALE s), artificial DNA or RNA sequences designed to reeorabine with Rhgl that can be introduced transiently, or enzymes that "shuffle" ON A such as the mammalian Rag! enzyme or DN A transposases. Mutations or altered expression of endogenous plant genes involved in DNA recombination, DNA rearrangement and/or DMA repair pathways are additional examples.

The screening methods described above could also be used to screen soybean isolates (Glycine max) and closely related species (Glycine j , Glycine iomeniella or other Glycine, species) ibr resistance markers and then resistant lines can be crossed naturally or artificially with, soybean, to develop a soybean with a variant copy number or sequence at the Rhgl site. Any useful alleles identified in such screens could then be 7 introduced using traditional breeding or transgenic technology into soybeans. Similar systems are available for other plants

on-transgeme means of generating plant varieties carry ing traits of in terest such as increased resistance to nematodes, such as SCN, are available to those of skill in the art and include traditional breeding, chemical or other means of generating chromosome abnormalities, such as chemically induced chromosome doubling and artificial rescue of polyploids followed by chromosome loss, knocking-oui DMA repair mechanisms or increasing the likelihood of recombination or gene duplication by generation of chromosomal breaks. Other means ofnott-transgenetically increasing the expression or copy number of Glyma 18g026l ^' 0, Gfyma J8g02590, and/or Glymct 18g02580 include the following: screening for mutations in plant DNA encoding mtRNAs or other small RNAs, plant transcription factors, or other genetic elements that impact Gl^'ymolSg02610_f Gfyma 18g0259{)_< and/or Gfymal8g0258(} expression; screening large field or breeding populations for spontaneous variation in cop number or sequence at Jihgl by screening of plants for nematode resistance, Rhgl copy number or other Rhgl gene or protein expression traits as described in preceding paragraphs; crossin of lines that contain different or the same copy number at Rhgl but have distinct polymorphisms on either side, followed by selection of recombinants at Rhgl using molecular markers from two distinct genotypes flanking the Rhgl locus; chemical or radiation mutagenesis or plant tissue culture/regeneration that creates chromosome instability or gene expression changes, followed by screening of plants for nematode resistance, Rhgl copy number or other Rhgl gene or protein expression traits as described m preceding paragraphs; or introduction by conventional genetic crossing of non-transgenic loci that create or increase genome instability into Rhgl - containing lines, followed by screening of plants for either nematode resistance or .Rhgl copy number, Bxampies of loci that cou ld be used to create genomic instability include active transposons (natural or artificially introduced from other species), loci that activate endogenous transposons (for example mutations affecting DMA methylation or small RMA processing such as equivalent mutations to metl in Arabidopsis or mop I in maize), mutation of plant genes that impact DN A repair or suppress illegitimate recombination such as those orthoiogous or similar in function to the .¾¾'./ heltcase of yeast or RecO of £ coll, or overexpression of genes such as RAD50 or RAD52 of yeast that mediate illegitimate combination. Those of skill in the art may find other transgenic and. non-trattsgenic methods of increasing expression of

GfymaI8gQ26l(h Glyma I8g⁽)259(h and/or GfymaJ 8g02580.

The polynucleotides and or polypeptides described and used herein may encode the fell-length or a functional fragment of GfymaJ 8g02610_t GfymaJ 8g02590, and/or Gfyma 8g02S80 from the rhgl-b locus, or a naturally occurring or engineered variant of Glyma 18g02610, Gfym !8g⁽)2S90, and/or GfymaJ-8g02580, or a derived polynucleotide or polypeptide all or part of which is based upon nucleotide or amino acid combinations similar to ail or portions of GfymaJ 8g0261 Ί), Glyma 1 g02S9(K and/or GfymaJ8g02580 or their encoded products. Additional polynucleotides encoding polypeptides may als be included in the construct such as Glyma J8g02600 (which encodes the polypeptide of SBQ ID NO:4). The polypeptide may be at least 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the sequences provided herein. The polynucleotides encoding the polypeptides may be at least 50%. 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 100% identical to the sequences available in the public soybean genetic sequence database.

The expression of the polypeptide encoded by GfymaJ 8g026 O, GfymaJ8g02590, and or GfymaJ 8g02580 may be increased, suitably the level of polypeptide is increased at least 1 :2, 1.5, 1.7, 2, 3, 4, 5, 7, 10, 15, 20 or 25 fold in comparison to the untreated, susceptible or other control plants or plant cells, Control cells or control plants are comparable plants or cells in which GfymaJ8g026J0, GfymaJ 8g02S90, and/or

GfymaJ8g02580 expression has not been increased, such as a plant of the same genotype transfected with empty vector or transgenic for a distinct polynucleotide.

Increased resistance to nematodes ma be measured as described above. The increased resistance may be measured by the plant having a lower percentage of invading nematodes that develop past the J2 stage, a lower rate of cyst formation on the roots, reduced SCN egg production within cysts, reduced overall SCN egg production pe plant, and/or greater yield of soybeans on a per-plant basis or a per-growi ng-area basis as compared to a control plant grown in a similar growth environment Other .methods of measuring SCN resistance also will be known to those with skill in the art Jn the methods of increasing resistance to nematodes described herein, the resulting plant may have at least 10% increased resistance as compared to the untreated or control plant or plant cells. Suitably the increase in resistance is at least 15%, 20%, 30%, 50%, 100%, 200%, 500% as compared, to a control. Suitably, the female index of the plant wit Increased resistance to nematodes is about 0% or less of the female in dex of an untreated or control plantpiant derived from the same or a similar plant genotype, infested with a similar nematode population within the same experiment. More suitably, the female index a fter experimental infection is no more than 60%, 40%, or 20% of that o f the control plant derived from the same or a similar plant genotype, infested with a similar nematode population within the same experiment. Suitably, when grown in fields heavily infested, with SCN (for example, more than 2500 SCN eggs per 100 cubic centimeters of soil), soybean grain yields of field-grown plants are 2% greater than isogenic control plants. More suitably, the grain, yield increase is at least 3%, 4%, or 5% over that of isogenic control plants grown in similar environments.

Also provided herein are constructs including a promoter operably linked to a. G!ym l8g⁽⁾261lh Giym l8g02590_f and/or Gfyma 8g02580 polynucleotide encoding a polypeptide comprising SEQ ID NO; 1-3 or 5-6 or a fragment or functional variant thereof. Also included are homologs or variants of these sequences from other soybean varieties. The constructs may further include Gly al 8g026( ) or other genes. The constructs may he introduced into plants to make transgenic plants or may be introduced into plants, or portions of plants, such as plant tissue, plant caili, plant roots or plant cells. Suitabl the promoter is a plant promoter, suitably the promoter is operational in root cells of the plant. The promoter ma be tissue specific, inducible, constitutive, or developmeniaily regulated. The constructs may be an expression vector. Constructs may be used to generate transgenic plants or transgenic ceils. The polypeptide may be at least 80%, 85%, 90%, 95%, 97%, 8 , 99% or 100% identical to the sequences of SEQ ID NO: 1-3 or 5-6. Th -constructs may comprise all three polynucleotides and may mediate expression of all three polypeptides.

Transgenic plants including a non-native or exogenous polynucleotide encoding the thgl-b polypeptides identified and described herein are also provided. Suitably the transgenic plants -are soybeans. The soybean polynucleotides and polypeptides identified herein as associated with resistance to nematodes may also be used to generate transgenic sugar beets, potatoes, corn, peas, or beans capable of expressing the soybean genes described herein. Alternatively, homologous genes or polypeptides from these plants may be identified by comparison to the soybean .genes . and polypeptides identified, herein and these genes may be used to generate transgenic plants. The transgenic plants express increased levels of Glym l8g026 !0, Glymal8g02590, and/or Glymal8g02580 polypeptide as compared to a control no«-transgenic plant from the same line, variety or eiiitivar or a transgenic control expressing a _.polypeptide other than Glymal8g02610, Glyma 1.8g()2590, and/or Glymal 8gO2580. The transgenic plants also have increased resistance to nematodes, in particular SCN, as compared to a. control plant. Portions or parts of these transgenic plants are also useful. Portions and parts of plants includes, but is not limited to, plant cells, plant tissue, plant progeny, plant asexual propagates, plant seeds.

Transgenic plant cells comprising a polynucleotide encoding a polypeptide capable of increasing resistance to nematodes such as SCN are also provided. Suitably the plant cells are soybean plant cells. Suitably the cells are capable of regenerating a plant, The polypeptide comprises the sequences of SEQ 3D NOs: 1 -3 or 5-6 or fragments, variants or combinations thereof: The polypeptide may be 85%, 90%, 95%, 97%, 98%, 99% or 100% identical to the sequences provided. The transgenic cells may be found in a seed. A plant, such as a soybea plant, may include the transgenic cells. The plant may be grown from a seed comprising transgenic cells or may be grown by any oilier means available to those of skill in the art. Chimeric plants comprising transgenic cells are also provided.

The expression of the polypeptide and the polynucleotides encoding the polypeptides in the transgenic plant Is altered relative to ihe level of expression of the native polypeptides in a control soybean plant. In particular the expression of the polypeptides i the root of the plant is increased. The transgenic plant has increased resistance to nematodes as compared to the control plant. The transgenic plant may be generated from a transgenic cell or callus using methods available to those skilled in the art.

The Examples provided below are meant to be illustrative and not to limit, the scope of the invention or the claims. All .references and appendices cited herein are hereby incorporated by reference in their entireties. EXAMPLES

To identify the gene conferring resistance to SCN in the PIS8788 soybean within the locus identified by Kirn et aL, 20 K) (within the chromosomai interval defined by the termini BARCSOYSSR..._.! 8.0090 and BARCSOYSSR 18. 0094), a candidate gene testing approach was used. This approach is described ra Melito et al. (S C' Plant Biology 2010, 10: 104), which is mcorporated herein by reference in its eniirety. Briefly, this candidate gene approach was completed with various genes at the Rhg locus defined above using a resistant soybean variety Fayette, which carries the PI88788-derived rhgl- b allele of the Rkgl locus, to make transgenic soybean roots thai carry gene-silencing constructs and then testing these transgenic roots for loss of SCN resistance. The silencing strategy used is depicted m Figure 2. The artificial microRNA used in the Melito et al, reference was replaced with artificial microRNA sequences directed against various candidate or putative genes within the Rhgl locus. The expression of the artificial mieroRNAs was driven by the soybean Ubi3 promoter. The construct also contained a OFF reporter suc that transformed roots could readily be identified by GFP expression. Transgenic soybean roots expressing artificial tnicro-RNA (amiRNA) or hairpin (E Ai) constructs were produced using Agrobacterium rhisogenes. Roots expressing GFP were selected for further analysis. Transgenic roots were inoculated with SCN to test for decreased or increased resistance to SCN caused by candidate gene silencing conditioned b artificial microRNA. expression.

Soybean resistance to SCN was measured two weeks after root inoculation by determining the proportion of the tot l nematode population that had advanced past the J2 stage in each root (Fig. 3 A), relative to known resistant and susceptible controls.

Silencing any of three closely Jinked genes, namely Gtymai8g2580_f G}ymaJ8g259()_i and Gfymal8g26!(h at the rhgl-b locus of the SCN-resistant soybean variety Fayette significantly reduced SCN resistance (Fig. 3B). Depletion of resistance was dependent on target transcript reduction (Fig. 4), Silencing of other genes in and around the locus did not impact SCN resistance (e.g., Fig 3B, genes Glyma 8g02570 and 2620).

The predicted Glymal8g02610 protein product contains a Wound-Induced protein domain (Mam domain PF07.107; M Pimta,ei ' al, (2012) The Pfiim protein families database. Nucleic Acids Research Database issue 4():D290~D3()1 and logematm et at., (1988) Differential expression of genes itt potato tubers afie wounding. Proc Nafi Acad Sci USA 85: 1136-1140) and a. homologous (55% identical) protein in ice plant

(Mesembryanthemutn crystaUinum) was previously shown to be responsive to both biotie and abiotic stimuli (Yen et l„ Environmental and developmental regulation of the wound-induced cell wall protein WII2 in the halophyte ice plant. Plant Physiol. 127:517- 528), The annotated protein product of GlymalSg026l() does not have other widely known protein domains or inferred biochemical functions that, at the present time, are obvious to those with normal skill in the art, However, the above results indicate mat Glyma 8g02610 is necessary for full Rhgl-medi&isd SCN resistance.

A genomic duplication of four genes at Rhgl hi Glycine max is present in the tested SCN-resistant lines

Concurrent study of the physical, structure of the rhgl-h locus revealed an unusual genomic configuration, A 31 ,2 kb genome segment, encoding the above three genes that contribute to SCN resistance, is present in multiple copies in SCN resistant lines (Figs. 5, 6). The DNA sequence of fosmid clone inserts carrying genomic DMA from the hgl-b genetic interval identified a unique DNA junction, not present in the published Williams 82 soybean genome, in which a 3^* fragment of Glyma 18g02570 is immediately adjacent to the mtergenic sequence downstream of (centromeric to) Glymal8g02610 (Fig. 5 A), The genomic repeat contains full copies of Glyma I8g02 '580, -2590 , -2600 and -2610 as well as the final two exons of Giyma 8g0257(⁾< Whole- genome shotgun sequencing of a line containing rhgl-b revealed ten-fold greater depth of coverage of this interval relative to surrounding or homologous regions (Fig. 5B), suggesting the presence of multiple repeats.

Sequencing and PCR amplification confirmed the presence of the

Glyma 18g02610-2570 junction in DNA from multiple SCN-resistant soybean accessions, including accessions that carry the commercially important PI 88788, Peking and PI 437654 ha lotypes of the Rhgl locus (Fig, 5C and. Fig. 7). The junction was not detected in four tested SC -susceptib!e varieties including Williams 82 (Fig. 7B). This constitutes a direct test for economically desirable alleles of the Rhgl locus. The shared identity of the junction sites from disparate sources of SCN resistance suggests a shared origin of the initial resistance-conferring event at Rhgl. Fiber-FISH (fluorescence in situ hybridization) was utilized to directly determine the number- of copies and arrangement of the 31 k.b repeat, segment in different hapiotypes of tiie RhgJ locus. Hie hybridization pattern and DNA fiber length estimates generated using these probes (Fig. 6 and Table 1 ) are consistent with the presence of a single copy of the repeat in Williams 8.2, as in the reference soybean genome. In. Fayette, fiher-FISH revealed ten copies per DNA fiber of the predicted 31 kb repeat segment, in the same configuration throughout the multiple nuclei sampled, in a pattern indicating ten. direct repeats abutting in a head-to-tail arrangement (Fig. 6 and Table 1). No additional copies (e.g., at. other loci) were evident hi samples from soybean line Peking, three copies per DNA fiber were present in apparent direct repeat orientation (Fig. 6), Although fiber- FISH cannot resolve small sequence differences, the single size of all junction- amplification PCR products and the consistency of all junction sequences assembled from fosraid or genomic DNA sequencing (Fig. 7) further suggest the presence of adjacent direct repeat copies.

Table I. Length estimates for F iber-FISH hybridization signals. N: number of DNA. fibers analyzed.

Length of Fiber-FISB Estimated Length of Fiber-F ISH

signals (gm) signals (kb) N Wilbams 82 M QM 27.W ± I 20 Fayette 96.56 ^ 7.54 309.94 * 24.2 20 Peking 34.42 A 2.91 U0. g ± 9.34 20_

To discover additional copy number and DNA polymorphisms we analyzed whole genome re-sequencing (WGS) data tor 41 soybean lines, the "NAM parents" from a current nested association mapping study, using sequence data provided by Dr. Perry Cregan. The data set consists of whole genome shotgun sequencing reads produced using kimina Hise equipment and protocols, with average depth of sequencing coverage ranging from 5 to 60 fold. Reads were mapped to the Williams 82 reference genome (Phytozome, assembly 189) and analyzed for read depth (RD)_S INDELs and SNPs relative to the SCN susceptible line Williams 82. When this IUumina read depth was used to estimate copy number at the Rhgl locus, using methods analogous to those used, to generate Figure 5B. 8 of the 41 soybean lines analyzed bad a normalized read depth for the approximately 31 kb Rhgl region (eo.rresponding to tire rhgl-b repeat segment described above) that differed by grea ter than 5 standard deviations of the mean from, the read depth of the two 30 kb regions immediately flanking the regio corresponding to the rhgl-b repeat, segment. See Table 2. Seven of those lines had an estimated, copy number ranging from 9,2 to 9,9 copies. These lines have PI 88788 in their pedigree, where ^•pedigree are available, and have been classified as SCN^'-resistant. in laboratory and/or field tests. The other genotype predicted to carry Rhgl repeats had an estimated copy number of 2.9. Its pedigree contains, both Peking and PI 437654. The Rhgl loci derived from Peking and Pi 437654 are widely recognized to be much less effective at conferring SCN resistance if they are not coupled with preferred alleles of an unlinked locus, Rhg4. All other genotypes (33) were estimated to contain one copy of the approximately 31 kb of Rhgl DNA described in this document. AH twel ve of the 33 lines that had an available, previously determined. SCN resistance phenotype were listed as SCN susceptible, while information on the SCN resistance pbeaotype was not readily available for the other 21 lines. As a control read, depth was used to estimate copy number at the homologous region on Chromosome 1 1. The estimated copy number was approximately 1 in all tested genotypes. In addition to those lines shown in Table 2, we recently determined thai a variety known as Cloud (PI 548316), that displays intermediate levels of SCN resistance, carries seven copies of the Rhgi locos repeat segment.

varieties.

The source of the first duplication event to arise at Rhgl is not known, but was possibly the result of nearby T l/copia-like retrotransposon Tvr or RTvr2 activity. Later copy number expansion may have occurred by tare unequal exchange events between homologous repeats during meiotic recombination.

Genes within the duplicated gene block at rhgl-h are expressed at higher levels than their homology from SC -suseeptible Rhgl haplotypes

Gene expression analysis using quantitative PCR (qPCR) determined that the three genes found to impact SCN resistance exhibit significantly more transcript abundance in roots of SCN-resi slant varieties relative to susceptible lines (Fig. 5D and Fig. 7D). In contrast, the transcript abundance for genes immediately flanking the SCN- impacting genes did not differ significantly between SCN -resistant and susceptible varieties (Fig. 5; GfymaJ.8g026(⁾0 expression in roots is at or below the limits of detection of qPCR, cDNA cloning and RNAseq methods; See Cook ei at, 2012 methods and Severiii et ai. RNA~Seq Atlas of Glycine max: A guide to the soy bean transeriptome. Bmc Plant Biology, 2010). full-length transcripts were confimied for G! ma 8g()2580_> - 2590 and -26.10, and no hybrid repeat-junction transcripts were detected for

GhmaI8gQ2570 ( Fig. 7E). The above suggested that elevated expression of one or more of the SCN-impacihig genes could be a primary cause of elevated SC resistance.

Quantitative real-time P R iqPCR was also used to examine and compare the niRNA transcript abundance of five genes at the Rhgl locus in non-inoculated roots of the llg-typktg soybean lines. These Lines have been established ad accepted by researchers as representing a useful and diverse set of SCN resistant soybean lines (Niblaek. ei ah, 2002, J. of Nemat. 34(4): 279-288; T. L. Nih!ack, . N. Lambert, G. L. Tylka, 2002, Anno, Rev. Phytopathol. 44:283-303). Transcript abundance for three of the genes, Giyma ! 8g02580, Gfym l 8g02S90, and Ghm l8g(⁾26H) are all expressed more highly in each of the 7 tested SCN differentials relative to the SCN susceptib le line Williams 8 as shown in Figure 8. Another gene at the locus, Glymai 8g026Q , was also more highly expressed in the SCN resistant lines, but the data for Glyma 18g02600 may be less accurate and the absolute measured transcript level of Glymal 8g0260G was near the limit of detection, (consistent with published RNA-seq data front soybean roots). As a control, a neighboring, but not duplicated gene, Glym l 8 «02570 shows similar expression pattern for all tested genotypes. In a separate experiment two additional genes, Gtymal8gO2620 and Giymal 8g02630, flanking the repeal to the eentromerk side, also show similar transcript abundance across SCN resistant and susceptible lines.

Four of the SCN resistant genotypes (Peking, Pi 90763, PI 89772, and PI 437654) are similar to each other in their level of rnRNA abundance for the four genes

GfymaJ8≠2S8Q, Giymal 8g02590_f Gfymal gO2610, and G!ymaI8gO260Q. in these genotypes, transcript abundance is 1.5 to 5 fold higher for the four repeated genes relative to Williams 82. Separately, the SC -resistant genotypes Cloud, PI 88788, and 209332 are similar to each other in their levels of elevated rnRNA abundance for Rhgl genes compared to Williams 82 and the previous tour genotypes. Transcript abundance ranged Scorn 4 to 20 fold higher for the repeated genes in the Cloud, PI 88788, and PI 209332 genotypes. These data show thai the increased DNA copy number encoding these four genes increases the transcript abundance. There is also a strong grouping for DNA copy number and transcript abundance, making at least two classes with genotypes Peking, 90763, 89772, and 437654 together, and genotypes Cloud, PI 88788, and 209332 together. We note the correlation of these Rhgl genotype (copy number) and

Gfymal8gO2580!Glymal8g0259OIGlyⁱmal8gQ26lQ expression level groupings with the SCN resistance phenotype groupings reported, by Colgrove et at. 2008 (Col grove, AX., and TX. Niblaek. 2008. Correlation of female indices from virulence assays on inbred lines and -field populations of ^' Heierodera glycines. Journal of Neonatology 40:39-45), While GSymal 8g02600 is more highly expressed in SCN resistant lines, there i not a clear relationship between copy number and transcript, abundance as found for the other three genes in the repeat. This suggests that increased DNA content does increase transcript abundance, but not in a dosage dependent fashion for Gfym l8gQ2600.

Rhgl DNA methylation state is eulttvar-dependent for genes within the duplicated gene block.

To address the mechanism leading to the observed higher gene expression i SCN-resistant eultivars, we assessed DN A methylation of the Rhgl locus using methylation sensitive restriction enzyme digestion and PCR. McrBC is an endonuelease that specifically cleaves DNA containing 5-methylcytosme (5-mC) while leaving un~ methylated DNA intact. D A incubated with McrBC and the subjected to PCR fails to produce a product if the product spaas methylated cytosines. We identified .significant and reproducible differences between SCN-resistant and SCN-snsceptible cultivars when soybean genomic DNA was tested for metliyktion. at the R gl locus. For example, three different primer pairs for the Gfymal8g02610 promoter or coding regions either failed to amplify a product, or the -product was greatly reduced, between McrBC-digested and undigested genomic DNA from resistant cultivars (Figure 9). The same primer pairs used for PCR with DNA. collected from susceptible cultivars produced similar products whether the genomic DMA template had been digested or not, ind cating little or no DNA methylation.

Interestingly, a consistent correlation, between hypermeihylated DNA and elevated gene expression was discovered in the SCN-resistant cultivars tested. The promoter .region for G!ymaI8g02580_> Glym l8g02$9Q and GtymaJ8g02610 were all methylated and showed higher transcription, A neighboring gene, Gfym J8g02620_> did not display polymorphic .meth lation or altered gene expression between resistant and susceptible cultivars f Figure 9).

Further characterization of 258Θ, 2590 and 2618 genes

RACE PCR for Giym lSg02590 and GfymaI8g026lO from. Fayette (not inoculated with SON) revealed that the transcripts derived from the SCN-resistant PI88788 hap!otype have identical start and stop sites to the annotated transcripts associated with the Williams 82 (SCN-susceptibie) genome sequence that is available at PSiyiozoftie (http://wvvw.phytozome.net/cgi~bin/gbrowse soybeaa'^f')' S an initial test for readily detectable protein degradation or post-translational modification differences between SCN-resistant as opposed to SCN-susesptibie soybean lines (not inoculated with SCN), protein immunodetection experiments by western blot using 1.5 kb of Fayette native promoter driving Ghmal8g(⁾2590-BA ( ? #_/¾¾rte::2590-MA.) or using 3.2kb of Fayette native promoter driving GfymaI g026i 0-BA (261 O_f^ - :2 10-MA) revealed a detectable protein product that migrated at approximately the predicted size for the respective proteins, and did not. reveal protein size differences in Williams 82 as opposed to Fayette (Figure 10).

To explore the possibility that impacts of GfymaI8g02580, Glyma 18g02590 and

GiymaI8gO2610 on SCN development in soybean correlate with SC -inducible gene expression, we analyzed gene expression in excised root tissue from heavily SCN- tnfested root segments of resistant and susceptible lines. Modest increases in the expression of Glyma i8g02S80 and Glyma I g⁽)26! 0 were observed in SCN-resistant Fayette, above the high levels of expression already present in non-inoculated Fayette 5 compared to SCN-suseept!bte Williams 8.2 (Figure I I).

To further explore the possibility that impacts of Glyma 18gQ2580, Glyma Ϊ 8g⁽)2590 and. Gfymal8g()26l0 on. SCN development in soybean roots correlate with SCN-inducible expression, promoter-GUS fusion constructs (Proms 5 w'_' :GUS.

Prom^>::GUS, Pron\¾/&::GUS were made and expressed in transgenic roots.

I^'D Transgenic roots were stained for GUS activity 5 days after inoculation with SCN {Figure 12). Pro _f¾>::GUS roots had a moderate level of background staining and appeared to have brighter staining of swollen plant vascular tissue at the head of infecting J2 SCN (apparent developing syncytia). Proni 5¾s::GUS roots showed very low levels of background stainins and consistent iv greater GUS stamina at apparen svncitia, along

15 with strong staining of the dps of emerging la teral roots. Prom¾»>::GU^'S roots had very high levels of background staining but also appeared to be more highly stained at areas likely to form syncytia. The levels of elevated GU S staining in apparent syncitia were similar to those we observed in positive control promoter-GUS experiments using the previousl characterized syncitium-indudble promoter for Glyma 14g06080. As noted 0 above, the predicted Gfy^' maJ8g02610 encoded protein contains a Wound-Induced protein, domain (PfenO710?) and a homologous (55% identical) protein in ice plant

(Memmhryanthem m aystattimm) was shown to be responsive to both biotic and abiotic stimuli. on- transgenic Fayette soybean plants exposed to MeJA. had significantly elevated Glymal8g026l 0 transcript abundance compared to neighboring genes, further25 documenting stress-associated expression of this gene (Figure 1 1 ).

Amino acid polymorphism or ove.rexpress.ioii of any one of the three identified rhgl-h genes did not account for SCN resistance on its own. From all available rhgl~h sequence reads (across multiple repeat copies), no predicted amino acid polymorphisms relative to Williams 82 were identified for Gty J8g02580, Glyma 18g02600 or

30 Glyma 18g026i0. Some copies o Glyma 18g02590 from, rhgi-h resemble the Williams 82 sequence, while others contain a set of polymorphisms, notably at the predicted C- terminal six amino acids of the predicted a-SNAP protein ( Table 3, confirmed by cD A sequencing),

The whole-genome sequencing (WGS) data were also analyzed for DNA polymorphisms such as insertions or deletions (INDELs) and single nucleotide

polymorphisms (SNPs). In the seven genotypes with an estimated copy number ranging from 9 to 10, a number of SNPs were identified relative to the reference Williams 82 sequence. One gene contained in the repeated rhgf-b segment of DNA, Gfym lHg02590, contains DNA polymorphisms relative to Williams 82 as defined above. There is a single SNP, C to A (Williams 82 to Pi 88788 derived), at position 1 ,643,192 thai results in a Q to amino acid substitution. There are 3 SNPs present at the C-terminxis, occurring at positions 1,644,965 (G to C), 1,644,968 (G io C), and 1,644,974 (C to A), and a 3 bp insertion after base 1 ,644,972 (GGC) that collectively change the final 5 amino acids of the Williams 82 protein from EEDLT to QHBA1T. The nucleotide and amino acid sequences are show in Figure .13. ^"The 3 bp insertion causes an. extra amino acid in the Pi 88788 derived lines. All base pair positions correspond to the Williams 82 genome version 1.1, assembly 189. Numerous SNP and INDEL polymorphisms were observed within the approximate 31 kb Rkgl repeat DNA region, between Williams 82 and Pi 88788-souree .R gl, in the nucleotide regions outside of those thai directly comprise the final open reading frame ϋΐ Gfyma I Sg02580, Glymal 8,0)2590, 6fymaI8g26⁽)0, and Gl m JSgO2610. Analyses of Ilhiraina sequencing read depth, in the seven soybean lines from the NAM sequencing project with an estimated copy number ranging from 9 to 10, indicated that there were 9 very simi lar copies of the Pi 88788-type repeat at rhgl-h, and one partial copy of a Williams 82-iike repeat at rhgl-h.

The soybean line L DO 1-5907 from ihe soybean NAM parent sequencing project, which carries an estimated copy number of 3, also contains DNA polymorphisms affecting the amino acid sequence for Giymai8gQ2590. The DN A polymorphisms are different than those found in PI 88788 derived lines, but occur at similar positions. There is a SNP at position 1,643,225 lhat results in a D to E amino acid substitution. There are 2 S Ps present at the C~termmus, occurring at positions I ,(544,968, (G to T) and

1,644,974 (C to A) and a 3 bp insertion after base 1 ,644,972 (GGT) that collectively change the final 5 amino acids of the Williams 82 protein from. EBDLT to YEViT. The 3 bp insertion causes an extra amino acid in the Glymal 8g0259G protein product in lines with an Rhgl locus derived from Peking or Pi 437654 sources.

The DNA polymorphisms for Gl raal 8g02590 identified through WGS analysis were confirmed to be expressed using V RACE and cD A sequencing, in SCN resistant genotypes Cloud, PI 88788, and Pi 209332, two different Glymal 8g02590 transcripts were identified , One of the sequences corresponded to the Williams 82 reference type sequence, and the other corresponded to the sequence from Pi 88788-derived resistant sources (from. NAM parents). The proportion of Pi 88788-derived versus Williams 82- iype cD A sequence follows that observed for DNA sequence. That is, the cDNA of Pi 88788 derived Glymal 8g02590 is roughly 90% of the total transcripts sequenced. This is consistent with the data tha these genotypes contain 8 or 9 copies of the 31 kb DNA segment derived from Pi 88788. A SNP present in the 5^* UTR of Glymal 8g02610 was also analyzed in Pi 88788. The proportion of the sequence types fits the other observations.

i SCN-resistant genotypes Peking, Pi 90763, PI 89772, and PI 437654 two different transcripts were identified for Giynia 18g025 0. One of the sequences corresponds to the sequence from the Peking Ρί 437654-derived resistant source LD01- 5907 from, the NAM sequencing project. See Figure 1 . An alternati ve form of c NA was also detected fr m each of the four SCN-resistant genotypes Peking, PI 90763, PI 89772, and PI 437654, with the same type of polymorphism across all four sources. This apparent mRNA splicing isoforra had 36 nucleotides deleted resulting in. a

GlymaI g02590 isotbrm wit 1.2 fewer amino acids as shown in Figure 1.3. The deletion occurs at the end of exon 6 and splices back into frame in exoit 7. None of the sequenced. products from Peking, PI 90763, PI S9772, and PI 437654 contained the Williams 82- type Giymal8g02$9() sequence, consistent with the W^'CSS analysis. Based on the proportio of cDNAs sequenced, very approximately 70% to 90% of the Glyma18g02S9G rxanscript is the full-length version m these lines.

The various polymorphisms may result in functional differences in the

Giyraal Sg25 0 polypeptide and are modeled ihree-diroensionally in. Figure 14 which relies on. the solved crystal structure of the yeast. Seel ? protein. The deleted alpha-helix is shown in light gray. It is noted that these polymorphisms are clustered in one general area near the C-terminus of the predicted folded Glymal8g02590, which is an alpha- SNAP protein homo!og, and thai substantial functional data are available for eukaryofe alpha-SNAP proteins that suggest particular functions for this region of the protein (e.g. , Barnard Ri. Morgan A, & Burgoyne RD (1996) Domains of alpha-SNAP required, for the stimulation of exocytosis and for N-etliy!malemk1e- sensitive fusion protein (NSF) binding and activation. Molecular hio gy of the cell 7(5):693-701 ; Barnard RJ, Morgan A, & Burgoyne RD ( 1997) Stimulation of NSF ATPase activity by alpha-SNAP is required for SNARE complex disassembly and exocytosis. J Ceil Biol 139(4):S7S-883; Jahn. R & Seheiler RH (2006) SNAREs - engines for membrane fusion, Nat Rev. Mot Cell Biol 7(9):631.-643.)

However, expressing only the Fayette polymorphic rhgI-b~iypQ Glymal8g02390 downstream of a strong constitutive promoter or native promoter sequence did not increase the SC resistance reaction of Williams 82 transgenic roots (Fig. 15 and Fig. 16), suggesting that rhgl-h SCN resistance requires more than this 2590 amino acid polymorphism. Bui such polymorphisms may play a contributing role in SC resistance that was not detected in these experiments. Overexpression of Gly al 8g02580 or Gly aI8g02610 also failed to increase SCN resistance (Fig. 13) when expressed alone using a strong constitutive promoter. These data are preliminary and may indicate that the resistance phenotype requires more than a single gene or that some other factor is necessary to mediate resistance.

Given the above, simultaneous overexpression. of the set of genes within the 31 kb repeat segment was tested as a possible source of SCN resistance, A single recombinant DMA construct was made in which each of the genes Giymal8g02580, GlytnaI8g2590, Giymal8g260⁽) and Glyma.l8g26l0 was fused to a strong promoter. In two separate experiments that together tested >25 independent transgenic events for each D A construct, resistance to SCN was significantly increased in SCN-snsceptibl.e Williams 82 by simultaneous overexpression of this set of genes (Fig, 15). Increased SCN resistance was conferred despite the fact that three of the genes being overexpressed encode predicted, amino acid products identical to those of SCN-suseep ble Williams 82, and the polymorphic Fayette rhgl~h GfymaI8g02S90 gene that was used was not sufficient to cause a detectable change in SCN resistance when overexpressed on its own (Fig, 15). Of note, there was no significant elevation of PR-1 in these transgenic roots, which could have indicated non-specific elevation of defenses (Fig. 1 ). We also tested the impact of simultaneously over-expressing GIymaI8g0258(⁾ GtynmI8g02590f tt<t> and

Giy aISg026lO on SCN resistance in Williams 82. We observed increased resistance to SCN in transgenic roots of Williams 82 over-expressing Glymai8g02580,

Gfyma J8g02590ft_m and Gfym l^' 8g02610 relative to Williams 82 empty vector roots as shown in Figure 17. These data indicate that over-expressing ihis combination of genes results in enhanced SCN resistance.

These results reveal a novel mechanism for disease resistance: an expression polymorphism for multiple disparate but tightly linked genes, derived through copy number variation at the Rhgl locus. This knowledge suggests future approaches to enhance the efficacy of -mediated quantitative resistance to the highly important SCN disease of soybean, for example through isolation of soybean lines that carry more copies of the 31 kb Rhgl repeal, or through transgenic overexpression of the relevant, genes. These approaches may be applicable in other species as well, for resistance to other endoparasitic nematodes,.

The biochemical mechanisms of Rhgl -mediated resistance remain unknown. Other sequenced plant genomes do not carry close homologs of the predicted Glyma 18g02610 protein, although a wound-inducibie protein in ice plant with 55% identity has been studied. Modeling of the Glyma 18gO26T0 predicted tertiary structure using Phyre2 indicated, with 98% confidence, similarity of 48% of (Ilymal 8g02610 to the PhzA/B subfamily of Delia(5)-3-keiosteroid isomerase/nuclear transport factor 2 famil proteins. Hence (Ilymal 8g0261O may participate in the production, of phenazine- like compounds that are toxic to nematodes. Thus application of Glymal8g26! 0 to plants, soil or seeds may inhibit nematodes in susceptible plants. Secretion of the

Gly.mal8g02 10 protein or other plant products thai contribute to disease resistance may be impacted by the Glyma I Sg02590 a-SNAF protein. Because it is one of at least five a-SNAF homoiogs encoded in the soybean reference genome, Glyma 18gO2590 may have undergone subfunctionalizaiion or neo.tanctionalization. Fully sequenced plant genomes carry from two dozen to over five dozen annotated amino acid transporters of many subtypes (www.phyotzome.iiet), which can be involved in amino acid import and/or export between cells or between subcellular organelles. The Glyma 18g02580 protein and its most closely related transporters of soybean and other species are not functionally well-characterized, so the concept that Glyma.! 8g02580 alters nematode success by altering the levels of specific amino acids or amino acid derivatives at the feeding site is only one of many viable hypotheses for -future study regarding the SCN- deterring function of Glyma 18g0258O.

Cop number variation (CNV) of block of dissimilar genes, rather than. CNV for a single gene -family, confers /{ / -mediated SC resistance. Recent analyses of genome-architecture in sorghum, rice, and soybean have reported high levels of CNV, and a tendency for overlap of region of CN V with postulated hiotie and abiotic stress- related genes. The present work provides a concrete example of CN V conferring a valuable disease resistance trait. In humans and insects, adaptive traits have been associated with CN V for specific single genes. Single-copy clusters of functionally related but non-homologous genes are highly unusual in multicellular eu.karyot.es, but these have been reported in association with plant secondary metabolism. We provide a unique example of CNV involving more than two repeals, with the repeat encoding multiple gene products thai are necessary for adaptation, to the same important

environmental constraint. Given the highly repetitive nature and plasticity of plant genomes and the relatively under-explored association between CNV and phenotypes, it seems likely that a number of other complex traits are coo trolled by the general type of C V we report for soybean RhgJ .

Materials and Methods:

Agrohaet rium rkizogmes Soybean Root Transformation

A. rhizogenes strain Arqual was transformed by freeze-thaw as previously reported by Wise, A. A.,∑. ^'Liu, and. A.N. Binns, Three methods for the introduction of foreign DNA into Agrobacterium. Methods Mol Biol, 2006. 343: p. 43-53 and Hofgen, R. and L. i!imitzer, Storage of competent cells tor Agrobacterium transformation. ^'Nucleic Acids Research, 1 88. 16(20): p. 9877-9877. The cells were plated on selective media with the appropriate antibiotic and incubated at 28°C for two days. A. rhizogenes ^•strain Arqual was received from Dr. Jean-Michel Aoe, University of Wisconsin

Madison. Soybean seeds lacking macroscopic signs of fungal or viral contamination were surface-sterilized for 56-20 h in a desiccator jar with chlorine gas generated by adding 3.5 nil 12N HQ into 100 ml household bleach (6% sodium hypochlorite). At least 20 seeds per experiment were plated onto germination media (Gamborg's BS salts (3.1 g/L), 2% sucrose, 1 X Gamborg's B5 vitamins, 7% Noble agar, pH 5.8) in 100 x 25 mm Petri plates. Plates were wrapped with Micropore tape (3M, Si. Paul, MN) and incubated at 26°C in. a growth chamber (18/6 light dark hours) for approximately one week. Soybean cotyledons were harvested 5-7 days after germination by gently removing them from the hypocoiyls with sterile forceps. With a sterile forceps and. Falcon #15 scalpel, several shallow slices were made across the abaxial surface of the cotyledons after dipping the scalpel in A. rhizogenes suspension OD«»> 0,6 - 0,7 in. sterile ddHjO). The cotyledons were then placed abaxial-side down on a co-culture medium (CCM) (0.31 g/L Gamborg's B^'5 salts, 3% sucrose, IX Gamborg's B5 vitamins (Bi World.

Dublin OH), 0.4g L L-cysteine, 0.!54g/L dithioihreitoi, 0.245g L sodium thiosulfate, 40mg/L aeetosyringone, 5% Noble agar, pH 5,4) in 100 x 15 mm Petri plates with a piece of 70 mm filter paper (Whaiman, Plseataway, NJ) on the surface of the agar to prevent A, rhizogenes from overgrowing. Plates were wrapped with para.fibn and incubated in the dark at room, temper ture for three days. The explants were then transferred to a hairy root medium (HRM) of 4.3g/L MS salts (Sigma Co., St. Louis, MO), 2% sucrose, 1 X Garnborg's B5 vitamins (Bio World, Dublin, OH), 7% Noble agar, 0.15g/L cefotaxime, 0,I5g/L. carbenicilim, pH 5.6 in 100 x 15 mm Petri plates, wounded side up. Plates were wrapped with Micropore tape and incubated in the dark at room temperature until roots emerged, usually in around 2 weeks. Transgenic soybean roots were detected based on plasmid vector-encoded GFP expression, using a fluorescence ste eormcroscope (LEI.CA Z PL III with GFP2 filter). Transgenic soybean root tip segments (2-3 cm) were transferred to MRM. Roots thai were expressi ng incomplete strips of fluorescence (chimeras) o exhibiting overall low levels of GFP fluorescence were avoided.

Independent transgenic events, generated from different inoculation sites or different cotyledons, were maintained separately for RNA extraction and nematode demographic assays.

Nematode maintenance

An SCN population from Racine, Wisconsin (Kg type 7), collected by Ann MacGuidwin (University of Wisconsin-Madison), was maintained on the susceptible soybean eultivar Williams 82. Seeds were germinated between two damp pieces of paper towel that were rolled-np and placed vertically in a glass beaker with a small amount of water at the bottom for 2-4 days. Germinated seeds were then planted in autoclaved 4: 1. sand:soii mixture and inoculated with 2000 eggs of H, glycines per plant, and grown in a 28°C growth chamber. Cysts were collected -50 days after infection when soybeans were at. R2 (full flowering) and extracted from soil and. roots using sieves and

cefttrifugation. Briefly, soil and roots from infected pots was placed in a pitcher of water and agitated. The soil-eyst-water slurry was passed over a 710um - 250 μη sieve tower, and the mixture from the 250 μηι sieve wa backwashed into a 50ml, plastic conical tube. The tubes were centrifnged at 2000 rpm for 4 minutes then the supernatant was poured off. A 60% sucrose solution was added to the tubes, stirred, and centrifuged at 2000 rpm for 2 min. Cysts in the supernatant were then collected over a 250 pra sieve. Collected cysts were stored at.4 C in scalable plastic bags containing twice-sterilized flint sand. Nematode demographies assay

Nematode demographics assays were performed as in Melito et a!., intra.

Vigorous new root segments (2-3 cm including root tip) were utilized. All roots (all genotypes within an experiment) were coded with random number prior to inoculation, to mask root genotype information from the investigators who stained roots two weeks later and determined the number of nematodes in each nematode development category. For inoculum, H. glycines eggs were collected by breaking open cysts with a large rubber stopper and collecting the eggs o a sieve stack consisting of 250 μτη - 75 μιη - 25 μιη 5 sieves (USA Standard Testing Sieve). Eggs were collected from the 25 μηι sieve and rinsed. Eggs were placed in a hatch chamber with 3 mM ZnCfe for hatching at room temperature in the dark for 5-6 days. See Wong, A.T.S., G.L. TyJfca, and .G. Hartzier. Effects of 8 herbicides o in-vitro hatching of Heterodera-glycines. Journal of

Nematoiogy, 1 93, 25(4): p. 578-584. Hatched 12 nematodes were surface-sterUked. for i^'O 3 min i 0,001% mercuric chloride and washed three times with sterile distilled water, then suspended in room temperature 0.05% low-melting point agarose to facilitate even distribution. Baum, TJ., M.J.E, Wubben, K.A. Hardy, R. Su, and S.R, Roderroel, A. screen for Arabidopsts thaHana mutants with altered susceptibility to Heterodera schachtii Journal of ^'Nematoiogy, 2000. 32(2): p. 166-173. The number of active

15 nematodes was determined by viewing an aliquot under a stereomicroscope at least one- half hour after surface-sie.ri.Hza.tion and washing, and 200-250 active J2s were inoculated onto each fresh root segment. Inoculated roots with nematodes were maintained on HRM media at 2 ^C'C substantia! root growth typically occurred during the subsequent, two weeks. Nematode infection and development within these root systems was monitored 0 by clearing and staining with acid fuchsin, typically 1.5 days post inoculation (dpi).

Bybd, D.W., T. Kirkpatrick, and K.R. Barker, An improved technique for clearing and staining plant-tissue for detection of nematodes, journal of Nematoiogy, 1983, 15(1): p, 142-143. The nematode demographic assay was then completed by recording the number of nematodes in eac root system that exhibited a morphology resembling either J2 (thin), 5 J3 (sausage-shaped), elongated male, or J4/aduit female nematodes, as noted in text and figures. T pically, 20-80 nematodes were present in each root; roots containing fewer than ten nematodes were excluded from further analysis. Results were expressed as % of nematodes that had developed beyond J2 stage ([,B + adult males -i-adu!t females]/" J2 ÷ J3 · adult males - adult females]). Each data point was normalized to the mean for 0 Williams 82 roots transformed with empty vector, from the same experiment All reported data are based on at least two independent biological replicate experiments (n >

12 independently transformed roots for each bar on a bar graph),

Primer Table

Primer sequences used to perform this research are listed in Table 4 and referred to by number in this document.

Table 4, D A sequences of oligonucleotide primers used for PCR,

ID Primer Sequence SEQ ID

Silencing constructs

1 2570 hpRNAi _F AGGATCCATTTAAATCAAGTACTCTTCCCCACAAAAGCT 19

2 2570 RNAi JFt ACCTAGGAGGCGCGCCTGGGGCCATTTCAGTAATTAGGTC 20

3 2580 hpRNAi„F acctaggaggcgcgccTCATGAAGGTTCTCGGCGTAG 21

4 2580 hpRNAi„R aggatccatttaaatCCACCAGTGAATTCCAAACCA 22

5 2590 hpRNAi ... F GAcctaggcgcgccGGACTTGGTCGTCAACACAGTC 23

6 2590 hpRNAi __R GCggatccatttaaatGAGCAGCAAACTGGGCAACT 24

7 2600 h RNAi„F acctaggaggcgcgccGCCAAATTCAAAAGGCTTGCT 25

8 2600 hpRNAi _ R aggatccat aaatCACCATTCAACATGCCTGTCA 26

9 2610 hpRNAi __F taacctaggaggcgcgccACAACTCClTCCGATTCGTT^'CCG 27

10 2610 hpRNAi __R caggatecatttaaatAGATACAACCACCTGAATACGCCC 28

11 2620 hpRNAi __F AGGATCCATITAAATCTCGCAACACCATATCCAGAGTA 29

12 2620 hpRNAi _R ACCIAGGAGGCGCGCCGGTGTTAAGGTCGAACCTGCGAA 30

13 2590-1 I miR-s gaTATTGGTTATAGCAACACCGTtctctcttttgtattcc 31

14 2590-1 H ms^'R-a gaAG ! 1 i GCTATAACCAATAtcaaagagaatcaafga 32

15 2590-1 ill miR*S gaACAGTGTTCCTATTACCAATTtcacagg cgtgatatg 33

16 2590-1 IV miR*a gaAATTGGTAATAGCAACACTGTtctaca atatattcct 34

17 2610-1 I mi -S gaTATTTCCCGACCCGACGGGACtctCtCttttgtattcc 35

18 2610-1 H miR-a gaGTCCCGTCGGGTCGGGAAATAtcaaagagaatcaatga 36

19 2610-1 HI miR*s gaGTACCGTCGGGTCCGGAAATTtcacaggtcgtgatatg 37

20 2610-1 I mfR*a gaAATrTCCGGACCCGACGGTACtctacatatatattcct 38

21 2610-2 I miR-s gaTATCCAGTCACCGCGACGTGGtctctcttttgtattcc 39

2610-2 li msR-a gaCCACGTCGCGGTGACTGGATAtcaaagagaatcaatga 40

23 2610-2 HI miR*s gaCCCCGTCGCGGTGTCTGGATTtcaeaggtcgtgatatg 41

24 2610-2 IV miR*a gaAATCCAGACACCGCGACGGGGtCtaca tatattCct 42

Transcript Abundance using qPCR

gml8: 2570 43

25 F ..qPCR TGAGATGGGTGGAGCTCAAGAAC

gm l8: 2570 44

26 R.„_. PCR AGCTTCATCTGATTGTGACAGTGC

gm l8: 2580 45

27 F„qPCR CGTGTAGAGTCCTTGAAGTACAGC

gm l8: 2580 46

28 R qPCR ACCAGAGCTGTGATAGCCAACC

gm l8: 2590 47

29 F... PCR TCGCCAAATCATGG6ACAAGGC

30 gml8: 2590 CAATGTGCAGCATCGACATGGG 48 R_qPCR

gm lS: 2600 49

31 F...qPCR GCTTCAGTCAAGAAAATGTGCATG

gml8: 2600 50

32 R„qPCR CACCCGAAACCGCGACACAAATG

gmiS: 2610 51

33 F.„.qPCR AGGTCACGTGTTG CCGTTG

gm lS: 2610 52

34 R„qPCR AAACCACACCAATAACAACAAAGCTCT

gmlS: 2620 53

35 F„qPCR AAGCCCAACAGGCCAAAGAGAG

gmiS: 2620 54

36 R qPCR ACACCAAATGGGTTC6CACTTC

gm lS: 2630 55

37 F„qPCR TTGTGGAAGTGAAAGTCGGTTTGC

gmlS: 2630 56

38 R„qPCR GTTGTCACGTTTCCCGTAACAATG

39 EFlbJFor.qRT CCACTGCTGAAGAAGATGATGATG 57

40 EFlb._Rev.qRT AAGGACAGAAGACTTGCCACTC 58

*43t S IP16J¾r.qRT GAGCCCAAGACATTGCGAGAG 59

42 5KIP16_Rev.qRT CGGAAGCGGAAGAACTGAACC 60

43 UKN2„For.qRT GCCTCTGGATACCTGCTCAAG 61

44 UKN2._Rev.qRT ACCTCCTCCTCAAACTCCTCTG 62

45 ACTi i„.For. PCR ATCWGACTGAGCGTGGTTATTCC 63

46 ACTi i„Rev.qPCR GCTGGTCCTGGCTGTCTCC 64

47 UN lJ¾r.qPCR TGGTGCTGCCGCTATTTACTG 65

48 UNKi_.Rev.qPCR GGTGGAAGGAACTGCTAACAATC 66

49 TIP41„For. qPCR AGGATGAACTCGCTGATAATGG 67

50 TfP41. Rev.qPCR CAGAAACGCAACAGAAGAAACC 68

51 PR-1 (6790) F TGCTTGGTCACCTGGAAGTTGG 69

52 PR-1 (6790) AACTTCCTGCGAGCTGCGATAC 70

53 PR-1 (6800) F AGTCATTGTGGGTGATCATGCTG 71

54 PR-1 (6800) R GCAGCGTTGTGTGCATTAACAAAG 72

Expression Vectors

55 Ox2610-SafF2 g cgacATGCGCATGCTCACCGG 73

56 P2610f¾sed-R TATTGCGAGAACCAAACCG G 74

57 Ox259QSaS-F GGgtcgacATGGCCGATCAGTTATCGAAGG 75

58 Ox2S9Qfused~R AGTAATAGCCTCATGCTGCTCAAGTT 75

59 TerXba-R ACtctagaGCGCATGTCTTGCGTTGATG 77

60 GmubiXba-F GCtctaga GGGCCCAATATAACAACGACG 78

61 TerKpn-R TCggtaccGCGCATGTCTTGCGTTGATG 79

62 PPA Linker j op GatgtcTTAArrAAtatctgtGGGCCCactatGGCGCGCCaatgtaaA 80

PPA AGCrrttacattGGCGCGCCatagtGGGCCCacagata 81

63 Linker_... Bot om TTAATTAAgacatCTGCA

64 Ox2600-F ATGGTTTCGGTTGATGATGGG 82

65 Ox2600-R M i l 1 GTGCATATAAGGGGTTCAT 83

66 NosHind-F GCaagcttGATCATGAGCGGAGAATTAAGGG 84

67 Nos2600-R CCCATCATCAACCGAAACCATAGATCCGGTGCAGATTATTTGG 85

68 Nos2600-F CCAAATAATCTGCACCGGATCT ATGGTTTCGGTTGATGATGGG 86

69 NosAsc-R TCggcgcgccGCGCATGTCTTGCGTTGATG 87 70 Ox2580~F ATGTCTCCGGCCGCCG 88

71 OX2580-R TGACTTGCTACTAAAAGCATTATATATGTTG 89

72 NosAsc-F CAggcgcgccGATCATGAGCGGAGAATTAAGGG 90

73 os2S80- CGGCGGCCGGAGACATAGATCCGGTGCAGATTATTTGG 91

74 os2580-F CCAAATAATCTGCACCGGATCTATGTCTCCGGCCGCCG 92

75 NosSfaf-R TGcctgcaggGCGCATGTCTTGCGTTGATG 93

76 13 F GTAAAACGACGGCCAG 94

77 M 13 R CAGGAAACAGCTATGAC 95

78 pSM iOl seq GTCTTGATGAGACCTGCTGCG 96

79 g2590pHind~F C aagc tGAATGGTTTTTGTTTTGTTGTCTCTCAC 97

80 g2S90pSai- TTGGTCGACCGTATCATCCAATG 98

Bridge PCR

SCN„Res Bridge 99

81 F TTTAGCCTGCTCCTC CAAATTC

SCN_Res Bridge 100

82 R TTGGAGAATATGCTCTCGGTTGT

Probes for Northern Analysis and Alt Transcript

83 2570F_qPCR TGAGATGG6TG6AGCTCAAGAAC 101

84 2570 UT Rev CAAGTACTCTTCCCCACAA AGC 102

85 2570 put exon F TGCAGTTTTAGTGG A A AGG CC 103

86 2570 exon 6 R TCATC GCTCAACTTGAATCCC 104

RACE PCR

87 2590-5GSP GATCGGCCATTTTCCTCCGATCGAAACA 105

88 2S90-5NGSP GACGACCAAGTCCAAATCCAAAACCCGC 106

8 259Q-3GSP AAGCC.AAAGAACTTGAGCAGCATGAGGC 107

90 2590-3NGSP CTGTCCAGTTGTTCGTCTTACACATCGA 108

91 261G-5GSP GGCGACGATCTTGACGACGGCGTT 109

92 2610-5N6SP TCATACAGTGCAACCACCAGCCGCG 110

93 261Q-3GSP GGACGAGGTCACGTGTTGCCGTTGCT 111

94 2610-3NGSP TTCACCACTATGGGCGTATTCAGGTGGT 112

95 2580- 3GSP CCTGGGGGATTCCAAAGGAACGC 113

Vector Construction for Soybean transformation

Binary vectors pSM!Ol and pSMI03 for soybean transformation were

constructed as previously described in Melito et al. To generate and clone soybean

a niRNAs, the Web microRNA Designer {http://wmd3.weigeiwbrid.org) and protocols were used. The concept is more thoroughly documented in other references. See

Schwab, ., S. Ossowski, M« Riester, N, Wart mann, and D, WeigeL Highly specific gene silencing by artificial mtcroR.NA.8 in Arahidopsis, Plant Cell, 2006. 18(5): p. 1 121- 1 133. Soybean DNA was extracted from either expanding soybean trifoHates or soybean roots using a previously reported CTAB method. .Doyle, .I.J. and E.E. Dickson, Preservation of plant-samples for DNA restriction endonuelease analysis. ^"Faxon, 1987. 36(4): p. 715-722, PC fragments for arai NA construction were TA cloned using pCR8/GW TOPO TA cloning kit (Life Technolog es Corp., Carlsbad CA) (Table 4 13- 24). Binary vectors pGRNAi I and pGRN Ai2 for soybean transformation were a gift from Wayne Parrot, University of Georgia (unpublished). For each hairpin, a 300-600bp DMA fragment was PCR amplified (Table 4 1-12) using Phusion HF polymerase (New England Biolabs, Ipswich, MA) and .Script cDNA. synthesis kit (Biorad, Hercules, CA) as a template, as per manufacturer's instructions. PCR products were TA cloned as previously described. Primers used to generate the DMA f agments were designed t contain restriction sites Avrll/Ascl (forward primer) and BamHI/Swai (reverse primer) to allow cloning into pGRNAU andpGRNAil. To generate the first arm of the hairpin, the insert and vector were sequentially digested with restriction endonucleases Swal and Ascl using snami lecturer's recommended protocol. (New England Biolabs, Ipswich, MA). DNA was separated on a 1.0% agarose gel stained with ethidium bromide, and respective DHA fragments were gel purified using Qiaqoiek gel extraction kit (Qiagen, Valencia, CA) and ligated together overnight at 4°C using T4 DNA ligase (Promega, Madison, W.I). The same procedure was used to insert the second arm of the hairpin construct using the restrictio endonucleases BamHI and Avrll. To construct single gene overexpression vectors for GIymal80258 (Table 4 70, 71), Glymal g0259() (Table 4 57, 58) and Gyma 1802610 (Table 4 55, 56), full-length ORFs were PCR amplified from cDNA of Fayette using Phusion HF polymerase and TA cloned in pCRS/GW/TOPO as previously described. Glym 18gi)2600 (Table 4 67, 68) was cloned from genomic DNA by similar methods, as no Gly a 1802600 cDNA could be detected in root cDNA libraries. The Glyma 18g02610 and Glyma 802590 ORFs were recombined with pGWBS 4 (CaMV 35S promoter, 6X HA-NOS terminator) using LR clonase reaction (Life Technologies Corp., Carlsbad, CA) per manufactures instructions. See Nakagawa, T,, T, tirose, T. Hi.no, . Tanaka, M. Kawamukai, Y. iwa, K, Toyooka, K. Matsiroka, T. Jinbo, and T. imara, ^'Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transfomiation. J Biosci Bioeng, 2007, 104(1): p. 34-41. Glymal8g02610 (Table 4 55, 59) was PCR amplified from pGWB14 and TA cloned into pCR8. This vector and pSM1.03 were digested with Xbal/Kpnl and !igated to yield G Ubi_f!l-^:26W~HA;NOS^_in (D&2610-HA). The same procedure was used -for Giym l8g0259Q (Table.4 57, 59), except the amp!icon contained Xbai/SaH sites and was TA cloned into pCR.8. 259Q~HA:NDS_term and pSM 103 were digested with Xhal/Sall and Hgated to yield Gm Ubi^- SW-HA :NOS_mw (OB-2590- HA). The full ΟΕ-.2590-ΉΑ wa also digested (Xbal/Sall) and Hgated into pSMI 03 containing OE:2 10-HA to yield OE:261 O~OE:2590. To generate the four gene overexpressioTi construct, the restriction sites Pad, PspO i, and Asd were added to pSMlOl between sites Psti/Hindli by annealing o!igos (Table 4 62, 63) to generate pSMi OH. The two gene overexprcssion cassette (OE:2610- OE:2S90) was moved to the new pSM.l QH- using the restriction enzymes Fsti/Kpnl and ligation. A Nos promoter was added to Giym J8g02600 in. pCR.8. using overlap PG (Table 4 65-68) and TA cloned into pCR8. This vector was recombmed with pGWB 1 (no promoter, 4xMyc- NOS terminator) in an LR elonase reaction to yield m_prom:26()0~myc:No>s _m (OE 26(}Q- myc). OE:26^'00-mye was PCR amplified (Table 4 66, 72) and TA cloned into pCR8, and subcloned into pSMlOB- (OE:2610-QE:2590) using restriction enzymes Hinlll/AscI to yield the three gene overexpression vector (ΟΒ:26ί -ΟΕ:2590-ΟΕ:2600). A Nos promoter was added to Gfytn 18g02580 m pCR8 using overlap PCR with primers 71 -74 and TA cloned into pCRS, This vector was used wit pGWB 16 in an ER elonase reaction to yield N ^_n:2580-myc:Nox_ie^ (OE:25W-my€). OE:2580-mye was amplified (Table 4 72, 75) and TA cloned, then subeloned into the three gene overexpression vector resulting in the four gene overexpression vector pSM 101+ OE;2610~OE:2590-OE:2600- OE:2580, The native Fayette GIymal8g02590 ( 590^: 590_?^ construct for Williams 82 complementation was suhcloned from a fosmid containing the desired allele. A 6.5 kb DMA fragment containing the Pi 8S788 Gfym l8g02590 was isolated from a fosmid following Sail digestion and cloned into pSM 101 using the Sail restriction site. This sequence contained approximately Ikb of 5" regulatory DNA sequence. An additional 600bp of 5^* regulatory sequence directly upstream of the sabcioned region was added to the construct by amplif ing a PCR product (Table 4 79, 80) from the fosmid and inserted using the restriction enzymes HmdlH/SalL The resulting construct contained

approximately 1.6 kb of naturally occurring 5' regulatory sequence of the Fayette

Giymal8g02590 allele. Vector sequences were confirmed at various steps using Sanger sequencing with ABI Big Dye cycle sequencing kit (dicleox ehain-terniination) and ΑΒΪ 3730x1 DNA Analyzers (Life Technologies Corp., Carlsbad, CA), using the DNA sequencing service at the University of Wisconsin-Madison Biotechnology Center.

Quantitative Real Time PCR

Quantitative. PCR (qPCR) was -performed using either the MylQ or C X.96 realtime PCR detection system (BioRad, Hercules, CA). eDNA was synthesized, from RNA using iScript eD A synthesis kit (Biorad, Hercules, CA) per .manufactures protocol by adding 0.825 ug to 1.0 ug of RNA depending on me experiment. Total RNA was extracted from root tissue of conventional and transgenic soybeans. RNA was extracted from, conventional soybean plants grown in Metro mix for two weeks at 26°C and 16 hours light prior to tissue collection. Roughly 200 rag of tissue was collected from each plant, immediately -flash-frozen in liquid nitrogen and stored at ~80C. Transgeni root material was collected from roots actively growing on HRM as previously described. Roughly 50-100 mg of tissue was collected from each root, flash frozen in liquid nitrogen and stored at -80(1 RN A was extracted using either the RNeasy Mini Kit (Qiagen, Valencia, CA) or TRJzol reagent (Life Technologies Corp., Carlsbad, CA) following manufactures protocols. RNA concentrations were determined using the NanoDrop-l 000 spectophotomoter (Thermo Scientific, Waltham, MA). DNA was removed from RNA samples using either RNase-free DNase 1 (Qiagen, Valencia, CA) or DMA-free (Life Technologies Corp., Carlsbad, CA) following -manufacture protocols. RNA. integrity was determined using the 2100 BioAn!yzer (Agilent Technologies, Santa Clara, CA) or 500 iig of total RNA was run on a 1.2% agarose gel stained with ethklium bromide and visualized under UV-light to ensure RNA quality following extraction. qPCR reactions were carried out using either 1Q SYBR Green Supermix or SsoFast EvaGreen Supermix. (Biorad, Hercules, CA). Primer concentrations for all reactions were between 0.2 uM and 0.3 μΜ. Two technical replicates were run per RNA. Efficiency curves were generated for qPCR primer pairs using eDNA from the cultivar Fayette or Williams 82 following a 3-4 step, 3-5 fold dilution. Following amplification, a. melt curve program was performed. To ensure qPCR fluorescent signal was not the results of DNA, 1.00 ng of RNA extraction was added directly to IQ SYBR Green Supermix or SsoFast EvaGreen Supermix with primers. DNA, contamination was considered negligible if CT values were not detected until after 32-35 cycles. A control reaction was run in parallel using a known cDNA sample. Transcript abundance for genes at. Rhgl was measured. using pri mers X-X. A total of six primer pairs were tested as reference genes (EFJ , SKIP 1 ^'6, UNK2, ACTU, UNKL TIP41) (Table 4 39-50). Hu₍ R.B., CM, Fan, Lf.Y. Li, Q.Z.

Zhang, and Y.F. Fu, Evaluation of putative reference genes for gene expression normalization in soybean by quantitative real-time RT-PCR. Brae Molecular Biology, 2009. 10: p. 12. Reference genes were validated using Bestkeeper analysis. PFaff , M.W., A. Tichopad, C. .Prgomet, and T.P. Neuvians, Determination of stable

'housekeeping genes, differentially regulated target genes and. sample integrity;

BestKeeper - Excel -based tool using pair-wise correlations. Biotechnology Letters, 2004, 26(6): p. 509-515. Primer pairs SKP16 and TIP41 were selected and used in subsequent experiments. Transgenic roots expressing empty-vector constructs analogous to the vectors carrying gene silencing or gene expression constructs were included in the experiments as controls and used to standardize gene expression. Results were considered to be at the limits of detection if CT values were >35 (i.e., for

Gfym l8g(⁾2600 transcripts).

DM repeat junction analysis

The presence of a repeat junction was confirmed using PGR (Table 4 81, 82) and soybean genomic DNA. from SCN resistant cu!tivars Fayette, Hartwig, Newton and SCN susceptible cuiitvars Williams 82, Essex, Thome and Sturdy, DNA. extraction and PCR were performed as previously described. Possible impacts ofretrotransposons on. Rhgl locus evolution were investigated by searching for sequences with similarity to known plant retroiransposons, A 185 b sequence with 75% identity to the 5' and 3' long terminal repeat (LTR) regions of Tyl/copia-!ike retrotransposons RTvr! and RTvr2 is present within 400 bp of the rhgl-h duplication junction.

Statistical analysis

Data were analyzed by ANOVA using Mini tab (v.14) with the General Linear Model and Tukey Simultaneous Test.

Fosraid library construction

Seed of soybean Plant Introduction (PI) 88788 was obtained from, the USDA soybean gerraplasm collection. Plants were grown In a growth chamber set at a photocyle of 18/6 hr (day/night), 23/20°C (day/night), and 50% relative humidity for 1-2 weeks. Young leaf tissue was collected, from six to 15 individuals for each line. Genomic DNA was extracted using cetrimon.iuiti bromide (CTAB). Plant samples were ground to fine powder in liquid nitrogen, transferred to 20 ml of CTAB extraction buffer (2% CTAB, i 00 mM ^'Iris pH 9.5, 1.4 NaC ,. 1% PEG 6000, 20 mM EDI^' ., 2%

polyvinylpyrrolidone, 2.5% β-mercaptoethanoi), and placed at 65 °C for 1 hr. After incubation, an equal volume ofPhenol;Chloroform:Isoaxnyl Alcohol (25:24: 1 , pH 6.7) was added to the tube, then centrifuged at 8,000 g at 10°C for 1.0 rain. The aqueous (top) phase was transferred to a new tube and an equal volume of ehlor oforrmisoamyl alcohol (24:1) was added to the aqueous phase and centrifuged. The aqueous (top) phase was then transferred to a new tube and 0,7 volumes of isopropyl aicohol was added to the aqueous phase. After mixing well, the aqueous phase was centrifuged and the pellet resuspended in 70% EtOH, centrifuged at 7,500 g for 10 rain. After centrifiigation, the pellet was resuspended in .100 ul of TE (10 mM Tris pH 7.5, ImM EOT A). The DMA was treated with RNase A. by incubating in 20 ug/ml RNase A at 3 C for 1 hr. The PI 88788 fosmid library was constructed using the CopyControl™ Fosmid Library

Production Kit (Epicentre, Madison, Wi) following the manuiacturer's protocol. Briefly, 20 ug of the size-t actionated. DNA. was used for end-repair. 35-45 kb fragment pools of DMA were cloned in the pCClFOS™ Vector. Ligated DNA. was packaged using the axPlax™ Lambda. Packaging Extracts and transformed, into the Phage II -Resistant EPi 300™-Tl^R £ coil strain.

Fosmid clone sequencing and assembl

Five candidate fosmid clones were identified by PCR-based pool screening using primers based on the rhgl-h interval of the Williams 82 reference sequence. Once it was confirmed that end sequences .matched the anticipated region of the reference soybean genome sequence, they were sequenced using both the Roche 454/GS FLX-i- system (Roche) and lllumina MiSeq (lllumina). 1 -3 ug of fosmid clone DNA was used for making paired-end sequencing libraries for 454/GS FLX+. After library construction, pooled barcoded libraries were loaded onto one lane of the sequencing flow cell and sequenced. The average read length was.463 bp. The number of reads generated from 454/GS FLX+ is as follows: fosmid clone #i in Fig. 2A: 10,865, #2: 6,271 , #3: 6,648, U: 6,520, and #5: 9,390. The reads were assembled using Phrap/Cross _...match (www.phrap.org) and CAP3. Huang, G.Z., R, Alien, EX, Davis, T.J. Baura, ami R.S. l iussey. Engineering broad .root-knot resistance in transgenic plants by RN At silencing of a conserved and essential root-knot nematode parasitism gene. Proceedings of the ^'National Academy of Sciences of the United States of America, 2006, 103(39): p. .14.302- 14306. For the MiSeq, 0.3-2 ug of DMA was used for making the sequencing library. Average DNA fragment size was 550 fop (range from 430 to 720 bp). 154 cycles from each end of the fragments were performed using a TrnSeq SBS sequencing kit version 1 and analyzed with Casaval .8 (pipeline 1.8). Throughout the reads, the average quality scores for each base were over 30, The number of reads generated from MiSeq is as follows: jfosmid clone #1 in Fig. 2A 1 ,067,403, #2: 814,728, #3: 1 ,1.56,784, #4:

1 ,091,852, and #5: 946,028. ABySS was used to assemble the reads from. MiSeq.

Simpson, JX, . Wong, S.D. Jackraan, I.E. Sehein, SJ.M. Jones, and L Birol, ABySS; A parallel, assembler tor short read sequence data. Genome Research, 2009. 19(6): p, 1 1 17-1123. The result was visualized using Geneious. Homopoiymeric sequences and other problematic regions were manually sequenced using Sanger primer walking.

Whole-genome shotgun sequencing and read depth in duplicated region

Whole-genome shotgun sequencing of a soybean breeding line LD09-15087a, a near-isogenie line (NIL) that harbors rhgl~b from PI 887S8, was conducted using lilurmna technology. 1.5 u of genomic DNA was sequenced using the Il!umina HiSeq 2000 instrument with 1.00 bp paired-end sequencing at the University of Illinois

.Biotechnology Center. The DMA fragment size for the soybean whole-genome shotgun, sequencing library was 600 bp; the library was loaded onto one lane of a flow cell and sequenced using version 3 of sequencing kits and Casava 1.8 (pipeline 1,9). 312,909,668 reads (about 28 x coverage of the 1.1 gb soybean genome) were generated with all positions having average quality scores 30 or higher. To examine the depth of the coverage within the duplicated region, reads from the sequencing were aligned to the Glymal version of the soybean genome assembly. Novoalign (v 2.08.01;)

(http://www.novocraft.com) with paired end options (PE 600, 120) was used to align the reads to the reference genome. Approximately 95.1 % of reads were aligned to the reference sequence. The number of reads aligned to the target interval was counted from a BAM file using SAMtoois (v 0,1.18). Target interval is as follows: "Block" in Fig, 5B: a 31.2 kb region ( 1 ,632,225- 1 ,663,455 on chromosome 18), "Block- 1": the s me size region as region of interest upstream, and "Block-H": the same size region as region of interest downstream. Homeologous regions oo chromosome 11 ("Block" in Fig.5.B: 37,392,345-37,434,356 bp) and 2 ("Block": 47,772,323-47,791 ,521 bp) were identified using BLASTN. Analogous approaches were used with the soybean NAM parent sequence data. Table 5 shows the amino acid sequences for the four genes.

Table 5: Amino acid sequences for GrymaI8g2S80₅ Glynial8g259G, Giymal8g26O0 and

Glymal8g26^}0

>Giynmi¾02580J|PACid: 16307711 (SEQ ID NO: 1)

SPAAGVSVPLLGDS GTPPPASVPGAVF VATSIVGAGIMSIPAIMKVLGWPA

>GIyraal8g02590.1iPACid:16307712 (SEQ ID NO: 2)

.MADOLSKGEEFEkKAEK I,SGWGiJ¾SKYEDAA LFDKAANCFKLA SWDKA GAITL LASCHLKLES HEAAQAH DAAHCYKKTNINESVSCLD AVNLFCDIG RLS AARYL EIAELYEGEQNIEQALVYYE SADFFQNEEVTTSANQC QKVAQ FAAQLEQYQKSl IYEEiARQSL-NNNlJ.-KYGV GFIIl,NAGICQlX EDVVArFNA

LERYQELDPTFSGTREYRLLADIAAA1 EEDVA FTDVV EFDSMTPLDSW .TTL I V EKL AKELEEDDLT*

>Giymal 8g02610.1iPACid: 16307714 (SEQ ID NO: 3)

MR LTGDSAADNSF FVPOSIAAFGSTVlVEGCDSAR !iAWVFIAWTVTlX ITQ IREYFNTALTVTRIHDSGEIVPARSG

>G!ymai8g02600JiPACid: 1 307713 (SEQ ID NO: 4)

MVSVDDGIWPNDElE SNGSK EFASMDiSAfQKSYLNSEDPQRRLOGTLISSS lTviRlNFLKFGSASAKF^y RLATERDQVSiSVPSPRSKSLRSRFSGMFAQKED\VAS VK MCMEWIRNPVN AIJ^WKCVAW

FEV NQiLNAVF LIPNDISSLRKVY K VTYKPHEWTHMMVWILLHVNCFAQ YALCGENIXiYKRSERPAIGVGlGSFAIAGEYTIE^

SQG EQLRE PTE KYSFASKDQQRVVENRP WSGGIEDIWND1SLAYLSLFCTF CVLGWNMKRLGFGmiYVHIAlFMLFCMAPFWIFLLASV IDDDNVRQALAAVG IlLCFLGEI- C SFWRIQMRKRFNLPAYDFCFG PSASIXniAVEPCCWCSEAOEAR. TR f YDLVED FSR BTDTSDQPSISPLAREDVVSTRSGTSSPMGSTSNSSPY M KTSSSPNSSNVL GYYSPDKMLSTLNED CERGQDGTMNPLYAQK.* Fiber-FISe

Soybean nuclei were lysed to release large chromosomal segments and, in contrast to more standard FISH methods, the chromosome segments were decondensed to generate extended DNA fibers before fixing to microscope slides and hybridizing to lluorescently labeled DNA probes. Young leaf tissues were collected from fast growing _.plants of Williams 8.2, Peking, and Payette. Nuclei isolation, DNA fiber preparation, and fiber- FISH were performed following published protocols. Jackson, S.A., M.L. Wang, H.M. Goodman, and J. Jiang, Application of fiber-FISFl in physical mapping of

Arabidopsis thaliana. Genome, 1 98, 41(4): p. 566-72. A tosmid clone spanning an rhgJ-b repeat from PI 88788 was digested using the exonuelease Smai (New England Biolabs, Ipswich, MA). The products of the restriction digestion were separated in a 0.7% gel and isolated using the Qiaex II gel extraction kit (Qiagen, Valencia, CA). DNA probes were labeled with either biotin-16-UTP or digoxigenm-i 1-dlJTP (Roche

Diagnostics, Indianapolis, IN) using a standard nick translation reaction. The liber- FISH images were processed with Mela Imaging Series 7.5 software, The final contrast of the images was processed using Adobe Photoshop CS3 software. The eytological measurements of the fiber-FISH signals were converted into kilohases using a 3.21 kb/μηι conversion rate.

Traa script analysis

To confirm the annotation of transcripts at Rhgl, ra pid amplification of cDNA end (RACE) PGR was performed for Gfymal8g02580 (Table 4 95), Gfymal8g02590 (Table 4 87- 90) and Giyma!SgOMlO (Table 4 9 - 94) using the SMARTer RACE cDNA kit per manufacturer protocols (GonTech, Mountain View, CA). Following RACE, PCR products were TA cloned into pCR8/GW/TOPO as previously mentioned. Randomly chosen colonies were sequenced (Fable 4 76, 77) as described to confirm the 5' and 3' ends of individual transcripts. To detect potential transcript isofomis, northern analysis was conducted using standard methods. Probes were generated for

Gfymai8g0257() (Table 4 83, 84). Absence of truncated Giyma.l8g02570 transcripts (Table 4 85, 86) derived from 31 ,2 kb repeat junctions was also confirmed by PCR fi^*om cDNA, using a 2570 reverse primer and a forward prime in the most strongly predicted exon upstream of the repeat junction. Hebsgaard, S.M., P , orning, N. Tolstrup, 1. Engelbrecht, P. Rouze, and S, Br nak, Splice site prediction in Arahiefopsis thaliana pre- mRNA by combining local and global sequence information. Nucleic Acids Research, 1996. 24(1.7): p. 3439-3452. Transcript abundance studies using qPCR also indicated that there is not a Ghmai8g0257{)4ike transcript produced by the repealed DMA insertion. GIymaJ8g02570 transcript abundance was measured using primers (Table 425, 26) that amplify the final two exons and hence should amplify both the reference genome (full-length; Williams 82-1 ike) Gfyma 18 2570 transcript and possible hybrid

GlymalSg02S?i) transcripts that are transcribed from DNA thai spans the repeat junction, if the repeated DNA produced an alternative transcript, these primers would amplify additional product from genotypes with the repeat. However, no differences in transcript abundance were detected between SCN-resistant vs SCN-susceptihle varieties using

Glymal8g02S70 primers 25 and 26.

Protein structure prediction and comparison

The protein, structure for the predicted Glymal.8g02 10 gene product was modeled and proteins with the most homologous structures were identified using Fhyre2, with default settings. elley, L.A. and M.J.E. Sternberg, Protein, structure prediction on the Web: a case study using the Phyre server. Nature Protocols, 2009. (3): p. 363-371. Methylation Analysis

f ocus specific DNA methylation was analyzed using the methylation specific endonulease McrBC, or the methylation sensitive endonuclease Hpall followed by PCR. McrBC (New England Biolabs. Ipswich, MA) digests DNA with methylated cytosines in a sequence-independent manner while unmethylated DNA is not digested. Hpall (New England Biolabs, Ipswich, MA) digests DNA at the recognition sequence CCGG, but Hpall endonuclese activity is blocked by cytosine methylation. Restriction digestions were performed using 600-700ng of DNA and .manutactureris protocols. Control reactions were set up by adding the same amount of DNA to the reaction buffer with no restriction enzyme. Samples, with and without the restrictio enzyme, were incubated at ^'37°C for 90 minutes, and heat inactivated at 65 °C for 20 minutes. DNA was visualized in a 0.8% ethidium bromide stained gel. to ensure DNA digestion. Both digested and control DNA samples were used for subsequent PCR using GoTaq Flexi DNA

polymerase (Promega, Madison Wi). For DNA treated with McrBC, PCR primers that spanned methylated DNA would not produce the intended product following PGR because the template DNA would b digested by McrBC. DN A that was not methylated or not treated with the e zyme yielded a product of the expected size. For DNA treated with Hpall, PCR primers that spanned the DNA sequence CCGG in which either cytos ne was methylated yielded a PCR product of the expected size, DNA sequence CCGG that was not methylated was cleaved by Hpali and failed to yield a PGR product. DNA incubated in buffer without i-lpall yielded expected PCR. products. See table in Appendix F and figure for primer details and results.

Western Blot Analysis

Protein size and abundance were measured using Western blot and immunodetection procedures (Auaubel et at 1997). Briefly, protein was extracted from roots of transgenic soybeans by homogenizing frozen root tissue and re-suspending the material in 2% Tricine sample buffer (0.1M TrisCl/0,3%SDS pH6.8, 24% glycerol, S% SDS, 0.2M DTT) at :1. w/v ratio. Art equal volume of each, protein sample was separated in a Tris-Tricine polyaerylairnde gel (9,8% separation gel, 3,9% stacking gel) using electrophoresis in the Biora.d Mini Protean3 cassette (Biorad, Hercules CA). The samples are separated at 35 voks for roughly one hour, followed by another hour at 160 volts. The gel was moved to a transfer cassette and aqueous transferred to a Protran nitrocellulose membrane (Whatman, Fiscataway, Nil. The transfer was run for an hour at 80 volts at room temperature. Following transfer, membranes were stained for total, protein using ø.! % Ponceau S ( Sigma- Aldrieh, St, Louis, MO) in 5% acetic acid and .imaged. Ponceau S was tleslained in dd¾0, and the membrane was blocked over night at 4°C in TEST (20mM Ids pH7.5, 8g/L NaCI, 0,1% Tween) carrying 5% milk. New 5% milk in TBST was added to the membran and placed on shaker at room temperature for 30 minutes. The membrane was incubated with HA primar antibody directly conjugated to horse radish peroxidase (H P) at a ί : .!000 concentration in 5% milk TBST for 90 minutes. The membrane was washed 3x in TBST at room temperature on. a shaker for 20 minutes each. Super-signal West. Dura Extended Duration Substrate (Thermo Scientific, Waltham, MA) ECL kit was used following manufacture protocols to detect the H.A-H P antibody on the membrane. The memebrane was exposed to Cl-Xposure film (Thermo Scientific, Waltham, MA) and developed.

Claims

A method of increasing resistance of a plant to nematodes comprising increasing expression of, altering the expression pattern of or increasing the copy number of a polynucleotide encoding a Glymal 8g02580 polypeptide, a Glymal Sg02590 polypeptide, or a G!yraaI8g02610 polypeptide,- a

polypeptide having 90% or more identity to S Q IB NO: 1 (2580). SEQ ID NO: 2 (2590), SEQ ID NO: 3 (2610), SEQ ID NO: 5 (2590-88788), SEQ ID NO: 6 (2590-Feking) or homologs, functional variants or combinations of an of the aforementioned polypeptides in cells of the plant, wherein increased expression of the polynucleotide in cells of the plant increases the resistance of the plant to nematodes.

The method of claim 1 , wherein the expression is increased via genetic transformation of the plant.

The method of claim I or 2, wherein the plant is selected from soybean, sugar beets, potatoes, corn, peas and beans.

The method of any one of claims 1-3, wherein expression is increased in cel ls in the root of the plant.

The method of any one of claims 1 -4, wherei expression of the polypeptide i increased by increasing expression of the native polynucleotide.

The method of any one of claims 1 -4, wherein expression of the polypeptide is increased by introducing a construct comprising a promoter operably linked to a polynucleotide encoding the polypeptide into ceils of the plant.

The method of any one of claims 1-4, wherein expression of the polypeptide is increased by incorporation of a fransgene comprising a promoter operably linked to a polynucleotide encoding the polypeptide in the plant.

The method of any one of claims 1-4, wherein expression of the polypeptide is increased by introducing one or more copies of polynucleotide encoding at least two of a Glymal 8gQ2580 polypeptide, a Glymal 8g02590 polypeptide and a Glymal 8g02610 polypeptide.

3

9. The method of claim 8, wherein the copies are introduced in the RhgJ locus of the plant.

10. The method of any one of the preceding claims, wherein at least three copies of the polynucleotide are introduced in the plant,

11.. The method of any one of the preceding claims, wherein at least ten copies of the polynucleotide are introduced in the plant.

12. The method of any one of the preceding claims, wherein the expression of a Glymal8g02580 polypeptide, a Glyraal 8g02590 polypeptide and a

Glymal 8g02610 polypeptide are increased,

13. The method of any one of the preceding claims, further comprising increasing the expression of or altering the expression pattern of a polynucleotide encoding a Glyma 18g02600 polypeptide or a polypeptide having 90% or more identity to SEQ ID NO; 4 (02600),

14. The method of any one of the preceding claims, wherein the plant has

increased resistance to cyst nematodes, or soybean cyst nematodes (SCN) as compared to a control pi a t,

15. The method of claim 14, wherein increased resistance is measured by the plant having a lower percentage of invading nematodes that develop past the J2 stage, a lower rate of cyst formation on the roots, reduced nematode female index of a plant exposed, to nematodes, reduced SC egg production within cysts, reduced overall SCN^' egg production per plant, or greater yield of soybean seeds on a per~plant basis or a per-growmg-area basis as compared to a control plant grown in a similar growth environment.

16. The method of any one of claims 1 -15, wherein the nematode female inde of the plan t after exposure to nematodes is lower than that of a control plant.

17. The method of any one of claims 1-16, wherein sequences derived from

PI88788-, Ρ1437654-» or Peking-derived sources are used in place of the Williams 82 sequences provided in Table 5.

i 8. A construct comprising a promoter operab!y linked to a polynucleotide

encoding a Glyma i 8g02580 polypeptide comprising SEQ ID NO: 1, a Glymal 8g02590 polypeptide comprisin SEQ ID NO: 2, 5 or 6, a Glymal 8gO26I0 polypeptide comprising SEQ .ID NO: 3 or a polypeptide having at least 90% identity to SEQ ID NO: I, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID MO: 6, or a homolog or a .mnetiona! portion of any of the aforementioned polypeptides or combinations thereof.

19. The construct of claim 18, wherein the promoter is a plant promoter.

20. The construct of chum 18 or 19, wherein the polynucleotide encodes all three of the po Sypeptkles.

1. The construct of claim 18 or 1 , wherein the polynucleotide encodes at least two of the polypeptides.

22. The construct of any one of claims 1.8-21, wherein polynucleotide further encodes a Glymal 8g026 polypeptide.

23. A transgenic cell, comprising a polynucleotide encoding a polypeptide capable of increasing resistance to nematodes, the polypeptide having at least 90% identit to a Glymal 8g02580 polypeptide comprising SEQ ID NO: 1, a Glymal 8gO2590 polypeptide comprising SEQ ID NO: 2, 5 or 6, a

Glymal 8g0261 polypeptide comprising SEQ ID NO: 3 or a polypeptide having at least 90% identity to SEQ ID NO^* 1 , SEQ ID NO: 2, SEQ ID NO: 3_f SEQ ID NO; 5, SEQ ID NO: 6, or a oniolog or functional portion thereof or combinations thereof.

24. The transgenic cell of claim 23, wherein the polynucleotide encodes at least two of the polypeptides selected from Glymal 8g02610, Glymal 8g02590 and Glymal 8g02580.

25. The transgenic eel! of claim 23, wherein the polynucleotide encodes at least a Glym l8g02610 polypeptide, a Glymal 8 025 0 polypeptide and a

Glymal 8g02580 polypeptide.

26. The transgenic cell of any one of claims 23-25, wherein the polynucleotide i preseni in at least three copies in the plant.

27. The transgenic cel l of any one of claim 23-25, wherein the polynucleotide is preseni in at least ten copies in the plant.

28. The transgenic cell of any one of claims 23-27, wherein polynucleotide further encodes a Glymal 8g02600 polypeptide. The transgenic celt of any one of claims 23-28, wherein the plant is selected. from .soybean, sugar beets, po tatoes, com, peas and beans.

A seed comprising the transgenic cell of any one of claims 23-29.

A plant grown from, the seed of claim 30,

A transgenic plant comprising the cell of any one of claims 23-29.

A pari, progeny or asexual propagate of the transgenic plant of claim 32,

A .method of generating a transgenic plant with increased resistance to nematodes comprising introducing an. exogenous polynucleotide encoding a

Glyma 18gO25S0 polypeptide having at least 90% identity to SEQ I^'D NO: t ,

Glyma.l8g 2590 polypeptide having at least 90% identity t SEQ ID NO: 2, 5 or 6, or Glyma 18gO2610 polypeptide having at least 90% identity to SEQ ID

NO: 3, or a homoiog, functional variant or combinations thereof into a soybean plant eel! or progeny thereof, whereby expression of the polypeptide is increased in a..root cell of the soybean plant and whereby the plant has increased resistance to nematodes as compared to a control plant.

The method of claim 34, wherein, the polynucleotide encodes at least two of the polypeptides selected from Glyma i8g02610, GlymaI 8g0259 and

Glyma _8g02580

The method of claim 34, wherein the polynucleotide encodes at least a Glyma 18g02610 polypeptide, a. G!yma 18g02590 polypeptide and a

Glymai 8g02580 polypeptide.

The method of any one of claims 34-36, wherein polynucleotide former encodes a Glyma 18gO2600 polypeptide.

The method of any one of claims 34-37, wherein the polynucleotide is present, in at least three copies in the plant.

The method of any one of claims 34-37, wherein the polynucleotide is present in at least ten copies in the plant.

The method of any one of claims 34-38, wherein the plant is selected from soybean, sugar beets, potatoes, com, peas and beans.

A .method of screening a first plant cell for resistance or susceptibility to nematodes eo.mpri sing: detecting a genetic marker or selectable marker in the first plant cell, the genetic marker or the selectable marker associated with cyst nematode resistance or susceptibility to cyst nematodes;

and predicting the resistance or susceptibility of the first plant cell to nematodes,

42. The method of claim 41 , wherein the genetic marker is the methvlation stains of the promoter, upstream region or gene body of at least one of

Gfymal8g02610, Gfymal8g0259(h or Glymal 8g02580.

43. The method of claim 41 , wherein the genetic marker is the level of RMA

transcript, transcription or protein expression of at least one of

Gfy^' mal8g026l{K G!ymal8g0259Q Giym !8g02580 or G!ym l8g02600.

44. The method of claim 43, wherein the level is measured in root cells.

45. The method of claim 4.1, wherein the genetic marker is the genomic copy

number of at least one of Glymal 8g020.l0. Glymal 8g02390, Glymal 8g02S 80, Glymal 8g02600 or any portion of the 31.2 kb Rhgl region identified as being present in multiple copies in resistant varieties.

46. The method of claim 41, wherein the genetic marker is the genomic DN A

segment, carrying a repeat junction between Glymal 8g02610 and

Glymal 8g0257(l

47. The meihod of claim 41, wherein the genetic marker is the transcription, or expression level of at least one of Glymal 8gO2610, Glymal 8g92590,

Glymal 8g02600, or Giymal8g02580 after or upon contact with. a. nematode.

48. The method of claim 41 , wherein the genetic marker is a single nucleotide polymorphism in at least one of Glymal 8g02610, Glymal 8g02590_t

Gfymal 8g02580, Glymal 8g026(M) or within the 3.1.2 kb Rhgl repeat region.

49. The method of claim 41 , wherein the genetic marker is the presence or

absence of more than one copy of a. genomic region comprising at least one of Glymal 8g02600, Glymal 8g02610, Glymat8g02590. or Glymal 8gG2580.

50. The method of^" any one of 41-49, wherein the predicting step comprises

comparing the marker in the first plant cel.! to the marker in a second plant cell with a known resistance or susceptibility phenotype, wherein the phenotype of the second ceil is predictive of the phenotype in the first ceil

The method of any one of claims 1-50, wherein the second plant cell is SCN- resistant, is PI88788, Peking or carries an Rhgl locus derived from PI88788 or

Peking or other sources of Rhgl -mediated SCN resistance.

The method of any one of claims 41-51, wherein the second plant cell is SCN- suseeptible is 'Williams 82', 'Lee 84\ Essex or carries an Rhgl locus derived from 'Williams 82', *Lee 84', Essex or other varieties in which the Rhgl locus is less effective at mediatin SCN resistance than the Rhgl locus of PJ88788 or Pekine.

The method of any of claims 41-52, wherein the SCN is controlled by rhg!-h, is a Race 3 SCN, an SCN Hg Type lacking the "2" designation, in its Eg Type designation or an SCN Hg Type lacking the T^* designation in its Hg Type designation.

The method of any one of claims 41-53, wherein detecting comprises amplifying the marker or a portion of the marker to produce an amplified product and determining all or pari of the UNA sequence of the amplified product or assessing the marker using differential sensitivity to a restriction endotmclease, allele specific hybridization analysts, allele specific PGR, high density nucleotide array analysis, quantitative PCR, Northern blot analysis, micros ielKte analysis, ELISA or Western blot analysis.

The method of any one of claims 41-54. wherein the prediction is used to select resistant plant cells for use in developing resistant soybean lines.

The method of any one of claims 41-54, wherein the prediction is used to select resistant plant cells for use in developing resistant sugar beets, potatoes, com, peas or beans.

A method of increasing resistance of a plant to nematodes comprising expressing a polynucleotide encoding a Glymal 8gG2580 polypeptide of SEQ ID NO: 1 , a Glymal 8g02590 polypeptide of SEQ ID NO: 2, 5 or {>_> or a.

Glymal 8g0261.0 polypeptide of SEQ ID NO: 6, a -polypeptide having 90% or more identity to SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5 or SEQ ID NO: 6, or a ^'homoiog, a functional variant or combination of any of the aforementioned polypeptides in a cell,, and applying the polypeptide or a cell composing the polypeptide to the plant, seeds of the plant or soil in which the seeds may he planted, wherein the application increases the resistance of the plant to nema todes.

The method of claim 57, wherein the polynucleotide encodes at least two of a Glyma I8g()2610 polypeptide, a Glyma 18g02590 polypeptide, or a.

Glyma 18gO2580 polypeptide

The method of claim 57, wherein the polynucleotide encodes a

Giymal 8g 26I0 polypeptide, a Olymal8gG2590 polypeptide, and a

Glyma 18g025S0 polypeptide.

The method of any one of claims 57-59, wherein the .polynucleotide further encodes a Glyma 18g02600 polypeptide