WO2013168832A1

WO2013168832A1 - Analysis kit for high-risk human papillomavirus genes, and analysis method therefor

Info

Publication number: WO2013168832A1
Application number: PCT/KR2012/003588
Authority: WO
Inventors: 신지영; 신수경; 민경태; 조우재; 유왕돈; 김수옥; 홍선표; 김석준
Original assignee: (주)진매트릭스
Priority date: 2012-05-08
Filing date: 2012-05-08
Publication date: 2013-11-14

Abstract

The present invention relates to an analysis kit for high-risk human papillomavirus genes, and to an analysis method therefor. More specifically, the present invention relates to a method for simply and effectively analyzing high-risk human papillomavirus genes, and particularly relates to a kit and method for specifically detecting, from among the various types of papillomavirus genes, only those types of genes which are closely associated with cervical cancer and thus classified into a high-risk group.

Description

High Risk Human Papillomavirus Gene Analysis Kit and Analysis Method

The present invention relates to a kit for genetic analysis of high risk human papillomavirus and a method of analyzing the same, and more particularly, to a method for simple and effective analysis of high risk human papillomavirus, and is particularly classified as a high risk group because it is associated with cervical cancer among various genotypes of HPV. The present invention relates to a kit and a method for detecting only a specific genotype.

Cervical cancer is the second most common female cancer after breast cancer worldwide. Epidemiologic investigations have shown that cervical cancer is caused by human papillomavirus (HPV) infection, and HPV DNA has been detected in 99.7% of patients with cervical dysplasia and cervical cancer.

HPV proliferates in the nucleus and is found mainly in the cytoplasm in the form of episomes. The HPV genome is about 8 kb of double-stranded circular DNA, the open reading frame (ORF) that only differentiates with the E1, E2, E4, E5, E6, and E7 genes that act on its DNA replication and cell transformation. It consists of the L1 and L2 genes that only express epithelial cells to form capsid proteins. The classification of HPV genotypes is based on the similarity of DNA sequences, and if the sequences of E6, E7, L1 ORFs differ by more than 10% from the existing sequences, they are defined as new genotypes and show 90-98% similarity. Subtype, defined as a variant at or near 98%.

To date, about 100 HPV subtypes are known, of which about 40 subtypes are known to be associated with cervical cancer. HPV genotypes are classified into high risk group, probable high risk group and low risk group on the basis of patient / control comparative epidemiological studies. Genotypes belonging to the high-risk group with high incidence of invasive cervical cancer include

types

16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, and 82 and are established epidemiologically. Genotypes of 26, 53, and 66 genotypes, which have not been reported, but have been reported to be associated with the development of cervical cancer, are 6, 11, 40, 42, 43, 44, 54 for low-risk groups that are not associated with carcinogenesis. , 61, 70, 72, 81, and the like.

In the study of 426 women in Korea, HPV-positive cases were distributed in the order of 16, 52, 53, 62, 58, 81, 56, 66, 18, 44, and invasive squamous cervical cancer (SCC) patients. Of high-risk HPV were detected in 96.2% of patients and 86% of patients with high grade squamous intraepithelial lesions (HSIL). High-risk HPV infection occurs in the 10s and 20s with the onset of sexual life, and epithelial dysplasia occurs 10 years later and cervical cancer occurs in the 40s and 50s. In particular, the risk of developing cervical cancer in women with persistent high-risk HPV infections was 12-350 times higher, with the presence of specific high-risk HPVs detected continuously every six months.

In addition, the odds ratio of the high-risk HPV group and cervical cancer was 260.63, and the likelihood ratio of the high-risk and latent high-risk HPV group was 464.1, which supports why the high-risk HPV group should be included in the screening of cervical cancer. . However, current commercial high risk screening products do not include potential risk groups.

Because of the close association between HPV infection and cervical cancer and the high incidence of cervical cancer, screening tests for cervical cancer are considered to be very important. Screening tests can be divided into cytology and high-risk HPV DNA tests.

Liquid-based Pap smears can be used to observe the morphological changes of cells with the naked eye, thereby reconstructing the cytopathological stages of atypical squamous cells of undetermined significance (ASSCUS) and low grade squamous intraepithelial dysplasia. lesions (LSIL), high grade squamous intraepithelial lesions HSIL, and invasive squamous cervical cancer (SCC). This method has the advantages of economics and ease of examination, but because it is diagnosed by the shape of the cell, not only the objectivity of diagnosis is low, but also the false negative rate is high (15 ~ 45%), and the reproducibility and accuracy of the result are inferior. It is pointed out.

As the HPV DNA screening method, a hybrid capture method (Qiagen) method and a PCR method are known.

Hybrid capture (Qiagen) method is a method of detecting HPV using the hybridization reaction of the probe, which is convenient because there is no separate DNA extraction process, but it requires a large amount of DNA and shows a detection limit when the sample is small Because of the use of RNA probes (probe), the stability is low, considering the screening test equipment is expensive. In addition, false positives due to cross activity, which has been reported continuously since the release, has been pointed out as a big problem, and a probe detecting a high risk group may show false positives in response to HPV DNA rather than a high risk group.

The PCR detection method is a method for amplifying a small amount of DNA by producing oligomers that specifically react to HPV nucleic acid, which enables rapid, simple and large-scale testing, and has higher specificity than the cytogenetic method or hybrid capturing method. However, PCR detection methods have been reported to show differences in analytical sensitivity according to genotypes and reaction compositions and conditions, and amplification products can be obtained using commonly used PGMY11 / 09 and GP5 + / 6 + primer sets. If there is no separate genotyping process, it is not possible to determine whether HPV is a high risk group associated with cervical cancer. In addition, secondary PCR (nested PCR method) is used to improve the sensitivity at present, but since the two PCR processes require more time than the first PCR, the false positive rate may increase.

Therefore, by specifically detecting only high-risk groups that are highly related to cervical cancer, including potential high-risk groups, the practicality and utility of cervical cancer screening tests are increased, and at the same time, sensitive, accurate and reproducible testing methods are required.

The present invention has been made in view of the above-mentioned problems and the necessity of the above, and an object of the present invention is to identify high-risk HPV infected or potentially infected subjects with high sensitivity and specificity, which can be quickly and easily analyzed. It is to provide a method for detecting HPV high risk group.

Another object of the present invention is to provide a primer that specifically detects only genotypes of 18 high-risk human papillomaviruses highly associated with cervical cancer, and a kit comprising the same.

In order to achieve the above object, the present invention provides a primer pair for detecting HPV type 16 of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, or SEQ ID NO: 7 and 8; SEQ ID NO: 9 and 10, sequence Primer pairs for detecting HPV type 18 of SEQ ID NOs: 11 and 12, or SEQ ID NOs: 13 and 14; pairs of primers for detecting HPV type 31 of SEQ ID NOs: 15 and 16, SEQ ID NOs: 17 and 18, or SEQ ID NOs: 19 and 20; And primer pairs for detecting HPV type 33 of SEQ ID NOs: 23 and 24, or SEQ ID NOs: 25 and 26; primer pairs for detecting HPV type 35 of SEQ ID NOs: 27 and 28, SEQ ID NOs: 29 and 30, or SEQ ID NOs: 31 and 32; Primer pairs for detecting HPV type 39 of SEQ ID NOs: 33 and 34, SEQ ID NOs: 35 and 36, or SEQ ID NOs: 37 and 38; HPV 45 type of SEQ ID NOs: 39 and 40, SEQ ID NOs: 41 and 42, or SEQ ID NOs: 43 and 44; Primer pairs for detection; HPV 51 detection primers of SEQ ID NOs: 45 and 46, SEQ ID NOs: 47 and 48, or SEQ ID NOs: 49 and 50 Immer pair; primer pairs for detecting HPV type 52 of SEQ ID NOs: 51 and 52, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 55 and 56; HPV of SEQ ID NOs: 57 and 58, SEQ ID NOs: 59 and 60, or SEQ ID NOs: 61 and 62 56 pairs of primers for detection; SEQ ID NOs 63 and 64, SEQ ID NOs: 65 and 66, or HPV 58 primer pairs for SEQ ID NOs: 67 and 68; SEQ ID NOs: 69 and 70, SEQ ID NOs: 71 and 72, or SEQ ID NO: 73 And a pair of primers for detecting HPV 59 of 74; SEQ ID NOs: 75 and 76, SEQ ID NOs: 77 and 78, or a pair of primers for detecting HPV 68 of SEQ ID NOs: 79 and 80; SEQ ID NOs: 81 and 82, SEQ IDs 83 and 84, Or a pair of primers for detecting HPV type 73 of SEQ ID NOs: 85 and 86; a pair of primers for detecting HPV type 82 of SEQ ID NOs: 87 and 88, or SEQ ID NOs: 91 and 92, SEQ ID NOs: 93 and 94, or sequence Primer pair for detecting HPV 26 of SEQ ID NOs: 95 and 96; SEQ ID NOs: 97 and 98, SEQ ID NOs: 99 and 100, or SEQ ID NO: 101 One or more high risk human papillomavirus genes selected from the group consisting of a pair of primers for detecting HPV 53 of 102; and a pair of primers for detecting HPV 66 of SEQ ID NOs: 103 and 104, SEQ ID NOs: 105 and 106, or SEQ ID NOs: 107 and 108 Provide primer pairs.

In another aspect, the present invention provides a composition for detecting a high risk group HPV virus gene comprising the primer pair of the present invention.

In one embodiment of the invention, the composition is

HPV

16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, one selected for each HPV subtype of the primer pair of the present invention And combinations of 18 primer pairs for

types

68, 73, 82, 26, 53, and 66, but are not limited thereto.

In another embodiment of the present invention, the concentration of the

HPV

16, 51 and 26 type primer is

HPV

18, 33, 35, 39, 45, 52, 56, 58, 68 type , Twice the concentration of primers of type 73, 82, 53, and 66, the concentration of the

HPV

59 and 31 primer is the

HPV type

18, 33, 35, 39, 45, 52, 52 It is preferable that the concentration of the primers of

type

56, 58, 68, 73, 82, 53, and 66 is three times the concentration, but is not limited thereto.

In another aspect, the present invention provides a kit for detecting a high risk group HPV virus gene comprising the primer pair of the present invention.

In one embodiment of the present invention, the kit preferably further comprises a buffer, DNA polymerase, and dNTP, but is not limited thereto.

In another aspect, the present invention comprises the steps of obtaining a sample from the subject; And it provides a method for detecting a high risk group HPV gene comprising the step of detecting the polymerase chain reaction and high risk group HPV virus gene using the primer pair according to the present invention.

In one embodiment of the present invention, the annealing temperature in the polymerase chain reaction is preferably carried out at 65 to 70 ℃ but is not limited thereto.

Hereinafter, the present invention will be described.

The present invention is a

genotype

16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, genotype of HPV classified as high risk group, low risk group, high risk group associated with high incidence of invasive cervical cancer Provided are methods that can specifically detect 68, 73, 82, 26, 53, 66 type.

The high risk groups used in the present invention are 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, 82, 26, 53, including genotypes of HPV high risk group and latent high risk group. And 66.

High risk primer (HRP) used in the present invention refers to primers that specifically amplify the HPV high risk group.

Briefly describing the HPV high risk group detection method of the present invention, HPV

high risk groups

16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, 82, 26, 53, and 66 Genotypes can be analyzed quickly, simply, sensitively, accurately, and efficiently, with no detection of other genotypes, other viruses or other microorganisms, except HPV high risk. Using a mixture (HRP Mix), the reaction time is short to about 1 hour, it is a method of reaction at a high temperature of 65 ℃ or more.

The present invention to achieve the object described in the problem to be solved, a) amplifying a specific HPV nucleic acid using a primer that can select each genotype from the primers represented by SEQ ID NO: 1 ~ 108; b) providing a step of detecting the high-risk HPV DNA from the amplified reaction (PCR product).

The HRP used in the present invention has a nucleotide sequence that specifically amplifies only the HPV high risk group gene, and is characterized by a primer formulation that specifically hybridizes under stringent hybridization conditions.

In the present invention, after HRP multiple alignment of HPV genotype sequences, the HRP is not present in DNA viruses or microorganisms of humans or other species, and is characterized by having a sequence that exists only in 18 high-risk groups of HPV.

In the present invention, HRP is composed of 108 forward or reverse nucleotides, characterized in that the specific reaction at 65 ~ 70 ℃ sequencing, RFMP method, real-time polymerase chain reaction (Real- time PCR), HPV DNA chip can also be used or applied.

In general, primers used are designed to operate at 65 ° C. or lower, but the HRP used in the present invention is characterized by the arrangement of guanine and cytosine in the primer sequence and temperature of Tm (Melting Temperature). It is characterized by a special design above ℃.

The HPV high risk group detection kit of the present invention selects one primer set for each genotype among the primers of SEQ ID NOs: 1 to 108 and includes HRP Mix and DNA polymerase, dNTPs, and buffer containing 18 sets of primers in total. It features.

According to the HPV high risk group detection method of the present invention, the positive diagnosis rate is more effective than the conventional HPV high risk group detection method. Furthermore, given all of the HPV diagnoses detected in infected patients, it is a robust detection method with more sensitive, specific, and high throughput processing than conventional HPV high risk group assays.

1-1 to 1-18 of FIG. 1 shows annealing temperature by diluting 18 HPV plasmid DNA with TE (Tris-EDTA) buffer (including 1 ng / ml Human Genomic DNA) to find the optimum annealing temperature in HRP. After the polymerase reaction was carried out at 50 ℃, 55 ℃, 60 ℃, 65 ℃, 70 ℃, the amplified product was verified using an automatic electrophoresis equipment. Lane 1 is 50 ° C, lane 2 is 55 ° C, lane 3 is 60 ° C, lane 4 is 65 ° C, lane 5 is 70 ° C, lane 6 is a negative control and L represents the size marker. Also, 1-1 is 16, 1-2 is 18, 1-3 is 31, 1-4 is 33, 1-5 is 35, 1-6 is 39, 1-7 is 45 1-8 is 51, 1-9 is 52, 1-10 is 56, 1-11 is 58, 1-12 is 59, 1-14 is 73 and 1-14 is 73 , 1-15 is 82, 1-16 is 26, 1-17 is 53, and 1-18 is 66.

2a of FIG. 2 is a photograph of verifying an amplification product using an automated electrophoresis apparatus after producing a HRP mix at 0.05 μM, which is less than 0.2 μM to 0.5 μM of primer concentration used in a conventional polymerase reaction. . Where L is the size marker, lane 1 is 16, lane 2 is 18, lane 3 is 31, lane 4 is 33, lane 5 is 35, lane 6 is 39, lane 7 is 45, lane 8 51 type, lane 9 is 52 type, lane 10 is 56 type, lane 11 is 58 type, lane 12 is 59 type, lane 13 is 68 type, lane 14 is 73 type, lane 15 is 82 type, lane 16 is 26 type Type, lane 17 is type 53, lane 18 is type 66, Figure 2b is a HRP of 0.025μM at the same concentration of the sample diluted with 18 HPV plasmid DNA in PBS buffer (including 1ng / ml Human Genomic DNA) The results of the polymerase reaction using the Mix using the automatic electrophoresis equipment were verified photos. Where L is the size marker, lane 1 is 16, lane 2 is 18, lane 3 is 31, lane 4 is 33, lane 5 is 35, lane 6 is 39, lane 7 is 45, lane 8 51 type, lane 9 is 52 type, lane 10 is 56 type, lane 11 is 58 type, lane 12 is 59 type, lane 13 is 68 type, lane 14 is 73 type, lane 15 is 82 type, lane 16 is 26 type Type, lane 17 is type 53, lane 18 is type 66, and FIGS. 2C to 2G are samples prepared by diluting 18 HPV plasmid DNAs with PBS buffer (containing 1 ng / ml of human genomic DNA) in 10 steps. The amplification product was verified by the automated electrophoresis equipment by performing the polymerase reaction with the same concentration of 0.025μM HRP Mix. Among the 18 HPV genotypes, 5 kinds of sensitivity were significantly lower. 2c represents 16 type, 2d represents 31 type, 2e represents 51 type, 2f represents 59 type, and 2g represents 26 type. Lane 1 is also 5x10³ copies / PCR, lane 2 is 2.5x10³copies / PCR, lane 3 is 1x10³copies / PCR, lane 4 is 5x10²copies / PCR, lane 5 is 2.5x10²copies / PCR, lane 6 is 1x10² copies / PCR, lane 7 is 5x10^Onecopies / PCR, lane 8 is 2.5x10^Onecopies / PCR, lane 9 is 1x10^Onecopies / PCR, lane 10 is 1Represents copies / PCR.

3a to 3e of the three HPV genotypes of significantly lower sensitivity among the 18 kinds of HPV genotype HRP Mix was prepared by varying the magnification according to the genotype, 18 kinds of HPV plasmid DNA PBS buffer (1ng / ml of After the polymerase reaction was carried out using a sample diluted 10 consecutively with human genomic DNA), the amplification product was verified using automatic electrophoresis equipment. Among the 18 HPV genotypes, 16 and 31 types were significantly lower in sensitivity. , 51 type, 59 type, 26 type sensitivity is increased. 3a represents 16 type, 3b represents 31 type, 3c represents 51 type, 3d represents 59 type, and 3e represents 26 type. Lane 1 is also 5x10³ copies / PCR, lane 2 is 2.5x10³copies / PCR, lane 3 is 1x10³copies / PCR, lane 4 is 5x10²copies / PCR, lane 5 is 2.5x10²copies / PCR, lane 6 is 1x10² copies / PCR, lane 7 is 5x10^Onecopies / PCR, lane 8 is 2.5x10^Onecopies / PCR, lane 9 is 1x10^Onecopies / PCR, lane 10 is 1Represents copies / PCR.

4A of FIG. 4 is a method for determining HPV high risk group results. L is the size marker, lane 1 positive for HPV high risk group, lane 2 negative for HPV high risk group, and lane 3 did not show an internal control band, so DNA extraction failed or samples were insufficient. FIG. 4B is a spectrum of lane 1 shown in FIG. 4A, and FIG. 4C is a spectrum of lane 2 shown in FIG. 4A to determine positive or negative HPV high risk groups, respectively. FIG. 4D is a spectrum of lane 3 shown in FIG. 4A, and DNA sampling has failed or the sample is insufficient. Therefore, sampling should be repeated.

FIG. 5 shows

HPV

6, 11, 40, 42, 44, 54, 55, 61, 62, 67, 68, 70, 71, which were identified as low-risk HPV groups associated with the occurrence of carcinogenesis in the sequencing method.

Clinical samples

72, 74, 81, 83, 84, 86, 87, 89, and 102 were subjected to polymerase reaction using HRP Mix, and then the amplification products were verified using automatic electrophoresis equipment. Is a size marker and each lane represents genotypes identified as HPV low risk groups in the sequencing method, PC represents positive control, and NC represents negative control.

Figure 6 is a photograph of the amplification product verification using automatic electrophoresis equipment after the examination of 564 women who visited the obstetrics and gynecology department of Konkuk University Hospital. Only 21 of the 564 patients were shown, and all 21 patients showed the corresponding band at 520 bp, an amplification product of human-derived β-golbin, an internal control. The band appeared around 300bp, a high-risk amplification product. L is the size marker,

lanes

1, 2, 3, 5, 6, 9, 10, 11, 15, 16, 17, 20, 21 are considered HPV high risk groups, lanes 4, 7, 8, 12, 13, 14 , 18 and 19 were negative for HPV high risk group.

Hereinafter, the present invention will be described in more detail with reference to non-limiting examples. However, the following examples are intended to illustrate the present invention and the scope of the present invention is not limited by the following examples.

Example 1: Primer Design and Screening

HPV high risk groups known to be closely associated with causing human cervical cancer,

ie

16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, 82, 26 In order to design 18 pairs of primers capable of amplifying types 53 and 66, HPV genome sequences were obtained by NCBI GeneBank (Aceession No. HE798687, AJ388068, X66269, A25077, GQ161734, K02718, L22674, AF115831, M83860, M83862, S67066, L22664, M83882, EU918764, EF140814, AF404703, JF728187, FJ528600, X05015, AY262282, GQ180787, AY863152, FJ610150, GQ180791, U45889, HM596525, EF202153, U45893, M12732, DQ059013, AF54883753140 E140827 HQ537679, HM596539, EU911366, DQ241373, JN041158, HQ537677, HM596536, X05015, J04353, GU296036, EU911364, HQ537694, HQ537693, HQ537691, GU797245, GQ479014, EU73744, M12748 JN104070, U45902, M62849, EU911263, EF202167, EU911266, JN104069, U45903, U45916, M96309, M62877, HM596533, HV509953, EU779728, GQ472848, EF177181, EU779717, DQ003074, EF202166, EF202167, X74479, Y13218, GQ487711, AB438955, M62877, U45917, D90400, GU296060, GU296065, JN874436, HQ537743, X77858, D8000594 HQ537745, AB027021, U45920, GQ472849, EF546481, EF546480, DQ486475, JN393897, X74482, DQ007180, EF177176, HM585462, X74483, EF177179, X74472, X74482, X77858, U45930, U45932, EU911290 FJ4305 EF177189, U31794, AY147908, U12498, JN661514, EU918769, AJ831568, FR751040, U45934, GQ472851, DQ080079).

The sequence of the primer (HRP) for amplifying the high risk group HPV gene to be analyzed is as follows.

Table 1

HPV genotype	Primer Set Number	Sequence (5 '->3')	Estimated Size of Amplified Product (bp)	Sequence number
16 inch	Primer set 1	AAGGGGTCGGTGGACCGGTC	293	One
		TGTGTGCTTTGTACGCACAACCG		2
	Primer Set 2	CCCTGTTTTCCTGACCTGCACTGCT	302	3
		TCGGTTTGCACACACCCATGTGCA		4
	Primer Set 3	TGCAAGCAACAGTTACTGCGACGT	307	5
		GACCGGTCCACCGACCCCTT		6
	Primer Set 4	TAACAGCAGCCTCTGCGTTTAGGT	290	7
		AAAGTTGGGTAGCCGATGCACGT		8
18 inch	Primer Set 5	GGTGGTGCCAGCCTATAACATTTCA	299	9
		CCCTGTGACTTACACAGGTAGCGG		10
	Primer Set 6	CCGCTACCTGTGTAAGTCACAGGGG	300	11
		CACAGTGTCCAGGTCGTGTAGCAGC		12
	Primer Set 7	AAGTTGCGTGCAGGACAAAATCA	280	13
		TAGTTCCTCGCATGTGTCTTGCAGT		14
31 inch	Primer Set 8	CGACACACCACACGGAGTGTGTACA	310	15
		GCAACGTAGGTGTTTCTCCACGCAT		16
	Primer Set 9	CAACCTGAGGCAACTGACCTCCACT	301	17
		TGCATCCCGTCCCCTCCCCA		18
	Primer Set 10	ACTTGTTCCTACTTGTTCCTGCTCC	288	19
		GGCAAGGTGTGTTAGGCAGGAAACT		20
33 inch	Primer Set 11	ACAGGTTAAGGTTGTTGACCCTGC	318	21
		GGCACGGTGTGGTCTAAAGGCA		22
	Primer Set 12	GGCAATTTGGTTTAACACCTCCTCC	281	23
		GCGTTTTGCAGACGATGTGCG		24
	Primer Set 13	GGCTGGGATGGGGTGTACTGGTTGG	305	25
		ACGTTCTACACGGGTTTGCAGCACG		26
35 inch	Primer set 14	ACAGGTAGAGGGGCATGATACAGT	280	27
		ATGTTTAAAGTTCGCCACACTTGGG		28
	Primer Set 15	TACCAGACAGCGGTTATGGCAA	310	29
		GTTCGCCACACTTGGGGCTATT		30
	Primer Set 16	CTGTGGCGGTCTAACGAAGCCACT	300	31
		ACAGGCCCAAACCAAACGCTGGAG		32
39 inch	Primer set 17	ACGCAGTCACAGTTTCTGTCCA	291	33
		AGTTGCATACACCGAGTCCGAG		34
	Primer set 18	TGGGGTAAGGGAAAGGCATGCAAGC	305	35
		GCGTCACCCACCATACCACCACGAT		36
	Primer Set 19	GCCAATCGTGAAGGTACAGACGGG	292	37
		ACGGTCTAGTGTCGCCACTGCT		38
45 inch	Primer Set 20	CACGTCGACCCCCAAAACCGC	304	39
		ACCTGTCCAATGCCAGGTGGAGG		40
	Primer Set 21	TGCTGCAATGTCCCGCTTGTGCA	300	41
		TGCTGCACGGTGGGATACCATGGT		42
	Primer Set 22	GACGGGGAGGGAACGGGGTG	301	43
		CCGTCTCCACACTTAGCTGCTCCC		44
51 inch	Primer Set 23	TCTTTGTCTAGGCAGTTGCCCTCCT	300	45
		ACCTTGCTGTCATTAGTGCGCCA		46
	Primer set 24	AGGGGGCGGGGTGTAATGGG	315	47
		CGTTTGCCTGACTATGGCTGTGTGT		48
	Primer Set 25	TGCTGGCAACGTACACGACAACGT	302	49
		GCTGTACAACGCGAAGGGTGTCTCC		50
52 inch	Primer Set 26	CATGTGGGTGGTCGGGTAATTGT	300	51
		ACAAGTTGTATGTGCAACCCGTCC		52
	Primer Set 27	GCGACGGACCTTCGTACTCTACAGC	297	53
		ACAATGCCCGGGCTGCCTCA		54
	Primer set 28	AGCACTGCGACGGACCTTCGTACT	305	55
		AAACAATGCCCGGGCTGCCTCA		56
56 inch	Primer Set 29	CAGGTCCTGACATGGTGTTG	299	57
		GCAAGCAATCGTGAACTGCC		58
	Primer Set 30	GGCGCCGTAAACGTATTCCCT	322	59
		ACCGTTCCTGGTCCGGATT		60
	Primer Set 31	ATGGTGTTGCCTACAGGCCCCAGT	301	61
		GGGATGTCCTACGGCAAGCAATCGT		62
58 inch	Primer Set 32	TGAAGGTACAAACGGGGTAGGGGCG	301	63
		AGCCCGGTCCACACAGTCCTCTACA		64
	Primer Set 33	GGAGGTACATGTGGGTAGTCGGGT	280	65
		TTTAGAACTACACACGTTCCGCCC		66
	Primer Set 34	GCTGGCAGTTCCAGACTTTTGGC	320	67
		TCAGACCCTGGCTGTGCGGG		68
59 inch	Primer Set 35	TGGACACCCTTTCGCAGCGT	300	69
		GCCAAGAACTATGGCAAACAGCACC		70
	Primer 36	CGCAAGACGGATTGCGAGCCTTACA	300	71
		TAAACAAGGCCTGTGCTGTCTCGCG		72
	Primer Set 37	GGACACCCTTTCGCAGCGTT	318	73
		TGGACAATGCAAGAAACATGCCA		74
68 inch	Primer Set 38	AGGCCTGCCTTAACATCCCGAAGA	316	75
		TGGATGCAGCAGAAGCCAATGAAGG		76
	Primer Set 39	CCAATTGGCTGCACAAGGCACAAGG	304	77
		GGCGGAGGGGCAACACCAAAATTCC		78
	Primer Set 40	ACCAGGTGGTGCCGCCTGTAAACAT	305	79
		ACCCCAGTAATCCACACGCCCTTGG		80
73 inch	Primer Set 41	ACTGGTGATTGTCCCCCACTGGAAT	314	81
		GGTGTTGCAGTATTGCCTGTGCCTT		82
	Primer set 42	GCGCCTAGTATGGGCCTGTTCTG	281	83
		ATTCCAGTGGGGGACAATCACCA		84
	Primer Set 43	GGGGGTGGGCAAAGGTAGGTAGCA	304	85
		TCCGAGTCACACTGTCTTTGCCGT		86
82 inch	Primer 44	AGACATTACACCTTCCGCTGGTACA	288	87
		ACCTTAACCTGTGAAAATGCCCTGC		88
	Primer set 45	CACCTGCACCAGTGTCACGCATTGT	305	89
		GCCAACACCTAACGGCTGACCCCTA		90
26 inch	Primer set 46	GGCGGGGGTGTACAGGGTGGTT	301	91
		TGCTGACTGTCGCTTTGCTGTCTGT		92
	Primer set 47	AGTACTGTAGCACCTGACCCCGAT	301	93
		TGCGCGGCGTATGTATGCTAGG		94
	Primer Set 48	CGTGGACTTTAAACAAGAGGCGGAA	307	95
		TGACTGTCCGGGCTGTGTGG		96
53 inch	Primer set 49	GTTGCCCACCGGGCACGCAG	303	97
		TGAAGGGTCAGTGGGGCCTACCGA		98
	Primer Set 50	CCTCCATTTTGCCTTGCAACCG	299	99
		AGGTGCACACCTGGTTTACTAGACA		100
	Primer Set 51	TTGCAACCGGTTTCGGTTGTGC	308	101
		ACGGTTGCGGTGCATGAGTAATAGG		102
66 inch	Primer set 52	TGCAACGTGCACAGGGCCA	293	103
		TGCAACTGGTGGGGATAAGCCA		104
	Primer Set 53	AGGCCGAGGTCAACCTTTAGGTGCT	301	105
		TGCACCAAACCCGGTGTCCACCA		106
	Primer set 54	TGCAACGTGCACAGGGCCATA	295	107
		GTTGCAACTGGTGGGGATAAGCCAA		108

Table 1 is a table showing primer sequences and designs.

Example 2: HPV high risk group detection method

(1) Screening primers according to HPV genotype

The primers of Table 1 are primers capable of selectively amplifying type-specific HPV DNA by complementarily binding to specific types of HPV DNA through computer simulations, and thus all of the corresponding primers of Table 1 generate specific reactions. The same results are obtained using any of the primers for HPV genotypes indicated in.

For example, HRP Mix used in the present invention is HPV 16 type SEQ ID NO: 3 and 4, HPV 18 type 13, 14, HPV 31

type

17, 18, HPV 33 type 25, 26, 29 and 30 for HPV 35, 33 and 34 for HPV 39, 41 and 42 for HPV 45, 47 and 48 for HPV 51, 53 and 54 for HPV 52, HPV 56 Types 57, 58,

HPV

58, 67, 68,

HPV

59, 69, 70, HPV 68, 77, 78,

HPV

73, 83, 84, HPV 82, 89, 90 No. 93, 94 for HPV 26, 99, 100 for HPV 53, and 107, 108 for HPV 66 can complete the present invention.

(2) setting of polymerase reaction temperature

In order to find the optimum annealing temperature, 18 kinds of HPV genotype plasmid DNA were diluted in PBS buffer (containing 1 ng / ml of human genomic DNA) in the primer set used in the HRP Mix, and polymerized under the following conditions. Was performed.

Buffer solution 1x, MgSO ₄ 2 mM, dNTP 200 mM, DNA polymerase 0.5U, 0.4μM of primers for each of 18 HPV genotypes, 100ng each of the 18 HPV plasmid DNAs to be analyzed and total reaction volume Was adjusted to 20 μl.

5 minutes at 94 ° C,

94 ℃ 15 seconds 50 ~ 70 ℃ 30 seconds 72 ℃ 30 seconds (45 cycles),

72 ℃ 5 minutes

The final reaction solution was a multi-nano (MCE-202, Shimadzu) equipment and automated electrophoresis equipment and DNA-1000Kit capable of analyzing the size of 100bp-1,000bp. Prepare the separation buffer, which is a component of the kit, by mixing 62µl for each sample, 0.63µL of the fluorescent dye solution, 6.2µL of the marker solution, and 5µL of the PCR product, and confirm the PCR product according to the MultiNA user protocol. As shown in Figs. 1-1 to 1-18, the validity of the bands appearing in each lane of the photograph was determined to match the expected size of the amplification products of Table 1 above. Amplification products were formed in all lanes except negative control of all 18 HPV genotypes, and the size of the amplification products was the same as the expected size of Table 1, as shown in Table 2, 50 ℃, 55 depending on the genotype Nonspecific bands were observed at ℃ and 60 ° C, and no nonspecific bands were found in all genotypes at 65 ° C and 70 ° C.

TABLE 2

HPV genotype	Temperature
HPV genotype	50 ℃	55 ℃	60 ℃	65 ℃	70 ℃
16	O	X	X	X	X
18	O	O	O	X	X
31	O	O	O	X	X
33	O	O	O	X	X
35	O	O	X	X	X
39	O	O	O	X	X
45	O	O	O	X	X
51	O	O	O	X	X
52	O	O	O	X	X
56	O	O	O	X	X
58	O	O	O	X	X
59	O	O	O	X	X
68	O	O	X	X	X
73	O	X	X	X	X
82	O	O	X	X	X
26	O	O	O	X	X
53	O	O	O	X	X
66	O	O	X	X	X

Table 2 is a table showing the presence or absence of non-specific band generation with temperature.

Therefore, it is preferable to use from 65 degreeC to 70 degreeC by annealing temperature. Subsequent polymerase reactions were designated as 94 ° C 5 minutes, 94 ° C 15 seconds-65 ° C 30 seconds-72 ° C 30 seconds (45 cycles), and 72 ° C 5 minutes.

(2) setting of polymerase reaction product conditions

In order to determine the proper concentration of HRP Mix for detecting all 18 genotypes, HRP Mix was prepared with each primer as 0.05 μM lower than 0.2 μM to 0.5 μM, the primer concentration used in the existing polymerase reaction. The template was diluted with 18 HPV plasmid DNA in PBS buffer (including 1 ng / ml Human Genomic DNA).

Buffer 1x, MgSO ₄ 2 mM, dNTP 200 mM, DNA polymerase 0.5U, HRP Mix 1μM, 100ng HPV DNA to be analyzed was added, the total reaction volume was adjusted to 20μL. And the polymerase reaction was performed under the following conditions.

5 minutes at 94 ° C,

94 ℃ 15 seconds 65 ℃ 30 seconds 72 ℃ 30 seconds (45 cycles),

72 ℃ 5 minutes

The final reaction solution was identified by PCR using MultiNA (MCE-202, Shimadzu) (Fig. 2a). As shown in Figure 2a, amplification products were formed in all lanes of the 18 HPV genotypes, and the size of the amplification products was approximately 300 bp, which is consistent with the expected size of the amplification products of Table 1 above, but with non-specific products. It confirmed that it appeared.

Therefore, in order to improve the specificity of the detection method of the present invention, the HRP Mix was reduced from 0.05 μM to 1/2, 1/4, 1/5, 1/10, and the concentration of HRP Mix was measured as described above. It was confirmed that the non-specific product disappeared at 0.025 μM without decreasing the DNA amplification amount of 18 HPV high risk groups. (Fig. 2b) In the HRP Mix at a concentration lower than 0.025μM, although the same concentration of HPV DNA was used, it was confirmed that the DNA amplification amount of the 18 high HPV risk groups was reduced, so it is not preferable to use the HRP Mix lower than 0.025μM. It was judged not. In addition, since the HPV sample uses cells collected from the human cervix, an experimental control group (internal control) capable of confirming that the DNA extraction failed or the amount of the sample was insufficient was amplified by adding to the HRP Mix.

The internal control primer consists of a Forward 5'-AGGGAGGGCAGGAGCCAGGG-3 '(SEQ ID NO: 109) nucleotide and a reverse 5'-CGTGCAGCTTGTCACAGTGCAGC -3' (SEQ ID NO: 110) nucleotide.

The experimental control (internal control) is a primer that can detect human-derived β-golbin, the amplification product is 520bp, and if the band does not appear, it means that DNA extraction failed or the sample was insufficient.

As shown in Figure 2b, amplification products were formed in all lanes of 18 HPV genotypes, and the size of the amplification products was approximately 300 bp, which is consistent with the prediction result of Table 1 above. In particular, in each lane of every picture, no band was found that was difficult to distinguish from the effective band.

Samples of 10 consecutive serial dilutions of the 18 HPV plasmid DNAs with PBS buffer (including 1 ng / ml of human genomic DNA) (5000, 2500, 1000, 500, 250, 100, 50, 25, 10, 1 copies / PCR) As a result of performing the polymerase reaction with the same concentration of HRP Mix of 0.025μM using the same), 18, 33, 35, 39, 45, 52, 18 out of 18 HPV genotypes as shown in Figure 2c-2g In case of 56, 58, 68, 73, 82, 53 and 66, the sensitivity was less than 300copies / PCR, but in the case of 16, 31, 51, 59 and 26 It was confirmed that the detection capability was remarkably low. (FIGS. 2C-2G)

Therefore, in order to maintain the sensitivity of less than 300copies / PCR in all 18 HPV genotypes, the primer concentrations of 16, 31, 51, 59, and 26 in the HRP Mix were increased by 2, 3, and 4 times, respectively. As a result of performing the polymerase reaction in the same manner as described above, primer sets 2, 24 and 47 were doubled (0.05μM) and primer sets 9 and 35 were tripled (0.075μM). When the HRP Mix was prepared, it was confirmed that all 18 HPV genotypes showed a sensitivity of less than 300copies / PCR. As shown in Figs. 3a to 3e, 18 HPV genotypes including 5 species having low sensitivity in Figs. 2c to 2g formed amplification products at less than 300copies / PCR, and the amplification products were approximately 300bp. It was consistent with the expected size of the amplification product of 1. In particular, in each lane of every picture, no bands were found that were difficult to distinguish from the effective bands. This fact indicates that the sensitivity and specificity of the method according to the HPV genotype did not drop at all compared to the conventional hybrid capturing method. I confirmed the fact.

(3) Result judgment method

The result of the method of the present invention was determined using the multi-nano (MCE-202, Shimadzu) equipment of the automated electrophoresis equipment and DNA-1000Kit capable of analyzing the size of 100bp-1,000bp. Prepare the separation buffer, which is a component of the kit, by mixing 62µl for each sample, 0.63µL of the fluorescent dye solution, 6.2µL of the marker solution, and 5µL of the PCR product, and confirm the PCR product according to the MultiNA user protocol. do. The validity of the band or spectrum appearing in each lane of the photograph is determined as the HPV high risk group when the corresponding band or spectrum of about 300 bp, which is the expected size of the PCR product of Table 1, is determined (lane 1 of FIG. 4a or 4b). If the band or spectrum does not appear, it is not HPV high risk group or HPV negative (lane 2 or 4c in Figure 4a). In addition, if the band or spectrum does not appear in the 520bp amplification product of human-derived β-golbin, an internal control, it means that the DNA extraction failed or the sample was insufficient. (Lane 3 in FIG. 4a or 4d)

Experimental Example 1: Minimum Detection Limit

In the methods established in Examples 1 and 2, 18 HPV plasmid DNAs were serially diluted in PBS buffer (containing 1 ng / ml of human genomic DNA) for 10 steps and then repeated 20 times.

Table 3 shows the minimum detection limit of 16 HPV genotypes with repeated 16 test results.

TABLE 3

Table 3 shows the HPV Type 16 minimum detection limit.

When all 18 HPV genotypes were repeatedly tested in the same manner as described above, a concentration of 95% or more positive results for each genotype was set as the minimum detection limit and analyzed through probit analysis. The minimum detection limit was less than 300copies / PCR in all 18 high-risk HPV groups as shown in Table 4 below.

Table 4

HPV genotype	Minimum detection limit (copy number / PCR) according to the method of the present invention
16	26.91 (95% CI: 14.93-70.33)
18	78.48 (95% CI: 46.23-183.02)
31	42.78 (95% CI: 28.78-93.90)
33	49.63 (95% CI: 27.87-129.93)
35	58.75 (95% CI: 43.10-104.86)
39	57.35 (95% CI: 40.43-113.18)
45	72.84 (95% CI: 48.74-157.48)
51	91.46 (95% CI: 56.81-207.41)
52	34.24 (95% CI: 18.58-92.57)
56	134.10 (95% CI: 91.38-265.27)
58	50.97 (95% CI: 28.96-125.43)
59	129.74 (95% CI: 93.70-238.61)
68	40.20 (95% CI: 22.51-101.79)
73	57.48 (95% CI: 33.66-134.86)
82	83.67 (95% CI: 54.40-186.06)
26	259.80 (95% CI: 178.36-496-21)
53	173.56 (95% CI: 121.97-327.87)
66	36.77 (95% CI: 20.54-93.75)

Table 4 shows the minimum detection limit according to the HPV genotype.

Therefore, it was confirmed that the detection method of HPV high risk group according to the present invention is 10 times more sensitive than the conventional method of Hybrid Capture 2 in analyzing HPV high risk group (Lorincz, AT Hybrid Capture ^TM method for detection of human papillomavirus DNA). in clinical specimens: a tool for clinical management of equivocal Pap smears and for population screening.J. Obstet.Gynaecol.Res. 1996a; 22 (6): 629-636.)

Experimental Example 2: Specificity of the Method of the Invention

HPV

6, 11, 40, 42, 44, 54, 55, 61, 62, 67, 69, 70, 71, 72, 74 identified as low-risk HPV groups with less carcinogenesis in the sequencing method , 81, 83, 84, 86, 87, 89, 102 clinical polymerase reaction was carried out by the method established in Examples 1 and 2.

As shown in Table 5, HPV high-risk genotype was not amplified in all 22 genotypes identified as low-risk HPV by sequencing (FIG. 5).

Table 5

Table 5 is a table verifying the specificity of the method of the present invention.

Therefore, in the analysis of HPV high risk group, a probe detecting a high risk group may show false positives in response to HPV DNA rather than a high risk group in the hybrid capture 2, whereas the detection method according to the present invention detects only a high risk group of HPV. It was confirmed that the false positives due to the crossover error did not appear.

Experimental Example 3: Comparison of Clinical Effectiveness of the Invention Method and Conventional Method

In this experimental example, the hybrid capture 2 and sequencing detection methods of the present invention and the conventional methods were performed in human clinical samples to confirm the effectiveness in the clinical practice of the present invention.

First of all, women who visited the department of obstetrics and gynecology at Konkuk University Hospital were subjected to specialized examinations such as tissue biopsy and pap-smear under the responsibility of the clinician in charge. In this comparative example, a total of 564 patients were included, 75 cervical intraepithelial neoplasis (CIN), 13 epithelial adenocarcinomas (adenocarcinoma in situ, ACIS), 5 cervical cancers, and 471 cervical cancers. Irrelevant normal findings were received.

Thirty-nine patients diagnosed as being associated with cervical cancer and 471 unrelated cervical cancer based on the results of histological biopsy and smear smear, hybrid capturing2, sequencing, and high risk human papillomavirus by the method of the present invention. Inspection was carried out.

564 women who visited the department of obstetrics and gynecology at Konkuk University Hospital were shown in FIG. 6 only 21 results. As shown, in all 21 patients, the band appeared in 520 bp, an amplification product of human-derived β-golbin, which is an internal control, and was found around 300 bp of HPV high-risk amplification product, which may be the result of the present method. The band appeared.

Lanes

1, 2, 3, 5, 6, 9, 10, 11, 15, 16, 17, 20, and 21 are considered HPV high risk groups, and lanes 4, 7, 8, 12, 13, 14, 18, and 19 are HPV high risk group negative.

As a result, hybrid capture 2, a conventional method, has a sensitivity of 81.3%, a specificity of 73.5%, a positive predictive value of 15.6%, and a negative predictive value of 98.5%, and the sequencing method has a sensitivity of 93.8%, a specificity of 73.7%, and a positive predictive value of 17.7%. And 99.5% of the voice predictions were confirmed. The method of the present invention confirmed sensitivity 93.8%, specificity 73.3%, positive predictive value 17.4%, and negative predictive value 99.5%. It was confirmed that the high-risk human papillomavirus detection method according to the present invention is clinically identical to the sequencing method used as a reference method as a conventional technique, and has better clinical performance than HybridCapture 2, which is widely used in clinical practice. Table 6

Table 6

Table 6 is a table comparing the clinical effectiveness of the conventional method and the method according to the present invention.

Experimental Example 4: Comparison of Concordance Between the Invention Method and the Conventional Method

In this Experimental Example, the three high-risk human papillomavirus detection methods were performed using clinical specimens of Experimental Example 3 to confirm the concordance rate between the present invention method and the conventional method of Hybrid Capture 2 and sequencing.

As a result, of the 172 positive samples in the method of the present invention, 131 hybrid capture 2 positive samples and 41 negative samples of the conventional method, 36 hybrid capture 2 positive samples and 356 negative samples of the 392 method negative samples of the present invention were 86.3. The agreement of% (κ = 0.68) was confirmed.

In addition, among the 170 positive samples in the conventional method, 130 hybrid capture 2 positive samples and 40 negative samples of the conventional method, 37 hybrid capture 2 positive samples and 357 of the 394 negative sequences of the conventional method The concordance of 86.3% (κ = 0.67) was confirmed with the dog.

Finally, out of 172 positive samples in the method of the present invention, 165 positive and sequential samples of the conventional method and 7 negative samples, 5 sequencing positive samples and 387 of the 392 method negative samples of the present invention were 97.9. High concordance of% (κ = 0.95) was confirmed. Table 7

TABLE 7

Table 7 is a table comparing the experiments between the method of the present invention and the conventional method.

Experimental Example 5: Confirming the inconsistency between the method of the present invention and the conventional method

This experimental example is a genotype of human papillomavirus in order to identify the cause of the inconsistency between the hybrid capture 2 and the sequencing method and the method of the present invention and the method and the sequencing method, which showed 2.1% inconsistency in the experimental example 4 and 2.1% inconsistency. The analysis was performed.

Inconsistencies identified in Experimental Example 4 Seven method positive and sequencing negative samples of the present invention and five method negative and sequencing positive samples of the present invention were identified. As a result, four low risk groups and unknown risk groups were identified among seven method positive and sequencing negative samples of the present invention, and the other three did not identify human papillomavirus. In addition, five high risk groups were identified in the method negative and sequencing positive samples of the present invention.

In addition, 37 hybridcaptures2 positiveAnd sequence negative samples, 40 hybridCapture2 negativesAnd human papillomavirus genotypes of sequencing positive samples. As a result, hybrid capture 2 positiveEleven low-risk and unknown risk groups and four high-risk groups of the sequencing negative samples were identified, and the remaining 21 did not identify human papillomaviruses. In addition, 39 of 40 hybridcapture2 negative and sequencing positive samples were identified as high risk and one low risk, and one did not identify human papillomavirus.

Finally, the human papillomavirus genotypes of 36 inconsistent hybridcapture2 positive and method negative samples of the present invention and 41 hybridcapture2 negative and method positive samples of the present invention were identified. As a result, eleven low-risk and unknown risk groups and four high-risk groups of 36 hybridcapture2 positive and method negative samples of the present invention were identified, and the remaining 21 did not identify human papillomaviruses. In addition, 39 of 41 hybridcapture2 negative and method positive samples of the present invention were identified as high-risk, 1 low-risk, and one did not identify human papillomavirus. It was confirmed that the high-risk human papillomavirus detection method according to the present invention can be used as a part of correcting the nonspecific binding error of the conventional method, HybridCapture 2. Table 8

Table 8

Table 8 is a table confirming the inconsistency between the method of the present invention and the conventional method.

Claims

Primer pairs for detecting HPV Type 16 of SEQ ID NO: 1 and 2, SEQ ID NO: 3 and 4, SEQ ID NO: 5 and 6, or SEQ ID NO: 7 and 8;

Primer pairs for detecting HPV Type 18 of SEQ ID NOs: 9 and 10, SEQ ID NOs: 11 and 12, or SEQ ID NOs: 13 and 14;

Primer pairs for detecting HPV 31 of SEQ ID NOs: 15 and 16, SEQ ID NOs: 17 and 18, or SEQ ID NOs: 19 and 20;

Primer pairs for detecting HPV Type 33 of SEQ ID NOs: 21 and 22, SEQ ID NOs: 23 and 24, or SEQ ID NOs: 25 and 26;

Primer pairs for detecting HPV 35 of SEQ ID NOs: 27 and 28, SEQ ID NOs: 29 and 30, or SEQ ID NOs: 31 and 32;

Primer pairs for detecting HPV Type 39 of SEQ ID NOs: 33 and 34, SEQ ID NOs: 35 and 36, or SEQ ID NOs: 37 and 38;

Primer pairs for detecting HPV 45 of SEQ ID NOs: 39 and 40, SEQ ID NOs: 41 and 42, or SEQ ID NOs: 43 and 44;

Primer pairs for detecting HPV type 51 of SEQ ID NOs: 45 and 46, SEQ ID NOs: 47 and 48, or SEQ ID NOs: 49 and 50;

Primer pairs for detecting HPV type 52 of SEQ ID NOs: 51 and 52, SEQ ID NOs: 53 and 54, or SEQ ID NOs: 55 and 56;

Primer pair for detecting HPV 56 of SEQ ID NOs: 57 and 58, SEQ ID NOs: 59 and 60, or SEQ ID NOs: 61 and 62;

Primer pairs for detecting HPV Type 58 of SEQ ID NOs: 63 and 64, SEQ ID NOs: 65 and 66, or SEQ ID NOs: 67 and 68;

Primer pairs for detecting HPV Type 59 of SEQ ID NOs: 69 and 70, SEQ ID NOs: 71 and 72, or SEQ ID NOs: 73 and 74;

Primer pairs for detecting HPV 68 of SEQ ID NOs: 75 and 76, SEQ ID NOs: 77 and 78, or SEQ ID NOs: 79 and 80;

Primer pairs for detecting HPV 73 of SEQ ID NOs: 81 and 82, SEQ ID NOs: 83 and 84, or SEQ ID NOs: 85 and 86;

Primer pairs for detecting HPV Type 82 of SEQ ID NOs: 87 and 88, or SEQ ID NOs: 89 and 90;

Primer pairs for detecting HPV 26 of SEQ ID NOs: 91 and 92, SEQ ID NOs: 93 and 94, or SEQ ID NOs: 95 and 96;

A primer pair for detecting HPV 53 of SEQ ID NOs: 97 and 98, SEQ ID NOs: 99 and 100, or SEQ ID NOs: 101 and 102; and

At least one high risk human papillomavirus gene analysis primer pair selected from the group consisting of SEQ ID NOs: 103 and 104, SEQ ID NOs: 105 and 106, or pairs of HPV 66 detection primers of SEQ ID NOs: 107 and 108;
Composition for detecting a high risk human papillomavirus gene comprising a primer pair of claim 1.
According to claim 2, wherein the composition is HPV 16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 68, 73, one selected for each HPV subtype of the primer pair of claim 1 , 82, 26, 53, and 66 high-risk human papillomavirus gene detection composition comprising a combination of 18 primer pairs for type 66.
According to claim 3, wherein the concentration of the HPV 16, 51 and 26 primers are HPV 18, 33, 35, 39, 45, 52, 56, 58, 68, 73 type , Twice the concentration of primers of type 82, 53, and 66, the concentration of the HPV 59 and 31 primer is the HPV type 18, 33, 35, 39, 45, 52, 56 A composition for detecting a high risk human papillomavirus gene, characterized in that three times the concentration of the primers of the type, 58, 68, 73, 82, 53, and 66.
High-risk human papillomavirus gene detection kit comprising a primer pair of claim 1.
The kit of claim 5, wherein the kit further comprises a buffer solution, a DNA polymerase, dNTP, a nucleic acid stain, and sterile distilled water.
Obtaining a sample from the subject; And

A method for detecting a high risk human papillomavirus gene comprising a polymerase chain reaction using a primer pair according to claim 1 and detecting a high risk human papillomavirus gene.
The method of claim 7, wherein the annealing temperature in the polymerase chain reaction is performed at 65 to 70 ° C. 9.