WO2013166264A2 - Methods for altering virus replication - Google Patents
Methods for altering virus replication Download PDFInfo
- Publication number
- WO2013166264A2 WO2013166264A2 PCT/US2013/039234 US2013039234W WO2013166264A2 WO 2013166264 A2 WO2013166264 A2 WO 2013166264A2 US 2013039234 W US2013039234 W US 2013039234W WO 2013166264 A2 WO2013166264 A2 WO 2013166264A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- mir
- cell
- virus
- polynucleotide
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
- C12N2310/141—MicroRNAs, miRNAs
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/11—Applications; Uses in screening processes for the determination of target sites, i.e. of active nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
- C12N2320/12—Applications; Uses in screening processes in functional genomics, i.e. for the determination of gene function
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/16011—Orthomyxoviridae
- C12N2760/16111—Influenzavirus A, i.e. influenza A virus
- C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
Definitions
- Influenza A viruses generally cause seasonal epidemics; however, they have the potential to cause pandemics associated with substantial morbidity and mortality (Kandel and Hartshorn 2001, BioDrags 15:303-323, Thompson et al., 2003, JAMA 289:179-186). Development of seasonal vaccines is required for influenza virus due to high viral mutation rates that lead to antigenic drift, and also because of periodic antigenic shift which can render vaccines less or ineffective (Hale et al., 2008, J Gen Virol 89:2359-2376).
- antiviral drugs that have proven efficacy in the treatment of influenza infections: two M2 ion channel inhibitors (amantadine and rimantadine) and several neuraminidase inhibitors (including zamamivir and oseltamivir) (Basler 2007, Infect Disord Drug Targets 7:282-293, Betakova 2007, Curr Pharm Des 13:3231-3235, Hsieh et al., 2007, Curr Pharm Des 13:3531-3542, Jefferson et al., Cochrane Database Syst Rev.
- antiviral drug use may come with unwelcome effects that could include an increase in population vulnerability due to lack of seroconversion, as well as driving drug resistance among circulating strains (Conly and Johnston 2006, Can J Infect Dis Med Microbiol 17: 11-14).
- RNA interference RNA interference
- RNAi is an efficient mechanism for the sequence-specific inhibition of gene expression (Leung et al., 2005, Pharmacol Ther 107:222-239, Tripp and Tompkins 2009, Methods Mol Biol 555:43-61), and is mediated by small interfering RNAs (siRNA) incorporated in the RNA-induced silencing complex (RISC) where the antisense or guide strand of the siRNA can suppress protein expression or direct degradation of messenger RNAs that contain homologous sequences (Haasnoot et al., 2007, Nat Biotechnol 25:1435-1443, Kim et al, 2007, Nat Rev Genet 8:173-184, Wiznerowicz et al, Nat Methods 3:682-688).
- siRNA small interfering RNAs
- RISC RNA-induced silencing complex
- siRNAs can be readily developed to target viral or host genes and have been successfully applied in disease intervention approaches. For example, siRNA targeting respiratory syncytial virus has shown efficacy for silencing virus replication (Alvarez et al.,
- RNAi screens employed genome-wide RNAi screens to identify host genes required for influenza virus infection and replication (Konig et al., 2009, Nature 463:813- 817, Brass et al, 2009, Cell 139:1243-1254, Hao et al., 2008, Nature 454:890-893, Karlas et al, 2010, Nature, Shapira et al., 2009, Cell 139:1255-1267, and genes have also been identified by random homozygous gene perturbation (Sui et al, 2009, Virology 387:473-481) and by a proteomic screen (Bradel-Tretheway et al., 2011, Journal of Virology 85:8569-8581).
- influenza virus was co-opting many of the same host cell pathways (Konig et al., 2009, Nature 463:813- 817, Brass et al., 2009, Cell 139:1243-1254, Hao et al., 2008, Nature 454:890-893, Karlas et al, 2010, Nature, Shapira et al, 2009, Cell 139:1255-1267).
- proteases and kinases are important for infection and replication. Proteases may affect virus infection and replication in several ways including viral entry and hemagglutinin (HA) processing (Bottcher et al., 2009, Vaccine
- HPKs human protein kinases
- PKC protein kinase C
- ERK extracellular signal-regulated kinase ERK
- PI3K phosphatidylinositol-3 kinase
- NF- ⁇ a key mediator, is induced by accumulation of viral HA, NP and Ml proteins ( Wurzer et al., 2004, J Biol Chem 279: 30931-30937, Wei et al., 2006, J Biol Chem 281 : 11678-11684, Wang et al., 2000, J Virol 74: 11566-11573, Pinto et al., 2011, Antiviral Res 92: 45-56, Pauli et al, 2008, PLoS Pathog 4: el000196, Pahl and Baeuerle, 1995, J Virol 69: 1480-1484, Nimmerjahn et al., 2004, J Gen Virol 85: 2347-2356, Ludwig and Planz, 2008, Biol Chem 389: 1307-1312, Kumar et al, 2008, J Virol 82: 9880-9889, Flory et al., 2000, J Biol Chem 275: 8307-8314).
- miRNAs are similar to siRNAs in their silencing mechanism, but miRNAs are generated in the nucleus from short haiipin precursors and must be processed and exported before entering the RISC pathway (Carthew et al., 2009, Cell 136:642-655).
- miRNAs can be generated by the virus (Pfeffer et al., 2004, Science 304:734-736, Grundhoff et al., Virology 411 :325-343) or the host and can silence genes by similar mechanisms to siRNAs; however, unlike siRNA silencing, miRNA sequences do not need to be homologous to the target mRNA (Carthew et al., 2009, Cell 136:642-655).
- Viruses are obligate parasites, requiring a host cell to reproduce and spread. Viruses also encode miRNAs to regulate host genes and viral replication. During viral infection, host and viral miRNAs can regulate synergistically affect viral replication; however, most host cell encoded miRNAS are expressed to govern or limit virus replication. Utilizing a RNA
- a method for decreasing viral replication in a cell includes administering to a cell, such as a human cell, an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a protease or a kinase endogenous to the cell.
- the cell includes a virus or is at risk of infection by a virus, where the virus is selected from a member of the family Orthomyxoviridae or a member of the family Paramyxoviridae.
- the virus is selected from a member of the family Orthomyxoviridae
- the protease may be selected from an ADAMTS7 polypeptide, a CPE polypeptide, a DPP3 polypeptide, a MST1 polypeptide, a
- the virus is selected from a member of the family Orthomyxoviridae, and wherein the kinase may be selected from a CDK13 polypeptide, a HK2 polypeptide, a NEK8 polypeptide, a PANK4 polypeptide, a PLK4 polypeptide, a SGK3 polypeptide, or a combination thereof.
- a method for decreasing viral replication in a cell includes administering to a cell, such as a human cell, an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell, and the cell includes a virus or is at risk of infection by a virus.
- the virus may be selected from a member of the family Orthomyxoviridae
- the polypeptide may be selected from a PPARA polypeptide, a RIF1 polypeptide, a P4HA1 polypeptide, a GRIA4 polypeptide, a TWSG1 polypeptide, a SHANK2 polypeptide, or a combination thereof.
- a method for increasing viral replication in a cell includes administering to a cell, such as a human cell, an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell.
- the cell includes a virus or is at risk of infection by a virus, and the virus is selected from a member of the family
- the polypeptide may be selected from FGD4, PKD2, MAP3K2, ZNFX1, PDCD1LG2, PLEKHA3, EIF5A2, FYCOl, GPR6, ENPP5, EPHA4, VSX1, STK17B, SACS, C14orf28, ZFYVE26, FGL2, SZT2, MEIR5, RPS6 A5, Cl lorGO, XRN1, FBXL5, CAMTA1, ITPRIPL2, SERF 1 A, SERF IB, GPR137C, FTSJD1, EPHA5, GUCY1A3, RRAGD, CTSS, GNPDA2, FBX048, DYNC1LI2, FAM129A, CERCAM, FIBIN, EZH1, CYP2U1, RNF128, IRF9, VPS53, DDHD1, ANKRD29, REST, FAM40B, PPP1R3B, RAB11FIP5, ARID4B, C2CD2, PRRGl, TNFR
- a method for increasing viral replication in a cell includes administering to a cell, such as a human cell, an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell.
- the cell includes a virus or is at risk of infection by a virus, and the virus is selected from a member of the family Paramyxoviridae.
- the polypeptide may be selected from FGF23, HMCN1, GPC4, KIAA0754, PAQR9, H2AFV, C5orfl5, DPY19L4, PRDM16, USP13, ABAT, POU2F3, SHPK, PARP9, MORC3, DENND1B, SLC25A16, ZNF578, STAT5B, DGKE, NRG1, PCBD2, DNHD1, UNC5D, NUDT12, HNRNPA3, HSD17B13, C2CD4A, LOC100132963, ABCA1, CLVS 1 , C3 orf79, SEC62, CNNM4, CDC42BP A, LRRTM4, WWP2, CNTD2, MCM6, C4orf40, POLDIP2, KIAA0776, FLVCR1, ZNF615, EROILB, SLIT1, TNRC6A, ZFAND5, PNPT1, IPPK, CCDC142, KCNK2, SAR1B, RRAGD, HNRNPAB,
- FNDC3B AKR1D1, GPR180, TMEM194B, PCDH11X, RDH11, RFX7, SLC35F1, MGAT4A, SLC11A2, C9orfl50, GDAP2, CLYBL, TNFSF13B, NDUFA4, IGF1, CMTM4, CMTM6, SUZ12, C20orfl94, NCOA3, PAPD5, FBXO40, AQPEP, NDST3, PCOLCE2, SMAD9, CRIPT, GABRA4, SRSF7, MSN, LY75, ZNF624, UGT2A3, FXRl , EIF2C4, SUSD5, ADCYl , CDKL2, TRIM36, ARFGAP2, ZNF238, AAK1, OTOR, ALS2CR8, SLC1A2, BRWD1, SLC25A3, MATN1, SLAIN1, C10orfl40, TSC1, MDM4, RPS6KA5, MDFIC, SECISBP2L,
- the polynucleotide may be a double stranded RNA, a microRNA, or a microRNA inhibitor. In certain methods for increasing viral replication in a cell, the polynucleotide encodes a double stranded RNA, a microRNA, or a microRNA inhibitor.
- the human cell is in vivo.
- the member of the Orthomyxoviridae is a member of the genus Influenzavirus A or a member of the genus Influenzavirus B. In one embodiment, the member of the Paramyxoviridae is human respiratory syncytial virus.
- viral replication in a cell is decreased by at least 0.5% compared to a control cell that does not include the polynucleotide. In one embodiment, viral replication in a cell is increased by at least 0.5% compared to a control cell that does not include the polynucleotide. In one embodiment, the amount of the polypeptide in the cell is decreased by at least 5% compared to a control cell that does not include the polynucleotide. In one embodiment, the amount of the polypeptide in the cell is increased by at least 5% compared to a control cell that does not include the
- a method for decreasing viral replication in a cell includes administering to a human cell an effective amount of a polynucleotide, wherein the
- the polynucleotide decreases viral replication in the cell.
- the cell includes a virus or is at risk of infection by a virus.
- the virus is selected from a member of the family Orthomyxoviridae, and the polynucleotide may include a mature microRNA selected from miR- 1254, miR-1272, miR-124a, miR-124*, or a combination thereof.
- the virus is selected from a member of the family Paramyxoviridae
- the polynucleotide may include a mature microRNA selected from miR-668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR-190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR- 744, miR-942, miR-lOb*, miR-150, miR-124*, miR-17-3p, miR-3944, miR-135a, miR-30d*, miR-8
- the virus is selected from a member of the family Orthomyxoviridae
- the polynucleotide may include a microRNA inhibitor that inhibits a microRNA selected from miR-17-5p, miR- 106b, miR- 106b*, miR-34c, or a combination thereof.
- the virus selected from a member of the family Paramyxoviridae, and the polynucleotide may include a microRNA inhibitor that inhibits a microRNA selected from miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681*, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, miR- 18a*, or a combination thereof.
- a method for increasing viral replication in a cell includes administering to a human cell
- the polynucleotide increases viral replication in the cell.
- the cell includes a virus or is at risk of infection by a virus.
- the virus is selected from a member of the family Orthomyxoviridae, wherein the polynucleotide may include a mature microRNA selected from miR-17-5p, miR-106b, miR-106b*, miR-34c, or a combination thereof.
- the virus is selected from a member of the family Paramyxoviridae
- the polynucleotide may include a mature microRNA selected from miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681 *, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, miR-18a*, or a combination thereof.
- the virus is selected from a member of the family Orthomyxoviridae
- the polynucleotide may include a microRNA inhibitor that inhibits a microRNA selected from miR-1254, miR-1272, miR-124a, miR-124*, or a combination thereof.
- the virus is selected from a member of the family Paramyxoviridae
- the polynucleotide may include a microRNA inhibitor that inhibits a microRNA selected from miR-668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR- 190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR-744, miR-942, miR-lOb*, miR-150, miR-124*, miR-17-3p, miR- 3944, miR-135a, miR
- the administering may include administering a polynucleotide that encodes the microRNA or the microRNA inhibitor.
- the polynucleotide that encodes the microRNA or the microRNA inhibitor is a vector.
- the administering includes administering the microRNA or the microRNA inhibitor.
- the human cell is in vivo.
- the member of the Orthomyxoviridae is a member of the genus
- the member of the Paramyxoviridae is human respiratory syncytial virus.
- viral replication in a cell is decreased by at least 0.5% compared to a control cell that does not include the polynucleotide. In one embodiment, viral replication in a cell is increased by at least 0.5% compared to a control cell that does not include the polynucleotide. Also provided is an ex vivo cell produced by a method described herein.
- a method for treating a subject includes administering to the subject a composition including an effective amount of the polynucleotide described herein that results in decreased viral replication, wherein the subject has or is at risk of developing a viral infection by a virus selected from a member of the family Orthomyxoviridae or a member of the family Paramyxoviridae.
- the subject is a human.
- the composition is administered to tissues of the respiratory tract.
- the subject has a viral infection, and at least one sign of a viral infection is reduced.
- the member of the Orthomyxoviridae is a member of the genus Influenzavirus A or a member of the genus Influenzavirus B. In one embodiment, the member of the Paramyxoviridae is human respiratory syncytial virus.
- genetically modified cells that have increased replication when compared to replication of a virus in a control cell.
- the genetically modified cell includes a member of the family Orthomyxoviridae, such as a member of the genus
- the genetically modified cell a member of the family Paramyxoviridae, such as human respiratory syncytial virus.
- a genetically modified cell includes a polynucleotide that decreases expression of a polypeptide in a cell and results in increased viral replication.
- a genetically modified cell includes a polynucleotide that includes a mature miPvNA and results in increased viral replication. In one embodiment, a genetically modified cell includes a polynucleotide that includes an miRNA inhibitor and results in increased viral replication.
- the method includes incubating the genetically modified cell under conditions suitable for the production of virus by the cell.
- the method includes harvesting the virus produced by the genetically modified cell.
- the genetically modified cell includes a virus that is a member of the family Orthomyxoviridae. In one embodiment, the virus that is a member of the family Paramyxoviridae
- virus “replication” refers to the process that results in the production of a copy of the genetic material of a virus.
- Virus replication may or may not result in the production of infectious virus particles that can infect a cell and result in the production of more infectious virus particles.
- Virus replication, and changes in virus replication may be determined by measuring standard signs related to virus replication in a cell. Examples include, but are not limited to, cytopathic effects, virus titers, amount of viral polynucleotide, hemagglutination, nucleoprotein, viral load in an animal's sinuses, lungs, trachea, and/or pathology associated with infection by a virus.
- Assays for measuring viral replication are known in the art and include, but are not limited to, plaque assays, TCID50, hemagglutination inhibition assays,
- RT-qPCR quantitative real time polymerase chain reaction
- decreasing expression of a polypeptide refers to a decrease in the amount of the polypeptide in a cell.
- increasing expression refers to an increase in the amount of the polypeptide in a cell.
- polypeptide refers broadly to a polymer of two or more amino acids joined together by peptide bonds.
- polypeptide also includes molecules which contain more than one polypeptide joined by a disulfide bond, or complexes of polypeptides that are joined together, covalently or noncovalently, as multimers (e.g., dimers, tetramers).
- multimers e.g., dimers, tetramers.
- peptide, oligopeptide, and protein are all included within the definition of polypeptide and these terms are used interchangeably.
- a polypeptide may have "structural similarity" to a reference polypeptide if the amino acid sequence of the polypeptide possesses a specified amount of sequence similarity and/or sequence identity compared to the reference polypeptide.
- a polypeptide may have "structural similarity" to a reference polypeptide if, compared to the reference polypeptide, it possesses a sufficient level of amino acid sequence identity, amino acid sequence similarity, or a combination thereof.
- polynucleotide refers to a polymeric form of nucleotides of any length, either ribonucleotides, deoxynucleotides, peptide nucleic acids, or a combination thereof, and includes both single-stranded molecules and double-stranded duplexes.
- a polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques.
- a polynucleotide described herein may be isolated.
- a polynucleotide may have "structural similarity" to a reference polynucleotide if the nucleotide sequence of the polynucleotide possesses a specified amount of sequence identity compared to the reference polynucleotide.
- a polynucleotide may have "structural similarity" to a reference polynucleotide if, compared to the reference polynucleotide, it possesses a sufficient level of nucleotide sequence identity.
- polynucleotide or polypeptide is one that has been removed from its natural environment.
- Polynucleotides and polypeptides that are produced by recombinant, enzymatic, or chemical techniques are considered to be isolated and purified by definition, since they were never present in a natural environment.
- a “purified" polypeptide or polynucleotide is one that is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components of a cell.
- Polypeptides and polynucleotides that are produced outside of a cell are considered to be isolated and purified by definition, since they were never present in a cell.
- control cell refers to a cell that does not include the same genetic modification(s) as a genetically modified cell.
- a "coding sequence” refers to a polynucleotide that encodes an RNA and, when placed under the control of appropriate regulatory sequences, expresses the encoded RNA.
- the RNA can be an mRNA, or a biologically active RNA, such as a dsRNA, miRNA, or ribozyme.
- An mRNA can be translated in the host cell to yield a polypeptide.
- the boundaries of a coding region are generally determined by a translation start codon at its 5' end and a translation stop codon at its 3' end.
- a "regulatory sequence” is a nucleotide sequence that regulates expression of a coding sequence to which it is operably linked. Nonlimiting examples of regulatory sequences include promoters, enhancers, transcription initiation sites, translation start sites, translation stop sites, transcription terminators, and poly(A) signals.
- operably linked refers to a juxtaposition of components such that they are in a relationship permitting them to function in their intended manner.
- a regulatory sequence is “operably linked” to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence.
- miRNA refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation (see, e.g., Carrington et al., 2003, Science, 301:336-338). "miRNA” refers to the single-stranded RNA molecule processed from a precursor. Individual miRNAs have been identified and sequenced in different organisms, and have been named based on submission to the miRNA Registry (Griggiths- Jones, 2004, Nucl. Acids Res., 32(Suppl 1):D109-D111, and see
- miRBase.org Names of miRNAs and their sequences are provided herein. Additionally, other miRNAs are known to those of skill in the art and can be readily implemented in embodiments described herein. The methods and compositions should not be limited to miRNAs identified in the application, as they are provided as examples, not necessarily as limitations of the
- genetically modified cell refers to a eukaryotic cell into which has been introduced an exogenous polynucleotide and has been altered by human intervention.
- a cell is a genetically modified cell by virtue of introduction into a suitable cell of an exogenous polynucleotide.
- Genetically modified cell also refers to a cell that has been genetically manipulated such that endogenous nucleotides have been altered.
- a cell is a genetically modified cell by virtue of introduction into a suitable cell of an alteration of endogenous nucleotides.
- an endogenous coding region could be inactivated by deletion or incorporation of mutations to result in expression of an inactive polypeptide.
- Another example of a genetically modified cell is one having an altered regulatory sequence, such as a promoter, to result in increased or decreased expression of an operably linked endogenous coding region.
- genomic editing refers to editing a coding region in a cell such that the coding region is inactivated, modified, or includes an integrated sequence.
- the term "effective amount” refers to an amount of a polynucleotide, compound, composition, formulation and/or dosage form as described herein that may be effective to achieve a particular biological result. Such results may include, but are not limited to, an alteration of viral replication in a cell, or treating a subject.
- An effective amount of a composition to treat a subject refers to an amount that causes an animal to demonstrate reduced signs of a viral infection than an animal would otherwise demonstrate in the absence of the polynucleotide, compound, composition, formulation and/or dosage form.
- the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
- RNAi of 5 host protease genes down-regulated influenza virus replication.
- RLU relative luciferase units. * p ⁇ 0.05 vs siNEG, ** pO.01 vs siNEG, ***p ⁇ 0.005 vs siNEG; siTOX vs all samples: p ⁇ 0.001 (not shown).
- B A549 cells were reverse transfected with 50 nM of siRNA (SMARTpool) specific for the indicated genes (ADAMTS7, CPE, DPP3, MST1, PRSS12). After 48 hours, cells were infected with A/WSN/33 at an MOI of 0.001. 48 hours post-infection, cells were fixed in 4% formaldehyde and stained with an anti-NP (green) monoclonal antibody followed by counterstain with DAPI (blue.) Positive (+) control: siMEK, negative (-) control: siNEG. Magnification is 20* (bar is 100 microns).
- siRNA siRNA
- C Cells were transfected with 100 nM of a novel siRNA targeting a different seed site from the SMARTpool used in the primary screen and infected as in B. After 48 hours of infection, cellular supernatant was tested for infectious virus production by a modified TCID 50 . Data is expressed as
- Figure 2 Calculated standard deviation of the z-scores of the human protease library.
- the primary screen provided two independent studies and was analyzed using a scaling methodology that sets the non-targeting control siRNA (siNEG) at an arbitrary value of 1.0, and the negative control siTOX at zero.
- siRNAs targeting host genes were assigned a score based on the distribution of these values.
- Wells in the primary screen with a percent of differentiation greater than 1.5 standard deviations above the plate mean in both duplicates were considered primary hits.
- 24 were genes were identified as "primary hits”.
- Figure 3 siRNA treatment decreases protein levels of the target protease genes.
- A549 cells were untreated (A549), treated with 50 nM of siNEG, or 50 nM of the appropriate siRNA. After 72 hours, cells were lysed in 1% TritonX-100 and protease gene levels were assessed by Western blot.
- B Protein levels of the protease genes were determined by densitometry. Band density is shown as a percentage of the untreated A549 cells.
- RNAi of individual host protease genes down-regulates replication of a clinical influenza isolate.
- A549 cells were reverse transfected with 100 nM of the novel siRNA targeting siADAMTS7, siCPE, siDPP3, siMSTl, and siPRSS12. After 48 hours, cells were infected with A/New Caledonia/20/99 at an MOI of 0.1 in the presence of 1 ug/ml TPCK-trypsin. After 48 hours of infection, cellular supernatant was tested for infectious virus production by a modified TCID50. Data is expressed as TCID 5 o/ml. Data is representative of two independent experiments. (*p ⁇ 0.05 vs. siNEG).
- FIG. 5 An Ingenuity pathway analysis linked global cellular pathways and the host protease genes of interest.
- Hit protease genes (ADAMTS7, CPE, DPP3, MST1, and PRSS12) are shown and relevant influenza proteins are also shown (NSl, viral RNA).
- Nodes indicating global cellular pathways linked with the hit genes are shown (CREBl, NF-i Bl, caspases CASP3 and CASP9).
- FIG. 6 Analysis of host gene involvement in major cellular pathways.
- A549 cells were reverse cotransfected with CRE/CREB reporter plasmid or the appropriate control plasmid and 100 nM of the novel siRNA. After 24 h incubation, the transfection media was replaced with culture media. Cells were mock infected or infected with A/WSN/33 at an MOI of 0.001 the following day. After 24 h, culture supernatant was analyzed for luciferase expression. Luciferase units were normalized to Renilla expression.
- A549 cells were reversed cotransfected with NF- ⁇ reporter plasmid or the appropriate control plasmid and 100 nM of the novel siRNA. After 24 h incubation, the transfection media was replaced with culture media. Cells were mock infected or infected with A/WSN/33 at an MOI of 0.001 the following day. After 24 h, culture supernatant was analyzed for luciferase expression. Luciferase units were normalized to Renilla expression.
- RNAi of DPP3 inhibits influenza replication by modulation of apoptotic genes.
- A549 cells were reverse transfected with 50 nM of siDPP3 or siNEG. After 48 hours, cells were infected with A/WSN/33 at an MOI of 0.001. After 18 hours of infection, cellular RNA was isolated and apoptosis gene expression profiles were determined by array. Gene expression was normalized to GAPDH levels. Silencing DPP3 resulted in upregulated levels of the pro-apoptotic genes BCL2L10, TNFSF10, TNFSF25 and TNFSF8. Data is representative of three independent experiments. * p ⁇ 0.05.
- FIG. 8 miRNAs interact with host protease genes.
- An Ingenuity pathway analysis implicated several miRNAs connected with host protease genes of interest.
- Hit protease genes (ADAMTS7, CPE, DPP3, MST1 , and PRSS12) are shown, and miRNAs are also shown (miR- 124, miR-106B, miR-17, miR-1254, miR-1272).
- FIG. 9 Effect of miRNA inhibition on host protease gene expression 24 h post-miRNA inhibitor treatment.
- Host cell miRNAs of interest were evaluated for their effect on host gene hits by qPCR.
- A549 cells were treated with the appropriate miRNA inhibitor (25 nM) for 24 hours.
- Cellular RNA was isolated 24 hpi and evaluated by qPCR for host gene expression using a SYBRgreen assay with gene-specific primers.
- Gene expression was compared to cells transfected with siNEG (for siRNA) or NEG (non-targeting miRNA inhibitor) at the equivalent concentration. Data is normalized to GAPDH expression.
- miRNAs indicated on the x-axis refer to inhibition of those miRNAs.
- B CPE
- C DPP3, D: MST1, E: PRSS12.
- Data is representative of two independent experiments. (*p ⁇ 0.05 versus siRNA treatment.).
- FIG. 10 Effect of miRNA inhibition on influenza replication. A549 cells were treated with the appropriate miRNA inhibitor (25 nM) for 48 hours, followed by infection with
- FIG. 11 Optimization of siRNA knockdown using siMEK as a positive control. 48 hours after transfection with Dharmafect only (Mock) or Dharmafect + siMEK at 25nM, 50nM, and lOOnM concentrations in A549 cells, total RNA was extracted and used to quantify MEK- specific mRNA. The transcript copies divided by GAPDH of gene silenced cells normalized to the same values of non-target control siRNA transfected samples.
- Figure 12 Quantitative PCR based validation of the knock down of genes targeted by siRNA. After 48 hours of silencing with siRNAs (50nM) in A549 cells, total RNA was extracted and used for quantification.
- transcript copies divided by GAPDH of gene silenced cells normalized to the same values of non-target control siRNA transfected samples.
- CDK3, ERBB4, PRKAG3, and C90RF96 were excluded from further studies because novel siRNAs were suboptimal at silencing. Values of control transfected cells are set as 0% silencing. The results are expressed as mean + SD from a representative experiment performed in triplicate.
- FIG. 13 RNA interference screen strategy for identification of host factors affecting influenza infection.
- A549 cells were plated onto lyophilized siRNAs in 96-well flat-bottom plates and transiently transfected for 48h with 50 nM siRNA.
- Figure 14 Validation of human protein kinase genes affecting influenza virus replication.
- siNEG non-target negative control siRNA
- siHPK siHPK
- B After a 48 hour infection, the effect of siRNA silencing on influenza virus replication was measured by quantifying the levels of influenza M gene expression.
- the RNA from siRNA- transfected and WSN-infected A549s was isolated and used for quantification with an influenza M-specific primer/probe set. Light gray bars indicate controls. Data show mean + SEM from 3 independent experiments.
- FIG. 16 Identifying miRNA regulators of HPKs important for influenza replication.
- A Venn diagrams showing miRNAs common to computationally predicted miRNA regulators and influenza deregulated miRNAs.
- FIG. 1 Primary screen identified 22 kinase factors associated with influenza infection. Calculated Z scores of the human kinase library identified primary hits (z scores >2 and ⁇ -2) whose silencing increased virus replication (positive Z score) and strongest hits that decreased virus replication (negative Z score). The position of each cellular kinase gene identified important for virus replication in the primary screen are indicated.
- FIG. 1 miRNA regulators of NEK8.
- A549 cells were transfected with 25nM of miR- 1227, -149* and -197 inhibitor/mimic for 48hrs followed by RNA extraction and RT-qPCR with NEK8 specific primers. Expression data was normalized to 18S rRNA expression and shown as mean + SEM of independent experiments. * p ⁇ 0.05 compared to control.
- FIG. 19 miRNA regulators of MAP3K1.
- A549 cells were transfected with 25nM of miR-548d, -29a and -138 inhibitor/mimic for 48hrs followed by RNA extraction and RT- qPCR with MAP3K1 specific primers. Expression data was normalized to 18S rRNA expression and shown as mean + SEM of independent experiments. * p ⁇ 0.05 compared to control.
- B A549 cells mock/transfected with miR-548d inhibitor/mimic for 48 hrs were fixed with 4% formaldehyde in PBS and stained for MAPK1 protein using biotinylated rabbit anti-MAP3Kl antibody (Abeam ab69533) and detected with Streptavidin-Alexa488.
- FIG. 20 miRNA regulators of CDK13.
- A A549 cells were transfected with 25nM of miR-1228 or -138 inhibitor/mimic for 48hrs followed by RNA extraction and RT-qPCR with MAP3K1 specific primers. Expression data was normalized to 18S rRNA expression and shown as mean + SEM of independent experiments. * p ⁇ 0.05 compared to control.
- B A549 cells mock/transfected with miR-1228 or -138 inhibitor/mimic for 48 hrs were fixed with 4% formaldehydein PBS and stained for CD 13 protein using biotinylated mouse anti-CDK13 antibody (Abeam ab58309) and detected with Streptavidin-Alexa488. Cells were analyzed by Arrayscan Cellomics VTI scanner and data analyzed by GraphPad Prism.
- C A549 cells mock/transfected with miR-1228 or -138 inhibitor/mimic for 48 hrs were infected with
- FIG. 21 miRNA regulators of PLK4
- A A549 cells were transfected with 25nM of miR-34c inhibitor/mimic for 48hrs followed by RNA extraction and RT-qPCR with MAP3K1 specific primers. Expression data was normalized to 18S rRNA expression and shown as mean + SEM of independent experiments. * p ⁇ 0.05 compared to control.
- B A549 cells
- Group V viruses include those that are members of the family Orthomyxoviridae, and those that are members of the family Paramyxoviridae.
- a virus that is a member of the family Orthomyxoviridae may be a member of the genus Influenzavirus A, a member of the genus Influenzavirus B, a member of the genus Influenzavirus C, or a member of the genus Thogotovirus.
- Influenzavirus A include, but are not limited to, Influenza A virus.
- Serotypes of the type species Influenza virus A include, but are not limited to, H1N1, H1N2, H2N2, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N8, H5N9, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, and H10N7.
- the skilled person will recognize that other serotypes are possible in view of antigenic drift and the simultaneous infection of one animal with different influenza viruses.
- Other examples of Influenza type A virus include those having mutations, such as mutations that prevent a virus from repressing a cell's anti-viral response. Such mutations are known in the art, and include mutations of the NS1 gene,.
- Influenzavirus B include, but are not limited to, Influenza B virus.
- Type species that are members of the genus Influenzavirus C include, but are not limited to, Influenza C virus.
- Type species that are members of the genus Thogotovirus include, but are not limited to, Thogoto virus and Dori virus.
- Serotypes of the type species Dhori virus include, but are not limited to, Batken virus and Dhori virus.
- a vims that is a member of the family Paramyxoviridae may be a member of the subfamily Paramyxovirinae, including members of the genus.
- a virus that is a member of the family Paramyxoviridae may be a member of the subfamily Pneumovirinae, including members of the genus Pneumovirus (such as human respiratory syncytial virus).
- a virus for use in certain embodiments described herein may be a clinical isolate obtained from an animal, such as an animal presenting signs of viral infection. The signs of such an infection vary depending upon the animal and upon the type of viral infection, and are known to the person skilled in the art.
- a virus for use in certain embodiments described herein may be obtained from a depository such as the American Type Culture Collection.
- a virus targeted for altered replication is in a cell.
- the cell may be in vivo.
- the term "in vivo" refers to a cell that is present within the body of an animal.
- the in vivo cell may be present in a vertebrate, such as a mammal including, but not limited to, a human, a pig, a mouse, a bat, and a ferret, or an avian.
- Methods and conditions for replicating a virus in an animal model are routine and known in the art, and methods for determining whether a vertebrate, such as a human, is infected with a replicating virus are likewise routine and Icnown in the art.
- Whether a virus is replicating in a vertebrate can be easily determined using routine methods, such as, for instance, by observing viral load in the animal's sinuses, lungs, trachea, or observing pathology associated with infection by a virus. For instance, histopathologic examination can be done using trachea and/or lung tissue.
- the cell may be ex vivo.
- ex vivo refers to a cell that has been removed from the body of an animal.
- Ex vivo cells include, for instance, primary cells (e.g., cells that have recently been removed from a animal and are capable of limited growth in tissue culture medium), and cultured cells (e.g., cells that are capable of long term culture in tissue culture medium).
- Ex vivo cells that may be used as host cells for replication of a virus include, for instance, vertebrate cells.
- vertebrate cells are avian cells, in particular embryo cells from an embryonated egg.
- Other examples of vertebrate cells include mammalian cells, such as hamster cells, monkey cells, dog cells, or human cells.
- mammalian cells are epithelial cells.
- An example of an epithelial cell is a respiratory epithelial cell, such a type I or type II respiratory epithelial cell (e.g., A549).
- mammalian cells are kidney cells or cell lines derived from such cells.
- An example of a mammalian kidney cell is the Madin-Darby canine kidney (MDCK) cell or cells from a clone of MDCK, MDCK-like cells, monkey kidney cells such as AGMK cells including Vero cells, suitable pig cell lines, or any other mammalian cell type suitable for the replication of influenza virus.
- mammalian cells are ocular cells.
- mammalian cells are neuronal cells.
- Suitable cells also include human cells, e.g. MRC-5 or Per-C6 cells, and avian cell lines. Suitable cells are not limited to cell lines; for example primary cells may be used.
- Avian embryo cells such as chicken embryo fibroblasts, may be used in cell culture, or may be present in an embryonated egg. Methods and conditions for replicating virus in ex vivo cells may depend up the virus, but are routine and known in the art. Whether a virus is replicating in cultured cells can be easily determined using routine methods, such as by observing cytopathic effects, measuring virus titers, measuring
- nucleoprotein hemagglutination, and/or measuring nucleoprotein.
- methods for altering viral replication in a cell include decreasing expression of a polypeptide in a cell. Decreasing expression of a polypeptide in a cell may be accomplished by, for instance: (i) decreasing translation of a coding region's transcript, such as disrupting a coding region's mRNA transcript, (ii) decreasing expression of a coding region (e.g., preventing transcription of the coding region), and (iii) decreasing activity of a polypeptide (e.g., targeting a polypeptide through use of, for instance, a small molecule inhibitor or aptamer).
- methods for altering viral replication in a cell include increasing expression of a polypeptide in a cell.
- Increasing expression of a polypeptide in a cell may be accomplished by, for instance: (i) increasing expression of an endogenous coding region that encodes the polypeptide, (ii) adding an additional copy of the coding region to the cell, and (iii) increasing activity of a polypeptide (e.g., targeting a polypeptide through use of, for instance, a small molecule inhibitor or aptamer).
- Antisense RNA technology involves expressing in, or introducing into, a cell an RNA molecule (or RNA derivative) that is complementary to, or antisense to, sequences found in a particular mRNA in a cell. By associating with the mRNA, the antisense RNA can decrease translation of the encoded gene product.
- RNA molecule or RNA derivative
- a ribozyme is an RNA that has both a catalytic domain and a sequence that is
- the ribozyme functions by associating with the mRNA (through the complementary domain of the ribozyme) and then cleaving the message using the catalytic domain. Ribozymes were first identified after it was found that certain mRNAs excise their own introns. By starting with these mRNAs, it has been possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and subsequently cleave it.
- RNA interference involves a post-transcriptional gene silencing (PTGS) regulatory process, in which the steady-state level of a specific mRNA is reduced by sequence- specific degradation of the transcribed, usually fully processed mRNA without an alteration in the rate of de novo transcription of the target gene itself.
- PTGS post-transcriptional gene silencing
- Decreasing expression of a polypeptide in a cell may be accomplished by using a single stranded RNA polynucleotide (useful for antisense strategies) or a double stranded RNA polynucleotide (useful for dsRNA strategies) based on an mRNA encoding one of the polypeptides disclosed herein.
- a polynucleotide for decreasing expression of polypeptide in a cell includes one strand, referred to herein as the sense strand, that is, is at least, or is no greater than, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides (e.g., lengths useful for dsRNAi and/or antisense RNA).
- a polynucleotide for decreasing expression of a polypeptide in a cell includes substantially all of a coding region, or in some cases, an entire coding region.
- the sense strand is substantially identical, preferably, identical, to a target coding region or a target mRNA.
- the term "identical" means the nucleotide sequence of the sense strand has the same nucleotide sequence as a portion of the target coding region or the target mRNA.
- the term "substantially identical” means the sequence of the sense strand differs from the sequence of a target mRNA at least 1%, 2%, 3%, 4%, or 5% of the nucleotides, and the remaining nucleotides are identical to the sequence of the mRNA.
- a polynucleotide for decreasing expression of a polypeptide in a cell includes one strand, referred to herein as the antisense strand.
- the antisense strand may be, be at least, or be no greater than, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides.
- a polynucleotide for decreasing expression of a polypeptide in a cell includes substantially all of a coding region, or in some cases, an entire coding region.
- An antisense strand is substantially complementary, preferably, complementary, to a target coding region or a target mRNA.
- the term "substantially complementary” means that at least 1%, 2%, 3%, 4%, or 5% of the nucleotides of the antisense strand are not complementary to a nucleotide sequence of a target coding region or a target mRNA.
- Methods are readily available to aid in the choice of a series of nucleotides from a polynucleotide encoding a polypeptide described herein. For instance, algorithms are available that permit selection of nucleotides that will function as dsRNAi and antisense RNA for use in altering expression of a coding region.
- a polynucleotide for decreasing expression of a polypeptide in a cell is a double stranded RNA (dsRNA) that includes a sense strand and antisense strand.
- dsRNA double stranded RNA
- the two strands of a dsRNA are complementary, and in another embodiment the two strands of a dsRNA are substantially complementary.
- the sense and antisense strands of a double stranded polynucleotide may have different lengths. It should be understood that the sequences disclosed herein as DNA sequences can be converted from a DNA sequence to an RNA sequence by replacing each thymidine nucleotide with a uridine nucleotide.
- a double stranded polynucleotide for use in decreasing expression of a polypeptide may include overhangs on one or both strands.
- An overhang is one or more nucleotides present in one strand of a double stranded polynucleotide that are unpaired, i.e., they do not have a corresponding complementary nucleotide in the other strand of the double stranded
- An overhang may be at the 3' end of a sense strand, an antisense strand, or both sense and antisense strands.
- An overhang is typically 1, 2, or 3 nucleotides in length.
- the overhang is at the 3' terminus and has the sequence thymine-thymine (or uridine - uridine if it is an RNA). Without intending to be limiting, such an overhang may be used to increase the stability of a dsRNA.
- an overhang it is preferably not considered when determining whether a sense strand is identical or substantially identical to a target mRNA, and it is preferably not considered when determining whether an antisense strand is complementary or substantially complementary to a target mRNA.
- the sense and antisense strands of a double stranded polynucleotide may be covalently attached, for instance, by a spacer made up of nucleotides.
- a spacer made up of nucleotides.
- Such a polynucleotide is often referred to in the art as a short hairpin RNA (shRNA).
- shRNA short hairpin RNA
- the spacer region typically forms a loop.
- the number of nucleotides making up the loop can vary, and loops between 3 and 23 nucleotides have been reported (Sui et al., Proc. Natl. Acad. Sci. USA, 99:5515-5520 (2002), and Jacque et al, Nature, 418:435-438 (2002)).
- an shRNA includes a sense strand followed by a nucleotide loop and the analogous antisense strand.
- the antisense strand can precede the nucleotide loop structure and the
- Polynucleotides described herein including those used for decreasing expression of a polypeptide (such as antisense RNA, dsRNA, miRNA, or ribozyme), may be modified. Such modifications can be useful to increase stability of the polynucleotide in certain environments, and/or increase specificity of the polynucleotide for a target. The modifications can be synthetic, naturally occurring, or non-naturally occurring.
- a polynucleotide of the present invention can include modifications at one or more of the nucleic acids present in the polynucleotide.
- Modifications may be made to specific positions to increase the specificity of the polynucleotide for a target polynucleotide (Jackson et al., 2006, RNA, 12: 1197- 1205). Methods for producing polynucleotides having modifications are known to the art and routine. Polynucleotides can be commercially synthesized to include such modifications (for instance, Dharmacon Inc.,
- a modification can include a backbone.
- backbone modifications include, but are not limited to, phosphonoacetates, thiophosphonoacetates, phosphorothioates, phosphorodithioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide-nucleic acids.
- a modification can include a nucleic acid base.
- nucleic acid base modifications include, but are not limited to, inosine, purine, pyridin-4-one, pyridin-2- one, phenyl, pseudouracil, 2,4,6-trimethoxy benzene, 3 -methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5- halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6- methyluridine), or propyne modifications.
- a modification can include a nucleic acid sugar.
- nucleic acid sugar modifications include, but are not limited to, 2'-sugar modification, e.g., 2'-0-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-fluoroarabino, 2'-0-methoxyethyl nucleotides, 2'-0-trifluoromethyl nucleotides, 2'-0-ethyl-trifluoromethoxy nucleotides, 2'-0- difluoromethoxy-ethoxy nucleotides, or 2'-deoxy nucleotides.
- a biologically active polynucleotide causes the post-transcriptional inhibition of expression, also referred to as silencing, of a target mRNA, resulting in inhibiting expression of a polypeptide.
- the polynucleotides described herein may be referred to as, for instance, R Ai, siRNA, shRNA, miRNA, or antisense oligonucleotides.
- Whether the expression of a target gene is inhibited can be determined, for instance, by measuring a decrease in the amount of the target mRNA in the cell, measuring a decrease in the amount of polypeptide encoded by the mRNA, or by measuring a decrease in the amount or the activity of the polypeptide encoded by the mRNA.
- Methods for measuring mRNA levels in a cell are routine and laiown to the skilled person.
- Methods for determining whether expression of a polypeptide is altered are routine and laiown to the skilled person.
- the polypeptide being measured may be in an ex vivo cell or an in vivo cell. In one embodiment, altered expression of a polypeptide may be determined directly by measuring the polypeptide.
- the presence and/or amount of a polypeptide present in a cell may be determined by using an antibody detection method, such as western immunoblot or an enzyme-linked immunosorbent assay (ELISA).
- the amount of polypeptide present in the cell is compared to the amount of the polypeptide a control cell.
- altered expression of a polypeptide may be determined by an indirect method, such as a reverse transcription-polymerase chain reaction that determines the abundance in a cell of the mRNA encoding the polypeptide.
- the amount of mRNA may be indicative of the amount of polypeptide present in the cell.
- the amount of mRNA is compared to the amount of mRNA a control cell.
- the amount of a polypeptide in a cell may be increased or decreased by at least 0.1%, at least 1%, at least 5%, or at least 10% when compared to the amount of the polypeptide in a control cell. In one embodiment, the amount of the polypeptide is undetectable when using an antibody-based detection method.
- Bioly active polynucleotides such as biologically active RNAs like dsRNAs and ribozymes, can be designed using methods that are routine and known in the art. For instance, in one embodiment, polynucleotides that inhibit the expression of one of the polypeptides described herein may be identified by scanning an mRNA encoding the polypeptide for AA dinucleotide sequences; each AA and the downstream (3') consecutive 16 to 30 nucleotides of the mRNA can be used as the sense strand of a candidate polynucleotide. A candidate polynucleotide is the polynucleotide that is being tested to determine if it decreases expression of one of the polypeptides described herein.
- the candidate polynucleotide can be identical to nucleotides located in the region encoding the polypeptide, or located in the 5' or 3' untranslated regions of the mRNA.
- a candidate polynucleotide is modified to include 1, 2, or 3, preferably 1, non-complementary nucleotides.
- Other methods are known in the art and used routinely for designing and selecting candidate polynucleotides, and include the use of readily available computerized algorithms.
- Candidate polynucleotides are also readily available commercially.
- a biologically active polynucleotide may, but need not, begin with the dinucleotide A A at the 5' end of the sense strand.
- a candidate polynucleotide may also include overhangs of 1, 2, or 3 nucleotides, typically on the 3' end of the sense strand, the anti-sense strand, or both.
- Candidate polynucleotides are typically screened using publicly available algorithms (e.g., BLAST) to compare the candidate polynucleotide sequences with coding sequences. Those that are likely to form a duplex with an mRNA expressed by a non-target coding region are typically eliminated from further consideration. The remaining candidate polynucleotides may then be tested to determine if they inhibit expression of one of the polypeptides described herein.
- altering viral replication in a cell occurs through the use of microRNAs (miRNAs).
- miRNAs In contrast to a dsRNA polynucleotide with activity of inhibiting translation of an mRNA, an miRNA is single stranded. miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus to hairpin structures of
- RNA molecules approximately 70 nucleotides. These precursors (pre-miRNAs) are exported to the cytoplasm, where they are subsequently processed to a shorter mature miRNA that is typically 17 to 25 nucleotides. It is contemplated that a polynucleotide administered to a cell may subsequently be processed to a shorter mature miRNA.
- a polynucleotide that is, or encodes, an miRNA may be between 17 and 130 nucleotides or longer.
- an miRNA may be administered as a polynucleotide (e.g., a vector) that encodes a pri-miRNA, a pre-miRNA, or a mature miRNA.
- an miRNA may be administered as a polynucleotide that is a pri- miRNA, a pre-miRNA, or a mature miRNA.
- a polynucleotide that is, or encodes, an miRNA is is at least, or is no greater than 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97
- An miRNA includes an "miRNA region.”
- An miRNA region refers to a polynucleotide sequence that is identical to a mature miRNA sequence.
- An “miRNA region” also includes a polynucleotide sequence that has structural similarity with a mature miRNA sequence.
- RNA can include a polynucleotide that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identical to the sequence of a naturally- occurring miRNA.
- An miRNA having an miRNA region that is less than 100% identical to a natural miRNA region e.g., a mature miRNA sequence depicted in Table 1 has the biological activity of the mature miRNA.
- a miRNA having an miRNA region that is less than 100% identical to a natural miRNA region may be referred to as a "mimic miRNA.”
- a mature miRNA, and therefore an miRNA region includes a seed region.
- a seed region is a series of consecutive nucleotides, usually nucleotides 2 through 8 from 5' end, of a mature miRNA that are complementary to a miRNA recognition element (MRE) in the untranslated region operably linked to a target coding region.
- MRE miRNA recognition element
- miR-518b UCAUGCUGUGGCCCUCCAGAGGGAAGCGCUUUCUGUUG 27 51-72
- miR-135a AGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUG 37 17-39
- miR-520h UCCCAUGCUGUGACCCUCUAGAGGAAGCACUUUCUGUU 42 55-76
- miR-376a UAAAAGGUAGAUUCUCCUUCUAUGAGUACAUUAUUUAU 48
- miR-17-5p see miR-17-3p 14-36 miR-106b, CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGU 52 12-32
- miR-106b* see miR- 106b 52-73 miR-34c AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAA 53 13-35, 46-67
- miR-2116* GACCUAGGCUAGGGGUUCUUAGCAUAGGAGGUCUUCCC 54 51-71
- miR-3678-5p see miR-3678-3p 9-28 miR-3934, CACAGCCCUUCCUGUCCCCAGUUUUCAGGUGUGGAAAC 66 25-46, 64-85
- miR-3622a-3p AAUAGAGGGUGCACAGGCACGGGAGCUCAGGUGAGGCA 77 50-71
- miR-4321 CUGGUCUCCGCAGAGCCUCUGCCCCUCCCGAGACACCCG 80 50-70
- Sequence similarity of two polynucleotides can be determined by aligning the residues of the two polynucleotides (for example, a candidate polynucleotide and any appropriate reference polynucleotide described herein) to optimize the number of identical nucleotides along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical nucleotides, although the nucleotides in each sequence must nonetheless remain in their proper order.
- a reference polynucleotide may be a polynucleotide described herein.
- a candidate polynucleotide is the polynucleotide being compared to the reference polynucleotide.
- a candidate polynucleotide may be isolated, for example, from a plant, or can be produced using recombinant techniques, or chemically or enzymatically synthesized.
- a pair-wise comparison analysis of nucleotide sequences can be carried out using the Blastn program of the BLAST search algorithm, available through the World Wide Web, for instance at the internet site maintained by the National Center for Biotechnology Information, National Institutes of Health. Preferably, the default values for all Blastn search parameters are used.
- sequence similarity may be determined, for example, using sequence techniques such as GCG FastA (Genetics Computer Group, Madison, Wisconsin), Mac Vector 4.5 (Kodak/IBI software package) or other suitable sequencing programs or methods known in the art.
- reference to a nucleotide sequence of a mature miRNA can include a polynucleotide with at least 85%, at least 86%, at least 87%, at least 88%>, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, 99.1%, at least, 99.2%, at least, 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% nucleotide identity to a mature miRNA.
- an miRNA may include a "complementary region.”
- a complementary region refers to a region of an miRNA (e.g., a pri-miRNA or a pre-miRNA) that is or has at least 60%> complementary to the mature miRNA sequence of the miRNA.
- a hairpin loop structure is typically present between the miRNA region and the complementary region.
- the complementary region is, or is at least, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% complementary to the miRNA region.
- altering viral replication in a cell occurs through the use of miRNA inhibitors.
- miRNA inhibitors also referred to in the art as anti-miRs, antagomirs, and/or blockmirs
- miRNA inhibitors are engineered polynucleotides that, when introduced into a cell, silence endogenous miRNAs.
- the production, identification, and use of miRNA inhibitors is known to the person skilled in the art and is routine. Given the identity of an mRNA, a functional miRNA inhibitor can be easily produced.
- an miRNA inhibitor is complementary to the mRNA targeted by an miRNA, but includes a sequence that is altered to prevent the action of the mature miRNA.
- an miRNA inhibitor is a single-stranded polynucleotide that is a reverse complement of a mature miRNA sequence, and acts to prevent the action of the mature miRNA (Hutvagner et al., 2004, PLoS Biol., 2:E98; Meister et al., 2004, RNA 10:544-550). Inhibitors of greater length may also be used
- an miRNA inhibitor is a single-stranded polynucleotide that is a reverse complement of a mature miRNA sequence, but also includes secondary structural elements that enhance the activity of miRNA inhibitor (Vermeulen et al, 2007, RNA, 13:723-730).
- genomic editing refers to the use of artificially engineered nucleases to produce a site-specific double stranded break in the genomic DNA of a cell.
- the creation of a double stranded break at a specific location can be used to engineer a specific mutation in a coding region within a cell.
- a specific mutation may result in the inactivation or knock-out of a coding region.
- the coding region may be modified to express an inactive polypeptide, or to not express a polypeptide.
- genomic editing may be used to modify coding region or operably linked regulatory regions to express a polypeptide at increased level, or an additional copy of a coding region may be added to a cell.
- Genomic editing includes the use of meganucleases, zinc finger nucleases, and transcription activator-like effector nucleases (TALENs) (Smith et al., US Patent 8,021,867; Urnov and Jianbin, US Patent Application 20120196370; and Serber and Horwitz, US Patent Application 20120277120).
- TALENs transcription activator-like effector nucleases
- Altering virus replication may result in decreasing replication of a virus in a cell.
- the alteration of viral replication may be a decrease of at least 0.1%, at least 0.5%, at least 1%, at least 5%, or at least 10% when compared to the replication of the virus in a control cell.
- the result of decreased viral replication in a cell includes less virus genetic material in a cell when compared to a control cell.
- decreasing replication of a virus occurs by decreasing expression of a polypeptide in a cell, where the polypeptide is endogenous to the cell.
- the expression of more than one polypeptide may be decreased in a cell.
- the polypeptide is a protease.
- the protease polypeptide is an ADAMTS7 polypeptide.
- the coding region encoding an ADAMTS7 polypeptide is known by the common gene symbol ADAMTS7, and the full name ADAM metallopeptidase with thrombospondin type 1, motif 7.
- a human version of this coding region is available at Genbank accession number NM_014272, and the ADAMTS7 polypeptide encoded by the coding region is also available at Genbank accession number NM_014272.
- an "ADAMTS7 polypeptide” refers to the polypeptide available at Genbank accession number NM_014272.
- ADAMTS7 polypeptide also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_014272.
- An ADAMTS7 polypeptide is bound by an antibody that specifically binds to the ADAMTS7 polypeptide disclosed at Genbank accession number NM_014272.
- Such antibodies are commercially obtainable from, for instance, Abeam, (Cambridge, MA).
- an antibody that can specifically bind a polypeptide is an antibody that interacts only with the epitope of the antigen that induced the synthesis of the antibody, or interacts with a structurally related epitope.
- an antibody that specifically binds to an epitope will, under the appropriate conditions, interact with the epitope even in the presence of a diversity of potential binding targets.
- an ADAMTS7 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the protease polypeptide is a CPE polypeptide.
- the coding region encoding a CPE polypeptide is known by the common gene symbol CPE, and the full name Carboxypeptidase E. A human version of this coding region is available at Genbank accession number NM_014272, and the CPE polypeptide encoded by the coding region is also available at Genbank accession number NM_014272.
- a "CPE polypeptide” refers to the polypeptide available at Genbank accession number NM_014272.
- CPE polypeptide also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_001873.
- a CPE polypeptide is bound by an antibody that specifically binds to the CPE polypeptide disclosed at Genbank accession number NM_001873. Such antibodies are commercially obtainable.
- a CPE polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavir s A, a member of the genus Influenzavirus B.
- the protease polypeptide is a DPP3 polypeptide.
- the coding region encoding a DPP3 polypeptide is known by the common gene symbol DPP3, and the full name Dipeptidyl-peptidase 3.
- a human version of this coding region is available at Genbank accession number NM_005700, and the DPP3 polypeptide encoded by the coding region is also available at Genbank accession number NM_005700.
- a "DPP3 polypeptide” refers to the polypeptide available at Genbank accession number NM_005700.
- “DPP3 polypeptide” also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_005700.
- a DPP3 polypeptide is bound by an antibody that specifically binds to the DPP3 polypeptide disclosed at Genbank accession number NM_005700. Such antibodies are commercially obtainable.
- a DPP3 polypeptide has a role in DPP3, and as described herein, plays a role in viral replication.
- decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the protease polypeptide is a MST1 polypeptide.
- the coding region encoding a MST1 polypeptide is known by the common gene symbol MST1, and the full name macrophage stimulating 1 (hepatocyte growth factor-like).
- MST1 polypeptide refers to the polypeptide available at Genbank accession number NM_020998.
- MST1 polypeptide also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_020998.
- a MST1 polypeptide is bound by an antibody that specifically binds to the MST1 polypeptide disclosed at Genbank accession number NM_020998. Such antibodies are commercially obtainable.
- a MST1 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the protease polypeptide is a PRSS 12 polypeptide.
- the coding region encoding a PRSS 12 polypeptide is known by the common gene symbol PRSS 12, and the full name Neurotrypsin, motopsin. A human version of this coding region is available at
- PRSS12 polypeptide refers to the polypeptide available at Genbank accession number NM_003619.
- PRSS12 polypeptide also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_003619.
- a PRSS12 polypeptide is bound by an antibody that specifically binds to the PRSS 12 polypeptide disclosed at Genbank accession number NM_003619. Such antibodies are commercially obtainable.
- a PRSS 12 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the polypeptide is a kinase.
- the kinase polypeptide is a CDK13 polypeptide.
- the coding region encoding a CDK13 polypeptide is known by the common gene symbol CDK13 (also SDC2L5), and the full name cell division cycle 2-like 5.
- CDK13 also SDC2L5
- a human version of this coding region is available at Genbank accession number NM_003718, and the CDK13 polypeptide encoded by the coding region is also available at Genbank accession number M80629.
- a "CDK13 polypeptide" refers to the polypeptide available at Genbank accession number M80629.
- CDK13 polypeptide also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number M80629.
- a CDK13 polypeptide is bound by an antibody that specifically binds to the CDK13 polypeptide disclosed at Genbank accession number M80629. Such antibodies are commercially obtainable.
- a CDK13 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the kinase polypeptide is a HK2 polypeptide.
- the coding region encoding a HK2 polypeptide is known by the common gene symbol HK2 and the full name hexokinase 2.
- a human version of this coding region is available at Genbank accession number NM_000189, and the HK2 polypeptide encoded by the coding region is also available at Genbank accession number NM_000189.
- a "HK2 polypeptide” refers to the polypeptide available at Genbank accession number NM_000189.
- “HK2 polypeptide” also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_000189.
- a HK2 polypeptide is bound by an antibody that specifically binds to the HK2 polypeptide disclosed at Genbank accession number NM_000189. Such antibodies are commercially obtainable.
- a HK2 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the kinase polypeptide is a NEK8 polypeptide.
- the coding region encoding a NEK8 polypeptide is known by the common gene symbol NEK8, and the full name never in mitosis gene a- related kinase 8.
- a human version of this coding region is available at Genbank accession number NM_178170, and the NEK8 polypeptide encoded by the coding region is also available at Genbank accession number NM_178170.
- a "NEK8 polypeptide” refers to the polypeptide available at Genbank accession number NM_178170.
- NEK8 polypeptide also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_178170.
- a NEK8 polypeptide is bound by an antibody that specifically binds to the NEK8 polypeptide disclosed at Genbank accession number NM_178170. Such antibodies are commercially obtainable.
- a NEK8 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the kinase polypeptide is a PANK4 polypeptide.
- the coding region encoding a PANK4 polypeptide is known by the common gene symbol PANK4, and the full name pantothenate kinase 4.
- a human version of this coding region is available at Genbank accession number NM_018216, and the PANK4 polypeptide encoded by the coding region is also available at Genbank accession number NM_018216.
- a "PANK4 polypeptide” refers to the polypeptide available at Genbank accession number NM_018216.
- PANK4 polypeptide also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_018216.
- a PANK4 polypeptide is bound by an antibody that specifically binds to the PANK4 polypeptide disclosed at Genbank accession number NM_018216. Such antibodies are commercially obtainable.
- a PANK4 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the kinase polypeptide is a PLK4 polypeptide.
- the coding region encoding a PLK4 polypeptide is known by the common gene symbol PLK4, and the full name polo-like kinase 4.
- a human version of this coding region is available at Genbank accession number NM_014264, and the PLK4 polypeptide encoded by the coding region is also available at Genbank accession number NM_014264.
- a "PLK4 polypeptide” refers to the polypeptide available at Genbank accession number NM_014264.
- “PLK4 polypeptide” also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number PLK4.
- a PLK4 polypeptide is bound by an antibody that specifically binds to the PLK4 polypeptide disclosed at Genbank accession number NM_014264. Such antibodies are commercially obtainable.
- a PLK4 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the kinase polypeptide is a SGK3 polypeptide.
- This peptide has three isoforms.
- the coding region encoding a SGK3 polypeptide is known by the common gene symbol SGK3, and the full name serum/glucocorticoid regulated kinase family, member 3.
- a human version of this coding region is available at Genbank accession number _, and the SGK3 polypeptide isoforms encoded by the coding region are available at Genbank accession number NPJX) 1028750.1, NP_037389.4, and NP_733827.2.
- a "SGK3 polypeptide" refers to the polypeptides available at Genbank accession number NP_001028750.1,
- SGK3 polypeptide also refers to a polypeptide that has structural similarity with the polypeptides available at Genbank accession number NP 001028750.1, NP_037389.4, and NPJ733827.2.
- a SGK3 polypeptide is bound by an antibody that specifically binds to the SGK3 polypeptides disclosed at Genbank accession number NP_001028750.1, NPJ 7389.4, and NP_733827.2.
- Such antibodies are commercially obtainable.
- a SGK3 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the polypeptide is selected from PPARA, RIF1, P4HA1, GRIA4, TWSG1, and SHANK2, or a polypeptide having structural similarity with such a polypeptide.
- the amino acid sequence of each of these polypeptides is known and present in publicly available databases, as is the nucleotide sequence of an mRNA encoding each polypeptide.
- decreasing expression of one of these polypeptides results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- increasing expression of one of these polypeptides results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzaviru B.
- the polypeptide is selected from FGF23, HMCN1, GPC4,
- FNDC3B AKR1D1, GPR180, TMEM194B, PCDH11X, RDH11, RFX7, SLC35F1, MGAT4A, SLC11 A2, C9orfl50, GDAP2, CLYBL, TNFSF13B, NDUFA4, IGF1, CMTM4, CMTM6,
- each of these polypeptides is known and present in publicly available databases, as is the nucleotide sequence of an mRNA encoding each polypeptide.
- decreasing expression of one of these polypeptides results in decreased replication of a virus that is a member of the family Paramyxoviridae, such as a human respiratory syncytial virus.
- increasing expression of one of these polypeptides results in decreased replication of a virus that is a member of the family Paramyxoviridae, such as a human respiratory syncytial virus.
- Structural similarity of two polypeptides can be determined by aligning the residues of the two polypeptides (for example, a candidate polypeptide and an appropriate reference polypeptide described herein) to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical amino acids, although the amino acids in each sequence must nonetheless remain in their proper order.
- a reference polypeptide is a polypeptide described herein, such as, e.g., ADAMTS7, CPE, DPP3, MST1, or PRSS12.
- a candidate polypeptide is the polypeptide being compared to the reference polypeptide.
- a candidate polypeptide can be isolated, for example, from a cell, or can be produced using recombinant techniques, or chemically or enzymatically synthesized, or its presence inferred by identification of a coding region present in the genome of a cell.
- a pair- wise comparison analysis of amino acid sequences can be carried out using the Blastp program of the blastp suite-2sequences search algorithm, as described by Tatiana et al, (FEMS Microbiol Lett, 174, 247-250 (1999)), and available on the National Center for Biotechnology Information (NCBI) website.
- polypeptides may be compared using the BESTFIT algorithm in the GCG package (version 10.2, Madison WI).
- nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and tyrosine.
- Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine.
- the positively charged (basic) amino acids include arginine, lysine and histidine.
- the negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
- Conservative substitutions include, for example, Lys for Arg and vice versa to maintain a positive charge; Glu for Asp and vice versa to maintain a negative charge; Ser for Thr so that a free -OH is maintained; and Gin for Asn to maintain a free -NH2.
- ADAMTS7, CPE, DPP3, MST1, PRSS12, CDK13, H 2, NEK8, PANK4, PLK4, or SGK3 polypeptide can include a polypeptide with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence similarity to the reference amino acid sequence.
- reference to an amino acid sequence of, for instance, an ADAMTS7, CPE, DPP3, MST1, PRSS12, CDK13, HK2, NEK8, PAN 4, PLK4, or SGK3 polypeptide can include a polypeptide with at least 50%, at least 55%>, at least 60%, at least 65%, at least 70%>, at least 75%, at least 80%, at least 85%, at least 86%>, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%), at least 96%, at least 97%, at least 98%>, or at least 99% amino acid sequence identity to the reference amino acid sequence.
- miRNAs that may be used to decrease replication of a virus that is a member of the family Orthomyxoviridae, such as Influenza A virus include miR- 1254, miR- 1272, miR-124a, miR-124* (see Table 1).
- miRNAs that may be used to decrease replication of a virus that is a member of the family Paramyxoviridae, such as human respiratory syncytial virus, include miR- 668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR-190b, miR- 548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR-744, miR-942, miR-10b*, miR-150, miR-124*, miR-17-3p, miR-3944, miR- 135a, miR-30d
- miRNAs that may be used to decrease replication of a virus that is a member of the Orthomyxoviridae, such as Influenza A virus, and/or the family Paramyxoviridae, such as human respiratory syncytial virus, include miR-124*, and miR-124a.
- an miRNA inhibitor may be used to decrease replication of a virus that is a member of the family Orthomyxoviridae, such as Influenza A virus.
- miRNAs that may be the target of an miRNA inhibitor include miR-17-5p, miR-106b, miR- 106b*, and miR-34c.
- an miRNA inhibitor may be used to decrease replication of a virus that is a member of the family Paramyxoviridae, such as human respiratory syncytial vims.
- miRNAs that may be the target of an miRNA inhibitor include miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681*, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, and miR-18a*.
- Altering virus replication may result in increasing replication of a virus in a cell.
- the alteration of viral replication may be an increase of at least 0.1%, at least 0.5%, at least 1%, at least 5%, or at least 10% when compared to the replication of the virus in a control cell.
- the result of increased viral replication in a cell includes more virus genetic material in a cell when compared to a control cell.
- increasing replication of a virus occurs by decreasing expression of a polypeptide in a cell, where the polypeptide is endogenous to the cell.
- polypeptide targeted for decreased expression is selected from
- VASH2 CXCL6, KIAA1383, TM2D2, KIF23, SERP1, AHNAK, U2SURP, RPGR, C18orf32, DUSP18, NKIRAS1, PFKP, LYST, Cl lorf82, CHRM2, C19orf2, GPATCH2, RGMB,
- PAPOLB FIGNL1, CAPRIN2, CROT, MAP3K5, USP31, MKNK2, TXNIP, BTN3A1,
- each of these polypeptides is known and present in publicly available databases, as is the nucleotide sequence of an mRNA encoding each polypeptide. In one embodiment, decreasing expression of one of these polypeptides results in increased replication of a virus that is a member of the family
- Orthomyxoviridae such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- increasing expression of one of these polypeptides results in increased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
- the polypeptide is selected from FGF23, HMCN1, GPC4,
- FNDC3B AKR1D1, GPR180, TMEM194B, PCDH1 IX, RDH11, RFX7, SLC35F1, MGAT4A, SLC11A2, C9orfl50, GDAP2, CLYBL, TNFSF13B, NDUFA4, IGF1, CMTM4, CMTM6, SUZ12, C20orfl94, NCOA3, PAPD5, FBXO40, AQPEP, NDST3, PCOLCE2, SMAD9, CRIPT, GABRA4, SRSF7, MSN, LY75, ZNF624, UGT2A3, FXRl, EIF2C4, SUSD5, ADCYl, CDKL2, TRIM36, ARFGAP2, ZNF238, AAK1, OTOR, ALS2CR8, SLC1A2, BRWD1, SLC25A3, MATN1, SLAIN1, C10orfl40, TSC1, MDM4, RPS6KA5, MDFIC, SECISBP2L, SE
- OSBPL3, FIGN FLT1, ZNF124, SLC25A24, CTDSPL, PRPF18, ZNF845, SYN2, CREBL2, REPS2, NFE2L3, ZNF680, GRHL1, MCTP1, ZNF425, TMEM97, INF2, EDEM1, ONECUT2, CD69, NOX4, PHLPP2, KLF4, PLAC4, C5orf22, C2orf63, Clorf226, KIAA1919, SLC4A4, KBTBD8, TTC39A, C14orf28, ARHGEF38, CDC25A, RRAGD, REST, C2CD2, C2CD4A, CTDSPL, C20orfl94, SMARCA5, SYN2, ZNF845, and NOX4, or a polypeptide having structural similarity with such a polypeptide.
- each of these polypeptides is known and present in publicly available databases, as is the nucleotide sequence of an mRNA encoding each polypeptide.
- decreasing expression of one of these polypeptides results in increased replication of a vims that is a member of the family Paramyxoviridae, such as a human respiratory syncytial virus.
- increasing expression of one of these polypeptides results in increased replication of a virus that is a member of the family Paramyxoviridae, such as a human respiratory syncytial virus.
- miRNAs that may be used to increase replication of a virus that is a member of the family Orthomyxoviridae, such as Influenza A virus include miR-17-5p, miR- 106b, miR-106b*, and miR-34c.
- miRNAs that may be used to increase replication of a virus that is a member of the family Paramyxoviridae, such as human respiratory syncytial virus, include miR- 2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681 *, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, and miR- 18a*.
- miRNA inhibitors may be used to increase replication of a virus.
- an miRNA inhibitor may be used to increase replication of a virus that is a member of the family Orthomyxoviridae, such as Influenza A virus.
- Examples of such miRNAs that may be the target of an miRNA inhibitor include miR-1254, miR-1272, miR- 124a, and miR-124*.
- an miRNA inhibitor may be used to increase replication of a virus that is a member of the family Paramyxoviridae, such as human respiratory syncytial virus.
- miRNAs examples include miR-668, miR- 509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR-190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515- 5p, miR-744, miR-942, miR-10b*, miR-150, miR-124*, miR-17-3p, miR-3944, miR-135a, miR- 30d*, miR-876-5p, miR-873, miR-625, miR-520h, miR-491
- a polynucleotide described herein for instance, a polynucleotide used for RNAi or an miRNA or miRNA inhibitor, or a polynucleotide having a coding region, may be present in a vector.
- a vector is a replicating polynucleotide, such as a plasmid, virus, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a polynucleotide described herein may employ standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989).
- a vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polynucleotide, i.e., an expression vector.
- the term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, transposon vectors, and artificial chromosome vectors.
- viral vectors include, for instance, adenoviral vectors, adeno- associated viral vectors, lentiviral vectors, retroviral vectors, and herpes virus vectors.
- a vector may result in integration into a cell's genomic DNA.
- a vector may be capable of replication in a bacterial host, for instance E. coli.
- a polynucleotide described herein may be present in a vector as two separate complementary polynucleotides, each of which can be expressed to yield a sense and an antisense strand of a dsRNA, or as a single polynucleotide containing a sense strand, an intervening spacer region, and an antisense strand, which can be expressed to yield an RNA polynucleotide having a sense and an antisense strand of a dsRNA (e.g., a shRNA).
- a shRNA RNA polynucleotide having a sense and an antisense strand of a dsRNA
- Suitable host cells for cloning or expressing the vectors herein are prokaryotic or eukaryotic cells.
- Suitable eukaryotic cells include mammalian cells, such as murine cells and human cells.
- Suitable prokaryotic cells include eubacteria, such as gram-negative organisms, for example, E. coli.
- An expression vector optionally includes regulatory sequences operably linked to the polynucleotide described herein.
- Vectors may include constitutive, inducible, and/or tissue specific promoters for expression of a polynucleotide described herein in a particular tissue or intracellular environment, examples of which are known to one of ordinary skill in the art.
- Constitutive mammalian promoters include, but are not limited to, polymerase promoters as well as the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPTR), adenosine deaminase, pyruvate kinase, and ⁇ -actin.
- HPTR hypoxanthine phosphoribosyl transferase
- adenosine deaminase pyruvate kinase
- ⁇ -actin ⁇ -actin
- Exemplary viral promoters which function constitutively in eukaryotic cells include, but are not limited to, promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus.
- Other constitutive promoters are known to those of ordinary skill in the art.
- Inducible promoters are expressed in the presence of an inducing agent and include, but are not limited to, metal-inducible promoters and steroid-regulated promoters.
- metal-inducible promoters include, but are not limited to, metal-inducible promoters and steroid-regulated promoters.
- the metallothionein promoter is induced to promote transcription in the presence of certain metal ions.
- Other inducible promoters are known to those of ordinary skill in the art.
- tissue-specific promoters include, but are not limited to, the SFTPC promoter (Glasser et al., 2000, Am J Physiol Lung Cell Mol Physiol, 278:L933-L945), which is specific for lung epithelial cells.
- SFTPC promoter Glasser et al., 2000, Am J Physiol Lung Cell Mol Physiol, 278:L933-L945
- Other inducible promoters are known to those of ordinary skill in the art.
- the polynucleotide described herein may also include a transcription terminator.
- Suitable transcription terminators are loiown in the art and include, for instance, a stretch of 5 consecutive thymidine nucleotides.
- Polynucleotides described herein can be produced in vitro or in vivo.
- methods for in vitro synthesis include, but are not limited to, chemical synthesis with a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic polynucleotides and reagents for in vitro synthesis are well loiown.
- Methods for in vitro synthesis also include, for instance, in vitro transcription using a circular or linear expression vector in a cell free system. Expression vectors can also be used to produce a polynucleotide described herein in a cell, and the polynucleotide may then be isolated from the cell.
- a genetically modified cell has the characteristic of altered viral replication when compared to a control cell.
- the altered replication may be an increase in viral replication or a decrease in viral replication.
- the alteration of viral replication may be an increase or a decrease of at least 0.1%, at least 0.5%, at least 1%, at least 5%, or at least 10% when compared to the replication of the virus in a control cell.
- a genetically modified cell described herein includes a virus, such as a virus that is a member of the family Orthomyxoviridae or a member of the family Paramyxoviridae.
- a genetically modified cell includes a polynucleotide described herein.
- such a cell includes a polynucleotide (e.g., a vector) that encodes a biologically active RNA, for instance, a dsRNA, an miRNA (such as a pri-miRNA, a pre- miRNA, or a mature miRNA), or a ribozyme.
- a cell includes a polynucleotide that is a biologically active RNA.
- a genetically modified cell includes an alteration of endogenous nucleotides, for instance, the genomic DNA of the cell has been edited.
- a method for making such a cell includes introducing into the cell a vector that encodes a biologically active RNA, or introducing into the cell a biologically active RNA.
- a genetically modified includes an edited genome.
- Methods for editing a coding region in a cell generally include introducing into a cell a polynucleotide that encodes an artificially engineered nuclease that recognizes a target sequence in the coding region and is able to cleave a site in the coding region (Urnov and Wang, US Published Patent Application
- polynucleotide that includes a sequence for integration is also introduced into the cell.
- the sequence for integration may include flanking upstream and downstream sequences that share sequence identity with either side of the cleavage site.
- the cells containing the introduced polynucleotide(s) are cultured under conditions suitable for expression of the artificially engineered nuclease.
- the artificially engineered nuclease introduces a double-stranded break into the genomic sequence, and the double-stranded break may be repaired by a non-homologous end-joining repair process such that a mutation is introduced into the coding region, or a homology-directed repair process such that the sequence for integration is integrated into the genomic sequence.
- compositions include one or more of the agents described herein that alter viral replication.
- agents referred to herein as active agents, include the polynucleotides described herein, and small molecules.
- Such compositions may include a pharmaceutically acceptable carrier.
- pharmaceutically acceptable carrier includes saline, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration and not deleterious to a recipient thereof.
- a composition includes a genetically modified cell.
- a composition including a genetically modified cell may include a carrier that is not deleterious to the cell, such as a tissue culture medium.
- the polynucleotide present in a composition may be DNA, RNA, or a combination thereof.
- the polynucleotide may be supplied as part of a vector that encodes and subsequently expresses the polynucleotide, or may be supplied as the polynucleotide itself (e.g., a dsRNA that acts to decrease expression of a target polypeptide or an miRNA that acts to alter viral replication).
- a composition may include other compounds for protecting against viral pathogens, including viral pathogens that are members of the family Orthomyxoviridae and/or the family Paramyxoviridae.
- Many antiviral agents are known in the art and are used routinely. Examples of such compounds include, for instance, probenicid (Tripp et al., WO2012142492), zanamivir, oseltamivir, amantadine, and rimantadine.
- a composition may be prepared by methods known in the art of pharmacy.
- a composition can be formulated to be compatible with its intended route of administration.
- the compositions disclosed herein may be administered to any tissue of an animal, including, but not limited to, tissues of the respiratory tract such as lung tissue, muscle (such as skeletal muscle or cardiac muscle), skin, brain tissue, lung tissue, liver tissue, spleen tissue, bone marrow tissue, thymus tissue, heart tissue, e.g., myocardium, endocardium, and pericardium, lymph tissue, blood tissue, bone tissue, pancreas tissue, kidney tissue, gall bladder tissue, stomach tissue, intestinal tissue, testicular tissue, ovarian tissue, uterine tissue, vaginal tissue, rectal tissue, nervous system tissue, eye tissue, glandular tissue, tongue tissue, and connective tissue, e.g., cartilage.
- the compositions disclosed herein may be any tissue of an animal, including, but not limited to, tissues of the respiratory tract such as lung tissue, muscle (such as skeletal muscle or
- a composition disclosed herein may be administered to any internal cavity of an animal, including, but not limited to, lungs, mouth, nasal cavity, stomach, peritoneal cavity, intestine, a heart chamber, veins, arteries, capillaries, lymphatic cavities, uterine cavity, joint cavities, spinal canal in spinal cord, ocular cavities, the lumen of a duct of a salivary gland or a liver.
- Compositions disclosed herein may be administered to an animal by intramuscular (i.m.), subcutaneous (s.c), or intrapulmonary routes.
- Transdermal delivery includes, but not limited to intradermal (e.g., into the dermis or epidermis), transdermal (e.g., percutaneous) and transmucosal administration (i.e., into or through skin or mucosal tissue).
- Intracavity administration includes, but is not limited to, administration into oral, vaginal, rectal, nasal, peritoneal, or intestinal cavities as well as, intrathecal (i.e., into spinal canal), intraventricular (i.e., into the brain ventricles or the heart ventricles), inraatrial (i.e., into the heart atrium) and sub arachnoid (i.e., into the sub arachnoid spaces of the brain) administration.
- intrathecal i.e., into spinal canal
- intraventricular i.e., into the brain ventricles or the heart ventricles
- inraatrial i.e., into the heart atrium
- sub arachnoid i.e., into the sub arachnoid spaces of the brain
- intrapulmonary delivery is preferred, and may be accomplished by an aerosol or spray.
- a composition may be administered in a variety of different dosage forms.
- An aqueous medium containing the composition may be desiccated and combined with pharmaceutically acceptable inert excipients and buffering agents such as lactose, starch, calcium carbonate, sodium citrate formed into tablets, capsules, and the like. These combinations may also be formed into a powder or suspended in an aqueous solution.
- the active agent may be combined with pharmaceutically acceptable carrier(s) well known in the art such as saline solution, water, propylene glycol, etc.
- the composition may be parenterally, intranasally, or orally applied by methods known in the art.
- the composition may also be administered intravenously by syringe.
- the vaccine may be combined with pharmaceutically acceptable aqueous carrier(s) such as a saline solution.
- composition may also include emulsifying and/or suspending agents as well, together with pharmaceutically acceptable diluent to control the delivery and the dose amount of the composition.
- Solutions or suspensions may include the following components: a sterile diluent such as water for administration, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates, or phosphates; electrolytes, such as sodium ion, chloride ion, potassium ion, calcium ion, and magnesium ion, and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH may be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
- a composition may be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
- compositions may include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile solutions or dispersions.
- suitable carriers include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS).
- PBS phosphate buffered saline
- a composition is typically sterile and, when suitable for injectable use, should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi.
- Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- isotonic agents for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition.
- Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
- compositions disclosed herein may be prepared with carriers that will protect the one or more active agents against rapid elimination from the body, such as a controlled release formulation, including implants.
- a controlled release formulation including implants.
- Biodegradable, biocompatible polymers may be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.
- Such formulations may be prepared using standard techniques.
- the materials may also be obtained commercially.
- Liposomal suspensions may also be used as
- an active agent may be associated with a targeting group.
- a targeting group refers to a chemical species that interacts, either directly or indirectly, with the surface of a cell, for instance with a molecule present on the surface of a cell, e.g., a receptor. The interaction can be, for instance, an ionic bond, a hydrogen bond, a Van der Waals force, or a combination thereof.
- targeting groups include, for instance, saccharides, polypeptides (including hormones), polynucleotides, fatty acids, and catecholamines. Another example of a targeting group is an antibody.
- the interaction between the targeting group and a molecule present on the surface of a cell, e.g., a receptor, may result in the uptake of the targeting group and associated active compound.
- useful targeting groups include lectins that bind to mucins present on the surface of respiratory cells.
- the polynucleotide may be delivered into the cells by, for example, transfection or transduction procedures.
- Transfection and transduction refer to the acquisition by a cell of new genetic material by incorporation of added polynucleotides. Transfection can occur by physical or chemical methods. Many transfection techniques are known to those of ordinary skill in the art including, without limitation, calcium phosphate DNA co-precipitation, DEAE-dextrin DNA transfection, electroporation, naked plasmid adsorption, cationic liposome-mediated transfection (commonly known as lipofection), .
- Transduction refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus.
- a polynucleotide described herein may be used in combination with other agents assisting the cellular uptake of polynucleotides, or assisting the release of poylnucleotides from endosomes or intracellular compartments into the cytoplasm or cell nuclei by, for instance, conjugation of those to the polynucleotide.
- the agents may be, but are not limited to, peptides, especially cell penetrating peptides, protein transduction domains, and/or dsRNA-binding domains which enhance the cellular uptake of polynucleotides (Dowdy et al., US Published Patent Application 2009/0093026, Eguchi et al, 2009, Nature Biotechnology 27:567-571, Lindsay et al, 2002, Curr. Opin. Pharmacol., 2:587-594, Wadia and Dowdy, 2002, Curr. Opin. Biotechnol. 13:52-56. Gait, 2003, Cell. Mol. Life Sci., 60:1-10).
- the conjugations can be performed at an internal position at the oligonucleotide or at a terminal postions either the 5 '-end or the 3 '-end.
- Toxicity and therapeutic efficacy of active agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 5 o (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 5 o/ED 50 .
- Compounds which exhibit high therapeutic indices are preferred.
- the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED 5 0 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC 50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of signs of disease) as determined in cell culture.
- IC 50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of signs of disease
- levels in plasma may be measured, for example, by high performance liquid chromatography.
- compositions can be administered one or more times per day to one or more times per week, including once every other day.
- treatment of a subject with an effective amount of an active compound can include a single treatment or, preferably, can include a series of treatments. Determining an effective amount of one or more polynucleotides disclosed herein depends upon a number of factors including, for example, the age and weight of the animal, the severity of the disease, and the route of administration. Based on the above factors, determining the precise amount, number of doses, and timing of doses are within the ordinary skill in the art and will be readily determined by an attending physician or veterinarian.
- the methods include the use of a genetically modified cell that permits increased virus replication compared to a control cell that does not include the same genetic
- the methods may include contacting a genetically modified cell with a virus under conditions for insertion of the virus genetic material into the cell.
- the method includes providing a genetically modified cell that includes a virus that is a member of the family Orthomyxoviridae or the family Paramyxoviridae.
- the virus is an Influenza type A virus.
- the virus is an Influenza type B virus.
- the methods include incubating a genetically modified cell that includes a virus under conditions suitable for replication of the virus. Such methods are known in the art and are routine, and typically include incubation at a temperature at, or around, 37°C, in a cell culture medium suitable for growth of the genetically modified cell and replication of the virus.
- the virus is harvested.
- Methods for harvesting virus after replication in large numbers of eulcaryotic cells are known and routine.
- the resulting virus may be prepared for use as a vaccine, which may include isolating, or purifying the virus, and optionally inactivating the virus such that the virus may be administered to a subject to obtain an immune response.
- live virus may be prepared using the methods described herein.
- Inactivation of a virus refers to rendering the virus incapable of reproducing in a cell. Methods of virus inactivation are known to the person skilled in the art and are routine.
- Examples include, for instance, treatment of a virus with heat, a standard chemical inactivating agent such as an aldehyde reagent including formalin, acetaldehyde; reactive acidic alcohols including cresol and phenol; acids such as benzoic acid and benzene sulfonic acid; lactones such as beta-propiolactone and caprolactone; amines such as binary ethyleneimine; and activated lactams, carbodiimides and carbonyl diheteroaromatic compounds such as carbonyl diimidazole.
- Treatment by heat or irradiation such as with ultraviolet and gamma irradiation may also be used to inactivate the virus.
- compositions of virus made by these methods may include a whole virus, such as an inactivated virus or an attenuated virus.
- a composition may include virus that has been disrupted.
- Such a composition often referred to as a split vaccine, may be prepared by fragmentation of whole virus, either infectious, inactivated, or attenuated, with solubilizing concentrations of organic solvents or detergents and subsequent removal of the solubilizing agent and some or most of the viral lipid material.
- Split vaccines generally contain contaminating matrix protein and nucleoprotein and sometimes lipid, as well as the membrane envelope proteins.
- Split vaccines typically contain most or all of the virus structural proteins, although not necessarily in the same proportions as they occur in the whole virus.
- Methods for disrupting virus to prepare split vaccines are known and used routinely, and typically include a number of different filtration and/or other separation steps such as ultracentrifugation, ultrafiltration, zonal centrifugation, and chromatography (e.g., ion exchange) steps in a variety of combinations, and optionally an inactivation step, which may be carried out before or after splitting.
- the splitting process may be carried our as a batch, continuous, or semi- continuous process.
- the methods include the use of a genetically modified cell that permits decreased virus replication compared to a control cell that does not include the same genetic modification(s).
- Such genetically modified cells are useful, for instance, in investigating the biology of viral replication.
- the methods may include contacting a genetically modified cell with a virus under conditions for insertion of the virus genetic material into the cell.
- the method includes providing a genetically modified cell that includes a virus that is a member of the family Orthomyxoviridae or the family Paramyxoviridae.
- the virus is an Influenza type A virus.
- the virus is an Influenza type B virus.
- the methods include administering to a cell a composition described herein.
- the composition includes a polynucleotide described herein that has the biological activity of decreasing the replication of a virus in a cell.
- the administered includes a polynucleotide described herein that has the biological activity of decreasing the replication of a virus in a cell.
- polynucleotide may be a biologically active RNA, such as a dsRNA, an miR A (such as a pri- miRNA, a pre-miRNA, or a mature miRNA), or a ribozyme.
- the administered polynucleotide may be a polynucleotide (e.g., a vector) that encodes a biologically active RNA, such as a dsRNA, an miRNA (such as a pri-miRNA, a pre-miRNA, or a mature miRNA), or a ribozyme.
- the cell may be ex vivo or in vivo.
- Treating a subject such as a human, may provide protection against the virus, reducing morbidity associated with viral infection, including the incidence of hopitalization, and reducing mortality associated with the viral infection.
- Treatment may be prophylactic or, alternatively, may be initiated after the exposure of a subject to a virus, such as an influenza A virus, an influenza B virus, or a respiratory syncytial virus.
- Prophylactic treatment refers to the use of a composition described herein with a subject which has not yet been exposed to a virus, thereby preventing or reducing disease signs if the subject is later exposed to such a virus.
- Treatment that is prophylactic, for instance, initiated before a subject manifests signs of viral infection is referred to herein as treatment of a subject that is "at risk" of developing a viral infection.
- Treatment initiated after the exposure of a subject to a virus may result in decreasing the severity of the signs, or completely removing the signs.
- an "effective amount" is an amount effective to prevent the manifestation of signs of a viral infection, such as influenza, decrease the severity of the signs of a viral infection, and/or completely remove the signs.
- the methods therefore may be referred to as therapeutic vaccination or preventative or prophylactic vaccination. It is not required that any composition described herein provide total immunity to a virus or totally cure or eliminate all disease signs of a viral infection.
- the methods may include administering a composition described herein to a subject.
- the administered composition may include one or more polynucleotides described herein that have the biological activity of decreasing the replication of a virus in a cell.
- the administered polynucleotide may be a biologically active RNA, such as a dsPvNA, an miRNA (e.g., a pri-miRNA, a pre-miRNA, or a mature miRNA), or a ribozyme.
- the administered polynucleotide may be a polynucleotide (e.g., a vector) that encodes a biologically active RNA, such as a dsRNA, an miRNA (e.g., a pri-miRNA, a pre- miRNA, or a mature miRNA), or a ribozyme.
- a biologically active RNA such as a dsRNA, an miRNA (e.g., a pri-miRNA, a pre- miRNA, or a mature miRNA), or a ribozyme.
- the subject may be any animal susceptible to infection by a virus that is a member of the family Orthomyxoviridae or the family Paramyxoviridae, including, but not limited to, a vertebrate, more preferably a mammal (such as a pig, a mouse, a ferret, or a human), or an avian (such as a bird).
- a mammal such as a pig, a mouse, a ferret, or a human
- avian such as a bird
- birds include, but are not limited to, feral birds such as ducks and geese, and domesticated birds such as turkeys, chickens, ducks, and geese.
- a composition may be delivered to a subject by methods described herein and known in the art, thereby achieving an effective therapeutic vaccination or preventative vaccination.
- kits that includes a polynucleotide described herein, a genetically modified cell, or a composition that includes such a polynucleotide or genetically modified cell.
- a polynucleotide may be used to alter viral replication in a cell, and/or treat a subject having or at risk of developing a viral infection.
- a kit includes, includes at least, or includes no greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
- kits includes, includes at least, or includes no greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
- RNAs such as miRNAs or miRNA inhibitors, where the one or more biological RNAs are encoded by one or more vectors.
- the polynucleotide and/or genetically modified cell may be present in a suitable packaging material in an amount sufficient for at least one use.
- other reagents such as buffers and solutions may be included.
- packaging material refers to one or more physical structures used to house the contents of the kit.
- the packaging material is constructed by known methods, preferably to provide a sterile, contaminant-free environment, and may include a container, such as a tube, bottle, vial, syringe, or other suitable container means.
- the packaging material has a label which indicates how the polynucleotides and/or
- genetically modified cells can be used.
- Influenza A virus causes seasonal epidemics and periodic pandemics threatening the health of millions of people each year.
- Vaccination is an effective strategy for reducing morbidity and mortality, and in the absence of drug resistance, the efficacy of chemoprophylaxis is comparable to that of vaccines.
- the rapid emergence of drug resistance has emphasized the need for new drug targets.
- Knowledge of the host cell components required for influenza replication has been an area targeted for disease intervention.
- the human protease genes required for influenza vims replication were determined and validated using RNA interference approaches.
- the genes validated in influenza virus replication were ADAMTS7, CPE, DPP3, MST1, and PRSS12, and pathway analysis showed these genes were in global host cell pathways governing inflammation (NF-kB), cAMP/calcium signaling (CRE/CREB), and apoptosis. Analyses of host microRNAs predicted to govern expression of these genes showed that eight miRNAs regulated gene expression during virus replication. These findings identify unique host genes and microRNAs important for influenza replication providing potential new targets for disease intervention strategies.
- A549 cells (ATCC CCL-185) were cultured in Dulbecco's modified Eagle's medium (DMEM) (HyClone, Logan, UT) containing 5% heat-inactivated FBS (HyClone, Logan, UT). Cells were frozen in 10% DMSO and 90% FBS to create one stock of a single cell passage that was used for the entire screen.
- DMEM Dulbecco's modified Eagle's medium
- FBS Hex-inactivated FBS
- a stock of MDCK cells (ATCC CCL-34) was also propagated and stored using the same conditions.
- A/WSN/33 H1N1 influenza virus was used for the primary siRNA screen as this virus has the ability to replicate without the need for exogenous trypsin (Someya et al., 1990, Biochemical and biophysical research communications 169:148- 152).
- H1N1 influenza virus was also used. All viruses were propagated in 9-day-old embryonated chicken eggs as previously described (Woolcock et al, 2008, Methods Mol Biol 436:35 ⁇ 16). Viruses were titrated in MDCK cells and titers calculated by the method developed by Reed and Muench (1938, The American Journal of Hygiene 27:493 ⁇ 197). Protease library screen
- a primary screen using four pooled siRNAs to target each gene of the 481 genes in the human protease library was performed using A/WSN/33 influenza virus and type II human alveolar pneumocytes (A549 cells) similar to a method previously described (Konig et al., 2009, Nature 463:813-817).
- siRNAs were resuspended in Dharamcon siRNA buffer to a concentration of 1 uM and stored at -80°C until use.
- the screen was conducted in two steps, a primary screen targeting all 481 human protease genes, followed by a smaller-scale validation screen of the primary hits to confirm the genes identified were essential for influenza virus replication.
- siRNA targeting the MEK gene (siMEK), a well-characterized human kinase gene important for influenza replication (Basler 2007, Infect Disord Drug Targets 7:282-293, Kumar et al., 2011, Journal of Virology 85:2818-2827), was used to control for the transfection efficiency and host gene silencing.
- siNEG non-targeting siRNA control
- siRNA SMARTpool library constituents siMEK, and siNEG transfected A549 cells at >85% efficiency, and a few ( ⁇ 2%) siRNA pools targeting HP genes induced cytotoxicity as determined by adenylate kinase (AK) release in the cell culture supernatant (Crouch et al., 1993, Journal of Immunological Methods 160:81-88, Olsson et al., 1983, Journal of applied biochemistry 5:437-445) and by visual inspection of cell morphology.
- AK adenylate kinase
- the primary screen was analyzed using a scaling methodology that sets the non-targeting control siRNA (siNEG) at an arbitrary value of 1.0, and the negative control siTOX at zero.
- siRNAs targeting host genes were assigned a score based on the distribution of these values.
- standard deviations from the plate mean in both duplicate assays were considered primary hits.
- Twenty-four genes were identified as "primary hits”. Hits that caused greater than 20% cytotoxicity in A549 cells were excluded (Figure 1 A).
- Z-scores were computed based on this data for each gene hit and those > ⁇ .5 ⁇ and ⁇ -l .5 ⁇ were considered for validation.
- HBSS HyClone, Logan, UT
- Dharmafect-1 transfection reagent Lafayette, CO
- HBSS HBSS
- the siRNA/transfection reagent mix was allowed to incubate for 20 minutes at room temperature after which 0.08 ml of 1.5xl0 4 A549 cells suspended in DMEM/5% FBS was added to each well, and the plate incuba ted for 48 hours at 37°C in 5% C0 2 .
- the final concentration of siRNA for all primary screen transfections was 50 nM.
- siRNA transfected A549 cells were analyzed for adenylate kinase (AK) using a Toxilight kit (Lonza, Rockland, ME). Results were normalized to a siTOX control, i.e. a siRNA control (Dharmacon) causing complete cell death by 48 hours. siRNA transfected cells with luminescence greater than or equal to 20% of the siTOX control were not considered for further evaluation.
- A549 cells were subsequently infected with A/WSN/33 at an MOI of 0.001 pfu/cell. Cells were incubated for 48 hours at 37°C/5% C0 2 .
- Virus titers in siRNA-treated A549 cells infected with A/WSN/33 were determined by modified TCID 50 or hemagglutination assay (HA). Briefly, virus infected A549 cell culture supernatants were serially diluted ten-fold, and added to MDCK cells. The MDC cell plates were incubated for 72 h, followed by an HA using 0.5% chicken red blood cells as previously described (Subbarao et al., 1992, J Clin Microbiol 30:996-999). To further identify gene hits the cells were screened for nucleoprotein (NP) by IHC staining and evaluated using high content analysis.
- NP nucleoprotein
- NP staining the cells were fixed with 3.7% formaldehyde and stained with anti-NP monoclonal antibody (5 ug/ml; H16-L10-4R5) and the antibody staining detected using Alexa Fluor 488 labeled goat anti-mouse IgG (1 ug/ml; Invitrogen, Carlsbad, CA). Cells were counterstained with DAPI (2 ug/ml) (Invitrogen, Carlsbad, CA) and visualized by
- PCR was performed using the amplification cycle: 10 minutes at 95°C followed by 40 cycles of 95°C for 30 seconds, 60°C for 1 minute, and 72°C for 30 seconds. M gene copies were normalized to the siNEG control.
- A549 cells were untreated, treated with 50 nM of the siNEG control, or treated with 50 nM of the appropriate siRNA. After 72 hours, cells were lysed in 1% TritonX-100 and proteins from total cell lysate were separated on a 4-20% Tris-HCl precast SDS PAGE gel (BioRad, Hercules, CA) and transferred to a PVDF membrane.
- Membranes were blocked in 5% BSA/TBS- 0.05% tween and incubated with 1 ug/ml rabbit polyclonal primary antibodies to ADAMTS7, CPE, DPP3, MST1, or PRSS12 (Abeam, Cambridge, MA).
- a goat anti-rabbit alkaline phosphatase-conjugated secondary antibody (Invitrogen) was used to visualize the proteins.
- Reporter plasmids used to confirm pathway were obtained from SABiosciences/Qiagen as a dual luciferase Cignal Reporter Assay Kit.
- the reporters consisted of a transcription factor of interest linked to a firefly luciferase gene, a positive control plasmid (luciferase linked to a CMV promoter), and a negative control plasmid (luciferase with no promoter).
- A549 cells were co-transfected with 100 nM of siRNA and 100 ng of the appropriate plasmid (reporter, positive, or negative control plasmids) using either the SureFECT (SABiosciences) or Attractene (Qiagen) transfection reagents.
- the plasmid kit also contains a Renilla luciferase plasmid fused to a CMV promoter, and all data was normalized to Renilla luciferase expression. After 24 h of transfection, cells were allowed to rest for one day and then infected with
- Cell lysate was taken and luciferase expression was measured using a Safire2 Microplate reader (Tecan, Mannedorf, Switzerland).
- Apoptosis array
- a human apoptosis array was obtained from SABiosciences/Qiagen.
- A549 cells were transfected with 50 nM of either the appropriate siRNA or siNEG. After 48 h, cells were infected with A/WSN/33 at an MOI of 0.001.
- RNA was isolated 18 hpi, a time point chosen because it is late enough for apoptosis modulation to become evident at the transcriptional level, but sufficiently early such that cells were not destroyed (Schultz-Cherry et al., 2003, Avian diseases 47:968-971), and then treated with DNase I to remove any genomic DNA.
- cDNA was synthesized using an RT First Strand Kit (SABiosciences) and PCR was performed using RT S YBR Green Master Mix (SABiosciences) per the manufacturer protocol. Data was analyzed by calculating 2 (_ ⁇ ) . Silencing of the protease genes relative to siNEG-treated cells was confirmed for each independent experiment. miRNA studies
- a library of miRNA hairpin inhibitors synthesized as RNA oligonucleotides with novel secondary structure designed to inhibit the function of endogenous miRNA, and chemically enhanced to improve efficacy and longevity were used to target host cell miRNAs identified as potential regulators of host genes validated as important for influenza virus replication. miRNA mimics were not used since treatment with mimics results in extremely high concentrations of miRNA relative to biological levels. In these studies, A549 cells (1.5xl0 4 ) were transfected with 25 nM of an appropriate miRNA inhibitor using
- Viral replication was assayed by TCID 50 and qPCR for M gene as described above.
- Gene specific primers were also used to quantify changes in host gene expression in cells receiving the miRNA inhibitors using
- a primary RNAi screen of 481 host protease genes in a human type II respiratory epithelial cell line (A549) identified 24 genes important for A/WSN/33 influenza virus replication (Figure 2).
- the gene hits identified were >1.5 ⁇ and ⁇ — 1.5 ⁇ from the mean Z-score.
- Endpoint validation of the gene hits in the primary screen included influenza nucleoprotein (NP) cell localization determined by immunohistochemistry, determining the level of infectious virus by TCID 5 o assay, as well as influenza matrix (M) gene copy number determined by qPCR (data not shown).
- NP nucleoprotein
- M influenza matrix
- a novel siRNA targeting the same gene but at a different seed site was required to produce the same phenotype as observed in the screen.
- RNAi silencing Protein levels of the protease genes were assessed to ensure that RNAi silencing was decreasing target gene expression (Figure 3). After validation, five genes were identified that decreased virus replication when silenced: ADAMTS7, CPE, DPP3, MST1, and PRSS12 (Table 2). Silencing of these protease genes did not cause cytotoxicity in A549 cells compared to the cytotoxicity (siTOX) control. siMEK (an siRNA targeting MAP2K) and siNEG (a negative, non- targeting siRNA control) both displayed low level cytotoxicity possibly due to the importance of ME in cellular signaling, and the induction of an inflammatory response to siNEG due to off- target effects (Figure 1 A).
- RNAi of MST1 by siRNA targeting led to a significant (p ⁇ 0.05) increase in CRE/CREB signaling compared to the siNEG and CRE controls in the presence or absence of influenza virus infection ( Figure 6A).
- RNAi of PRSS12 by siPRSS12 did not affect CRE/CREB activation relative to controls.
- Pathway analysis also indicated that ADAMTS7, CPE, and MST1 genes were potentially involved in the NF-KB activation pathway (Figure 5).
- siCPE did not affect NF- ⁇ activation under mock conditions, but during infection NF- KB activation levels were significantly (p ⁇ 0.05) downregulated. siMSTl also had a negative effect on NF- ⁇ activation regardless of infection. Elevated NF-KB levels were also seen in controls receiving the NF-i B plasmid alone but this was not significant compared to siNEG controls.
- Table 3 Expression ratios for pro- and anti-apoptotic genes in A549 cells treated with siRNA for protease gene targets 3 ' 13
- CD40 1.22 ⁇ 0.14 0.83 ⁇ 0.03 1.74 ⁇ 0.50 1.11 ⁇ 0.09 1.45 ⁇ 0.19
- IGF1R 0.75 ⁇ 0.04 0.72 ⁇ 0.06 1.04 ⁇ 0.17 0.52 ⁇ 0.01 0.71 ⁇ 0.10
- TNFRSF10A 1.03 ⁇ 0.04 0.58 ⁇ 0.02 0.80 ⁇ 0.23 0.70 ⁇ 0.01 0.75 ⁇ 0.12
- TNFRSF1A 1.14 ⁇ 0.09 0.73 ⁇ 0.04 1.58 ⁇ 0.34 0.93 ⁇ 0.01 1.00 ⁇ 0.13
- TNFRSF25 1.24 ⁇ 0.37 0.60 ⁇ 0.13 6.40 ⁇ 3.02 1.05 ⁇ 0.27 1.04 ⁇ 0.21
- CD70 1.47 ⁇ 0.22 0.36 ⁇ 0.001 0.90 ⁇ 0.05 0.57 ⁇ 0.01 0.88 ⁇ 0.28
- miRNAs govern host genes required for influenza replication
- the primary and secondary RNAi screens were performed with A/WSN/33 influenza virus because of its ability to replicate in the absence of trypsin in a type II respiratory epithelial (A549) cell line. All five genes showed reduced A/WSN/33 titers and some showed a substantial decrease in NP staining to the level where NP was not detected using a NP- specific monoclonal antibody. This may have been due to an inability of the virus to reenter the host cells for subsequent infection as a consequence of protease gene silencing. To confirm the findings for WSN/33 infection, the five validated genes were assessed against a clinical influenza virus strain, i.e. A/New Caledonia/20/99.
- RNAi silencing of all five genes resulted in decreased levels of A/New Caledonia/20/99 replication.
- previous RNAi host factor screens for influenza virus replication did not identify any of the five protease genes in this study, the same host cell pathways were identified which included the genes validated in this study (Konig et al., 2009, HNature 463:813-817, Brass et al., 2009, Cell 139:1243-1254, Hao et al., 2008, Nature 454:890-893, Karlas et al., 2010, Nature. Shapira et al., 2009, Cell 139:1255-1267).
- ADAMTS7, CPE, DPP3, MSTl, and PRSS12 were involved in three previously identified host cell pathways, specifically CRE/CREB signaling, NF- ⁇ activation, and apoptosis. It is likely that different pathway interaction is co-opted by the virus at different stages in the virus replication process, but further study is needed to determine the exact process.
- An additional caveat may be the use of an immortalized cell line to identify gene hits. Clonal cell lines can have misregulated gene expression relative to primary cells, particularly for genes involved in cell growth and differentiation (Ostano et al., 2012, Omics:a journal of integrative biology 16:24-36). Use of a primary human cell line to perform this study, e.g.
- NHBE normal human bronchial epithelial
- primary cells often have reduced transfection efficacy and issues with maintenance of a uniform stage of differentiation that makes it difficult to perform high-throughput screening (Meliopoulos et al., 2012, The FASEB J). Therefore, it is possible that some genes discovered may not translate to a primary cell line, so further evaluation is needed to confirm the results of this study.
- CRE/CREB signaling is an important cellular process that serves a variety of functions.
- CRE/CREB signaling in response to influenza infection, CRE signaling levels in cells treated with siPRSS 12 were unchanged compared to both pathway reporter and siNEG controls.
- RNAi of the MST1 gene resulted in significantly higher CRE signaling levels regardless of infection.
- ADAMTS7, CPE, and MST1 have been shown to have a role in tissue injury and inflammation (Mallakin et al, 2006, Am J Respir Cell Mol Biol 34:15-27, Luan et al., 2008, Osteoarthritis Cartilage 16:1413-1420, Johnston et al, 2006, Am J Physiol Regul Integr Comp Physiol 290 :R126-133), and pathway analysis performed in this study identifying their linkage to NF-KB pathway activation is consistent with these earlier findings. However, there was no significant effect of these genes on the NF- ⁇ pathway relative to controls.
- NF- ⁇ signaling may involve ADAMTS7 and DPP3.
- ADAMTS7 plays a role in maintenance of the extracellular matrix (Luan et al, 2008, Osteoarthritis Cartilage 16:1413-1420) and DPP3 is a metallopeptidase, it is possible that silencing these genes is decreasing the inflammatory response because less damage is being done to basement tissue.
- ADAMTS7 has also been shown to be upregulated by TNF-a and IL- ⁇ secretion (Luan et al., 2008, Osteoarthritis Cartilage 16:1413-1420), both of which are activated upon influenza infection (Wang et al., 2010, The Journal of Infectious Diseases 202:991-1001).
- DPP3 is involved in apoptosis modulation and is over-expressed in cancerous cells
- RNAi of the DPP3 gene was performed to evaluate the effect on apoptotic gene expression.
- the results showed induction of BCL2L10, TNFSF10, TNFRSF25 and TNFSF8 pro-apoptotic genes.
- BCL2L10 is a pro-apoptotic gene that interacts with caspase 9 to signal apoptosis (Kim et al, 2009, Cellular physiology and biochemistry: international journal of experimental cellular physiology, biochemistry, and pharmacology 23 :43-52), and TNFSF8 and TNFRSF25 are involved in the pro-inflammatory response through NF- ⁇ signaling (Wright et al., 2007, The Journal of biological chemistry 282:10252-10262, Fang et al., 2008, The Journal of experimental medicine 205:1037-1048).
- TNFSF10 also known as TRAIL
- TRAIL has been shown to be involved in H5N1 virus-induced apoptosis in human monocyte-derived macrophages (Ekchariyawat et al., 2011, Innate immunity). Since DPP3 silencing resulted in a sharp decrease of influenza replication as quantified by TCID 50 and NP staining, the findings suggest that reducing DPP3 gene expression causes influenza virus infected cells to initiate apoptosis without interference by the known anti- apoptosis activities of the influenza NSl protein (Hale et al., 2008, J Gen Virol 89:2359-2376).
- Host gene expression is governed by miRNAs (Carthew et al., 2009, Cell 136:642-655, Djuranovic et al, 2011, Science 331 :550-553), thus it is important to understand potential miRNA regulation of host genes validated as required for influenza virus replication.
- the results from the miRNA hairpin inhibitor studies showed that targeting the predicted miRNAs had a considerable and significant outcome on most host gene expression. For example, inhibition of miR-106B and miR-124* resulted in 20-fold and 40-fold increased ADAMTS7 gene expression levels, respectively, while CPE gene expression was slightly reduced by miRNA inhibitors. As expected, some miRNA inhibitors had differential effects on host genes required for influenza virus replication.
- miRNA inhibitors also affected influenza virus replication.
- inhibition of miR-106B a miRNA known to cause cell cycle arrest when inhibited in a laryngeal cancer model (Cai et al., 2011, Journal of experimental & clinical cancer research:CR 30:73), resulted in substantially decreased virus replication.
- HPKs Human protein kinases
- siRNA small interfering RNA screen of 720 HPKs was performed. From the screen, 17 HPKs (NPR2, MAP3K1, DYRK3, EPHA6, TPK1, PDK2, EXOSC10, NEK8, PLK4, SGK3, NEK3, PANK4, ITPKB, CDC2L5 (CDK13), CALM2, PKN3, and HK2) were validated as essential for A/WSN/33 influenza virus replication, and 6 HPKs (CDK13, HK2, NEK8, PANK4, PLK4 and SGK3) were identified as vital for both A/WSN/33 and A/New
- HPKs Caledonia/20/99 influenza virus replication. These HPKs were found to affect multiple host pathways and regulated by miRNAs induced during infection. Using a panel of miRNA agonists and antagonists, miR-149* was found to regulate NEK8 expression, miR-548d-3p was found to regulate MAPKl transcript expression, and miRs -1228 and -138 to regulate CDK13 expression. Upregulation of miR-34c induced PLK4 transcript and protein expression and enhanced influenza virus replication, while miR-34c inhibition reduced viral replication. These data identify HPKs important for influenza viral replication and show the miRNAs that govern their expression.
- A549 human lung epithelial cells (CCL-185, ATCC) and Madin-Darby canine kidney cells (MDCK, CCL-34, ATCC) were used for all assays from a frozen stock stored in 10% DMSO and 90% fetal bovine serum (FBS), in liquid nitrogen.
- the cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM, HyClone, ThermoScientific) supplemented with 5% heat-inactivated FBS (HyClone, Thermo Scientific) at 37°C and 5% C0 2 . All cells were confirmed to be free of mycoplasma using a PlasmoTest kit (InvivoGen, San Diego, CA).
- Influenza A/WSN/33 (H1N1) virus was obtained from Richard Webby (St Jude's Children Research Hospital, Memphis, TN) and A/New Caledonia/20/99 (H1N1) was obtained from the Centers for Disease Control and Prevention, Atlanta, GA.
- the influenza viruses were grown in the allantoic cavities of 9-day-old embryonated chicken eggs as previously described (Woolcock et al., 2008, Methods Mol Biol 436:35-46).
- Virus stocks were titrated in MDCK cells as previously described (Matrosovich et al., 2006, Virology Journal 3:63) and a 50% tissue culture infectious dose (TCID 50 ) was determined using the method described by Reed and Muench (1938, The American Journal of Hygiene 27:493-497).
- the siGENOME library is shipped as a series of 96 well plates with 0.5 nmol of lyophilized siRNA per well.
- the HPK library contains 9 master plates (a total of 720 gene targets).
- a siRNA arrayed library containing four pooled siRNAs per target gene for 720 different human protein kinase genes was used for the primary siRNA screen.
- siGENOME smartpool CCAGAAAGCUAAUUCAUCU (SEQ ID NO: 148), siGENOME smartpool, Dharmacon M- 003571-01), a negative non-targeting control siRNA (siNEG, 5'-
- SMARTpool siRNA reagent used in the primary screen was validated for on-target activity by Dharmacon ThermoFisher and consists of four rationally designed siRNAs targeting a distinct region of the target mRNA to achieve gene knockdown and reduce the incidence of off target effects (Table 4). To assure maximum silencing of target gene expression in our system, transfection and detection conditions were first optimized using the validated SMARTpool siMEK positive control (Figure 11).
- siRNA duplexes The sequences for all siRNA duplexes provided with Dharmacon' s siGENOME libraries are proprietary and confidential and are not listed; however, the siRNA duplexes are commercially available. A list of the 720 HPK targeted by the library are listed in Table 5, as well as the siRNA sequences used for validation screen. All siRNAs were resuspended in Dharmacon siRNA buffer to a concentration of 1 ⁇ and stored at -80°C. Table 4.
- RNA interference (RNAi) experiments were carried out according to the Minimum Information for an RNAi Experiments (MIARE) guidelines (Haney et al, 2007, Pharmacogenomics 8:1037-1049).
- the infection assay involved lh incubation at 37°C with either A/WSN/33 or A/New Caledonia/20/99 at the indicated multiplicity of infection (MOI). After lh incubation at 37°C, cells were rinsed with PBS and replenished with fresh media without virus. Cells used to study A/WSN/33 were cultured and infected in DMEM supplemented with 5% FBS and cells used to study A/New Caledonia/20/99 in DMEM supplemented with 0.2% bovine serum albumin (Sigma Aldrich) and l ⁇ g/mL of TPCK trypsin (Worthington).
- MOI multiplicity of infection
- TCID50 Crohn's disease .
- 2 x 10 4 MDCK cells per well in 100 ⁇ were plated in a 96-well flat- bottom cell culture plate.
- the virus samples were 1/10 serially diluted and each diluted sample was used to infect the replicate wells by incubating 50 ⁇ of the sample on a confluent monolayer of MDCK cells at 37°C and 5% C0 2.
- the supernatants from all wells were transferred to a V-bottom plate.
- the primary screen data was normalized by correcting the raw data for across plate variation. Specifically, the percent inhibition of infectious virus was calculated for each experimental siRNA such that the difference of the experimental HPK siRNA treated well (XsiHPit) was subtracted from the mean of the negative control well values (X SINEG ) and then divided by the difference of the means of the negative control and the TOX control (X s iTox) for each plate:
- the primary screen was performed in at least two mdependent experiments, and each experiment was performed in duplicate, yielding a dataset of > 4 replicates for each X S MPK-
- the mean of the replicates for each of the 720 X SI HPK was calculated and the resulting dataset was standardized using Z-score analysis (Table 5), whereby the mean ( ⁇ ) of the data becomes zero and the standard deviation (SD) becomes 1.
- a "positive hit" in the primary screen was considered to have a Z-score > ⁇ ⁇ 2 SD using the formula below.
- RNA from A549 cells was isolated using an RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. The quantity of total RNA was determined using a NanoDrop ND-1000 Fluorospectrometer (NanoDrop Technologies, Wilmington, DE). Equal amounts of RNA were then reverse transcribed to cDNA using random hexamers and MuLV reverse transcriptase (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems) in accordance to the manufacturer's protocol.
- qPCR was performed using 200 nM internal probe (M + 64, 5 '-FAM-TCA GGC CCC CTC AAA GCC GA-BHQ-1 -3 '), 400 nM forward primer (M + 25, 5 ' - AGATGAGTCTTCTAACCGAGGTCG (SEQ ID NO:187), and 400 nM reverse primer (M-124, 5 ' -TGC AA A AAC ATCTTC A AGTCTCTG (SEQ ID NO: 188)) following a previously described TaqMan assay (Spackman et al., 2002, J Clin Microbiol 40:3256-3260).
- the cycling conditions for qPCR were 95°C for 10 min followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 15 sec.
- the qPCR was carried out and analyzed with a Stratagene Mx3005P instrument and software (La Jolla, CA). Copy numbers were determined by generation of a standard curve using plasmid DNA encoding influenza M gene (Spackman et al., 2002, J Clin Microbiol 40:3256-3260). Results reported for these studies were the averages of at least three replicates.
- qPCR was performed using QuantiTect SYBR Green PCR Master Mix (Qiagen) according to the manufacturer's instructions with the primer sequences described in Table 6. Relative expression level was calculated using the endogenous control glyceraldehyde 3 -phosphate dehydrogenase (GAPDH). Fold changes were calculated against the mean of negative control siRNA treated cells. Methodology and data analysis for all qPCR experiments were carried out according to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines (Bustin et al, 2009, Clin Chem 55:611-622).
- MIQE Minimum Information for Publication of Quantitative Real-Time PCR Experiments
- A549 cells were fixed with 3.7% formaldehyde and permeabilized with 0.5% Triton X- 100 (Sigma), 10%> FBS (Hyclone) in PBS.
- A549 cells were incubated with a primary antibody against the viral NP (25 ⁇ g/mL, H16-L10, HB65; ATCC) diluted in PBS with 10% FBS for lh at room temperature.
- the cells were incubated with Alexa-488 goat anti-mouse secondary antibody (Al 1001, Invitrogen) diluted 1:500 in PBS with 10% FBS for lh in the dark, and the cells were subsequently stained for 20 min with 1 ⁇ g/mL of 4'-6-Diamidino-2- phenylindole stain (DAPI, Invitrogen).
- DAPI 4'-6-Diamidino-2- phenylindole stain
- the cells were imaged using the EVOS digital inverted fluorescent microscope (Advanced Microscopy Group, Bothell, WA) at two wavelengths, 488 ran to detect Influenza infected cells expressing NP, and 350 nm for nuclear DNA bound by DAPI.
- DAPI 4'-6-Diamidino-2- phenylindole stain
- A549 cells in 96 well plates were transfected with HPK specific miRNA inhibitors or mimics and incubated for 48h. Cells were fixed with 4% formaldehyde in PBS and
- DAPI fluorescence was measured in channel 1 and Alexa 488 fluorescence was measured in channel 2.
- a minimum of 5000 valid channel 2 objects were counted per well in triplicate for each mimic/inhibitor treatment. Data was exported into csv files and statistically analyzed using GraphPad Prism version 5.0. miRNA target prediction and literature analysis
- miRNAs targeting the selected HPKs were mined using miRWalk (Dweep et al., 2011, J Biomed Inform 44:839-847). Briefly, miRWalk tabulates the miRNAs targeting a gene of interest based on predictions from multiple algorithms and can be used to either find miRNAs targeting a gene(s) or vice versa. Lists were exported into spreadsheets containing data on miRNA deregulation during influenza infection and compared. Most predictions with significant scores have (1) a significant seed region match and (2) are evolutionarily conserved as per TargetScan (Lewis et al., 2005, Cell 120:15-20). miRNA validation
- A549 cells (2 x 10 4 ) were transfected with either a miRIDIAN miRNA antagonist (25 nM), a miRIDIAN miRNA agonist (12.5 nM) (Dharmacon), or a siRNA targeting the HPK under study using Lipofectamine 2000 (Invitrogen) per the manufacturer's protocol.
- miRNA- let- 7f (expressed at ⁇ 750 copies in A549 cell [Johnson et al., 2007, Cancer Res 67:7713-7722]) was used to optimize inhibitor or mimic concentrations and at 25nM miRNA antagonist
- the miRIDIAN miRNA antagonists are chemically modified dsRNAs consisting of a central region complementary to the mature miRNA flanked by 0-16 nt long sequences with reverse complement to pri-miRNA to enhance specificity and reduce RISC incorporation (Esau 2008, Methods 44:55-60, Krutzfeldt et al., 2005, Nature 438:685-689, Vermeulen et al, 2007, RNA 13:723-730).
- agonists are chemically modified dsRNAs that increased the guide strand concentration in RISC complex, thus increasing native miRNA mediated repression (Vermeulen et al., 2007, RNA 13:723-730, Xiao et al., 2007, J Cell Physiol 212:285-292).
- Virus replication and HPK knockdown was assayed by high content microscopy and HPK expression was analyzed using qPCR (for transcript) and high content screening (for protein).
- qPCR for transcript
- high content screening for protein
- 18S rRNA was used as housekeeping control. Fold changes were calculated against the mean of mock treated cells.
- RNAi screen identifies host kinase genes important for influenza virus replication.
- HPKs are key mediators of signaling events in a cell and inhibition of HPKs has been shown to reduce progeny virus production both in vitro and in vivo (Droebner et al., 2011, Antiviral Res 92:195-203).
- an RNAi-based genetic screen was performed and validated (Figure 13). siRNA SMARTpools individually targeting 720 different HPKs were transfected into A549 cells followed by influenza A/WSN/33 infection.
- Levels of infectious virus were determined by TCID50 and effects of siRNA treatment quantified using a z-score method where a positive z- score (>2.0) indicates HPK knockdown resulting in an increase in viral replication and a negative z score ( ⁇ -2.0) value indicates a resulting decrease in virus replication.
- NPR2 natriuretic peptide receptor B/guanylate cyclase B 2.64 6.5
- MAP3K1 mitogen-activated protein kinase kinase kinase 1 2.55 5.7
- the novel siRNAs targeting genes CDK3, PRKAG3, ERBB4, and C90RF96 were unable to knockdown mRNA expression and were excluded from the validation screen.
- Transfection of A549 cells with the novel siRNAs for the 18 HPKs followed by A/WSN/33 influenza infection modulated influenza replication significantly (pO.01) similar to those obtained in the primary screen confirming the relevance of the HPK genes (Figure 14A).
- Figure 14B additional endpoint assays that included measurement of viral genome replication by qPCR
- Figure 14C influenza nucleoprotein high content analysis
- the false-negative rate decreases to 23% because 37 HPK genes can be identified that overlap with HPK genes discovered in related published screens (Brass et al., 2009, Cell 139:1243-1254, Hao et al., 2008, Nature 454:890-893, Karlas et al, 2010, Nature, 463:818-22, Konig et al, 2009, Nature 463:813-817, Shapira et al, 2009, Cell 139:1255-1267). Since only the ADK gene was not validated, the false-positive rate in the primary screen was 4.5% (1 out of 22).
- Influenza virus A/WSN/33 was chosen for the primary and validation screens based on its stability and ability to replicate without exogenous trypsin. However, because it is a lab- adapted strain, a more pertinent influenza virus strain was tested to be sure the validated HPK hits were important for other influenza viruses regarding replication. Therefore, A549 cells were transfected with siRNAs targeting the hit HPKs and subsequently infected with influenza A/New Caledonia/20/99 ( Figure 15). Of the 17 HPK genes identified important for A/WSN/33 replication, six (CDK13, HK2, NEK8, PANK4, PLK4, SGK3) emulated the phenotype following A/New Caledonia/20/99 infection, i.e.
- miRNA inhibitors are miRNA-specific and able to distinguish between different members of the same miRNA family
- miRNA mimics affect native levels of all members of a miRNA family especially when the seed sites are conserved. Based on the dogma of miRNA action, it is expected that miRNA inhibition which increases gene expression and miRNA upregulation which decreases gene repression relative to non-targeting controls are evidence suggestive that miRNAs post-transcriptionally affect target gene expression.
- miR-548d mimics, but not inhibitor treatment, caused increased MAP3K1 protein (Figure 19B). This is may be due to significant "seed identity" between >20 members of the 68 member strong miR-548 family, and seed shifting between miR-548d members that can lead to off-target effects (Liang et al, 2012, J Biomed Biotechnol 2012:679563).
- transfection of miR-548d mimic is expected to deregulate expression of other mRNAs and could explain the upregulation of MAPKl protein seen with mimic transfection. Indeed, replication of A/WSN/33 is reduced in miR-548d inhibitor transfected cells.
- miR-34c-3p has been shown previously to be a major miRNA induced during infection with both H1N1 and H5N1 influenza viruses (Loveday et al., 2012, J Virol 86:6109-6122), although its role in influenza biology is presently incompletely understood. These data show that HPKs important for influenza virus replication are regulated by influenza deregulated miRNAs.
- influenza virus biology has revealed complex mechanisms by which the influenza virus co-opts host cellular pathways to facilitate virus replication and evade the antiviral response.
- interactions between the virus and specific host cell components are now being identified and have led to new insights into viral and host interactions at different stages of the life cycle.
- a direct outcome of these studies can be the repurposing of old drugs for new conditions as was recently demonstrated for influenza (Perwitasari et al., 2013, Antimicrob Agents Chemother 57:475-483).
- the objective of this study was to identify human protein kinases that regulate influenza virus replication and their regulation by miRNAs during influenza infection.
- a genome-wide siRNA screen of 720 HPK members was evaluated for the HPK family consisting of multiple kinase classes. This screen identified 22 HPK that upon silencing led to increased or decreased influenza virus replication. Three HPKs (NPR, MAP3K1 and DYRK3) when silenced led to increased viral replication, suggesting that they have anti-viral activity. The remaining 19 HPKs when silenced decreased virus replication significantly, suggesting that they are pro-viral and indispensable for viral replication.
- the preliminary hits identified from the primary screen were silenced using siRNAs targeting a novel seed site in the same gene and tested for impact on viral replication using multiple endpoint assays that evaluated viral genome, virus replication, and NP staining.
- a total of 18 HPKs (NPR2, MAP3K1, DYRK3, EPHA6, TPK1, PDK2, EXOSC10, NEK8, PLK4, SGK3, NEK3, PANK4, ITPKB, CDK13, CALM2, ADK, PKN3, and HK2) passed this secondary validation and were tested with a seasonal strain of influenza virus where six HPKs that were identified as necessary for replication. It should be noted that other genes identified in the primary screen, i.e.
- CDK3, PRKAG3, ERBB4, and C90RF96 were excluded from validation studies only because their expression was not silenced with the novel siRNA, and these HPKs may also have a role in virus replication.
- One primary screen hit, ADK showed reduced Ml levels measured by qPCR, but did not validate in our NP localization analysis. Genomic changes would be expected to be subtle compared to changes in NP localization and could account for these findings.
- the minimal overlap between different virus strains is expected since the tempo of signal transduction and host gene expression is differentially induced by different virus strains which is linked to differences in replication dynamics and virus yield (Heynisch et al, 2010, Vaccine 28 : 8210-8218). It is also likely that different influenza viruses may use alternate pathways for virus replication though core pathways were generally found to be conserved between screens (Min and Subbarao, 2010, Nat Biotechnol 28:239-240). This may be particularly relevant as A/WSN/33 which is a mouse-adapted virus and A/New Caledonia is a human virus.
- the experimental approach used in this study to analyze influenza virus replication at 48h post-siRNA transfection limits the findings to the later phases of the viral life cycle and may preclude HPKs that are important in the early phases of the viral life cycle.
- a very low MOI of infection was used to allow sufficient viral replication and avoid excessive cytopathic effect.
- the screen in this study was validated using three endpoints to confirm the effect of host gene silencing on influenza virus replication. These endpoints included determining infectious virus titers as measured in MDCK cells, viral genome replication as determined by qPCR measurement of influenza M gene expression, and influenza NP as determined by high content analysis.
- HPK13 From the HPKs identified in the secondary validation screen, four pro-viral (NEK8, PLK4, SGK3 and CDK13) and two anti-viral (MAP3K1 and DYRK3) HPKs were assessed for miRNA regulation, and identified three HPKs (two pro-viral and one antiviral) (CDK13,
- MAP3K1 and PLK4 were found to have differential expression upon corresponding miRNA inhibitor/mimic treatment suggesting that these miRNAs likely regulate these HPKs. Contrary to current dogma that miRNA inhibition relieves native miRNA inhibition and causes increased expression of target genes, and vice versa, it was observed that miRNA inhibition reduced transcript levels for CDK13, MAP3K1 and PLK4 while mimic treatment induced protein expression.
- Influenza infection has been shown to upregulate expression of a large number of proteins (Liu et al, 2012, J Proteome Res 11 :4091-4101, Kroeker et al, 2012, J Proteome Res 11 :4132-4146, Dove et al, 2012, Proteomics 12:1431-1436, Zhu et al., 2012, J Proteomics 75:1732-1741, Lietzen et al, 2011, PLoS Pathog 7:el001340, Zhang et al, 2010, Genomics Proteomics Bioinformatics 8:139-144), and the genes expressing these proteins are likely regulated at some level by miRNAs.
- Mycoplasma free A549 human lung epithelial cells (CCL-185, ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM, HyClone, ThermoScientific) supplemented with 5% heat-inactivated FBS (HyClone, Thermo Scientific) at 37°C and 5% C0 2 and used for all infections.
- DMEM Dulbecco's modified Eagle's medium
- FBS Heat-inactivated FBS
- Virus stocks were titrated in Madin-Darby canine kidney cells (MDCK, CCL-34, ATCC) cells as previously described (Reed and Muench, 1938, The American Journal of Hygiene 27:493-497) and a 50% tissue culture infectious dose (TCID 50 ) was determined using the method described by Reed and Muench.
- Respiratory Syncytial Virus (RSV) wild type (wt) and NS 1 mutant viruses were grown in VeroE6 cells and isolated by sonication of infected cells day 3 post infection or when syncytia were clearly visible.
- Viral stocks were tittered using a standard plaque assay and developed with an immunoassay using anti-RSV F monoclonal 131-2A.
- Viral inocula were prepared in DMEM without serum for both viruses and added to washed cells to achieve an moi of 0.5. Viral inocula were removed after a 2 hr incubation, washed thrice with phosphate buffered saline (PBS) and replaced with either complete medium (for RSV) or DMEM containing 2ug/ml TPCK-Trypsin and 2mg/ml BSA for Influenza infection. Each infection was done in triplicate and for 12 and 24 time points each.
- PBS phosphate buffered saline
- RNA samples isolated as above were sent to ThermoFisher scientific for miRNA microarray analysis. Samples were labelled and hybridized to version 16 miRNA microarrays using in house protocols, scanned and data was analyzed to obtain lists of miRNAs deregulated during wild type and NS1 mutant influenza and RSV infections at 12 and 24hr post infection. Hits with p value (False discovery rate multiple test corrected p value) ⁇ 0.05 were considered significant and were compared between viruses and time points. miRNA inhbitor /mimic transfection.
- HBSS HyClone, Logan, UT
- Dharmafect-1 transfection reagent Lafayette, CO
- HBSS HBSS
- the siR A/transfection reagent mix was allowed to incubate for 20 minutes at room temperature after which 0.08 ml of 1.5 10 4 A549 cells suspended in DMEM/5% FBS was added to each well, and the plate incubated for 48 hours at 37°C in 5% C0 2 .
- the final concentration of siRNA for all primary screen transfections was 25 nM.
- Viral inoculum was replaced with complete DMEM supplemented with 5% heat inactivated FBS.
- GFP expression was measured using a Tecan Satire X2 plate reader using excitation at 480nm and emission at 520nm. Percent changes in GFP were calculated by multiplying the ratio of raw GFP fluorescence values between test and non-targeting control treatments) by 100.
- siRNA against RSV N gene was used as a positive control.
- RSV and influenza virus infection deregulate host microRNA expression.
- Influenza wildtype (A/NY/1682) infected cells showed induced expression of miR-451 and mir-663 24hr post infection while infection with A NY/1682/NS1-126 infection induced the expression of numerous miRNAs (miR-944, mIR-762, miR-7-1*, miR-663, miR-629*, miR- 548c-5p, miR-452, miR-424, miR-371-5p, miR-22*, miR-1977, miR-1973, miR-196a, miR- 1915, miR-186, miR-1826, miR-1539, miR-1280, miR-1274a, miR-1268, miR-1260, miR-1181, miR-let-7b*, miR-20a*, miR-142-3p, miR-363, miR-222, miR-7, miR-630, miR-454, miR-31, miR-203, miR-149, miR-1308, miR-1307, miR-lO
- miRNAs miR-769-3p, miR-758, miR-652, miR-541, miR-630, miR-625, miR-582-3p, miR-570, miR-503, miR-489, miR-455-3p, miR-454*, miR-449a, miR-421, miR-378, miR-362-5p, miR-361-5p, miR-34b*, miR-340*, miR-339-3p, miR-324-5p, miR-31*, mIR-30e*, miR-30d*, miR-30c, miR-30a*, miR-27b, miR- 27a, miR-221, miR-19b-l*, miR-186, miR-183*,miR-181b, mIR-181a*, miR-181a-2*, miR- 1246, mIR-lOb, miR-lOa, miR-363, miR-
- miR-100*, - 363 and -222 were induced in both RSV WT and NSl infection while miR-1268 and -663 were common miRs induced between WT and NSl mutant influenza 24hr post infection. miR-363 and -222 were also induced in Influenza NSl infection. miRNAs let-7b*, -20a*, and -142-3p were common between RSV and Influenza NSl infections while miR-663 was coomon between RSV and Influenza WT infections. Deregulated miRNAs potentially regulate RSV replication.
- miRNAs whose inhibition upregulated RSV replication include (miR-769-3p, miR-758, miR-630, miR-625, miR- 582-3p, miR-570, miR-503, miR-455-3p miR-421, miR-362-5p, miR-361-5p, miR-339-3p, miR- 30e, miR-30d* miR-27b miR-27a miR-221 miR-181b miR-181a-2*, mIR-lOb, miR-100*, miR- 889, miR-579, miR-550a, miR-544, miR-19a*, miR-100, miR-363, let-7b*, miR-lOb, miR-454, miR-630, miR-944, miR-762, miR-548c-5p, miR-452, miRNA-769-3p, miR-758, miR-630, miR-625, miR- 582-3p, miR-570
- Influenza and RSV infection deregulate host miRNA expression which is driven by NSl gene responsible for regulating host anti- viral response. Many of the deregulated miRNAs are important for regulating RSV replication.
- the complete disclosure of all patents, patent applications, and publications, and electronically available material including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incoiporated by reference in their entirety.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Provided herein are methods for altering viral replication in a cell. The virus may be a member of the family Orthomyxoviridae, such as an influenza virus, or a member of the family Paramyxoviridae, such as human respiratory syncytial virus. Altering viral replication is accomplished through the use of polynucleotides. In one embodiment, a polynucleotide decreases expression of a polypeptide, such as a protease or a kinase. In one embodiment, a polynucleotide is an miRNA or an miRNA inhibitor. In some embodiments viral replication is decreased, and in other embodiments viral replication is increased. Also included are methods for treating a subject, and genetically modified cells having the characteristic of altered virus replication compared to a control cell.
Description
METHODS FOR ALTERING VIRUS REPLICATION
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application Serial No.
61/641,664, filed May 2, 2012, which is incorporated by reference herein.
GOVERNMENT FUNDING
The present invention was made with government support under Grant No.
HHSN266200700006C, awarded by the NIAID. The Government has certain rights in this invention. BACKGROUND
Influenza A viruses generally cause seasonal epidemics; however, they have the potential to cause pandemics associated with substantial morbidity and mortality (Kandel and Hartshorn 2001, BioDrags 15:303-323, Thompson et al., 2003, JAMA 289:179-186). Development of seasonal vaccines is required for influenza virus due to high viral mutation rates that lead to antigenic drift, and also because of periodic antigenic shift which can render vaccines less or ineffective (Hale et al., 2008, J Gen Virol 89:2359-2376). There are various antiviral drugs that have proven efficacy in the treatment of influenza infections: two M2 ion channel inhibitors (amantadine and rimantadine) and several neuraminidase inhibitors (including zamamivir and oseltamivir) (Basler 2007, Infect Disord Drug Targets 7:282-293, Betakova 2007, Curr Pharm Des 13:3231-3235, Hsieh et al., 2007, Curr Pharm Des 13:3531-3542, Jefferson et al., Cochrane Database Syst Rev. CDOOl 169, Lowen et al., 2007, Infect Disord Drug Targets 7:318-328, Matheson et al., 2008, Antiviral Res 78:91-102). Early treatment with these antiviral drugs reduces the duration of symptoms and the time to recovery; however, the use of antiviral drugs is
complicated by the emergence of drug resistant viruses (Betakova 2007, Curr Pharm Des 13:3231-3235, Hsieh et al., 2007, Curr Pharm Des 13:3531-3542, Beigel and Bray 2008, Antiviral Res 78: 91-102, Conly and Johnston 2006, Can J Infect Dis Med Microbiol 17:11-14, Lackenby et al., 2008, Curr Opin Infect Dis 21 :626-638). In addition, antiviral drug use may come with unwelcome effects that could include an increase in population vulnerability due to lack of seroconversion, as well as driving drug resistance among circulating strains (Conly and Johnston 2006, Can J Infect Dis Med Microbiol 17: 11-14).
Recent advances in our understanding of RNA interference (RNAi) have provided a means to perform genome-wide screens to determine and validate host cell genes that may be required for influenza virus replication (Krislinan et al., 2008, Nature 455:242-245, Hirsch 2010, Future Microbiol 5:303-311). RNAi is an efficient mechanism for the sequence-specific inhibition of gene expression (Leung et al., 2005, Pharmacol Ther 107:222-239, Tripp and Tompkins 2009, Methods Mol Biol 555:43-61), and is mediated by small interfering RNAs (siRNA) incorporated in the RNA-induced silencing complex (RISC) where the antisense or guide strand of the siRNA can suppress protein expression or direct degradation of messenger RNAs that contain homologous sequences (Haasnoot et al., 2007, Nat Biotechnol 25:1435-1443, Kim et al, 2007, Nat Rev Genet 8:173-184, Wiznerowicz et al, Nat Methods 3:682-688).
Synthetic siRNAs can be readily developed to target viral or host genes and have been successfully applied in disease intervention approaches. For example, siRNA targeting respiratory syncytial virus has shown efficacy for silencing virus replication (Alvarez et al.,
2009, Antimicrob Agents Chemother 53:3952-3962, Barik 2004, Virus Res 102:27-35, Bitko et al, 2005, Nat Med 11 :50-55, DeVincenzo et al., 2008, Antiviral Res 77:225-231, Zhang and Tripp 2008, J Virol 82:12221-12231), a feature that has led to RNAi-based clinical trials as a new therapeutic option (DeVincenzo et al., 2008, Antiviral Res 77:225-231). In addition, there are promising results from targeting host genes, such as the use of siRNA silencing for the treatment of age-related macular degeneration (Barakat et al., 2009, Expert Opin hivestig Drugs 18:637-646), and in the case of influenza, inhibiting the host gene CAMK2B prevented vRNA transcription in vitro (Konig et al., 2009, HNature 463 :813-817), and shRNA inliibition of trypsin also inhibited replication and apoptosis (Pan et al., 2011, Cardiovascular research 89:595-603). Recently, several studies employed genome-wide RNAi screens to identify host genes required for influenza virus infection and replication (Konig et al., 2009, Nature 463:813-
817, Brass et al, 2009, Cell 139:1243-1254, Hao et al., 2008, Nature 454:890-893, Karlas et al, 2010, Nature, Shapira et al., 2009, Cell 139:1255-1267, and genes have also been identified by random homozygous gene perturbation (Sui et al, 2009, Virology 387:473-481) and by a proteomic screen (Bradel-Tretheway et al., 2011, Journal of Virology 85:8569-8581). Although there were few common genes detected among the studies, meta-analysis revealed that influenza virus was co-opting many of the same host cell pathways (Konig et al., 2009, Nature 463:813- 817, Brass et al., 2009, Cell 139:1243-1254, Hao et al., 2008, Nature 454:890-893, Karlas et al, 2010, Nature, Shapira et al, 2009, Cell 139:1255-1267). Thus, the inability to find the same genes among the studies is not unexpected given that multiple genes may be affected in the same host cell pathway, that the tempo of gene expression may vary among the cell lines studied, and that differences can be attributed to variations in methodologies, viruses, and cell lines used among the studies (Konig et al., 2009, Nature 463:813-817, Brass et al., 2009, Cell 139: 1243- 1254, Hao et al., 2008, Nature 454:890-893, Meliopoulos et al, 2012, The FASEB J).
Of the host genes known to affect influenza virus, the proteases and kinases are important for infection and replication. Proteases may affect virus infection and replication in several ways including viral entry and hemagglutinin (HA) processing (Bottcher et al., 2009, Vaccine
27:6324-6329, Bottcher et al., 2006, J Virol 80:9896-9898, Bottcher-Friebertshauser et al., 2010, Journal of Virology 84:5605-5614, Kido et al, 2008, J Mol Genet Med 3:167-175), degradation of viral components for MHC presentation (Maytal-Kivity et al, 2002, BMC Biochem 3:28), cap-snatching (Bovee et al., 1998, Virology 245:229-240), induction of apoptosis (Ueda et al., 2010, J Virol 84:3068-3078), and by increasing vascular permeability aiding in the development of systemic infection in cases of severe infection (Wang et al., 2010, The Journal of Infectious Diseases 202:991-1001. However, it remains unclear which protease genes are essential in the biology of influenza virus replication.
Previous studies have identified human protein kinases (HPKs) having key functions in influenza biology. By example these include protein kinase C (PKC) which is induced by viral binding to cell surface (Arora and Gasse, 1998, Arch Virol 143: 2029-2037, Kunzelmann et al., 2000, Proc Natl Acad Sci U S A 97: 10282-10287), the extracellular signal-regulated kinase ERK (Pleschka et al, 2001, Nature cell biology 3: 301-305, Pleschka, 2008, Biol Chem 389: 1273-1282) induced by accumulation of viral HA on the cell surface via PKC and regulating RNP export (Marjuki et al., 2006, J Biol Chem 281 : 16707-16715), and phosphatidylinositol-3
kinase (PI3K) (Marjuki et al., 2006, J Biol Chem 281 : 16707-16715). The inhibition of this signaling network results in nuclear retention of the vRNP and decrease in influenza virus replication (Pleschka et al, 2001, Nature cell biology 3: 301-305, Ludwig et al., 2004, Febs Letters 561 : 37-43). NF-κβ, a key mediator, is induced by accumulation of viral HA, NP and Ml proteins ( Wurzer et al., 2004, J Biol Chem 279: 30931-30937, Wei et al., 2006, J Biol Chem 281 : 11678-11684, Wang et al., 2000, J Virol 74: 11566-11573, Pinto et al., 2011, Antiviral Res 92: 45-56, Pauli et al, 2008, PLoS Pathog 4: el000196, Pahl and Baeuerle, 1995, J Virol 69: 1480-1484, Nimmerjahn et al., 2004, J Gen Virol 85: 2347-2356, Ludwig and Planz, 2008, Biol Chem 389: 1307-1312, Kumar et al, 2008, J Virol 82: 9880-9889, Flory et al., 2000, J Biol Chem 275: 8307-8314). Additionally, the presence of viral dsRNA has been shown to activate signaling cascades involving IKK-NF-κΒ, c- Jun N-terminal kinase (JNK), and P38 mitogen- activated protein kinase (MAPK) cascades all which regulate the expression of antiviral cytokines (Majde, 2000, J Interferon Cytokine Res 20: 259-272, Chu et al, 1999, Immunity 11 : 721-731, Ludwig et al, 2006, Cell Microbiol 8: 375-386). Together, these findings show the importance of HPKs in influenza virus replication making them targets for disease intervention strategies.
In addition to host gene involvement during viral infection, the tempo of host gene expression may be altered by a variety of factors, such as by microRNAs (miRNA). Host miRNAs are similar to siRNAs in their silencing mechanism, but miRNAs are generated in the nucleus from short haiipin precursors and must be processed and exported before entering the RISC pathway (Carthew et al., 2009, Cell 136:642-655). miRNAs can be generated by the virus (Pfeffer et al., 2004, Science 304:734-736, Grundhoff et al., Virology 411 :325-343) or the host and can silence genes by similar mechanisms to siRNAs; however, unlike siRNA silencing, miRNA sequences do not need to be homologous to the target mRNA (Carthew et al., 2009, Cell 136:642-655). Little is known about the role of miRNAs during virus infection, however host- derived miRNAs have been shown to negatively affect influenza replication (Song et al., 2010, Journal of Virology 84:8849-8860) and miRNAs have even been used as therapeutics (Latronico et al., 2011, Current heart failure reports, Schonrock et al., 2011, Journal of molecular neuroscience:MN).
SUMMARY OF THE APPLICATION
Viruses are obligate parasites, requiring a host cell to reproduce and spread. Viruses also encode miRNAs to regulate host genes and viral replication. During viral infection, host and viral miRNAs can regulate synergistically affect viral replication; however, most host cell encoded miRNAS are expressed to govern or limit virus replication. Utilizing a RNA
interference gene knock down approach, the human genome was screened for cellular genes required for influenza and respiratory syncytial virus replication in cell culture. From this screen, cellular pathways were mapped that are used for influenza virus replication. Cellular miRNAs were then identified that regulate these pathways and demonstrated that by increasing or decreasing specific miRNA activity during infection regulates virus replication.
Provided herein are methods for decreasing viral replication in a cell. In one
embodiment, a method for decreasing viral replication in a cell includes administering to a cell, such as a human cell, an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a protease or a kinase endogenous to the cell. The cell includes a virus or is at risk of infection by a virus, where the virus is selected from a member of the family Orthomyxoviridae or a member of the family Paramyxoviridae. In one embodiment, the virus is selected from a member of the family Orthomyxoviridae, and the protease may be selected from an ADAMTS7 polypeptide, a CPE polypeptide, a DPP3 polypeptide, a MST1 polypeptide, a
PRSS12 polypeptide, or a combination thereof. In one embodiment, the virus is selected from a member of the family Orthomyxoviridae, and wherein the kinase may be selected from a CDK13 polypeptide, a HK2 polypeptide, a NEK8 polypeptide, a PANK4 polypeptide, a PLK4 polypeptide, a SGK3 polypeptide, or a combination thereof.
In one embodiment, a method for decreasing viral replication in a cell includes administering to a cell, such as a human cell, an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell, and the cell includes a virus or is at risk of infection by a virus. In one embodiment, the virus may be selected from a member of the family Orthomyxoviridae, and the polypeptide may be selected from a PPARA polypeptide, a RIF1 polypeptide, a P4HA1 polypeptide, a GRIA4 polypeptide, a TWSG1 polypeptide, a SHANK2 polypeptide, or a combination thereof.
Also provided herein are methods for increasing viral replication in a cell. In one embodiment, a method for increasing viral replication in a cell includes administering to a cell, such as a human cell, an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell. The cell includes a virus or is at risk of infection by a virus, and the virus is selected from a member of the family
Orthomyxoviridae. The polypeptide may be selected from FGD4, PKD2, MAP3K2, ZNFX1, PDCD1LG2, PLEKHA3, EIF5A2, FYCOl, GPR6, ENPP5, EPHA4, VSX1, STK17B, SACS, C14orf28, ZFYVE26, FGL2, SZT2, MEIR5, RPS6 A5, Cl lorGO, XRN1, FBXL5, CAMTA1, ITPRIPL2, SERF 1 A, SERF IB, GPR137C, FTSJD1, EPHA5, GUCY1A3, RRAGD, CTSS, GNPDA2, FBX048, DYNC1LI2, FAM129A, CERCAM, FIBIN, EZH1, CYP2U1, RNF128, IRF9, VPS53, DDHD1, ANKRD29, REST, FAM40B, PPP1R3B, RAB11FIP5, ARID4B, C2CD2, PRRGl, TNFRSF21, KLHL2, SGTB, SEMA4B, C2CD4A, LAMA3, PTPN4, MCHR2, TRDN, RUFY2, ARHGAP12, ESR1, ZXDA, SLITRK3, ISM2, RAB22A, SLC46A3, CEP97, UEVLD, BTG3, PGM2L1, IFIT5, CYBRD1, FNBP1L, PURB, SSH2, ATP 12 A, HSPA8, FJX1, SLC11A1, CNRIP1, Clorfl35, RASSF2, ANKRD52, DE ND5B, ATG16L1, BRMS1L,
CTDSPL, CCLl, ZFYVE9, SLC40A1, DUSP2, STARD8, ZNF800, TCF7L1, VLDLR, FCH02, MASTL, RBLl, ZNF652, CENPQ, MRPL24, FZD3, ITGB8, GPR133, NR2E3, AN06, UNC80, LIMA1, ARID4A, ARHGAP26, FBX031, ZNF367, ZFP3, GINS4, SAR1B, C7orf43, PBX3, E2F5, SEMA7A, HAUS8, LMOD3, RGMA, ITSN2, PTHLH, TGM2, ZADH2, Clorf63, ZIM3, ΝΓΝ, KLHL28, NAGK, PTPDC1, CTSK, TGFBR2, ST6GALNAC3, TRIP11, ZNF238,
TAOK3, WWP2, FRMD6, CRY2, TRIM36, C15orfl7, VASH2, CXCL6, KIAA1383, TM2D2, KIF23, SERPl, AHNAK, U2SURP, RPGR, C18orf32, DUSP18, NKIRAS1, PFKP, LYST, Cllorf82, CHRM2, C19orf2, GPATCH2, RGMB, PAPOLB, FIGNL1, CAPRIN2, CROT, MAP3K5, USP31, MKNK2, TXNIP, BTN3A1, AGFG1, KIF14, LRCH1, C18orfl9, SLAIN2, ZNF512B, BNIP2, RSBN1, DERL2, MMP3, HDHD1, PAG1, GLOl, FAM13C, NCEH1, SDC2, RBM34, MMAA, RPL17-C180RF32, ARL1, CHP2, PRRG4, TOPORS, MED 17, BMPR2, or a combination thereof.
In one embodiment, a method for increasing viral replication in a cell includes administering to a cell, such as a human cell, an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell. The cell includes a virus or is at risk of infection by a virus, and the virus is selected from a member of
the family Paramyxoviridae. The polypeptide may be selected from FGF23, HMCN1, GPC4, KIAA0754, PAQR9, H2AFV, C5orfl5, DPY19L4, PRDM16, USP13, ABAT, POU2F3, SHPK, PARP9, MORC3, DENND1B, SLC25A16, ZNF578, STAT5B, DGKE, NRG1, PCBD2, DNHD1, UNC5D, NUDT12, HNRNPA3, HSD17B13, C2CD4A, LOC100132963, ABCA1, CLVS 1 , C3 orf79, SEC62, CNNM4, CDC42BP A, LRRTM4, WWP2, CNTD2, MCM6, C4orf40, POLDIP2, KIAA0776, FLVCR1, ZNF615, EROILB, SLIT1, TNRC6A, ZFAND5, PNPT1, IPPK, CCDC142, KCNK2, SAR1B, RRAGD, HNRNPAB, ADPGK, GABRB2, NF2,
ARHGEF3, RAGE, PLAG1, ZNF805, NSUN4, ZNF573, 41525, FKBP5, E2F7, EDAR, CXorf36, JRK, CHM, HOOK3, RALGPS1, GREB1, CACNA1E, LHX8, TRIM67,
TMEM120B, LENEP, MEF2D, ZNF709, FLJ36031, TD02, PHIP, CLIC2, SAMD12, BEND7, BRPF3, HNMT, PSMC2, PHTF2, MFSD6L, CCNE2, CEP44, CDC14A, TFG, ZNF793, ANKRD36B, SAMD13, TOB2, ZC3HAV1L, DCLK1, MECP2, CLDN11, Clorfl06, VAMP2, PEX5, BCLAF1, ASB11, WDR26, KSR2, RLIM, USP38, YIPF6, NEK7, CEP85, TFRC, FAM59A, PPP1R2, TRPS1, CLIPl, DRAM1, ARL8A, LRRK2, UBXN2A, PDX1, KIAA0895, PPP2CA, ACTR10, UCP3, ZNF566, ABHD5, TBL1XR1, PSIP1, DNA2, CHSY1, MYSM1, EIF5A2, GOLPH3L, SLC9A6, LARP1B, TRIM2, GABRA6, PAPD4, PAN3, SYDE2,
FNDC3B, AKR1D1, GPR180, TMEM194B, PCDH11X, RDH11, RFX7, SLC35F1, MGAT4A, SLC11A2, C9orfl50, GDAP2, CLYBL, TNFSF13B, NDUFA4, IGF1, CMTM4, CMTM6, SUZ12, C20orfl94, NCOA3, PAPD5, FBXO40, AQPEP, NDST3, PCOLCE2, SMAD9, CRIPT, GABRA4, SRSF7, MSN, LY75, ZNF624, UGT2A3, FXRl , EIF2C4, SUSD5, ADCYl , CDKL2, TRIM36, ARFGAP2, ZNF238, AAK1, OTOR, ALS2CR8, SLC1A2, BRWD1, SLC25A3, MATN1, SLAIN1, C10orfl40, TSC1, MDM4, RPS6KA5, MDFIC, SECISBP2L, HSPC159, FMR1, GJA1, CHST1, MYBL1, IRF1, SBF2, JARID2, PCDHB4, MBD2, PRKAA2, ANGEL2, SYT6, RNF38, MTMR10, LDLR, KCNJ10, TRIM23, DSEL, FAM35A, UBA3, ESYT3, SPICE1, SATB2, SYT1, DLL1, LGR4, PDE7A, KIAA0889, MET, FGD6, LRPAP1, CCDC50, KLF6, KLRDl, COL4A4, FAM123B, LYST, PRUNE2, AFF4, RHOBTB1, ZBTB11, STRN3, PPP1R9A, GAN, CACNB4, KIAA2026, TESK2, DNAJC27, KIAA1370, ELL2, TMPO, GALNT3, REST, CACNG8, CHST2, WTH3DI, TRDMT1 , ZNF828, CELSR3, SDAD1, YAF2, ZFPM2, SLC9A8, AFFl, IL17RD, PLEKHG2, KCNIPl, GNA13, PRR20A, PRR20B, PRR20C, PRR20D, PRR20E, PCSK6, SYNC, SNX18, CLIC4, ABCA13, BTBD7, ANKRD40, ZNF644, TAX1BP1, CMKLR1, TC2N, ELOVL7, ERI2, PANX2, PDE4D, ZNF599, ZNF264, EFHC2,
CALM3, DNAH14, ZNF492, CSMD1, NAALADL2, AN06, CD302, LY75-CD302, SCN9A, RTKN2, NR3C1, YTHDC2, KIF2A, RNF141, RPGR, ZMYM6, PABPC4L, KCNQ3, GRB2, TCTEX1D1, ZMYM2, CAB39L, SSH1, LPP, CXorf57, DDX58, NCOA7, CHIC1, PRLR, VPS13B, OAS2, FRMD6, CLK4, KIAA0528, THAP2, DUSP9, KLHL29, CCDC149, LRCH1, GPR183, SEC61A2, PTGFRN, CENPBD1, RIMBP2, ZNF197, ZNF597, VDAC1, SASS6, TMEM135, SPTBN1, EPB41L4B, PDZD2, IDE, NSF, PIK3C2A, USP28, AKAP7, TSGA10, RNF144B, C20orfl77, SIN3B, EGLN3, RFX6, CHMP2B, Clorfl73, SLC35C1, DPY19L1, ZFAND1, ARSJ, CDS1, FBXW7, ARHGEF26, WDR35, MAP2K4, TMEM184A, NRK, LRRCC1, PRDM2, SNX4, RGS6, CDKN1B, CXCL12, IFRD1, ARHGEF38, TCF12, 0STM1, ZNF181, APOLD1, C6, GABRA1, BEAN1, LBR, LRRC19, HECTD2, PHACTR4, KIT, VGLL4, RAB18, WSB2, 41531, SOD2, PAIP1, CPEB3, TP53BP2, NAP1L5, DNAAF1, NBPF3, SPG20, ZNF25, CYP4X1, CCDC126, FBX047, MIS12, CFHR5, KIAA1731,
DNAJC6, IRX5, CBWD1, CBWD5, CBWD3, CBWD6, PANK3, NGRN, PLXNC1, CBWD2, KIF20A, PCMTD1, ATPBD4, DCUN1D1, MRPS7, CLVS2, LRRTM2, STMN1, ETV3, AP3B2, GDF9, PPP3R1, RIMS3, DCAF12, TMSB15B, CAPN7, INPP4B, Cl lorf41, ZNF652, NDUFAl, DMRT3, CCDC64, EML6, AGTPBPl, IL17RB, PLEKHA2, MRAP2, RFX8, KDR, NTF3, LGI2, FAM38B, SCD5, MYNN, C18orf56, ADRBl, S1PR1, BMPR2, STEAP2, ABCC3, FAM116A, RORA, MON2, PRICKLE2, IMPDH1, TMF1, PKHD1L1, SNAPC1, DYNC2H1, RB1CC1, PTAR1, TMPRSS11D, NETOl, KCNK10, RHPN2, SLC25A15, OSBPL3, FIGN, FLT1, ZNF124, SLC25A24, CTDSPL, PRPF18, ZNF845, SYN2, CREBL2, REPS2, NFE2L3, ZNF680, GRHL1, MCTP1, ZNF425, TMEM97, INF2, EDEM1, ONECUT2, CD69, NOX4, PHLPP2, KLF4, PLAC4, C5orf22, C2orf63, Clorf226, KIAA1919, SLC4A4, KBTBD8, TTC39A, C14orf28, ARHGEF38, CDC25A, RRAGD, REST, C2CD2, C2CD4A, CTDSPL, C20orfl94, SMARCA5, SYN2, ZNF845, NOX4, or a combination thereof.
In certain embodiments of the methods for decreasing or increasing viral replication in a cell, the polynucleotide may be a double stranded RNA, a microRNA, or a microRNA inhibitor. In certain methods for increasing viral replication in a cell, the polynucleotide encodes a double stranded RNA, a microRNA, or a microRNA inhibitor. In one embodiment, the human cell is in vivo. In one embodiment, the member of the Orthomyxoviridae is a member of the genus Influenzavirus A or a member of the genus Influenzavirus B. In one embodiment, the member of the Paramyxoviridae is human respiratory syncytial virus. In one embodiment, viral replication
in a cell is decreased by at least 0.5% compared to a control cell that does not include the polynucleotide. In one embodiment, viral replication in a cell is increased by at least 0.5% compared to a control cell that does not include the polynucleotide. In one embodiment, the amount of the polypeptide in the cell is decreased by at least 5% compared to a control cell that does not include the polynucleotide. In one embodiment, the amount of the polypeptide in the cell is increased by at least 5% compared to a control cell that does not include the
polynucleotide.
In one embodiment, a method for decreasing viral replication in a cell includes administering to a human cell an effective amount of a polynucleotide, wherein the
polynucleotide decreases viral replication in the cell. The cell includes a virus or is at risk of infection by a virus. In one embodiment, the virus is selected from a member of the family Orthomyxoviridae, and the polynucleotide may include a mature microRNA selected from miR- 1254, miR-1272, miR-124a, miR-124*, or a combination thereof.
In one embodiment, the virus is selected from a member of the family Paramyxoviridae, and the polynucleotide may include a mature microRNA selected from miR-668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR-190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR- 744, miR-942, miR-lOb*, miR-150, miR-124*, miR-17-3p, miR-3944, miR-135a, miR-30d*, miR-876-5p, miR-873, miR-625, miR-520h, miR-491, miR-1234, miR-628, miR-558, miR-544, miR-376a, miR-487b, miR-410, miR-208b, or a combination thereof.
In one embodiment, the virus is selected from a member of the family Orthomyxoviridae, and the polynucleotide may include a microRNA inhibitor that inhibits a microRNA selected from miR-17-5p, miR- 106b, miR- 106b*, miR-34c, or a combination thereof.
In one embodiment, the virus selected from a member of the family Paramyxoviridae, and the polynucleotide may include a microRNA inhibitor that inhibits a microRNA selected from miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681*, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, miR- 18a*, or a combination thereof.
In one embodiment, a method for increasing viral replication in a cell includes administering to a human cell an effective amount of a polynucleotide, wherein the
polynucleotide increases viral replication in the cell. The cell includes a virus or is at risk of infection by a virus. In one embodiment, the virus is selected from a member of the family Orthomyxoviridae, wherein the polynucleotide may include a mature microRNA selected from miR-17-5p, miR-106b, miR-106b*, miR-34c, or a combination thereof.
In one embodiment, the virus is selected from a member of the family Paramyxoviridae, and the polynucleotide may include a mature microRNA selected from miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681 *, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, miR-18a*, or a combination thereof.
In one embodiment, the virus is selected from a member of the family Orthomyxoviridae, and the polynucleotide may include a microRNA inhibitor that inhibits a microRNA selected from miR-1254, miR-1272, miR-124a, miR-124*, or a combination thereof.
In one embodiment, the virus is selected from a member of the family Paramyxoviridae, and the polynucleotide may include a microRNA inhibitor that inhibits a microRNA selected from miR-668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR- 190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR-744, miR-942, miR-lOb*, miR-150, miR-124*, miR-17-3p, miR- 3944, miR-135a, miR-30d*, miR-876-5p, miR-873, miR-625, miR-520h, miR-491, miR-1234, miR-628, miR-558, miR-544, miR-376a, miR-487b, miR-410, miR-208b, or a combination thereof.
In certain embodiments of the methods for decreasing or increasing viral replication in a cell, the administering may include administering a polynucleotide that encodes the microRNA or the microRNA inhibitor. In one embodiment, the polynucleotide that encodes the microRNA or the microRNA inhibitor is a vector. In one embodiment, the administering includes administering the microRNA or the microRNA inhibitor. In one embodiment, the human cell is in vivo. In one embodiment, the member of the Orthomyxoviridae is a member of the genus
Influenzavirus A or a member of the genus Influenzavirus B. In one embodiment, the member of
the Paramyxoviridae is human respiratory syncytial virus. In one embodiment, viral replication in a cell is decreased by at least 0.5% compared to a control cell that does not include the polynucleotide. In one embodiment, viral replication in a cell is increased by at least 0.5% compared to a control cell that does not include the polynucleotide. Also provided is an ex vivo cell produced by a method described herein.
Also provided are methods for treating a subject. In one embodiment, a method for treating a subject includes administering to the subject a composition including an effective amount of the polynucleotide described herein that results in decreased viral replication, wherein the subject has or is at risk of developing a viral infection by a virus selected from a member of the family Orthomyxoviridae or a member of the family Paramyxoviridae. In one embodiment, the subject is a human. In one embodiment, the composition is administered to tissues of the respiratory tract. In one embodiment, the subject has a viral infection, and at least one sign of a viral infection is reduced. In one embodiment, the member of the Orthomyxoviridae is a member of the genus Influenzavirus A or a member of the genus Influenzavirus B. In one embodiment, the member of the Paramyxoviridae is human respiratory syncytial virus.
Also provided herein are genetically modified cells that have increased replication when compared to replication of a virus in a control cell. In one embodiment, the genetically modified cell includes a member of the family Orthomyxoviridae, such as a member of the genus
Influenzavirus A or a member of the genus Influenzavirus B. In one embodiment, the genetically modified cell a member of the family Paramyxoviridae, such as human respiratory syncytial virus. In one embodiment, a genetically modified cell includes a polynucleotide that decreases expression of a polypeptide in a cell and results in increased viral replication. In one
embodiment, a genetically modified cell includes a polynucleotide that includes a mature miPvNA and results in increased viral replication. In one embodiment, a genetically modified cell includes a polynucleotide that includes an miRNA inhibitor and results in increased viral replication.
Also provided herein is a method for producing virus using a genetically modified cell described herein. The method includes incubating the genetically modified cell under conditions suitable for the production of virus by the cell. Optionally, the method includes harvesting the virus produced by the genetically modified cell. In one embodiment, the genetically modified
cell includes a virus that is a member of the family Orthomyxoviridae. In one embodiment, the virus that is a member of the family Paramyxoviridae
As used herein, virus "replication" refers to the process that results in the production of a copy of the genetic material of a virus. Virus replication may or may not result in the production of infectious virus particles that can infect a cell and result in the production of more infectious virus particles. Virus replication, and changes in virus replication, may be determined by measuring standard signs related to virus replication in a cell. Examples include, but are not limited to, cytopathic effects, virus titers, amount of viral polynucleotide, hemagglutination, nucleoprotein, viral load in an animal's sinuses, lungs, trachea, and/or pathology associated with infection by a virus. Assays for measuring viral replication are known in the art and include, but are not limited to, plaque assays, TCID50, hemagglutination inhibition assays,
immunofluorescence, quantitative real time polymerase chain reaction (RT-qPCR), and release of the virus from a cell.
As used herein, "decreasing expression" of a polypeptide refers to a decrease in the amount of the polypeptide in a cell. As used herein, "increasing expression" of a polypeptide refers to an increase in the amount of the polypeptide in a cell.
As used herein, the term "polypeptide" refers broadly to a polymer of two or more amino acids joined together by peptide bonds. The term "polypeptide" also includes molecules which contain more than one polypeptide joined by a disulfide bond, or complexes of polypeptides that are joined together, covalently or noncovalently, as multimers (e.g., dimers, tetramers). Thus, the terms peptide, oligopeptide, and protein are all included within the definition of polypeptide and these terms are used interchangeably.
As used herein, a polypeptide may have "structural similarity" to a reference polypeptide if the amino acid sequence of the polypeptide possesses a specified amount of sequence similarity and/or sequence identity compared to the reference polypeptide. Thus, a polypeptide may have "structural similarity" to a reference polypeptide if, compared to the reference polypeptide, it possesses a sufficient level of amino acid sequence identity, amino acid sequence similarity, or a combination thereof.
As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, either ribonucleotides, deoxynucleotides, peptide nucleic acids, or a combination thereof, and includes both single-stranded molecules and double-stranded duplexes. A
polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques. A polynucleotide described herein may be isolated.
As used herein, a polynucleotide may have "structural similarity" to a reference polynucleotide if the nucleotide sequence of the polynucleotide possesses a specified amount of sequence identity compared to the reference polynucleotide. Thus, a polynucleotide may have "structural similarity" to a reference polynucleotide if, compared to the reference polynucleotide, it possesses a sufficient level of nucleotide sequence identity.
An "isolated" polynucleotide or polypeptide is one that has been removed from its natural environment. Polynucleotides and polypeptides that are produced by recombinant, enzymatic, or chemical techniques are considered to be isolated and purified by definition, since they were never present in a natural environment.
A "purified" polypeptide or polynucleotide is one that is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components of a cell.
Polypeptides and polynucleotides that are produced outside of a cell, e.g., through chemical or recombinant means, are considered to be isolated and purified by definition, since they were never present in a cell.
As used herein, a "control cell" refers to a cell that does not include the same genetic modification(s) as a genetically modified cell.
As used herein, a "coding sequence" refers to a polynucleotide that encodes an RNA and, when placed under the control of appropriate regulatory sequences, expresses the encoded RNA. The RNA can be an mRNA, or a biologically active RNA, such as a dsRNA, miRNA, or ribozyme. An mRNA can be translated in the host cell to yield a polypeptide. The boundaries of a coding region are generally determined by a translation start codon at its 5' end and a translation stop codon at its 3' end. A "regulatory sequence" is a nucleotide sequence that regulates expression of a coding sequence to which it is operably linked. Nonlimiting examples of regulatory sequences include promoters, enhancers, transcription initiation sites, translation start sites, translation stop sites, transcription terminators, and poly(A) signals. The term
"operably linked" refers to a juxtaposition of components such that they are in a relationship permitting them to function in their intended manner. A regulatory sequence is "operably
linked" to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence.
The term "miRNA" is used according to its ordinary and plain meaning and refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation (see, e.g., Carrington et al., 2003, Science, 301:336-338). "miRNA" refers to the single-stranded RNA molecule processed from a precursor. Individual miRNAs have been identified and sequenced in different organisms, and have been named based on submission to the miRNA Registry (Griggiths- Jones, 2004, Nucl. Acids Res., 32(Suppl 1):D109-D111, and see
miRBase.org). Names of miRNAs and their sequences are provided herein. Additionally, other miRNAs are known to those of skill in the art and can be readily implemented in embodiments described herein. The methods and compositions should not be limited to miRNAs identified in the application, as they are provided as examples, not necessarily as limitations of the
embodiments described herein.
As used herein, "genetically modified cell" refers to a eukaryotic cell into which has been introduced an exogenous polynucleotide and has been altered by human intervention. For example, a cell is a genetically modified cell by virtue of introduction into a suitable cell of an exogenous polynucleotide. "Genetically modified cell" also refers to a cell that has been genetically manipulated such that endogenous nucleotides have been altered. For example, a cell is a genetically modified cell by virtue of introduction into a suitable cell of an alteration of endogenous nucleotides. For instance, an endogenous coding region could be inactivated by deletion or incorporation of mutations to result in expression of an inactive polypeptide. Another example of a genetically modified cell is one having an altered regulatory sequence, such as a promoter, to result in increased or decreased expression of an operably linked endogenous coding region.
As used herein, "genomic editing" refers to editing a coding region in a cell such that the coding region is inactivated, modified, or includes an integrated sequence.
As used herein, the term "effective amount" refers to an amount of a polynucleotide, compound, composition, formulation and/or dosage form as described herein that may be effective to achieve a particular biological result. Such results may include, but are not limited to, an alteration of viral replication in a cell, or treating a subject. An effective amount of a composition to treat a subject refers to an amount that causes an animal to demonstrate reduced
signs of a viral infection than an animal would otherwise demonstrate in the absence of the polynucleotide, compound, composition, formulation and/or dosage form.
The term "and/or" means one or all of the listed elements or a combination of any two or more of the listed elements.
The words "preferred" and "preferably" refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the invention.
The terms "comprises" and variations thereof do not have a limiting meaning where these terms appear in the description and claims.
Unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one.
Also herein, the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).
For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.
The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1. RNAi of 5 host protease genes down-regulated influenza virus replication. A: A549 cells were reverse transfected with 50 nM of siRNA (SMARTpool) specific for the indicated genes (ADAMTS7, CPE, DPP3, MST1, PRSS12). After 48 hours, cytotoxicity was determined by adenylate kinase (AK) release. Cells treated with the siTOX control were considered 100% cytotoxic and all values were normalized to siTOX. RLU = relative luciferase units. * p<0.05 vs siNEG, ** pO.01 vs siNEG, ***p<0.005 vs siNEG; siTOX vs all samples: p<0.001 (not shown). Line shows 20% of siTOX control. B: A549 cells were reverse transfected with 50 nM of siRNA (SMARTpool) specific for the indicated genes (ADAMTS7, CPE, DPP3, MST1, PRSS12). After 48 hours, cells were infected with A/WSN/33 at an MOI of 0.001. 48 hours post-infection, cells were fixed in 4% formaldehyde and stained with an anti-NP (green) monoclonal antibody followed by counterstain with DAPI (blue.) Positive (+) control: siMEK, negative (-) control: siNEG. Magnification is 20* (bar is 100 microns). C: Cells were transfected with 100 nM of a novel siRNA targeting a different seed site from the SMARTpool used in the primary screen and infected as in B. After 48 hours of infection, cellular supernatant was tested for infectious virus production by a modified TCID50. Data is expressed as
TCID5o/ml. Data is representative of two independent experiments. (*p<0.05 vs siNEG).
Figure 2. Calculated standard deviation of the z-scores of the human protease library. The primary screen provided two independent studies and was analyzed using a scaling methodology that sets the non-targeting control siRNA (siNEG) at an arbitrary value of 1.0, and the negative control siTOX at zero. siRNAs targeting host genes were assigned a score based on the distribution of these values. Wells in the primary screen with a percent of differentiation greater than 1.5 standard deviations above the plate mean in both duplicates were considered primary hits. Of the 481 HP genes targeted, 24 were genes were identified as "primary hits".
Figure 3. siRNA treatment decreases protein levels of the target protease genes. A: A549 cells were untreated (A549), treated with 50 nM of siNEG, or 50 nM of the appropriate siRNA. After 72 hours, cells were lysed in 1% TritonX-100 and protease gene levels were assessed by Western blot. B: Protein levels of the protease genes were determined by densitometry. Band density is shown as a percentage of the untreated A549 cells.
Figure 4. RNAi of individual host protease genes down-regulates replication of a clinical influenza isolate. A549 cells were reverse transfected with 100 nM of the novel siRNA targeting siADAMTS7, siCPE, siDPP3, siMSTl, and siPRSS12. After 48 hours, cells were infected with A/New Caledonia/20/99 at an MOI of 0.1 in the presence of 1 ug/ml TPCK-trypsin. After 48 hours of infection, cellular supernatant was tested for infectious virus production by a modified TCID50. Data is expressed as TCID5o/ml. Data is representative of two independent experiments. (*p<0.05 vs. siNEG).
Figure 5. An Ingenuity pathway analysis linked global cellular pathways and the host protease genes of interest. Hit protease genes (ADAMTS7, CPE, DPP3, MST1, and PRSS12) are shown and relevant influenza proteins are also shown (NSl, viral RNA). Nodes indicating global cellular pathways linked with the hit genes are shown (CREBl, NF-i Bl, caspases CASP3 and CASP9).
Figure 6. Analysis of host gene involvement in major cellular pathways. A: A549 cells were reverse cotransfected with CRE/CREB reporter plasmid or the appropriate control plasmid and 100 nM of the novel siRNA. After 24 h incubation, the transfection media was replaced with culture media. Cells were mock infected or infected with A/WSN/33 at an MOI of 0.001 the following day. After 24 h, culture supernatant was analyzed for luciferase expression. Luciferase units were normalized to Renilla expression. * p<0.05, ** p<0.01 compared to siNEG control (mock), # p<0.05, ## p<0.01 compared to siNEG control (A/WSN/33) B: A549 cells were reversed cotransfected with NF-κΒ reporter plasmid or the appropriate control plasmid and 100 nM of the novel siRNA. After 24 h incubation, the transfection media was replaced with culture media. Cells were mock infected or infected with A/WSN/33 at an MOI of 0.001 the following day. After 24 h, culture supernatant was analyzed for luciferase expression. Luciferase units were normalized to Renilla expression. * p<0.05, ** p<0.01 compared to siNEG control (mock), # p<0.05, ## p<0.01 compared to siNEG control (A/WSN/33). Data is representative of three independent experiments.
Figure 7. RNAi of DPP3 (siDPP3) inhibits influenza replication by modulation of apoptotic genes. A549 cells were reverse transfected with 50 nM of siDPP3 or siNEG. After 48 hours, cells were infected with A/WSN/33 at an MOI of 0.001. After 18 hours of infection, cellular RNA was isolated and apoptosis gene expression profiles were determined by array. Gene expression was normalized to GAPDH levels. Silencing DPP3 resulted in upregulated levels of the pro-apoptotic genes BCL2L10, TNFSF10, TNFSF25 and TNFSF8. Data is representative of three independent experiments. * p<0.05.
Figure 8. miRNAs interact with host protease genes. An Ingenuity pathway analysis implicated several miRNAs connected with host protease genes of interest. Hit protease genes (ADAMTS7, CPE, DPP3, MST1 , and PRSS12) are shown, and miRNAs are also shown (miR- 124, miR-106B, miR-17, miR-1254, miR-1272).
Figure 9. Effect of miRNA inhibition on host protease gene expression 24 h post-miRNA inhibitor treatment. Host cell miRNAs of interest were evaluated for their effect on host gene hits by qPCR. A549 cells were treated with the appropriate miRNA inhibitor (25 nM) for 24 hours. Cellular RNA was isolated 24 hpi and evaluated by qPCR for host gene expression using a SYBRgreen assay with gene-specific primers. Gene expression was compared to cells transfected with siNEG (for siRNA) or NEG (non-targeting miRNA inhibitor) at the equivalent concentration. Data is normalized to GAPDH expression. miRNAs indicated on the x-axis refer to inhibition of those miRNAs. A: ADAMTS7 expression levels, B: CPE, C: DPP3, D: MST1, E: PRSS12. Data is representative of two independent experiments. (*p<0.05 versus siRNA treatment.).
Figure 10. Effect of miRNA inhibition on influenza replication. A549 cells were treated with the appropriate miRNA inhibitor (25 nM) for 48 hours, followed by infection with
A/WSN/33 (MOI = 0.001). Cellular supernatant was tested for infectious virus production by a modified TCID5o 48 hpi. Data is expressed as TCID5o/ml and is representative of two
independent experiments.
Figure 11. Optimization of siRNA knockdown using siMEK as a positive control. 48 hours after transfection with Dharmafect only (Mock) or Dharmafect + siMEK at 25nM, 50nM, and lOOnM concentrations in A549 cells, total RNA was extracted and used to quantify MEK- specific mRNA. The transcript copies divided by GAPDH of gene silenced cells normalized to the same values of non-target control siRNA transfected samples.
Figure 12. Quantitative PCR based validation of the knock down of genes targeted by siRNA. After 48 hours of silencing with siRNAs (50nM) in A549 cells, total RNA was extracted and used for quantification. The transcript copies divided by GAPDH of gene silenced cells normalized to the same values of non-target control siRNA transfected samples. CDK3, ERBB4, PRKAG3, and C90RF96 were excluded from further studies because novel siRNAs were suboptimal at silencing. Values of control transfected cells are set as 0% silencing. The results are expressed as mean + SD from a representative experiment performed in triplicate.
Figure 13. RNA interference screen strategy for identification of host factors affecting influenza infection. A) A549 cells were plated onto lyophilized siRNAs in 96-well flat-bottom plates and transiently transfected for 48h with 50 nM siRNA. B) At 48 hours post-transfection, cells were infected with influenza virus A/WSN/33 (MOI 0.001). C) 48 hours post-infection, viral replication was assayed by titration of A549 cell supernatant on MDCK cells. Each siRNA given a score based on the number of wells with detectable virus, and primary hits determined using Z score analysis. D) Those hits were then validated using a novel siRNA to repeat the screen and E) phenotype was confirmed by influenza NP localization as well as assaying influenza viral genome replication via quantitative real time PCR detecting influenza M gene. F) Last, validated gene hits were associated with the cellular pathways they affect or intersect. MDCK, siNEG, non-target negative control siRNA; siMEK, mitogen-activated protein kinase kinase 2 siRNA positive control.
Figure 14. Validation of human protein kinase genes affecting influenza virus replication.
A549 cells were reverse transfected with 50 nM of a non-target negative control siRNA (siNEG) or with siHPK and infected at a MOI = 0.01 with A/WSN/33. (A) 72 hours after infection, supernatants were harvested and the viral titers were determined by TCID50 assay on MDCK cells (B) After a 48 hour infection, the effect of siRNA silencing on influenza virus replication was measured by quantifying the levels of influenza M gene expression. The RNA from siRNA- transfected and WSN-infected A549s was isolated and used for quantification with an influenza M-specific primer/probe set. Light gray bars indicate controls. Data show mean + SEM from 3 independent experiments. (C) After a 48 hour infection, cells were fixed, permeabilized and incubated with an anti-influenza virus NP monoclonal antibody and subsequently with an Alexa- 488 goat anti-mouse secondary antibody and DAPI. The intracellular distribution of the viral RNPs (NP) and cellular nuclei (DAPI) are shown.
Figure 15. Human protein kinase genes affect H1N1 A/New Caledonia/20/99 virus replication. A549 cells were reverse transfected with 50 nM of siRNA specific for validated HPK genes and after 48h the cells were infected with A/New Caledonia/20/99 at an MOI of 0.01 in the presence of 1 g/ml TPCK-trypsin. After 48h of infection, RNA was extracted and the effect of siRNA silencing of HPK genes on viral genome replication was measured by quantifying (A) influenza NP expression and (B) the level of influenza M gene. Data show mean + SEM of 3 independent experiments. * p < 0.05 and ** p < 0.001 compared to control.
Figure 16. Identifying miRNA regulators of HPKs important for influenza replication. (A) Venn diagrams showing miRNAs common to computationally predicted miRNA regulators and influenza deregulated miRNAs. (B) miRNAs that are shared between computationally predicted HPK regulators and miRNAs deregulated during influenza infection.
Figure 17. Primary screen identified 22 kinase factors associated with influenza infection. Calculated Z scores of the human kinase library identified primary hits (z scores >2 and < -2) whose silencing increased virus replication (positive Z score) and strongest hits that decreased virus replication (negative Z score). The position of each cellular kinase gene identified important for virus replication in the primary screen are indicated.
Figure 18. miRNA regulators of NEK8. A549 cells were transfected with 25nM of miR- 1227, -149* and -197 inhibitor/mimic for 48hrs followed by RNA extraction and RT-qPCR with NEK8 specific primers. Expression data was normalized to 18S rRNA expression and shown as mean + SEM of independent experiments. * p < 0.05 compared to control.
Figure 19. miRNA regulators of MAP3K1. (A) A549 cells were transfected with 25nM of miR-548d, -29a and -138 inhibitor/mimic for 48hrs followed by RNA extraction and RT- qPCR with MAP3K1 specific primers. Expression data was normalized to 18S rRNA expression and shown as mean + SEM of independent experiments. * p < 0.05 compared to control. (B) A549 cells mock/transfected with miR-548d inhibitor/mimic for 48 hrs were fixed with 4% formaldehyde in PBS and stained for MAPK1 protein using biotinylated rabbit anti-MAP3Kl antibody (Abeam ab69533) and detected with Streptavidin-Alexa488. Cells were analyzed by Arrayscan Cellomics VTI scanner and data analyzed by GraphPad Prism. (C) A549 cells mock/transfected with miR-548d inhibitor/mimic for 48 hrs were infected with A/WSN/33 (MOI=0.001) for 48hrs and stained for influenza NP protein using mouse-anti-NP coupled to
Alexa-488 and analyzed as above in (B). Data show mean + SEM of two independent experiments. * p < 0.05.
Figure 20. miRNA regulators of CDK13. (A) A549 cells were transfected with 25nM of miR-1228 or -138 inhibitor/mimic for 48hrs followed by RNA extraction and RT-qPCR with MAP3K1 specific primers. Expression data was normalized to 18S rRNA expression and shown as mean + SEM of independent experiments. * p < 0.05 compared to control. (B) A549 cells mock/transfected with miR-1228 or -138 inhibitor/mimic for 48 hrs were fixed with 4% formaldehydein PBS and stained for CD 13 protein using biotinylated mouse anti-CDK13 antibody (Abeam ab58309) and detected with Streptavidin-Alexa488. Cells were analyzed by Arrayscan Cellomics VTI scanner and data analyzed by GraphPad Prism. (C) A549 cells mock/transfected with miR-1228 or -138 inhibitor/mimic for 48 hrs were infected with
A/WSN/33 (MOI=0.001) for 48hrs and stained for influenza NP protein using mouse-anti-NP coupled to Alexa-488 and analyzed as above in (B). Data show mean + SEM of two
independent experiments. * p < 0.05.
Figure 21. miRNA regulators of PLK4 (A) A549 cells were transfected with 25nM of miR-34c inhibitor/mimic for 48hrs followed by RNA extraction and RT-qPCR with MAP3K1 specific primers. Expression data was normalized to 18S rRNA expression and shown as mean + SEM of independent experiments. * p < 0.05 compared to control. (B) A549 cells
mock/transfected with miR-34c inhibitor/mimic for 48 hrs were fixed with 4% formaldehydein PBS and stained for PLK4 protein using biotinylated rabbit anti-PLK4 antibody (Abeam ab71394) and detected with Streptavidin-Alexa488. Cells were analyzed by Arrayscan Cellomics VTI scanner and data analyzed by GraphPad Prism. (C) A549 cells mock/transfected with miR- 34c inhibitor/mimic for 48 hrs were infected with A/WSN/33 (MOI=0.001) for 48hrs and stained for influenza NP protein using mouse-anti-NP coupled to Alexa-488 and analyzed as above in (B). Data show mean ± SEM of two independent experiments. * p < 0.05. PLK4-3 'UTS, SEQ ID NOT; miR-34c3p, SEQ ID NO:2.
DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Provided herein are methods for altering viral replication. Examples of viruses that may be targeting for altered replication using the methods described herein include RNA viruses that are members of Group V (negative-sense ssRNA viruses). Examples of Group V viruses include those that are members of the family Orthomyxoviridae, and those that are members of the family Paramyxoviridae.
A virus that is a member of the family Orthomyxoviridae may be a member of the genus Influenzavirus A, a member of the genus Influenzavirus B, a member of the genus Influenzavirus C, or a member of the genus Thogotovirus. Type species that are members of the genus
Influenzavirus A, include, but are not limited to, Influenza A virus. Serotypes of the type species Influenza virus A include, but are not limited to, H1N1, H1N2, H2N2, H3N1, H3N2, H3N8, H5N1, H5N2, H5N3, H5N8, H5N9, H7N1, H7N2, H7N3, H7N4, H7N7, H7N9, H9N2, and H10N7. The skilled person will recognize that other serotypes are possible in view of antigenic drift and the simultaneous infection of one animal with different influenza viruses. Other examples of Influenza type A virus include those having mutations, such as mutations that prevent a virus from repressing a cell's anti-viral response. Such mutations are known in the art, and include mutations of the NS1 gene,. Type species that are members of the genus
Influenzavirus B include, but are not limited to, Influenza B virus. Type species that are members of the genus Influenzavirus C include, but are not limited to, Influenza C virus. Type species that are members of the genus Thogotovirus include, but are not limited to, Thogoto virus and Dori virus. Serotypes of the type species Dhori virus include, but are not limited to, Batken virus and Dhori virus.
A vims that is a member of the family Paramyxoviridae may be a member of the subfamily Paramyxovirinae, including members of the genus. A virus that is a member of the family Paramyxoviridae may be a member of the subfamily Pneumovirinae, including members of the genus Pneumovirus (such as human respiratory syncytial virus).
A virus for use in certain embodiments described herein may be a clinical isolate obtained from an animal, such as an animal presenting signs of viral infection. The signs of such an infection vary depending upon the animal and upon the type of viral infection, and are known
to the person skilled in the art. Alternatively, a virus for use in certain embodiments described herein may be obtained from a depository such as the American Type Culture Collection.
A virus targeted for altered replication is in a cell. In one embodiment, the cell may be in vivo. As used herein, the term "in vivo" refers to a cell that is present within the body of an animal. The in vivo cell may be present in a vertebrate, such as a mammal including, but not limited to, a human, a pig, a mouse, a bat, and a ferret, or an avian. Methods and conditions for replicating a virus in an animal model are routine and known in the art, and methods for determining whether a vertebrate, such as a human, is infected with a replicating virus are likewise routine and Icnown in the art. Whether a virus is replicating in a vertebrate can be easily determined using routine methods, such as, for instance, by observing viral load in the animal's sinuses, lungs, trachea, or observing pathology associated with infection by a virus. For instance, histopathologic examination can be done using trachea and/or lung tissue.
In one embodiment, the cell may be ex vivo. As used herein, the term "ex vivo" refers to a cell that has been removed from the body of an animal. Ex vivo cells include, for instance, primary cells (e.g., cells that have recently been removed from a animal and are capable of limited growth in tissue culture medium), and cultured cells (e.g., cells that are capable of long term culture in tissue culture medium). Ex vivo cells that may be used as host cells for replication of a virus include, for instance, vertebrate cells. In one embodiment, vertebrate cells are avian cells, in particular embryo cells from an embryonated egg. Other examples of vertebrate cells include mammalian cells, such as hamster cells, monkey cells, dog cells, or human cells. In one embodiment, mammalian cells are epithelial cells. An example of an epithelial cell is a respiratory epithelial cell, such a type I or type II respiratory epithelial cell (e.g., A549). In one embodiment, mammalian cells are kidney cells or cell lines derived from such cells. An example of a mammalian kidney cell is the Madin-Darby canine kidney (MDCK) cell or cells from a clone of MDCK, MDCK-like cells, monkey kidney cells such as AGMK cells including Vero cells, suitable pig cell lines, or any other mammalian cell type suitable for the replication of influenza virus. In one embodiment, mammalian cells are ocular cells. In one embodiment, mammalian cells are neuronal cells. Suitable cells also include human cells, e.g. MRC-5 or Per-C6 cells, and avian cell lines. Suitable cells are not limited to cell lines; for example primary cells may be used. Avian embryo cells, such as chicken embryo fibroblasts, may be used in cell culture, or may be present in an embryonated egg. Methods and conditions
for replicating virus in ex vivo cells may depend up the virus, but are routine and known in the art. Whether a virus is replicating in cultured cells can be easily determined using routine methods, such as by observing cytopathic effects, measuring virus titers, measuring
hemagglutination, and/or measuring nucleoprotein.
In one embodiment, methods for altering viral replication in a cell include decreasing expression of a polypeptide in a cell. Decreasing expression of a polypeptide in a cell may be accomplished by, for instance: (i) decreasing translation of a coding region's transcript, such as disrupting a coding region's mRNA transcript, (ii) decreasing expression of a coding region (e.g., preventing transcription of the coding region), and (iii) decreasing activity of a polypeptide (e.g., targeting a polypeptide through use of, for instance, a small molecule inhibitor or aptamer).
In one embodiment, methods for altering viral replication in a cell include increasing expression of a polypeptide in a cell. Increasing expression of a polypeptide in a cell may be accomplished by, for instance: (i) increasing expression of an endogenous coding region that encodes the polypeptide, (ii) adding an additional copy of the coding region to the cell, and (iii) increasing activity of a polypeptide (e.g., targeting a polypeptide through use of, for instance, a small molecule inhibitor or aptamer).
Technologies useful for decreasing translation of the coding region's transcript, such as disrupting a coding region's mRNA transcript, include antisense RNA, ribozyme, dsRNAi, and miRNA. Antisense RNA technology involves expressing in, or introducing into, a cell an RNA molecule (or RNA derivative) that is complementary to, or antisense to, sequences found in a particular mRNA in a cell. By associating with the mRNA, the antisense RNA can decrease translation of the encoded gene product. The use of antisense technology to decrease the expression of specific coding region has been described, for example in Zamecnik and
Stephenson (1978, PNAS USA, 75:280-284).
A ribozyme is an RNA that has both a catalytic domain and a sequence that is
complementary to a particular mRNA. The ribozyme functions by associating with the mRNA (through the complementary domain of the ribozyme) and then cleaving the message using the catalytic domain. Ribozymes were first identified after it was found that certain mRNAs excise their own introns. By starting with these mRNAs, it has been possible to engineer molecules that recognize specific nucleotide sequences in an RNA molecule and subsequently cleave it.
Because they are sequence-specific, only mRNAs with particular sequences are inactivated. The
use of ribozymes to target polynucleotides is known in the art (Persidis, 1997, Nature Biotech., 15:921-922).
RNA interference (RNAi) involves a post-transcriptional gene silencing (PTGS) regulatory process, in which the steady-state level of a specific mRNA is reduced by sequence- specific degradation of the transcribed, usually fully processed mRNA without an alteration in the rate of de novo transcription of the target gene itself.
Decreasing expression of a polypeptide in a cell may be accomplished by using a single stranded RNA polynucleotide (useful for antisense strategies) or a double stranded RNA polynucleotide (useful for dsRNA strategies) based on an mRNA encoding one of the polypeptides disclosed herein. In one embodiment, a polynucleotide for decreasing expression of polypeptide in a cell includes one strand, referred to herein as the sense strand, that is, is at least, or is no greater than, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides (e.g., lengths useful for dsRNAi and/or antisense RNA). In one embodiment, a polynucleotide for decreasing expression of a polypeptide in a cell includes substantially all of a coding region, or in some cases, an entire coding region. The sense strand is substantially identical, preferably, identical, to a target coding region or a target mRNA. As used herein, the term "identical" means the nucleotide sequence of the sense strand has the same nucleotide sequence as a portion of the target coding region or the target mRNA. As used herein, the term "substantially identical" means the sequence of the sense strand differs from the sequence of a target mRNA at least 1%, 2%, 3%, 4%, or 5% of the nucleotides, and the remaining nucleotides are identical to the sequence of the mRNA.
In one embodiment, a polynucleotide for decreasing expression of a polypeptide in a cell includes one strand, referred to herein as the antisense strand. The antisense strand may be, be at least, or be no greater than, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleotides. In one embodiment, a polynucleotide for decreasing expression of a polypeptide in a cell includes substantially all of a coding region, or in some cases, an entire coding region. An antisense strand is substantially complementary, preferably, complementary, to a target coding region or a target mRNA. As used herein, the term "substantially complementary" means that at least 1%, 2%, 3%, 4%, or 5% of the nucleotides of the antisense strand are not complementary to a nucleotide sequence of a target coding region or a target mRNA.
Methods are readily available to aid in the choice of a series of nucleotides from a polynucleotide encoding a polypeptide described herein. For instance, algorithms are available that permit selection of nucleotides that will function as dsRNAi and antisense RNA for use in altering expression of a coding region.
In one embodiment, a polynucleotide for decreasing expression of a polypeptide in a cell is a double stranded RNA (dsRNA) that includes a sense strand and antisense strand. In one embodiment the two strands of a dsRNA are complementary, and in another embodiment the two strands of a dsRNA are substantially complementary. The sense and antisense strands of a double stranded polynucleotide may have different lengths. It should be understood that the sequences disclosed herein as DNA sequences can be converted from a DNA sequence to an RNA sequence by replacing each thymidine nucleotide with a uridine nucleotide.
A double stranded polynucleotide for use in decreasing expression of a polypeptide may include overhangs on one or both strands. An overhang is one or more nucleotides present in one strand of a double stranded polynucleotide that are unpaired, i.e., they do not have a corresponding complementary nucleotide in the other strand of the double stranded
polynucleotide. An overhang may be at the 3' end of a sense strand, an antisense strand, or both sense and antisense strands. An overhang is typically 1, 2, or 3 nucleotides in length. In one embodiment, the overhang is at the 3' terminus and has the sequence thymine-thymine (or uridine - uridine if it is an RNA). Without intending to be limiting, such an overhang may be used to increase the stability of a dsRNA. If an overhang is present, it is preferably not considered when determining whether a sense strand is identical or substantially identical to a target mRNA, and it is preferably not considered when determining whether an antisense strand is complementary or substantially complementary to a target mRNA.
The sense and antisense strands of a double stranded polynucleotide may be covalently attached, for instance, by a spacer made up of nucleotides. Such a polynucleotide is often referred to in the art as a short hairpin RNA (shRNA). Upon base pairing of the sense and antisense strands, the spacer region typically forms a loop. The number of nucleotides making up the loop can vary, and loops between 3 and 23 nucleotides have been reported (Sui et al., Proc. Natl. Acad. Sci. USA, 99:5515-5520 (2002), and Jacque et al, Nature, 418:435-438 (2002)). In one embodiment, an shRNA includes a sense strand followed by a nucleotide loop and the
analogous antisense strand. In one embodiment, the antisense strand can precede the nucleotide loop structure and the sense strand can follow.
Polynucleotides described herein, including those used for decreasing expression of a polypeptide (such as antisense RNA, dsRNA, miRNA, or ribozyme), may be modified. Such modifications can be useful to increase stability of the polynucleotide in certain environments, and/or increase specificity of the polynucleotide for a target. The modifications can be synthetic, naturally occurring, or non-naturally occurring. A polynucleotide of the present invention can include modifications at one or more of the nucleic acids present in the polynucleotide.
Modifications may be made to specific positions to increase the specificity of the polynucleotide for a target polynucleotide (Jackson et al., 2006, RNA, 12: 1197- 1205). Methods for producing polynucleotides having modifications are known to the art and routine. Polynucleotides can be commercially synthesized to include such modifications (for instance, Dharmacon Inc.,
Lafayette, CO).
In one embodiment, a modification can include a backbone. Examples of backbone modifications include, but are not limited to, phosphonoacetates, thiophosphonoacetates, phosphorothioates, phosphorodithioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, and peptide-nucleic acids.
In one embodiment, a modification can include a nucleic acid base. Examples of nucleic acid base modifications include, but are not limited to, inosine, purine, pyridin-4-one, pyridin-2- one, phenyl, pseudouracil, 2,4,6-trimethoxy benzene, 3 -methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidines (e.g., 5-methylcytidine), 5-alkyluridines (e.g., ribothymidine), 5- halouridine (e.g., 5-bromouridine) or 6-azapyrimidines or 6-alkylpyrimidines (e.g. 6- methyluridine), or propyne modifications.
In one embodiment, a modification can include a nucleic acid sugar. Examples of nucleic acid sugar modifications include, but are not limited to, 2'-sugar modification, e.g., 2'-0-methyl nucleotides, 2'-deoxy-2'-fluoro nucleotides, 2'-deoxy-2'-fluoroarabino, 2'-0-methoxyethyl nucleotides, 2'-0-trifluoromethyl nucleotides, 2'-0-ethyl-trifluoromethoxy nucleotides, 2'-0- difluoromethoxy-ethoxy nucleotides, or 2'-deoxy nucleotides.
Polynucleotides described herein that alter viral replication are biologically active. In one embodiment, a biologically active polynucleotide causes the post-transcriptional inhibition of expression, also referred to as silencing, of a target mRNA, resulting in inhibiting expression of a
polypeptide. The polynucleotides described herein may be referred to as, for instance, R Ai, siRNA, shRNA, miRNA, or antisense oligonucleotides. Without intending to be limited by theory, after introduction into a cell a polynucleotide will hybridize with a target mRNA if present and signal cellular polypeptides to cleave the target mRNA or to inhibit translation of the target mRNA. The result is the inhibition of expression of the polypeptide encoded by the mRNA.
Whether the expression of a target gene is inhibited can be determined, for instance, by measuring a decrease in the amount of the target mRNA in the cell, measuring a decrease in the amount of polypeptide encoded by the mRNA, or by measuring a decrease in the amount or the activity of the polypeptide encoded by the mRNA. Methods for measuring mRNA levels in a cell are routine and laiown to the skilled person. Methods for determining whether expression of a polypeptide is altered are routine and laiown to the skilled person. The polypeptide being measured may be in an ex vivo cell or an in vivo cell. In one embodiment, altered expression of a polypeptide may be determined directly by measuring the polypeptide. For instance, the presence and/or amount of a polypeptide present in a cell may be determined by using an antibody detection method, such as western immunoblot or an enzyme-linked immunosorbent assay (ELISA). The amount of polypeptide present in the cell is compared to the amount of the polypeptide a control cell. In one embodiment, altered expression of a polypeptide may be determined by an indirect method, such as a reverse transcription-polymerase chain reaction that determines the abundance in a cell of the mRNA encoding the polypeptide. The amount of mRNA may be indicative of the amount of polypeptide present in the cell. The amount of mRNA is compared to the amount of mRNA a control cell. In one embodiment, the amount of a polypeptide in a cell may be increased or decreased by at least 0.1%, at least 1%, at least 5%, or at least 10% when compared to the amount of the polypeptide in a control cell. In one embodiment, the amount of the polypeptide is undetectable when using an antibody-based detection method.
Biologically active polynucleotides, such as biologically active RNAs like dsRNAs and ribozymes, can be designed using methods that are routine and known in the art. For instance, in one embodiment, polynucleotides that inhibit the expression of one of the polypeptides described herein may be identified by scanning an mRNA encoding the polypeptide for AA dinucleotide sequences; each AA and the downstream (3') consecutive 16 to 30 nucleotides of the mRNA can
be used as the sense strand of a candidate polynucleotide. A candidate polynucleotide is the polynucleotide that is being tested to determine if it decreases expression of one of the polypeptides described herein. The candidate polynucleotide can be identical to nucleotides located in the region encoding the polypeptide, or located in the 5' or 3' untranslated regions of the mRNA. Optionally, a candidate polynucleotide is modified to include 1, 2, or 3, preferably 1, non-complementary nucleotides. Other methods are known in the art and used routinely for designing and selecting candidate polynucleotides, and include the use of readily available computerized algorithms. Candidate polynucleotides are also readily available commercially. A biologically active polynucleotide may, but need not, begin with the dinucleotide A A at the 5' end of the sense strand. A candidate polynucleotide may also include overhangs of 1, 2, or 3 nucleotides, typically on the 3' end of the sense strand, the anti-sense strand, or both. Candidate polynucleotides are typically screened using publicly available algorithms (e.g., BLAST) to compare the candidate polynucleotide sequences with coding sequences. Those that are likely to form a duplex with an mRNA expressed by a non-target coding region are typically eliminated from further consideration. The remaining candidate polynucleotides may then be tested to determine if they inhibit expression of one of the polypeptides described herein.
In one embodiment, altering viral replication in a cell, including decreasing replication, occurs through the use of microRNAs (miRNAs). In contrast to a dsRNA polynucleotide with activity of inhibiting translation of an mRNA, an miRNA is single stranded. miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus to hairpin structures of
approximately 70 nucleotides. These precursors (pre-miRNAs) are exported to the cytoplasm, where they are subsequently processed to a shorter mature miRNA that is typically 17 to 25 nucleotides. It is contemplated that a polynucleotide administered to a cell may subsequently be processed to a shorter mature miRNA. A polynucleotide that is, or encodes, an miRNA, may be between 17 and 130 nucleotides or longer. In one embodiment, an miRNA may be administered as a polynucleotide (e.g., a vector) that encodes a pri-miRNA, a pre-miRNA, or a mature miRNA. In one embodiment, an miRNA may be administered as a polynucleotide that is a pri- miRNA, a pre-miRNA, or a mature miRNA. Accordingly, a polynucleotide that is, or encodes, an miRNA is, is at least, or is no greater than 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56,
57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, or 130 nucleotides in length.
An miRNA includes an "miRNA region." An miRNA region refers to a polynucleotide sequence that is identical to a mature miRNA sequence. An "miRNA region" also includes a polynucleotide sequence that has structural similarity with a mature miRNA sequence. Thus, reference to an "miRNA" can include a polynucleotide that is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, or 100% identical to the sequence of a naturally- occurring miRNA. An miRNA having an miRNA region that is less than 100% identical to a natural miRNA region (e.g., a mature miRNA sequence depicted in Table 1) has the biological activity of the mature miRNA. An miRNA having an miRNA region that is less than 100% identical to a natural miRNA region may be referred to as a "mimic miRNA." A mature miRNA, and therefore an miRNA region, includes a seed region. A seed region is a series of consecutive nucleotides, usually nucleotides 2 through 8 from 5' end, of a mature miRNA that are complementary to a miRNA recognition element (MRE) in the untranslated region operably linked to a target coding region.
Table 1. Human miRNA sequences.
miR-765, UUUAGGCGCUGAUGAAAGUGGAGUUCAGUAGACAGCCC 26 69-89 UUUUCAAGCCCUACGAGAAACUGGGGUUUCUGGAGGAG AAGGAAGGUGAUGAAGGAUCUGUUCUCGUGAGCCUGAA
miR-518b, UCAUGCUGUGGCCCUCCAGAGGGAAGCGCUUUCUGUUG 27 51-72
UCUGAAAGAAAACAAAGCGCUCCCCUUUAGAGGUUUAC GGUUUGA
miR-1236, GUGAGUGACAGGGGAAAUGGGGAUGGACUGGAAGUGG 28 2-23, 81-102
GCAGCAUGGAGCUGACCUUCAUCAUGGCUUGGCCAACA UAAUGCCUCUUCCCCUUGUCUCUCCAG
miR-100*, CCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUAU 29 48-69
UAGUCCGCACAAGCUUGUAUCUAUAGGUAUGUGUCUGU UAGG
miR-515- UCUCAUGCAGUCAUUCUCCAAAAGAAAGCACUUUCUGU 30 14-37
UGUCUGAAAGCAGAGUGCCUUCUUUUGGAGCGUUACUG UUUGAGA
miR-744, UUGGGCAAGGUGCGGGGCUAGGGCUAACAGCAGUCUUA 31 1 1-32, 68-89
CUGAAGGUUUCCUGGAAACCACGCACAUGCUGUUGCCA CUAACCUCAACCUUACUCGGUC
miR-942, AUUAGGAGAGUAUCUUCUCUGUUUUGGCCAUGUGUGUA 32 13-34
CUCACAGCCCCUCACACAUGGCCGAAACAGAGAAGUUA
CUUUCCUAAU
miR-10b*, CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAA 33 27-49, 66-87
CCGAAUUUGUGUGGUAUCCGUAUAGUCACAGAUUCGAU UCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA
miR-150, CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCU 34 16-37, 51-72
GGGCUCAGACCCUGGUACAGGCCUGGGGGACAGGGACC
UGGGGAC
miR-17-3p, GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUG 35 51-72
AUAUGUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUU AUGGUGAC
miR-3944, UCCACCCAGCAGGCGCAGGUCCUGUGCAGCAGGCCAAC 36 23-43, 63-85
CGAGAAGCGCCUGCGUCUCCCAUUUUCGGGCUGGCCUG CUGCUCCGGACCUGUGCCUGAUCUUAAUGCUG
miR-135a AGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUG 37 17-39
AUUCUACUGCUCACUCAUAUAGGGAUUGGAGCCGUGGC GCACGGCGGGGACA
miR-30d*, GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACAC 38 46-67
AGCUAAGCUUUCAGUCAGAUGUUUGCUGCUAC
miR-876-5p, UGAAGUGCUGUGGAUUUCUUUGUGAAUCACCAUAUCUA 39 11-32
AGCUAAUGUGGUGGUGGUUUACAAAGUAAUUCAUAGU
GCUUCA
miR-873, GUGUGCAUUUGCAGGAACUUGUGAGUCUCCUAUUGAAA 40 11-31, 46-67
AUGAACAGGAGACUGAUGAGUUCCCGGGAACACCCACA
A
miR-625, AGGGUAGAGGGAUGAGGGGGAAAGUUCUAUAGUCCUG 41 15-35, 52-73
UAAUUAGAUCUCAGGACUAUAGAACUUUCCCCCUCAUC
CCUCUGCCCU
miR-520h, UCCCAUGCUGUGACCCUCUAGAGGAAGCACUUUCUGUU 42 55-76
UGUUGUCUGAGAAAAAACAAAGUGCUUCCCUUUAGAGU UACUGUUUGGGA
miR-491, UUGACUUAGCUGGGUAGUGGGGAACCCUUCCAUGAGGA 43 16-37, 50-71
GUAGAACACUCCUUAUGCAAGAUUCCCUUCUACCUGGC
UGGGUUGG
miR-1234, GUGAGUGUGGGGUGGCUGGGGGGGGGGGGGGGGGGCC 44 18-38, 61-82 GGGGACGGCUUGGGCCUGCCUAGUCGGCCUGACCACCC ACCCCACAG
miR-628, AUAGCUGUUGUGUCACUUCCUCAUGCUGACAUAUUUAC 45 23-44, 61-81
UAGAGGGUAAAAUUAAUAACCUUCUAGUAAGAGUGGCA GUCGAAGGGAAGGGCUCAU
miR-558, GUGUGUGUGUGUGUGUGUGGUUAUUUUGGUAUAGUAG 46 61-79
CUCUAGACUCUAUUAUAGUUUCCUGAGCUGCUGUACCA AAAUACCACAAACGGGCUG
miR-544 AUUUUCAUCACCUAGGGAUCUUGUUAAAAAGCAGAUUC 47 55-76
UGAUUCAGGGACCAAGAUUCUGCAUUUUUAGCAAGUUC UCAAGUGAUGCUAAU
miR-376a UAAAAGGUAGAUUCUCCUUCUAUGAGUACAUUAUUUAU 48
GAUUAAUCAUAGAGGAAAAUCCACGUUUUC
miR-487b, UUGGUACUUGGAGAGUGGUUAUCCCUGUCCUGUUCGUU 49 51-72
UUGCUCAUGUCGAAUCGUACAGGGUCAUCCACUUUUUC AGUAUCAA
miR-410, GGUACCUGAGAAGAGGUUGUCUGUGAUGAGUUCGCUUU 50 50-70
UAUUAAUGACGAAUAUAACACAGAUGGCCUGUUUUCAG UACC
miR-208b CCUCUCAGGGAAGCUUUUUGCUCGAAUUAUGUUUCUGA 51 46-67
UCCGAAUAUAAGACGAACAAAAGGUUUGUCUGAGGGCA
G
miR-17-5p, see miR-17-3p 14-36 miR-106b, CCUGCCGGGGCUAAAGUGCUGACAGUGCAGAUAGUGGU 52 12-32
CCUCUCCGUGCUACCGCACUGUGGGUACUUGCUGCUCC
AGCAGG
miR-106b*, see miR- 106b 52-73 miR-34c AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAA 53 13-35, 46-67
UAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAU
U
miR-2116*, GACCUAGGCUAGGGGUUCUUAGCAUAGGAGGUCUUCCC 54 51-71
AUGCUAAGAAGUCCUCCCAUGCCAAGAACUCCCAGACU AGGA
miR- 1273d, GAAUCGCUUGAACCCAUGAGGUUGAGGCUGCAGUGAGC 55 10-34
CAAGAUCGUGCCACUGCACUUCAGCCUGGGUGACAAGA GCGAAACUUC
miR-2909, GGUGUUAGGGCCAACAUCUCUUGGUCUUUCCCCUGUGG 56 4-24
UCCCAAGAUGGCUGUUGCAACUUAACGCCAU
miR-3936, AUGAUUCAGAGCAUCUGUCCAGUGUCUGCUGUAGAUCC 57 66-87
CUCAAAUCCGUGUUUGGACGCUUCUGGUAAGGGGUGUA UGGCAGAUGCACCCGACAGAUGCACUUGGCAGCA
tniR-3922, GGAAGAGUCAAGUCAAGGCCAGAGGUCCCACAGCAGGG 58 13-35, 62-83
CUGGAAAGCACACCUGUGGGACUUCUGGCCUUGACUUG ACUCUUUC
miR-3675-5p, GGAUGAUAAGUUAUGGGGCUUCUGUAGAGAUUUCUAU 59 12-34
GAGAACAUCUCUAAGGAACUCCCCCAAACUGAAUUC
miR-3682, UAAGUUAUAUAUGUCUACUUCUACCUGUGUUAUCAUAA 60 15-36, 50-70
UAAAGGUGUCAUGAUGAUACAGGUGGAGGUAGAAAUA
UAUAACUUA
miR-3678-3p, GAAUCCGGUCCGUACAAACUCUGCUGUGUUGAAUGAUU 61 69-90
GGUGAGUUUGUUUGCUCAUUGAUUGAAUCACUGCAGAG UUUGUACGGACCGGAUUC
miR-3674, ACAUCACUAUUGUAGAACCUAAGAUUGGCCGUUUGAGA 62 9-30
UGUCCUUUCAAGUUUUUGCAUUUCUGAUGU
mi -3661, CACCUUCUCGCAGAGGCUCUUGACCUGGGACUCGGACA 63 21-42 GCUGCUUGCACUCGUUCAGCUGCUCGAUCCACUGGUCC AGCUCCUUGGUGAACACCUU
miR-3119 AUUAACUCUGGCUUUUAACUUUGAUGGCAAAGGGGUAG 64 9-28
CUAAACAAUCUAUGUCUUUGCCAUCAAAGUUAAAAGCC AUAGUUAAU
miR-3660, GAAAGAAGAACUGGACAAAAUUAAAAUGCUCUUCUGUC 65 60-80
AUUGUAAUAGUUCAUAUGGGCACUGACAGGAGAGCAUU UUGACUUUGUCAAGUGUGUCUGCU
miR-3678-5p, see miR-3678-3p 9-28 miR-3934, CACAGCCCUUCCUGUCCCCAGUUUUCAGGUGUGGAAAC 66 25-46, 64-85
UGAGGCAGGAGGCAGUGAAGUAACUUGCUCAGGUUGCA
CAGCUGGGAAGUGGAGCAGGGAUUUGAAUCC
miR-4259, GAUGGGCCCCUUGUGUCCUGAAUUGGGUGGGGGCUCUG 67 70-91
AGUGGGGAAAGUGGGGGCCUAGGGGAGGUCACAGUUGG GUCUAGGGGUCAGGAGGGCCCAGGA
miR-2861, GGCGCCUCUGCAGCUCCGGCUCCCCCUGGCCUCUCGGGA 68 54-72
ACUACAAGUCCCAGGGGGCCUGGCGGUGGGCGGCGGGC
GGAAGAGGCGGGG
miR-3664, CUGUAAACUUGAAGGUAGGGAACUCUGUCUUCACUCAU 69 21-42, 59-80
GAGUACCUUCCAACACGAGCUCUCAGGAGUAAAGACAG AGUUCCCUACCUUCAAUGUGGAU
miR-3651, GAUUCGAUGGGCCAUAGCAAUCCUGUGAUUUAUGCAUG 70 64-87
GAGGCUGCUUCUCCUCAGCAGCUGCCAUAGCCCGGUCG
CUGGUACAUGAUUC
miR-3646, UUCAGUAGGUUGGGUUCAUUUCAUUUUCAUGACAACCC 71 58-79
UAUAUGGGAAAAUGUUGUGAAAAUGAAAUGAGCCCAGC CCAUUGAA
miR-3688 UCUUCACUUUCAAGAGUGGCAAAGUCUUUCCAUAUGUA 72 60-81
UGUAUGUAUGUCUGUUACACAUAUGGAAAGACUUUGCC ACUCUUUAAAGUGAAGA
miR-3679-3p, CGUGGUGAGGAUAUGGCAGGGAAGGGGAGUUUCCCUCU 73 44-65
AUUCCCUUCCCCCCAGUAAUCUUCAUCAUG
miR-3173, UCCCUGCCCUGCCUGUUUUCUCCUUUGUGAUUUUAUGA 74 5-26, 43-64
GAACAAAGGAGGAAAUAGGCAGGCCAGGGA
miR-3928, GCUGAAGCUCUAAGGUUCCGCCUGCGGGCAGGAAGCGG 75 37-58
AGGAACCUUGGAGCUUCGGC
miR-3929, AGUGGCUCACACCAGUAAUCCCAGCACUUUGGGAGGCU 76 33-55
GAUGUGAGUAGACCACU
miR-3622a-3p, AAUAGAGGGUGCACAGGCACGGGAGCUCAGGUGAGGCA 77 50-71
GGGAGCUGAGCUCACCUGACCUCCCAUGCCUGUGCACC
CUCUAUU
miR3120, GUCAUGUGACUGCCUGUCUGUGCCUGCUGUACAGGUGA 78 13-33, 51 -71
GCGGAUGUUCUGCACAGCAAGUGUAGACAGGCAGACAC AUGAC
miR-3937, AGAAGAAUGCCCAACCAGCCCUCAGUUGCUACAGUUCC 79 61-83
CUGUUGUUUCAGCUCGACAACAACAGGCGGCUGUAGCA AUGGGGGGCUGGAUGGGCAUCUCAAUGUGC
miR-4321, CUGGUCUCCGCAGAGCCUCUGCCCCUCCCGAGACACCCG 80 50-70
CUACCUGGUGUUAGCGGUGGACCGCCCUGCGGGGGCCU GGC
miR-3652, CGGCUGGAGGUGUGAGGAUCCGAACCCAGGGGUGGGGG 81 1-18
GUGGAGGCGGCUCCUGCGAUCGAAGGGGACUUGAGACU CACCGGCCGCACGCCAUGAGGGCCCUGUGGGUGCUGGG CCUCUGCUGCGUCCUGC
miR-3659, UCUACAAGCAGAUACAAGGAUGCCCUUGUACACAACAC 82 59-79
ACGUGCUGCUUGUAUAGACAUGAGUGUUGUCUACGAGG
GCAUCCUUGUGUCUGUGUGUGUG
miR-449c*, GCUGGGAUGUGUCAGGUAGGCAGUGUAUUGCUAGCGGC 83 57-79
UGUUAAUGAUUUUAACAGUUGCUAGUUGCACUCCUCUC UGUUGCAUUCAGAAGC
miR-3649, GCUUGGAACAGGCACCUGUGUGUGCCCAAGUGUUUCUA 84 47-65
GCAAACACAGGGACCUGAGUGUCUAAGC
miR-4314, GGCCAUUCCUCUCUGGGAAAUGGGACAGGUAGUGGCCA 85 11-28
CAGUGAGAAAGCUGGCCUGUCCUUCUGCCCCAGGGCCC AGAGUCUGUGACUGGA
miR-4308, UAUGGGUUCAGAGGGAACUCCAUUGGACAGAAAUUUCC 86 54-71
UUUUGAGGAAAUCUUUCCCUGGAGUUUCUUCUUACCUU UUUCC
miR-3673, AUAUAUAUAUAUGGAAUGUAUAUACGGAAUAUAUAUA 87 71-91
UAUAUGGAAUGUAUAUACGGAAUAUAUAUAUAUAUGG AAUGUAUAUACGGAAUAUAUAUAUAUAU
miR-3128, UUCCUCUGGCAAGUAAAAAACUCUCAUUUUCCUUAAAA 88 5-27
A AU G AG AGUUUUUUACUUGC AAUAGG A A
miR-3942, UCUUCAGUAUGACACCUCAAAGAAGCAAUACUGUUACC 89 23-44, 65-85
UGAAAUAGGCUGCGAAGAUAACAGUAUUUCAGAUAACA
GUAUUACAUCUUUGAAGUGUCAUAUUCACUGAC
miR-3127, GGCCAGGCCCAUCAGGGCUUGUGGAAUGGGAAGGAGAA 90 11-33, 47-68
GGGACGCUUCCCCUUCUGCAGGCCUGCUGGGUGUGGCU
miR-4253, CCAGCCAUCGCCCUUGAGGGGCCCUAGGACUUACUUGU 91 41-58
GCAGGGCAUGUCCAGGGGGUCCAGGUCUGC
miR-449c*, GCUGGGAUGUGUCAGGUAGGCAGUGUAUUGCUAGCGGC 92 57-79
UGUUAAUGAUUUUAACAGUUGCUAGUUGCACUCCUCUC UGUUGCAUUCAGAAGC
miR-4264, AAAGCUGGAUACUCAGUCAUGGUCAUUGUAACAUGAUA 93 11-27
GUGACAGGUACUGGGUAAGACUGCAUAG
miR-3670 UCUAGACUGGUAUAGCUGCUUUUGGAGCCUCACCUGCU 94 40-63
GAGAGCUCACAGCUGUCCUUCUCUAGA
miR-4271, AAAUCUCUCUCCAUAUCUUUCCUGCAGCCCCCAGGUGG 95 39-57
GGGGGAAGAAAAGGUGGGGAAUUAGAUUC
miR-3675-5p, GGAUGAUAAGUUAUGGGGCUUCUGUAGAGAUUUCUAU 96 12-34
GAGAACAUCUCUAAGGAACUCCCCCAAACUGAAUUC
miR-4324, CGGCCCCUUUGUUAAGGGUCUCAGCUCCAGGGAACUUU 97 43-62
AAAACCCUGAGACCCUAACCUUAAAGGUGCUGCA
miR-3656, CUUUCGGCCAGCGGGACGGCAUCCGAGGUGGGCUAGGC 98 49-65
UCGGGCCCGUGGCGGGUGCGGGGGUGGGAGG
miR-3654, UUCAUGAGCUGCAAUCUCAUCACUGGAAUGUUCCAGCG 99 38-56
ACUGGACAAGCUGAGGAA
miR-43 19, UUGGCUUGAGUCCCUGAGCAAAGCCACUGGGAAUGCUC 100 1 1-27
CCUGAGGACGUUAUAUGAGUGCUCAGCUCAUGGGGCUA UGAUGGUCA
miR- 1273d, GAAUCGCUUGAACCCAUGAGGUUGAGGCUGCAGUGAGC 101 10-34
CAAGAUCGUGCCACUGCACUUCAGCCUGGGUGACAAGA GCGAAACUUC
miR-3650, UCAAGGUGUGUCUGUAGAGUCCUGACUGCGUGCCAGGG 102 4-22
GCUCUGUCUGGCACAUUUCUGA
miR-3680* UUUUGCAUGACCCUGGGAGUAGG 103
miR-21 17, GCUCUGAUUUACUUCUGUCCGGCAUGGUGAACAGCAGG 104 51-71
AUUGGCUGUAGCUGUUCUCUUUGCCAAGGACAGAUCUG AUCU
W
Sequence similarity of two polynucleotides can be determined by aligning the residues of the two polynucleotides (for example, a candidate polynucleotide and any appropriate reference polynucleotide described herein) to optimize the number of identical nucleotides along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical nucleotides, although the nucleotides in
each sequence must nonetheless remain in their proper order. A reference polynucleotide may be a polynucleotide described herein. A candidate polynucleotide is the polynucleotide being compared to the reference polynucleotide. A candidate polynucleotide may be isolated, for example, from a plant, or can be produced using recombinant techniques, or chemically or enzymatically synthesized.
Unless modified as otherwise described herein, a pair-wise comparison analysis of nucleotide sequences can be carried out using the Blastn program of the BLAST search algorithm, available through the World Wide Web, for instance at the internet site maintained by the National Center for Biotechnology Information, National Institutes of Health. Preferably, the default values for all Blastn search parameters are used. Alternatively, sequence similarity may be determined, for example, using sequence techniques such as GCG FastA (Genetics Computer Group, Madison, Wisconsin), Mac Vector 4.5 (Kodak/IBI software package) or other suitable sequencing programs or methods known in the art.
Thus, as used herein, reference to a nucleotide sequence of a mature miRNA, for instance, can include a polynucleotide with at least 85%, at least 86%, at least 87%, at least 88%>, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, 99.1%, at least, 99.2%, at least, 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% nucleotide identity to a mature miRNA.
In some embodiments, such as embodiments concerning a pri-miRNA or a pre-miRNA, an miRNA may include a "complementary region." A complementary region refers to a region of an miRNA (e.g., a pri-miRNA or a pre-miRNA) that is or has at least 60%> complementary to the mature miRNA sequence of the miRNA. When a complementary region is present, a hairpin loop structure is typically present between the miRNA region and the complementary region. The complementary region is, or is at least, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% complementary to the miRNA region.
In one embodiment, altering viral replication in a cell, including decreasing replication, occurs through the use of miRNA inhibitors. miRNA inhibitors (also referred to in the art as
anti-miRs, antagomirs, and/or blockmirs) are engineered polynucleotides that, when introduced into a cell, silence endogenous miRNAs. The production, identification, and use of miRNA inhibitors is known to the person skilled in the art and is routine. Given the identity of an mRNA, a functional miRNA inhibitor can be easily produced. In one embodiment, an miRNA inhibitor is complementary to the mRNA targeted by an miRNA, but includes a sequence that is altered to prevent the action of the mature miRNA. In one embodiment, an miRNA inhibitor is a single-stranded polynucleotide that is a reverse complement of a mature miRNA sequence, and acts to prevent the action of the mature miRNA (Hutvagner et al., 2004, PLoS Biol., 2:E98; Meister et al., 2004, RNA 10:544-550). Inhibitors of greater length may also be used
(Hutvagner et al., 2004, PLoS Biol., 2:E98). In another embodiment, an miRNA inhibitor is a single-stranded polynucleotide that is a reverse complement of a mature miRNA sequence, but also includes secondary structural elements that enhance the activity of miRNA inhibitor (Vermeulen et al, 2007, RNA, 13:723-730).
Technologies for altering expression of a coding region include genomic editing. In one embodiment, genomic editing refers to the use of artificially engineered nucleases to produce a site-specific double stranded break in the genomic DNA of a cell. The creation of a double stranded break at a specific location can be used to engineer a specific mutation in a coding region within a cell. A specific mutation may result in the inactivation or knock-out of a coding region. For instance, the coding region may be modified to express an inactive polypeptide, or to not express a polypeptide. In another embodiment, genomic editing may be used to modify coding region or operably linked regulatory regions to express a polypeptide at increased level, or an additional copy of a coding region may be added to a cell. Genomic editing includes the use of meganucleases, zinc finger nucleases, and transcription activator-like effector nucleases (TALENs) (Smith et al., US Patent 8,021,867; Urnov and Jianbin, US Patent Application 20120196370; and Serber and Horwitz, US Patent Application 20120277120).
Altering virus replication may result in decreasing replication of a virus in a cell. In one embodiment, the alteration of viral replication may be a decrease of at least 0.1%, at least 0.5%, at least 1%, at least 5%, or at least 10% when compared to the replication of the virus in a control cell. The result of decreased viral replication in a cell includes less virus genetic material in a cell when compared to a control cell. In one embodiment, decreasing replication of a virus occurs by decreasing expression of a polypeptide in a cell, where the polypeptide is endogenous
to the cell. In one embodiment, the expression of more than one polypeptide may be decreased in a cell.
In one embodiment, the polypeptide is a protease. In one embodiment, the protease polypeptide is an ADAMTS7 polypeptide. The coding region encoding an ADAMTS7 polypeptide is known by the common gene symbol ADAMTS7, and the full name ADAM metallopeptidase with thrombospondin type 1, motif 7. A human version of this coding region is available at Genbank accession number NM_014272, and the ADAMTS7 polypeptide encoded by the coding region is also available at Genbank accession number NM_014272. As used herein an "ADAMTS7 polypeptide" refers to the polypeptide available at Genbank accession number NM_014272. "ADAMTS7 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_014272. An ADAMTS7 polypeptide is bound by an antibody that specifically binds to the ADAMTS7 polypeptide disclosed at Genbank accession number NM_014272. Such antibodies are commercially obtainable from, for instance, Abeam, (Cambridge, MA). As used herein, an antibody that can specifically bind a polypeptide is an antibody that interacts only with the epitope of the antigen that induced the synthesis of the antibody, or interacts with a structurally related epitope. An antibody that specifically binds to an epitope will, under the appropriate conditions, interact with the epitope even in the presence of a diversity of potential binding targets. As described herein, an ADAMTS7 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the protease polypeptide is a CPE polypeptide. The coding region encoding a CPE polypeptide is known by the common gene symbol CPE, and the full name Carboxypeptidase E. A human version of this coding region is available at Genbank accession number NM_014272, and the CPE polypeptide encoded by the coding region is also available at Genbank accession number NM_014272. As used herein a "CPE polypeptide" refers to the polypeptide available at Genbank accession number NM_014272. "CPE polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_001873. A CPE polypeptide is bound by an antibody that specifically binds to the CPE polypeptide disclosed at Genbank accession number NM_001873. Such
antibodies are commercially obtainable. As described herein, a CPE polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavir s A, a member of the genus Influenzavirus B.
In one embodiment, the protease polypeptide is a DPP3 polypeptide. The coding region encoding a DPP3 polypeptide is known by the common gene symbol DPP3, and the full name Dipeptidyl-peptidase 3. A human version of this coding region is available at Genbank accession number NM_005700, and the DPP3 polypeptide encoded by the coding region is also available at Genbank accession number NM_005700. As used herein a "DPP3 polypeptide" refers to the polypeptide available at Genbank accession number NM_005700. "DPP3 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_005700. A DPP3 polypeptide is bound by an antibody that specifically binds to the DPP3 polypeptide disclosed at Genbank accession number NM_005700. Such antibodies are commercially obtainable. As described herein, a DPP3 polypeptide has a role in DPP3, and as described herein, plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the protease polypeptide is a MST1 polypeptide. The coding region encoding a MST1 polypeptide is known by the common gene symbol MST1, and the full name macrophage stimulating 1 (hepatocyte growth factor-like). A human version of this coding region is available at Genbank accession number NM_020998, and the MST1 polypeptide encoded by the coding region is also available at Genbank accession number NM_020998. As used herein a "MST1 polypeptide" refers to the polypeptide available at Genbank accession number NM_020998. "MST1 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_020998. A MST1 polypeptide is bound by an antibody that specifically binds to the MST1 polypeptide disclosed at Genbank accession number NM_020998. Such antibodies are commercially obtainable. As described herein, a MST1 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a
member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the protease polypeptide is a PRSS 12 polypeptide. The coding region encoding a PRSS 12 polypeptide is known by the common gene symbol PRSS 12, and the full name Neurotrypsin, motopsin. A human version of this coding region is available at
Genbank accession number NM_003619, and the PRSS 12 polypeptide encoded by the coding region is also available at Genbank accession number NM_003619. As used herein a "PRSS12 polypeptide" refers to the polypeptide available at Genbank accession number NM_003619. "PRSS12 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_003619. A PRSS12 polypeptide is bound by an antibody that specifically binds to the PRSS 12 polypeptide disclosed at Genbank accession number NM_003619. Such antibodies are commercially obtainable. As described herein, a PRSS 12 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the polypeptide is a kinase. In one embodiment, the kinase polypeptide is a CDK13 polypeptide. The coding region encoding a CDK13 polypeptide is known by the common gene symbol CDK13 (also SDC2L5), and the full name cell division cycle 2-like 5. A human version of this coding region is available at Genbank accession number NM_003718, and the CDK13 polypeptide encoded by the coding region is also available at Genbank accession number M80629. As used herein a "CDK13 polypeptide" refers to the polypeptide available at Genbank accession number M80629. "CDK13 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number M80629. A CDK13 polypeptide is bound by an antibody that specifically binds to the CDK13 polypeptide disclosed at Genbank accession number M80629. Such antibodies are commercially obtainable. As described herein, a CDK13 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the kinase polypeptide is a HK2 polypeptide. The coding region encoding a HK2 polypeptide is known by the common gene symbol HK2 and the full name hexokinase 2. A human version of this coding region is available at Genbank accession number NM_000189, and the HK2 polypeptide encoded by the coding region is also available at Genbank accession number NM_000189. As used herein a "HK2 polypeptide" refers to the polypeptide available at Genbank accession number NM_000189. "HK2 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_000189. A HK2 polypeptide is bound by an antibody that specifically binds to the HK2 polypeptide disclosed at Genbank accession number NM_000189. Such antibodies are commercially obtainable. As described herein, a HK2 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the kinase polypeptide is a NEK8 polypeptide. The coding region encoding a NEK8 polypeptide is known by the common gene symbol NEK8, and the full name never in mitosis gene a- related kinase 8. A human version of this coding region is available at Genbank accession number NM_178170, and the NEK8 polypeptide encoded by the coding region is also available at Genbank accession number NM_178170. As used herein a "NEK8 polypeptide" refers to the polypeptide available at Genbank accession number NM_178170. "NEK8 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_178170. A NEK8 polypeptide is bound by an antibody that specifically binds to the NEK8 polypeptide disclosed at Genbank accession number NM_178170. Such antibodies are commercially obtainable. As described herein, a NEK8 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the kinase polypeptide is a PANK4 polypeptide. The coding region encoding a PANK4 polypeptide is known by the common gene symbol PANK4, and the full name pantothenate kinase 4. A human version of this coding region is available at Genbank accession number NM_018216, and the PANK4 polypeptide encoded by the coding region is
also available at Genbank accession number NM_018216. As used herein a "PANK4 polypeptide" refers to the polypeptide available at Genbank accession number NM_018216. "PANK4 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number NM_018216. A PANK4 polypeptide is bound by an antibody that specifically binds to the PANK4 polypeptide disclosed at Genbank accession number NM_018216. Such antibodies are commercially obtainable. As described herein, a PANK4 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the kinase polypeptide is a PLK4 polypeptide. The coding region encoding a PLK4 polypeptide is known by the common gene symbol PLK4, and the full name polo-like kinase 4. A human version of this coding region is available at Genbank accession number NM_014264, and the PLK4 polypeptide encoded by the coding region is also available at Genbank accession number NM_014264. As used herein a "PLK4 polypeptide" refers to the polypeptide available at Genbank accession number NM_014264. "PLK4 polypeptide" also refers to a polypeptide that has structural similarity with the polypeptide available at Genbank accession number PLK4. A PLK4 polypeptide is bound by an antibody that specifically binds to the PLK4 polypeptide disclosed at Genbank accession number NM_014264. Such antibodies are commercially obtainable. As described herein, a PLK4 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the kinase polypeptide is a SGK3 polypeptide. This peptide has three isoforms. The coding region encoding a SGK3 polypeptide is known by the common gene symbol SGK3, and the full name serum/glucocorticoid regulated kinase family, member 3. A human version of this coding region is available at Genbank accession number _, and the SGK3 polypeptide isoforms encoded by the coding region are available at Genbank accession number NPJX) 1028750.1, NP_037389.4, and NP_733827.2. As used herein a "SGK3 polypeptide" refers to the polypeptides available at Genbank accession number NP_001028750.1,
NP__037389.4, and NP_733827.2. "SGK3 polypeptide" also refers to a polypeptide that has
structural similarity with the polypeptides available at Genbank accession number NP 001028750.1, NP_037389.4, and NPJ733827.2. A SGK3 polypeptide is bound by an antibody that specifically binds to the SGK3 polypeptides disclosed at Genbank accession number NP_001028750.1, NPJ 7389.4, and NP_733827.2. Such antibodies are commercially obtainable. As described herein, a SGK3 polypeptide plays a role in viral replication. In one embodiment, decreasing expression of this polypeptide results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the polypeptide is selected from PPARA, RIF1, P4HA1, GRIA4, TWSG1, and SHANK2, or a polypeptide having structural similarity with such a polypeptide. The amino acid sequence of each of these polypeptides is known and present in publicly available databases, as is the nucleotide sequence of an mRNA encoding each polypeptide. In one embodiment, decreasing expression of one of these polypeptides results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B. In one embodiment, increasing expression of one of these polypeptides results in decreased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzaviru B.
In one embodiment, the polypeptide is selected from FGF23, HMCN1, GPC4,
KIAA0754, PAQR9, H2AFV, C5orfl5, DPY19L4, PRDM16, USP13, ABAT, POU2F3, SHPK, PARP9, MORC3, DENND1B, SLC25A16, ZNF578, STAT5B, DGKE, NRG1, PCBD2, DNHD1, U C5D, NUDT12, HNRNPA3, HSD17B13, C2CD4A, LOC100132963, ABCA1, CLVSl, C3orf79, SEC62, CNNM4, CDC42BPA, LRRTM4, WWP2, CNTD2, MCM6, C4orf40, POLDIP2, KIAA0776, FLVCR1, ZNF615, EROILB, SLIT1, TNRC6A, ZFAND5, PNPT1, IPPK, CCDC142, KCNK2, SAR1B, RRAGD, HNRNPAB, ADPGK, GABRB2, NF2,
ARHGEF3, RAGE, PLAG1, ZNF805, NSUN4, ZNF573, 41525, FKBP5, E2F7, EDAR, CXorf36, JRK, CHM, HOOK3, RALGPS1, GREB1, CACNA1E, LHX8, TRIM67,
TMEM120B, LENEP, MEF2D, ZNF709, FLJ36031, TD02, PHIP, CLIC2, SAMD12, BEND7, BRPF3, HNMT, PSMC2, PHTF2, MFSD6L, CCNE2, CEP44, CDC 14 A, TFG, ZNF793, ANKRD36B, SAMD13, TOB2, ZC3HAV1L, DCLK1, MECP2, CLDN11, Clorfl06, VAMP2, PEX5, BCLAF1, ASB11, WDR26, KSR2, RLIM, USP38, YIPF6, NEK7, CEP85, TFRC,
FAM59A, PPP1R2, TRPS1, CLIPl, DRAM1, ARL8A, LRRK2, UBXN2A, PDX1, KIAA0895, PPP2CA, ACTR10, UCP3, ZNF566, ABHD5, TBL1XR1, PSIP1, DNA2, CHSY1, MYSM1, EIF5A2, G0LPH3L, SLC9A6, LARP1B, TRIM2, GABRA6, PAPD4, PAN3, SYDE2,
FNDC3B, AKR1D1, GPR180, TMEM194B, PCDH11X, RDH11, RFX7, SLC35F1, MGAT4A, SLC11 A2, C9orfl50, GDAP2, CLYBL, TNFSF13B, NDUFA4, IGF1, CMTM4, CMTM6,
SUZ12, C20orfl94, NC0A3, PAPD5, FBXO40, AQPEP, NDST3, PC0LCE2, SMAD9, CRIPT, GABRA4, SRSF7, MSN, LY75, ZNF624, UGT2A3, FXRl, EIF2C4, SUSD5, ADCYl, CDKL2, TRIM36, ARFGAP2, ZNF238, AAK1, OTOR, ALS2CR8, SLC1A2, BRWD1, SLC25A3, MATN1, SLAIN1, C10orfl40, TSC1, MDM4, RPS6KA5, MDFIC, SECISBP2L, HSPC159, FMRl, GJAl, CHSTl, MYBLl, IRFl, SBF2, JARID2, PCDHB4, MBD2, PRKAA2, ANGEL2, SYT6, RNF38, MTMR10, LDLR, KCNJ10, TRIM23, DSEL, FAM35A, UBA3, ESYT3, SPICE1, SATB2, SYT1, DLL1, LGR4, PDE7A, KIAA0889, MET, FGD6, LRPAP1, CCDC50, KLF6, KLRD1, COL4A4, FAM123B, LYST, PRUNE2, AFF4, RHOBTB1, ZBTB11, STRN3, PPP1R9A, GAN, CACNB4, KIAA2026, TESK2, DNAJC27, KIAA1370, ELL2, TMPO, GALNT3, REST, CACNG8, CHST2, WTH3DI, TRDMT1, ZNF828, CELSR3, SDAD1, YAF2, ZFPM2, SLC9A8, AFFl, IL17RD, PLEKHG2, KCNIPl, GNA13, PRR20A, PRR20B, PRR20C, PRR20D, PRR20E, PCSK6, SYNC, SNX18, CLIC4, ABCA13, BTBD7, ANKRD40, ZNF644, TAX1BP1, CMKLR1, TC2N, ELOVL7, ERI2, PANX2, PDE4D, ZNF599, ZNF264, EFHC2, CALM3, DNAH14, ZNF492, CSMD1, NAALADL2, AN06, CD302, LY75-CD302, SCN9A, RTKN2, NR3C1, YTHDC2, KIF2A, RNF141, RPGR, ZMYM6, PABPC4L, KCNQ3, GRB2, TCTEX1D1, ZMYM2, CAB39L, SSH1, LPP, CXorf57, DDX58, NCOA7, CHIC1, PRLR, VPS13B, OAS2, FRMD6, CLK4, KIAA0528, THAP2, DUSP9, KLHL29, CCDC149, LRCH1, GPR183, SEC61A2, PTGFRN, CENPBD1, RIMBP2, ZNF197, ZNF597, VDAC1, SASS6, TMEM135, SPTBN1, EPB41L4B, PDZD2, IDE, NSF, PIK3C2A, USP28, AKAP7, TSGA10, RNF144B, C20orfl77, SIN3B, EGLN3, RFX6, CHMP2B, Clorfl73, SLC35C1, DPY19L1, ZFAND1, ARSJ, CDS1, FBXW7, ARHGEF26, WDR35, MAP2K4, TMEM184A, NRK, LRRCC1, PRDM2, SNX4, RGS6, CDKN1B, CXCL12, IFRD1, ARHGEF38, TCF12, OSTM1, ZNF181, APOLD1, C6, GABRA1, BEAN1, LBR, LRRC19, HECTD2, PHACTR4, KIT, VGLL4, RAB18, WSB2, 41531, SOD2, PAIP1, CPEB3, TP53BP2, NAP1L5, DNAAF1, NBPF3, SPG20, ZNF25, CYP4X1, CCDC126, FBX047, MIS12, CFHR5, KIAA1731,
DNAJC6, IRX5, CBWD1, CBWD5, CBWD3, CBWD6, PANK3, NGRN, PLXNC1, CBWD2,
KIF20A, PCMTD1, ATPBD4, DCUN1D1, MRPS7, CLVS2, LRRTM2, STMN1, ETV3, AP3B2, GDF9, PPP3R1, RIMS 3, DCAF12, TMSB15B, CAPN7, Γ ΡΡ4Β, Cl lorf41, ZNF652, NDUFAl, DMRT3, CCDC64, EML6, AGTPBPl, IL17RB, PLEKHA2, MRAP2, RFX8, KDR, NTF3, LGI2, FAM38B, SCD5, MYNN, C18orf56, ADRB1, S1PR1, BMPR2, STEAP2, ABCC3, FAM116A, RORA, MON2, PRICKLE2, IMPDH1, TMF1, PKHD1L1, SNAPC1, DYNC2H1, RB1CC1, PTAR1, TMPRSS11D, NETOl, KCNK10, RHPN2, SLC25A15, OSBPL3, FIGN, FLT1, ZNF124, SLC25A24, CTDSPL, PRPF18, ZNF845, SYN2, CREBL2, REPS2, NFE2L3, ZNF680, GRHL1, MCTP1, ZNF425, TMEM97, INF2, EDEM1, ONECUT2, CD69, NOX4, PHLPP2, KLF4, PLAC4, C5orf22, C2orf63, Clorf226, KIAA1919, SLC4A4, KBTBD8, TTC39A, C14orf28, ARHGEF38, CDC25A, RRAGD, REST, C2CD2, C2CD4A, CTDSPL, C20orfl94, SMARCA5, SYN2, ZNF845, and NOX4, or a polypeptide having structural similarity with such a polypeptide. The amino acid sequence of each of these polypeptides is known and present in publicly available databases, as is the nucleotide sequence of an mRNA encoding each polypeptide. In one embodiment, decreasing expression of one of these polypeptides results in decreased replication of a virus that is a member of the family Paramyxoviridae, such as a human respiratory syncytial virus. In one embodiment, increasing expression of one of these polypeptides results in decreased replication of a virus that is a member of the family Paramyxoviridae, such as a human respiratory syncytial virus.
Structural similarity of two polypeptides can be determined by aligning the residues of the two polypeptides (for example, a candidate polypeptide and an appropriate reference polypeptide described herein) to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical amino acids, although the amino acids in each sequence must nonetheless remain in their proper order. In one embodiment a reference polypeptide is a polypeptide described herein, such as, e.g., ADAMTS7, CPE, DPP3, MST1, or PRSS12. A candidate polypeptide is the polypeptide being compared to the reference polypeptide. A candidate polypeptide can be isolated, for example, from a cell, or can be produced using recombinant techniques, or chemically or enzymatically synthesized, or its presence inferred by identification of a coding region present in the genome of a cell.
Unless modified as otherwise described herein, a pair- wise comparison analysis of amino acid sequences can be carried out using the Blastp program of the blastp suite-2sequences search
algorithm, as described by Tatiana et al, (FEMS Microbiol Lett, 174, 247-250 (1999)), and available on the National Center for Biotechnology Information (NCBI) website. The default values for all blastp suite-2sequences search parameters may be used, including general paramters: expect threshold=10, word size=3, short queries=on; scoring parameters: matrix = BLOSUM62, gap costs=existence: 11 extension: 1 , compositional adjustments=conditional compositional score matrix adjustment. Alternatively, polypeptides may be compared using the BESTFIT algorithm in the GCG package (version 10.2, Madison WI).
In the comparison of two amino acid sequences, structural similarity may be referred to by percent "identity" or may be referred to by percent "similarity." "Identity" refers to the presence of identical amino acids. "Similarity" refers to the presence of not only identical amino acids but also the presence of conservative substitutions. A conservative substitution for an amino acid in a polypeptide of disclosed herein may be selected from other members of the class to which the amino acid belongs. For example, it is well-known in the art of protein
biochemistry that an amino acid belonging to a grouping of amino acids having a particular size or characteristic (such as charge, hydrophobicity and hydrophilicity) can be substituted for another amino acid without altering the activity of a protein, particularly in regions of the protein that are not directly associated with biological activity. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Conservative substitutions include, for example, Lys for Arg and vice versa to maintain a positive charge; Glu for Asp and vice versa to maintain a negative charge; Ser for Thr so that a free -OH is maintained; and Gin for Asn to maintain a free -NH2.
Thus, as used herein, reference to an amino acid sequence of, for instance, an
ADAMTS7, CPE, DPP3, MST1, PRSS12, CDK13, H 2, NEK8, PANK4, PLK4, or SGK3 polypeptide, can include a polypeptide with at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% amino acid sequence similarity to the reference amino acid sequence.
Alternatively, as used herein, reference to an amino acid sequence of, for instance, an ADAMTS7, CPE, DPP3, MST1, PRSS12, CDK13, HK2, NEK8, PAN 4, PLK4, or SGK3 polypeptide, can include a polypeptide with at least 50%, at least 55%>, at least 60%, at least 65%, at least 70%>, at least 75%, at least 80%, at least 85%, at least 86%>, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%), at least 96%, at least 97%, at least 98%>, or at least 99% amino acid sequence identity to the reference amino acid sequence.
In one embodiment, miRNAs that may be used to decrease replication of a virus that is a member of the family Orthomyxoviridae, such as Influenza A virus, include miR- 1254, miR- 1272, miR-124a, miR-124* (see Table 1).
In one embodiment, miRNAs that may be used to decrease replication of a virus that is a member of the family Paramyxoviridae, such as human respiratory syncytial virus, include miR- 668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR-190b, miR- 548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR-744, miR-942, miR-10b*, miR-150, miR-124*, miR-17-3p, miR-3944, miR- 135a, miR-30d*, miR-876-5p, miR-873, miR-625, miR-520h, miR-491, miR-1234, miR-628, miR-558, miR-544, miR-376a, miR-487b, miR-410, miR-208b.
In one embodiment, miRNAs that may be used to decrease replication of a virus that is a member of the Orthomyxoviridae, such as Influenza A virus, and/or the family Paramyxoviridae, such as human respiratory syncytial virus, include miR-124*, and miR-124a.
In one embodiment, an miRNA inhibitor may be used to decrease replication of a virus that is a member of the family Orthomyxoviridae, such as Influenza A virus. Examples of such miRNAs that may be the target of an miRNA inhibitor include miR-17-5p, miR-106b, miR- 106b*, and miR-34c.
In one embodiment, an miRNA inhibitor may be used to decrease replication of a virus that is a member of the family Paramyxoviridae, such as human respiratory syncytial vims. Examples of such miRNAs that may be the target of an miRNA inhibitor include miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653,
miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681*, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, and miR-18a*.
Altering virus replication may result in increasing replication of a virus in a cell. In one embodiment, the alteration of viral replication may be an increase of at least 0.1%, at least 0.5%, at least 1%, at least 5%, or at least 10% when compared to the replication of the virus in a control cell. The result of increased viral replication in a cell includes more virus genetic material in a cell when compared to a control cell. In one embodiment, increasing replication of a virus occurs by decreasing expression of a polypeptide in a cell, where the polypeptide is endogenous to the cell.
In one embodiment, the polypeptide targeted for decreased expression is selected from
FGD4, PKD2, MAP3K2, ZNFX1, PDCD1LG2, PLEKHA3, EIF5A2, FYCOl, GPR6, ENPP5, EPHA4, VSX1, STK17B, SACS, C14orf28, ZFYVE26, FGL2, SZT2, MEIR5, RPS6KA5, CllorfiO, XRN1, FBXL5, CAMTA1, ITPRIPL2, SERF 1 A, SERF IB, GPR137C, FTSJD1, EPHA5, GUCY1A3, RRAGD, CTSS, GNPDA2, FBX048, DYNC1LI2, FAM129A, CERCAM, FIB IN, EZH1, CYP2U1, RNF128, IRF9, VPS53, DDHD1, ANKRD29, REST, FAM40B, PPP1R3B, RABl 1FIP5, ARID4B, C2CD2, PRRG1, TNFRSF21, KLHL2, SGTB, SEMA4B, C2CD4A, LAM A3, PTPN4, MCHR2, TRDN, RUFY2, ARHGAP12, ESR1, ZXDA, SLITRK3, ISM2, RAB22A, SLC46A3, CEP97, UEVLD, BTG3, PGM2L1, IFIT5, CYBRD1, FNBP1L, PURB, SSH2, ATP 12 A, HSPA8, FJX1, SLC11A1, CNRIP1, Clorfl35, RASSF2, ANKRD52, DENND5B, ATG16L1, BRMS1L, CTDSPL, CCL1, ZFYVE9, SLC40A1, DUSP2, STARD8, ZNF800, TCF7L1, VLDLR, FCH02, MASTL, RBL1, ZNF652, CENPQ, MRPL24, FZD3, ITGB8, GPR133, NR2E3, AN06, UNC80, LIMAl, ARID4A, ARHGAP26, FBX031, ZNF367, ZFP3, GINS4, SAR1B, C7orf43, PBX3, E2F5, SEMA7A, HAUS8, LMOD3, RGMA, ITSN2, PTHLH, TGM2, ZADH2, Clorf63, ZIM3, ΝΓΝ, KLHL28, NAGK, PTPDC1, CTSK, TGFBR2, ST6GALNAC3, TRIP11, ZNF238, TAOK3, WWP2, FRMD6, CRY2, TRIM36, C15orfl7,
VASH2, CXCL6, KIAA1383, TM2D2, KIF23, SERP1, AHNAK, U2SURP, RPGR, C18orf32, DUSP18, NKIRAS1, PFKP, LYST, Cl lorf82, CHRM2, C19orf2, GPATCH2, RGMB,
PAPOLB, FIGNL1, CAPRIN2, CROT, MAP3K5, USP31, MKNK2, TXNIP, BTN3A1,
AGFG1, KIF14, LRCH1, C18orfl9, SLAIN2, ZNF512B, BNIP2, RSBN1, DERL2, MMP3, HDHD1, PAG1, GLOl, FAM13C, NCEH1, SDC2, RBM34, MMAA, RPL17-C180RF32, ARL1, CHP2, PRRG4, TOPORS, MED 17, and BMPR2, or a polypeptide having structural
similarity with such a polypeptide. The amino acid sequence of each of these polypeptides is known and present in publicly available databases, as is the nucleotide sequence of an mRNA encoding each polypeptide. In one embodiment, decreasing expression of one of these polypeptides results in increased replication of a virus that is a member of the family
Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B. In one embodiment, increasing expression of one of these polypeptides results in increased replication of a virus that is a member of the family Orthomyxoviridae, such as a member of the genus Influenzavirus A, a member of the genus Influenzavirus B.
In one embodiment, the polypeptide is selected from FGF23, HMCN1, GPC4,
KIAA0754, PAQR9, H2AFV, C5orfl5, DPY19L4, PRDM16, USP13, ABAT, POU2F3, SHPK, PARP9, MORC3, DENND1B, SLC25A16, ZNF578, STAT5B, DGKE, NRG1, PCBD2, DNHD1, UNC5D, NUDT12, HNRNPA3, HSD17B13, C2CD4A, LOC100132963, ABCA1, CLVSl, C3orf79, SEC62, CNNM4, CDC42BPA, LRRTM4, WWP2, CNTD2, MCM6, C4orf40, POLDIP2, KIAA0776, FLVCR1, ZNF615, EROILB, SLIT1, TNRC6A, ZFAND5, PNPT1, IPPK, CCDC142, KCNK2, SAR1B, RRAGD, HNRNPAB, ADPGK, GABRB2, NF2,
ARHGEF3, RAGE, PLAG1, ZNF805, NSUN4, ZNF573, 41525, FKBP5, E2F7, EDAR, CXorf36, JRK, CHM, HOOK3, RALGPS1, GREBl, CACNA1E, LHX8, TRIM67,
TMEM120B, LENEP, MEF2D, ZNF709, FLJ36031, TD02, PHIP, CLIC2, SAMD12, BEND7, BRPF3, HNMT, PSMC2, PHTF2, MFSD6L, CCNE2, CEP44, CDC14A, TFG, ZNF793, ANKRD36B, SAMD13, TOB2, ZC3HAV1L, DCLK1, MECP2, CLDN11, Clorfl06, VAMP2, PEX5, BCLAF1, ASB11, WDR26, KSR2, RLIM, USP38, YIPF6, NEK7, CEP85, TFRC, FAM59A, PPP1R2, TRPS1, CLIPl, DRAM1, ARL8A, LRRK2, UBXN2A, PDX1, KIAA0895, PPP2CA, ACTR10, UCP3, ZNF566, ABHD5, TBL1XR1, PSIP1, DNA2, CHSY1, MYSM1, EIF5A2, GOLPH3L, SLC9A6, LARPIB, TRIM2, GABRA6, PAPD4, PAN3, SYDE2,
FNDC3B, AKR1D1, GPR180, TMEM194B, PCDH1 IX, RDH11, RFX7, SLC35F1, MGAT4A, SLC11A2, C9orfl50, GDAP2, CLYBL, TNFSF13B, NDUFA4, IGF1, CMTM4, CMTM6, SUZ12, C20orfl94, NCOA3, PAPD5, FBXO40, AQPEP, NDST3, PCOLCE2, SMAD9, CRIPT, GABRA4, SRSF7, MSN, LY75, ZNF624, UGT2A3, FXRl, EIF2C4, SUSD5, ADCYl, CDKL2, TRIM36, ARFGAP2, ZNF238, AAK1, OTOR, ALS2CR8, SLC1A2, BRWD1, SLC25A3, MATN1, SLAIN1, C10orfl40, TSC1, MDM4, RPS6KA5, MDFIC, SECISBP2L, HSPC159, FMRl, GJAl, CHSTl, MYBLl, IRFl, SBF2, JARID2, PCDHB4, MBD2, PRKAA2, ANGEL2,
SYT6, RNF38, MTMR10, LDLR, KCNJ10, TRIM23, DSEL, FAM35A, UBA3, ESYT3, SPICE1, SATB2, SYT1, DLL1, LGR4, PDE7A, KIAA0889, MET, FGD6, LRPAPl, CCDC50, KLF6, KLRD1, COL4A4, FAM123B, LYST, PRUNE2, AFF4, RH0BTB1, ZBTB11, STRN3, PPP1R9A, GAN, CACNB4, KIAA2026, TESK2, DNAJC27, KIAA1370, ELL2, TMPO, GALNT3, REST, CACNG8, CHST2, WTH3DI, TRDMTl, ZNF828, CELSR3, SDADl, YAF2, ZFPM2, SLC9A8, AFFl, IL17RD, PLEKHG2, KCNIPl, GNA13, PRR20A, PRR20B, PRR20C, PRR20D, PPvR20E, PCSK6, SYNC, SNX18, CLIC4, ABCA13, BTBD7, ANKRD40, ZNF644, TAX1BP1, CMKLR1, TC2N, ELOVL7, ERI2, PANX2, PDE4D, ZNF599, ZNF264, EFHC2, CALM3, DNAH14, ZNF492, CSMD1, NAALADL2, AN06, CD302, LY75-CD302, SCN9A, RTKN2, NR3C1, YTHDC2, KIF2A, RNF141, RPGR, ZMYM6, PABPC4L, KCNQ3, GRB2, TCTEX1D1, ZMYM2, CAB39L, SSH1, LPP, CXorf57, DDX58, NCOA7, CHIC1, PRLR, VPS13B, OAS2, FRMD6, CLK4, KIAA0528, THAP2, DUSP9, KLHL29, CCDC149, LRCH1, GPR183, SEC61A2, PTGFRN, CENPBD1, RIMBP2, ZNF197, ZNF597, VDAC1, SASS6, TMEM135, SPTBN1, EPB41L4B, PDZD2, IDE, NSF, PIK3C2A, USP28, AKAP7, TSGA10, RNF144B, C20orfl77, SIN3B, EGLN3, RFX6, CHMP2B, Clorfl73, SLC35C1, DPY19L1, ZFAND1, ARSJ, CDS1, FBXW7, ARHGEF26, WDR35, MAP2K4, TMEM184A, NRK, LRRCC1, PRDM2, SNX4, RGS6, CDKNIB, CXCL12, IFRDl, ARHGEF38, TCF12, OSTM1, ZNF181, APOLD1, C6, GABRA1, BEAN1, LBR, LRRC19, HECTD2, PHACTR4, KIT, VGLL4, RAB18, WSB2, 41531, SOD2, PAIP1, CPEB3, TP53BP2, NAP1L5, DNAAF1, NBPF3, SPG20, ZNF25, CYP4X1, CCDC126, FBX047, MIS12, CFHR5, KIAA1731,
DNAJC6, IRX5, CBWD1, CBWD5, CBWD3, CBWD6, PANK3, NGRN, PLXNC1, CBWD2, KIF20A, PCMTD1, ATPBD4, DCUN1D1, MRPS7, CLVS2, LRRTM2, STMN1, ETV3, AP3B2, GDF9, PPP3R1, RIMS3, DCAF12, TMSB15B, CAPN7, INPP4B, Cl lorf41, ZNF652, NDUFAl, DMRT3, CCDC64, EML6, AGTPBPl, IL17RB, PLEKHA2, MRAP2, RFX8, KDR, NTF3, LGI2, FAM38B, SCD5, MYNN, C18orf56, ADRBl, S1PR1, BMPR2, STEAP2, ABCC3, FAM116A, RORA, MON2, PRICKLE2, IMPDH1, TMF1, PKHD1L1, SNAPC1, DYNC2H1, RB1CC1, PTAR1, TMPRSS11D, NETOl, KCNK10, RHPN2, SLC25A15,
OSBPL3, FIGN, FLT1, ZNF124, SLC25A24, CTDSPL, PRPF18, ZNF845, SYN2, CREBL2, REPS2, NFE2L3, ZNF680, GRHL1, MCTP1, ZNF425, TMEM97, INF2, EDEM1, ONECUT2, CD69, NOX4, PHLPP2, KLF4, PLAC4, C5orf22, C2orf63, Clorf226, KIAA1919, SLC4A4, KBTBD8, TTC39A, C14orf28, ARHGEF38, CDC25A, RRAGD, REST, C2CD2, C2CD4A,
CTDSPL, C20orfl94, SMARCA5, SYN2, ZNF845, and NOX4, or a polypeptide having structural similarity with such a polypeptide. The amino acid sequence of each of these polypeptides is known and present in publicly available databases, as is the nucleotide sequence of an mRNA encoding each polypeptide. In one embodiment, decreasing expression of one of these polypeptides results in increased replication of a vims that is a member of the family Paramyxoviridae, such as a human respiratory syncytial virus. In one embodiment, increasing expression of one of these polypeptides results in increased replication of a virus that is a member of the family Paramyxoviridae, such as a human respiratory syncytial virus.
In one embodiment, miRNAs that may be used to increase replication of a virus that is a member of the family Orthomyxoviridae, such as Influenza A virus, include miR-17-5p, miR- 106b, miR-106b*, and miR-34c.
In one embodiment, miRNAs that may be used to increase replication of a virus that is a member of the family Paramyxoviridae, such as human respiratory syncytial virus, include miR- 2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681 *, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, and miR- 18a*.
In one embodiment, miRNA inhibitors may be used to increase replication of a virus. In one embodiment, an miRNA inhibitor may be used to increase replication of a virus that is a member of the family Orthomyxoviridae, such as Influenza A virus. Examples of such miRNAs that may be the target of an miRNA inhibitor include miR-1254, miR-1272, miR- 124a, and miR-124*.
In one embodiment, an miRNA inhibitor may be used to increase replication of a virus that is a member of the family Paramyxoviridae, such as human respiratory syncytial virus.
Examples of such miRNAs that may be the target of an miRNA inhibitor include miR-668, miR- 509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR-190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515- 5p, miR-744, miR-942, miR-10b*, miR-150, miR-124*, miR-17-3p, miR-3944, miR-135a, miR-
30d*, miR-876-5p, miR-873, miR-625, miR-520h, miR-491, miR-1234, miR-628, miR-558, miR-544, miR-376a, miR-487b, miR-410, miR-208b.
A polynucleotide described herein, for instance, a polynucleotide used for RNAi or an miRNA or miRNA inhibitor, or a polynucleotide having a coding region, may be present in a vector. A vector is a replicating polynucleotide, such as a plasmid, virus, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a polynucleotide described herein may employ standard ligation techniques known in the art. See, e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989). A vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polynucleotide, i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, transposon vectors, and artificial chromosome vectors. Examples of viral vectors include, for instance, adenoviral vectors, adeno- associated viral vectors, lentiviral vectors, retroviral vectors, and herpes virus vectors. A vector may result in integration into a cell's genomic DNA. A vector may be capable of replication in a bacterial host, for instance E. coli. A polynucleotide described herein may be present in a vector as two separate complementary polynucleotides, each of which can be expressed to yield a sense and an antisense strand of a dsRNA, or as a single polynucleotide containing a sense strand, an intervening spacer region, and an antisense strand, which can be expressed to yield an RNA polynucleotide having a sense and an antisense strand of a dsRNA (e.g., a shRNA).
Selection of a vector depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like. Suitable host cells for cloning or expressing the vectors herein are prokaryotic or eukaryotic cells. Suitable eukaryotic cells include mammalian cells, such as murine cells and human cells. Suitable prokaryotic cells include eubacteria, such as gram-negative organisms, for example, E. coli.
An expression vector optionally includes regulatory sequences operably linked to the polynucleotide described herein. Vectors may include constitutive, inducible, and/or tissue specific promoters for expression of a polynucleotide described herein in a particular tissue or intracellular environment, examples of which are known to one of ordinary skill in the art.
Constitutive mammalian promoters include, but are not limited to, polymerase promoters as well as the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPTR),
adenosine deaminase, pyruvate kinase, and β-actin. Exemplary viral promoters which function constitutively in eukaryotic cells include, but are not limited to, promoters from the simian virus, papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those of ordinary skill in the art.
Inducible promoters are expressed in the presence of an inducing agent and include, but are not limited to, metal-inducible promoters and steroid-regulated promoters. For example, the metallothionein promoter is induced to promote transcription in the presence of certain metal ions. Other inducible promoters are known to those of ordinary skill in the art.
Examples of tissue-specific promoters include, but are not limited to, the SFTPC promoter (Glasser et al., 2000, Am J Physiol Lung Cell Mol Physiol, 278:L933-L945), which is specific for lung epithelial cells. Other inducible promoters are known to those of ordinary skill in the art.
The polynucleotide described herein may also include a transcription terminator. Suitable transcription terminators are loiown in the art and include, for instance, a stretch of 5 consecutive thymidine nucleotides.
Polynucleotides described herein can be produced in vitro or in vivo. For instance, methods for in vitro synthesis include, but are not limited to, chemical synthesis with a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic polynucleotides and reagents for in vitro synthesis are well loiown. Methods for in vitro synthesis also include, for instance, in vitro transcription using a circular or linear expression vector in a cell free system. Expression vectors can also be used to produce a polynucleotide described herein in a cell, and the polynucleotide may then be isolated from the cell.
Also provided herein are genetically modified cells. A genetically modified cell has the characteristic of altered viral replication when compared to a control cell. The altered replication may be an increase in viral replication or a decrease in viral replication. In one embodiment, the alteration of viral replication may be an increase or a decrease of at least 0.1%, at least 0.5%, at least 1%, at least 5%, or at least 10% when compared to the replication of the virus in a control cell. Optionally, a genetically modified cell described herein includes a virus, such as a virus that is a member of the family Orthomyxoviridae or a member of the family Paramyxoviridae.
In one embodiment a genetically modified cell includes a polynucleotide described herein. In one embodiment, such a cell includes a polynucleotide (e.g., a vector) that encodes a biologically active RNA, for instance, a dsRNA, an miRNA (such as a pri-miRNA, a pre- miRNA, or a mature miRNA), or a ribozyme. In one embodiment, such a cell includes a polynucleotide that is a biologically active RNA. In one embodiment, a genetically modified cell includes an alteration of endogenous nucleotides, for instance, the genomic DNA of the cell has been edited.
Methods for making genetically modified cells are known in the art and routine. In one embodiment, a method for making such a cell includes introducing into the cell a vector that encodes a biologically active RNA, or introducing into the cell a biologically active RNA. In one embodiment, a genetically modified includes an edited genome. Methods for editing a coding region in a cell generally include introducing into a cell a polynucleotide that encodes an artificially engineered nuclease that recognizes a target sequence in the coding region and is able to cleave a site in the coding region (Urnov and Wang, US Published Patent Application
20120196370, Weinstein et al., US Published Patent Application 20120192298). Optionally, for instance in an embodiment that results in integration of a polynucleotide sequence, a
polynucleotide that includes a sequence for integration is also introduced into the cell. The sequence for integration may include flanking upstream and downstream sequences that share sequence identity with either side of the cleavage site. The cells containing the introduced polynucleotide(s) are cultured under conditions suitable for expression of the artificially engineered nuclease. In one embodiment, the artificially engineered nuclease introduces a double-stranded break into the genomic sequence, and the double-stranded break may be repaired by a non-homologous end-joining repair process such that a mutation is introduced into the coding region, or a homology-directed repair process such that the sequence for integration is integrated into the genomic sequence.
Also provided herein are compositions. In one embodiment, a composition includes one or more of the agents described herein that alter viral replication. Such agents, referred to herein as active agents, include the polynucleotides described herein, and small molecules. Such compositions may include a pharmaceutically acceptable carrier. As used herein
"pharmaceutically acceptable carrier" includes saline, solvents, dispersion media, coatings,
antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration and not deleterious to a recipient thereof.
In one embodiment, a composition includes a genetically modified cell. A composition including a genetically modified cell may include a carrier that is not deleterious to the cell, such as a tissue culture medium.
The polynucleotide present in a composition may be DNA, RNA, or a combination thereof. The polynucleotide may be supplied as part of a vector that encodes and subsequently expresses the polynucleotide, or may be supplied as the polynucleotide itself (e.g., a dsRNA that acts to decrease expression of a target polypeptide or an miRNA that acts to alter viral replication).
A composition may include other compounds for protecting against viral pathogens, including viral pathogens that are members of the family Orthomyxoviridae and/or the family Paramyxoviridae. Many antiviral agents are known in the art and are used routinely. Examples of such compounds include, for instance, probenicid (Tripp et al., WO2012142492), zanamivir, oseltamivir, amantadine, and rimantadine.
A composition may be prepared by methods known in the art of pharmacy. In general, a composition can be formulated to be compatible with its intended route of administration. More specifically, the compositions disclosed herein may be administered to any tissue of an animal, including, but not limited to, tissues of the respiratory tract such as lung tissue, muscle (such as skeletal muscle or cardiac muscle), skin, brain tissue, lung tissue, liver tissue, spleen tissue, bone marrow tissue, thymus tissue, heart tissue, e.g., myocardium, endocardium, and pericardium, lymph tissue, blood tissue, bone tissue, pancreas tissue, kidney tissue, gall bladder tissue, stomach tissue, intestinal tissue, testicular tissue, ovarian tissue, uterine tissue, vaginal tissue, rectal tissue, nervous system tissue, eye tissue, glandular tissue, tongue tissue, and connective tissue, e.g., cartilage. In one embodiment, the compositions disclosed herein may be
administered to an ex vivo cell.
A composition disclosed herein may be administered to any internal cavity of an animal, including, but not limited to, lungs, mouth, nasal cavity, stomach, peritoneal cavity, intestine, a heart chamber, veins, arteries, capillaries, lymphatic cavities, uterine cavity, joint cavities, spinal canal in spinal cord, ocular cavities, the lumen of a duct of a salivary gland or a liver.
Compositions disclosed herein may be administered to an animal by intramuscular (i.m.), subcutaneous (s.c), or intrapulmonary routes. Other suitable routes of administration include, but are not limited to intratracheal, transdermal, intraocular, intranasal, inhalation, intracavity, intravenous (i.v.), intraductal (e.g., into the pancreas) and intraparenchymal (i.e., into any tissue) administration. Transdermal delivery includes, but not limited to intradermal (e.g., into the dermis or epidermis), transdermal (e.g., percutaneous) and transmucosal administration (i.e., into or through skin or mucosal tissue). Intracavity administration includes, but is not limited to, administration into oral, vaginal, rectal, nasal, peritoneal, or intestinal cavities as well as, intrathecal (i.e., into spinal canal), intraventricular (i.e., into the brain ventricles or the heart ventricles), inraatrial (i.e., into the heart atrium) and sub arachnoid (i.e., into the sub arachnoid spaces of the brain) administration.
Any route of administration may be used so long as it results in the delivery of an amount sufficient to result in inhibition of virus replication in cells of an animal in need of such response. In one embodiment intrapulmonary delivery is preferred, and may be accomplished by an aerosol or spray.
A composition may be administered in a variety of different dosage forms. An aqueous medium containing the composition may be desiccated and combined with pharmaceutically acceptable inert excipients and buffering agents such as lactose, starch, calcium carbonate, sodium citrate formed into tablets, capsules, and the like. These combinations may also be formed into a powder or suspended in an aqueous solution.
For purposes of parenteral administration, the active agent may be combined with pharmaceutically acceptable carrier(s) well known in the art such as saline solution, water, propylene glycol, etc. In this form, the composition may be parenterally, intranasally, or orally applied by methods known in the art. The composition may also be administered intravenously by syringe. In this form, the vaccine may be combined with pharmaceutically acceptable aqueous carrier(s) such as a saline solution. The parenteral and intravenous formulations of the
composition may also include emulsifying and/or suspending agents as well, together with pharmaceutically acceptable diluent to control the delivery and the dose amount of the composition.
Solutions or suspensions may include the following components: a sterile diluent such as water for administration, saline solution, fixed oils, polyethylene glycols, glycerine, propylene
glycol, or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates, or phosphates; electrolytes, such as sodium ion, chloride ion, potassium ion, calcium ion, and magnesium ion, and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH may be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. A composition may be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
Compositions may include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, or phosphate buffered saline (PBS). A composition is typically sterile and, when suitable for injectable use, should be fluid to the extent that easy syringability exists. It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.
The compositions disclosed herein may be prepared with carriers that will protect the one or more active agents against rapid elimination from the body, such as a controlled release formulation, including implants. Biodegradable, biocompatible polymers may be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Such formulations may be prepared using standard techniques. The materials may also be obtained commercially. Liposomal suspensions may also be used as
pharmaceutically acceptable carriers. These may be prepared according to methods known to those skilled in the art.
In one embodiment, an active agent may be associated with a targeting group. As used herein, a "targeting group" refers to a chemical species that interacts, either directly or indirectly, with the surface of a cell, for instance with a molecule present on the surface of a cell, e.g., a
receptor. The interaction can be, for instance, an ionic bond, a hydrogen bond, a Van der Waals force, or a combination thereof. Examples of targeting groups include, for instance, saccharides, polypeptides (including hormones), polynucleotides, fatty acids, and catecholamines. Another example of a targeting group is an antibody. The interaction between the targeting group and a molecule present on the surface of a cell, e.g., a receptor, may result in the uptake of the targeting group and associated active compound. Examples of useful targeting groups include lectins that bind to mucins present on the surface of respiratory cells.
When a polynucleotide is introduced into cells using any suitable technique, the polynucleotide may be delivered into the cells by, for example, transfection or transduction procedures. Transfection and transduction refer to the acquisition by a cell of new genetic material by incorporation of added polynucleotides. Transfection can occur by physical or chemical methods. Many transfection techniques are known to those of ordinary skill in the art including, without limitation, calcium phosphate DNA co-precipitation, DEAE-dextrin DNA transfection, electroporation, naked plasmid adsorption, cationic liposome-mediated transfection (commonly known as lipofection), . Transduction refers to the process of transferring nucleic acid into a cell using a DNA or RNA virus.
A polynucleotide described herein may be used in combination with other agents assisting the cellular uptake of polynucleotides, or assisting the release of poylnucleotides from endosomes or intracellular compartments into the cytoplasm or cell nuclei by, for instance, conjugation of those to the polynucleotide. The agents may be, but are not limited to, peptides, especially cell penetrating peptides, protein transduction domains, and/or dsRNA-binding domains which enhance the cellular uptake of polynucleotides (Dowdy et al., US Published Patent Application 2009/0093026, Eguchi et al, 2009, Nature Biotechnology 27:567-571, Lindsay et al, 2002, Curr. Opin. Pharmacol., 2:587-594, Wadia and Dowdy, 2002, Curr. Opin. Biotechnol. 13:52-56. Gait, 2003, Cell. Mol. Life Sci., 60:1-10). The conjugations can be performed at an internal position at the oligonucleotide or at a terminal postions either the 5 '-end or the 3 '-end.
Toxicity and therapeutic efficacy of active agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD5o (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic
index and it can be expressed as the ratio LD5o/ED50. Compounds which exhibit high therapeutic indices are preferred.
The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For a compound used in the methods of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of signs of disease) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.
The compositions can be administered one or more times per day to one or more times per week, including once every other day. Moreover, treatment of a subject with an effective amount of an active compound can include a single treatment or, preferably, can include a series of treatments. Determining an effective amount of one or more polynucleotides disclosed herein depends upon a number of factors including, for example, the age and weight of the animal, the severity of the disease, and the route of administration. Based on the above factors, determining the precise amount, number of doses, and timing of doses are within the ordinary skill in the art and will be readily determined by an attending physician or veterinarian.
Methods are provided for using the genetically modified cells described herein. In one embodiment, the methods include the use of a genetically modified cell that permits increased virus replication compared to a control cell that does not include the same genetic
modification(s). Greater numbers of virus may be obtained through the use of such genetically modified cells, and be useful in the production of virus for use as a vaccine.
The methods may include contacting a genetically modified cell with a virus under conditions for insertion of the virus genetic material into the cell. Methods for contacting an ex vivo cell with a virus that is a member of the family Orthomyxoviridae or the family
Paramyxoviridae are known in the art and routine. Alternatively, the method includes providing a genetically modified cell that includes a virus that is a member of the family Orthomyxoviridae
or the family Paramyxoviridae. In one embodiment, the virus is an Influenza type A virus. In one embodiment, the virus is an Influenza type B virus.
The methods include incubating a genetically modified cell that includes a virus under conditions suitable for replication of the virus. Such methods are known in the art and are routine, and typically include incubation at a temperature at, or around, 37°C, in a cell culture medium suitable for growth of the genetically modified cell and replication of the virus.
Optionally, the virus is harvested. Methods for harvesting virus after replication in large numbers of eulcaryotic cells are known and routine. The resulting virus may be prepared for use as a vaccine, which may include isolating, or purifying the virus, and optionally inactivating the virus such that the virus may be administered to a subject to obtain an immune response. In other embodiments, for instance, when the virus is attenuated, killing is not necessary, and live virus may be prepared using the methods described herein. Inactivation of a virus refers to rendering the virus incapable of reproducing in a cell. Methods of virus inactivation are known to the person skilled in the art and are routine. Examples include, for instance, treatment of a virus with heat, a standard chemical inactivating agent such as an aldehyde reagent including formalin, acetaldehyde; reactive acidic alcohols including cresol and phenol; acids such as benzoic acid and benzene sulfonic acid; lactones such as beta-propiolactone and caprolactone; amines such as binary ethyleneimine; and activated lactams, carbodiimides and carbonyl diheteroaromatic compounds such as carbonyl diimidazole. Treatment by heat or irradiation such as with ultraviolet and gamma irradiation may also be used to inactivate the virus.
Also provided herein is a composition of virus made by these methods. Such a composition may include a whole virus, such as an inactivated virus or an attenuated virus. A composition may include virus that has been disrupted. Such a composition, often referred to as a split vaccine, may be prepared by fragmentation of whole virus, either infectious, inactivated, or attenuated, with solubilizing concentrations of organic solvents or detergents and subsequent removal of the solubilizing agent and some or most of the viral lipid material. Split vaccines generally contain contaminating matrix protein and nucleoprotein and sometimes lipid, as well as the membrane envelope proteins. Split vaccines typically contain most or all of the virus structural proteins, although not necessarily in the same proportions as they occur in the whole virus. Methods for disrupting virus to prepare split vaccines are known and used routinely, and typically include a number of different filtration and/or other separation steps such as
ultracentrifugation, ultrafiltration, zonal centrifugation, and chromatography (e.g., ion exchange) steps in a variety of combinations, and optionally an inactivation step, which may be carried out before or after splitting. The splitting process may be carried our as a batch, continuous, or semi- continuous process.
In one embodiment, the methods include the use of a genetically modified cell that permits decreased virus replication compared to a control cell that does not include the same genetic modification(s). Such genetically modified cells are useful, for instance, in investigating the biology of viral replication.
The methods may include contacting a genetically modified cell with a virus under conditions for insertion of the virus genetic material into the cell. Methods for contacting an ex vivo cell with a virus that is a member of the family Orthomyxoviridae or the family
Paramyxoviridae are known in the art and routine. Alternatively, the method includes providing a genetically modified cell that includes a virus that is a member of the family Orthomyxoviridae or the family Paramyxoviridae. In one embodiment, the virus is an Influenza type A virus. In one embodiment, the virus is an Influenza type B virus.
Also provided herein are methods for decreasing virus replication in a cell. In one embodiment, the methods include administering to a cell a composition described herein. The composition includes a polynucleotide described herein that has the biological activity of decreasing the replication of a virus in a cell. In one embodiment, the administered
polynucleotide may be a biologically active RNA, such as a dsRNA, an miR A (such as a pri- miRNA, a pre-miRNA, or a mature miRNA), or a ribozyme. In one embodiment, the administered polynucleotide may be a polynucleotide (e.g., a vector) that encodes a biologically active RNA, such as a dsRNA, an miRNA (such as a pri-miRNA, a pre-miRNA, or a mature miRNA), or a ribozyme. The cell may be ex vivo or in vivo.
Also provided herein are methods of treatment. Treating a subject, such as a human, may provide protection against the virus, reducing morbidity associated with viral infection, including the incidence of hopitalization, and reducing mortality associated with the viral infection.
Without intending to be limited by theory, it is expected that reducing viral replication in a subject will provide greater time for a subject to mount an effective immune response to the virus, reduce the duration of disease signs and the time to recovery, and may lower spread from an infected subject by decreasing virus load in the subject's sinuses, lungs, trachea.
Treatment may be prophylactic or, alternatively, may be initiated after the exposure of a subject to a virus, such as an influenza A virus, an influenza B virus, or a respiratory syncytial virus. Prophylactic treatment refers to the use of a composition described herein with a subject which has not yet been exposed to a virus, thereby preventing or reducing disease signs if the subject is later exposed to such a virus. Treatment that is prophylactic, for instance, initiated before a subject manifests signs of viral infection, is referred to herein as treatment of a subject that is "at risk" of developing a viral infection. Treatment initiated after the exposure of a subject to a virus may result in decreasing the severity of the signs, or completely removing the signs. In this aspect of the invention, an "effective amount" is an amount effective to prevent the manifestation of signs of a viral infection, such as influenza, decrease the severity of the signs of a viral infection, and/or completely remove the signs. The methods therefore may be referred to as therapeutic vaccination or preventative or prophylactic vaccination. It is not required that any composition described herein provide total immunity to a virus or totally cure or eliminate all disease signs of a viral infection.
The methods may include administering a composition described herein to a subject.
Thus, the administered composition may include one or more polynucleotides described herein that have the biological activity of decreasing the replication of a virus in a cell. In one embodiment, the administered polynucleotide may be a biologically active RNA, such as a dsPvNA, an miRNA (e.g., a pri-miRNA, a pre-miRNA, or a mature miRNA), or a ribozyme. In one embodiment, the administered polynucleotide may be a polynucleotide (e.g., a vector) that encodes a biologically active RNA, such as a dsRNA, an miRNA (e.g., a pri-miRNA, a pre- miRNA, or a mature miRNA), or a ribozyme.
The subject may be any animal susceptible to infection by a virus that is a member of the family Orthomyxoviridae or the family Paramyxoviridae, including, but not limited to, a vertebrate, more preferably a mammal (such as a pig, a mouse, a ferret, or a human), or an avian (such as a bird). Examples of birds include, but are not limited to, feral birds such as ducks and geese, and domesticated birds such as turkeys, chickens, ducks, and geese. A composition may be delivered to a subject by methods described herein and known in the art, thereby achieving an effective therapeutic vaccination or preventative vaccination.
Also provided herein is a kit that includes a polynucleotide described herein, a genetically modified cell, or a composition that includes such a polynucleotide or
genetically modified cell. In one embodiment, a polynucleotide may be used to alter viral replication in a cell, and/or treat a subject having or at risk of developing a viral infection.
In one embodiment, a kit includes, includes at least, or includes no greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29,
30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more biologically active RNAs, such as miRNAs or miRNA inhibitors. In one embodiment, a kit includes, includes at least, or includes no greater than 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,
12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more biologically active
RNAs, such as miRNAs or miRNA inhibitors, where the one or more biological RNAs are encoded by one or more vectors. The polynucleotide and/or genetically modified cell may be present in a suitable packaging material in an amount sufficient for at least one use. Optionally, other reagents such as buffers and solutions may be included.
Instructions for use of the polynucleotides and/or genetically modified cells may also be included.
As used herein, the phrase "packaging material" refers to one or more physical structures used to house the contents of the kit. The packaging material is constructed by known methods, preferably to provide a sterile, contaminant-free environment, and may include a container, such as a tube, bottle, vial, syringe, or other suitable container means.
The packaging material has a label which indicates how the polynucleotides and/or
genetically modified cells can be used.
The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.
Example 1
MicroRNA Regulation of Human Protease Genes Essential
for Influenza Virus Replication
Influenza A virus causes seasonal epidemics and periodic pandemics threatening the health of millions of people each year. Vaccination is an effective strategy for reducing morbidity and mortality, and in the absence of drug resistance, the efficacy of chemoprophylaxis is comparable to that of vaccines. However, the rapid emergence of drug resistance has emphasized the need for new drug targets. Knowledge of the host cell components required for influenza replication has been an area targeted for disease intervention. In this study, the human protease genes required for influenza vims replication were determined and validated using RNA interference approaches. The genes validated in influenza virus replication were ADAMTS7, CPE, DPP3, MST1, and PRSS12, and pathway analysis showed these genes were in global host cell pathways governing inflammation (NF-kB), cAMP/calcium signaling (CRE/CREB), and apoptosis. Analyses of host microRNAs predicted to govern expression of these genes showed that eight miRNAs regulated gene expression during virus replication. These findings identify unique host genes and microRNAs important for influenza replication providing potential new targets for disease intervention strategies.
Materials and Methods
Cells and virus stocks
A549 cells (ATCC CCL-185) were cultured in Dulbecco's modified Eagle's medium (DMEM) (HyClone, Logan, UT) containing 5% heat-inactivated FBS (HyClone, Logan, UT). Cells were frozen in 10% DMSO and 90% FBS to create one stock of a single cell passage that was used for the entire screen. A stock of MDCK cells (ATCC CCL-34) was also propagated and stored using the same conditions. A/WSN/33 (H1N1) influenza virus was used for the primary siRNA screen as this virus has the ability to replicate without the need for exogenous trypsin (Someya et al., 1990, Biochemical and biophysical research communications 169:148- 152). For the validation studies, A/New Caledonia/20/99 (H1N1) influenza virus was also used. All viruses were propagated in 9-day-old embryonated chicken eggs as previously described
(Woolcock et al, 2008, Methods Mol Biol 436:35^16). Viruses were titrated in MDCK cells and titers calculated by the method developed by Reed and Muench (1938, The American Journal of Hygiene 27:493^197). Protease library screen
A primary screen using four pooled siRNAs to target each gene of the 481 genes in the human protease library (SMARTpool; Dharmacon ThermoFisher, Lafayette, CO) was performed using A/WSN/33 influenza virus and type II human alveolar pneumocytes (A549 cells) similar to a method previously described (Konig et al., 2009, Nature 463:813-817). siRNAs were resuspended in Dharamcon siRNA buffer to a concentration of 1 uM and stored at -80°C until use. The screen was conducted in two steps, a primary screen targeting all 481 human protease genes, followed by a smaller-scale validation screen of the primary hits to confirm the genes identified were essential for influenza virus replication. In all studies, a siRNA targeting the MEK gene (siMEK), a well-characterized human kinase gene important for influenza replication (Basler 2007, Infect Disord Drug Targets 7:282-293, Kumar et al., 2011, Journal of Virology 85:2818-2827), was used to control for the transfection efficiency and host gene silencing. A non-targeting siRNA control (siNEG) was also used in all assays. The siRNA SMARTpool library constituents, siMEK, and siNEG transfected A549 cells at >85% efficiency, and a few (<2%) siRNA pools targeting HP genes induced cytotoxicity as determined by adenylate kinase (AK) release in the cell culture supernatant (Crouch et al., 1993, Journal of Immunological Methods 160:81-88, Olsson et al., 1983, Journal of applied biochemistry 5:437-445) and by visual inspection of cell morphology.
A549 cells were reverse transfected with the siRNA 48 hours before infection with influenza A/WSN/33 (MOI = 0.001). The amount of infectious virus was measured 48 hpi by titration of A549 cell supernatant on MDCK cells, and the results normalized to siNEG-treated cells. All assays were run in duplicate and the entire screen assay was repeated twice. Both plate- based controls and assay-wide controls, e.g. siMEK, siNEG, and siTOX, were included on each individual assay plate. The results were normalized to the plate median for the SMARTpools. After excluding cytotoxic siRNAs based on detection of AK, primary screen data was subject to analysis. The primary screen, performed as two independent studies, was analyzed using a scaling methodology that sets the non-targeting control siRNA (siNEG) at an arbitrary value of
1.0, and the negative control siTOX at zero. siRNAs targeting host genes were assigned a score based on the distribution of these values. Wells in the primary screen with a percent of differentiation >|1.5| standard deviations from the plate mean in both duplicate assays were considered primary hits. Of the 481 HP genes targeted, twenty-four genes were identified as "primary hits". Hits that caused greater than 20% cytotoxicity in A549 cells were excluded (Figure 1 A). Z-scores were computed based on this data for each gene hit and those >\ .5σ and <-l .5σ were considered for validation.
Reverse transfection
Lyophilized siRNAs in 96-well plates were diluted with HBSS (HyClone, Logan, UT) and allowed to incubate for 5 minutes. Dharmafect-1 transfection reagent (Lafayette, CO) and HBSS were added such that each well received 0.004 ml of transfection reagent and 0.096 ml of HBSS. The siRNA/transfection reagent mix was allowed to incubate for 20 minutes at room temperature after which 0.08 ml of 1.5xl04 A549 cells suspended in DMEM/5% FBS was added to each well, and the plate incuba ted for 48 hours at 37°C in 5% C02. The final concentration of siRNA for all primary screen transfections was 50 nM.
Cytotoxicity and virus infection
To determine if siRNA gene silencing was cytotoxic, the cell supernatants from siRNA transfected A549 cells were analyzed for adenylate kinase (AK) using a Toxilight kit (Lonza, Rockland, ME). Results were normalized to a siTOX control, i.e. a siRNA control (Dharmacon) causing complete cell death by 48 hours. siRNA transfected cells with luminescence greater than or equal to 20% of the siTOX control were not considered for further evaluation. A549 cells were subsequently infected with A/WSN/33 at an MOI of 0.001 pfu/cell. Cells were incubated for 48 hours at 37°C/5% C02.
Endpoint assays
Virus titers in siRNA-treated A549 cells infected with A/WSN/33 were determined by modified TCID50 or hemagglutination assay (HA). Briefly, virus infected A549 cell culture supernatants were serially diluted ten-fold, and added to MDCK cells. The MDC cell plates were incubated for 72 h, followed by an HA using 0.5% chicken red blood cells as previously
described (Subbarao et al., 1992, J Clin Microbiol 30:996-999). To further identify gene hits the cells were screened for nucleoprotein (NP) by IHC staining and evaluated using high content analysis. For NP staining, the cells were fixed with 3.7% formaldehyde and stained with anti-NP monoclonal antibody (5 ug/ml; H16-L10-4R5) and the antibody staining detected using Alexa Fluor 488 labeled goat anti-mouse IgG (1 ug/ml; Invitrogen, Carlsbad, CA). Cells were counterstained with DAPI (2 ug/ml) (Invitrogen, Carlsbad, CA) and visualized by
immunofluorescent microscopy (20x, EVOS digital inverted fluorescent microscope, Advanced Microscopy Group, Bothell, WA). As an additional hit identification endpoint, real-time qRT- PCPv analysis was performed to quantify influenza M gene copy number in the cells as previously described (Spaclonan et al, 2002, J Clin Microbiol 40:3256-3260). Briefly, RNA was purified using the RNeasy kit (Qiagen, Valencia, CA), and cDNA was synthesized using a Superscript First Strand cDNA synthesis kit (Invitrogen, Carlsbad, CA) and appropriate primer/probe set (Spaclonan et al., 2002, J Clin Microbiol 40:3256-3260) to detect the M gene. PCR was performed using the amplification cycle: 10 minutes at 95°C followed by 40 cycles of 95°C for 30 seconds, 60°C for 1 minute, and 72°C for 30 seconds. M gene copies were normalized to the siNEG control.
Validation of gene hits
Individual novel siRNAs (Dharmacon) were used to target a different seed site on the same gene for gene hits identified during the primary screen (Table 2). Gene silencing was confirmed by qPCR using SybrGreen (Qiagen, Valencia, CA) to detect the dsDNA product allowing for quantification of gene silencing relative to cells treated with the siNEG control. Primers targeting each individual hit were compared to control GAPDH levels. For phenotype validation, A549 cells were transfected with 100 nM siRNA, incubated 48 h at 37°C in 5% C02, infected with A/WSN/33 (MOI = 0.001), and the amount of infectious virus was measured 48 hpi by TCID50 and NP staining assays to validate the screen phenotype previously observed. From the primary gene hits, five genes essential for influenza virus replication were validated using the novel siRNAs. The five genes were also tested using A/New Caledonia/20/99 at an MOI of 0.001 as described above; however infection was done in the presence of TPCK-trypsin (1 ug/ml).
Table 1. Human protease gene hits
*: Refers to the pool of four siRNAs used in the primary screen.
#: Refers to the individual siRNA used for the validation step.
1. Luan et al., 2008, Osteoarthritis Cartilage 16:1413-1420; Somerville et al., 2004, J Biol Chem 279:35159-35175, Liu et al., 2006, FASEB J 20:988-990, Bevitt et al., 2003, Biochim Biophys Acta 1626:83-91.
2. Johnston et al., 2006, Am J Physiol Regul Integr Comp Physiol 290:R126-133, He et al., 2004, Hum Pathol 35:1196-1209, Fan et al., 2001 , J Histochem Cytochem 49:783-790, Fan et al., 2002, J Histochem Cytochem 50:1509-1516.
3. Shin et al., 2005, Mol Reprod Dev 70:390-396. doi: 0.1002/mrd.20219, Navarathna et al., 2007, Infect Immun 75:1609-1618. doi:10. 128/IAI.01182-06, Liu et al., 2007, Proc Natl Acad Sci U S A 104:5205-5210.
4. Mallakin et al., 2006, Am J Respir Cell Mol Biol 34:15-27.
Western blot
To determine protein levels in A549 cells treated with siRNA specific for the target protease genes, A549 cells were untreated, treated with 50 nM of the siNEG control, or treated with 50 nM of the appropriate siRNA. After 72 hours, cells were lysed in 1% TritonX-100 and proteins from total cell lysate were separated on a 4-20% Tris-HCl precast SDS PAGE gel (BioRad, Hercules, CA) and transferred to a PVDF membrane. Membranes were blocked in 5% BSA/TBS- 0.05% tween and incubated with 1 ug/ml rabbit polyclonal primary antibodies to ADAMTS7, CPE, DPP3, MST1, or PRSS12 (Abeam, Cambridge, MA). A goat anti-rabbit alkaline phosphatase-conjugated secondary antibody (Invitrogen) was used to visualize the proteins.
Host cell pathway analysis
To survey the spectrum of host cell pathways that may be linked to the validated gene hits, pathway analysis was performed using Ingenuity Pathway Analysis software (Ingenuity Systems, ingenuity.com). The results provided network modeling of the validated genes and identified several functional groups (NF-κΒ, CRE/CREB signaling, apoptosis) linked to protease gene expression, host cell miRNA regulation, and influenza replication. Reporter system assays
Reporter plasmids used to confirm pathway were obtained from SABiosciences/Qiagen as a dual luciferase Cignal Reporter Assay Kit. The reporters consisted of a transcription factor of interest linked to a firefly luciferase gene, a positive control plasmid (luciferase linked to a CMV promoter), and a negative control plasmid (luciferase with no promoter). A549 cells were co-transfected with 100 nM of siRNA and 100 ng of the appropriate plasmid (reporter, positive, or negative control plasmids) using either the SureFECT (SABiosciences) or Attractene (Qiagen) transfection reagents. As a transfection control, the plasmid kit also contains a Renilla luciferase plasmid fused to a CMV promoter, and all data was normalized to Renilla luciferase expression. After 24 h of transfection, cells were allowed to rest for one day and then infected with
A/WSN/33 (MOI = 0.001) for 24 h. Cell lysate was taken and luciferase expression was measured using a Safire2 Microplate reader (Tecan, Mannedorf, Switzerland).
Apoptosis array
A human apoptosis array was obtained from SABiosciences/Qiagen. A549 cells were transfected with 50 nM of either the appropriate siRNA or siNEG. After 48 h, cells were infected with A/WSN/33 at an MOI of 0.001. RNA was isolated 18 hpi, a time point chosen because it is late enough for apoptosis modulation to become evident at the transcriptional level, but sufficiently early such that cells were not destroyed (Schultz-Cherry et al., 2003, Avian diseases 47:968-971), and then treated with DNase I to remove any genomic DNA. cDNA was synthesized using an RT First Strand Kit (SABiosciences) and PCR was performed using RT S YBR Green Master Mix (SABiosciences) per the manufacturer protocol. Data was analyzed by calculating 2(_ΔΛα). Silencing of the protease genes relative to siNEG-treated cells was confirmed for each independent experiment. miRNA studies
A library of miRNA hairpin inhibitors synthesized as RNA oligonucleotides with novel secondary structure designed to inhibit the function of endogenous miRNA, and chemically enhanced to improve efficacy and longevity (miRIDIAN, Dharmacon, Lafayette, CO) were used to target host cell miRNAs identified as potential regulators of host genes validated as important for influenza virus replication. miRNA mimics were not used since treatment with mimics results in extremely high concentrations of miRNA relative to biological levels. In these studies, A549 cells (1.5xl04) were transfected with 25 nM of an appropriate miRNA inhibitor using
Dharmafect-1 per the manufacturer's protocol. After 48 h, the cells were infected with
A/WSN/33 at an MOI of 0.001 for an additional 24 h or 48 h. Viral replication was assayed by TCID50 and qPCR for M gene as described above. Gene specific primers were also used to quantify changes in host gene expression in cells receiving the miRNA inhibitors using
SybrGreen as described above.
Statistics
The primary siRNA protease gene screen was performed independently and in duplicate. HA results for each gene were assigned values 0-8 based on the dilution of the HA readout. HA values were normalized to the average of the siNEG control readout per plate. Robust z-scores (Z
= xi-x/sx) were used as the normalizing method and calculated for each gene to determine hits based upon the standard deviation where xi is the raw measurement on the z'th siRNA, and sx are the mean and the standard deviation, respectively, of all measurements within the plate.
Normalization of raw data removes systematic plate-to-plate variation, making measurements comparable across plates. Statistical analyses for the cross-strain validation studies, the reporter studies, and miRNA studies were performed using GraphPad Prism software using the Mann- Whitney U test.
Results
Human protease genes required for influenza replication
A primary RNAi screen of 481 host protease genes in a human type II respiratory epithelial cell line (A549) identified 24 genes important for A/WSN/33 influenza virus replication (Figure 2). The gene hits identified were >1.5σ and <— 1.5σ from the mean Z-score. Endpoint validation of the gene hits in the primary screen included influenza nucleoprotein (NP) cell localization determined by immunohistochemistry, determining the level of infectious virus by TCID5o assay, as well as influenza matrix (M) gene copy number determined by qPCR (data not shown). For validation of primary gene hits, a novel siRNA targeting the same gene but at a different seed site (Table 2) was required to produce the same phenotype as observed in the screen. Protein levels of the protease genes were assessed to ensure that RNAi silencing was decreasing target gene expression (Figure 3). After validation, five genes were identified that decreased virus replication when silenced: ADAMTS7, CPE, DPP3, MST1, and PRSS12 (Table 2). Silencing of these protease genes did not cause cytotoxicity in A549 cells compared to the cytotoxicity (siTOX) control. siMEK (an siRNA targeting MAP2K) and siNEG (a negative, non- targeting siRNA control) both displayed low level cytotoxicity possibly due to the importance of ME in cellular signaling, and the induction of an inflammatory response to siNEG due to off- target effects (Figure 1 A). Silencing of the five validated genes resulted in considerably decreased influenza NP staining compared to the negative (— ) control, and was consistent with low NP staining in cells treated with the positive (+) siRNA control, siMEK (Figure IB). The level of infectious virus from A549 cells treated with 100 nM of a single siRNA targeting each of the validated genes was greatly (siCPE, siMSTl and siPRSS12) and significantly (p<0.05; siADAMTS7 and siDPP3) reduced (Figure 1C). Influenza virus M gene levels reflected the low
level of infectious virus and NP staining observed for A549 cells treated with siRNAs targeting the five validated genes, as well.
Host genes validated with a clinical influenza virus isolate
Since A/WSN/33 was used in the primary and secondary screens because of its ability to grow in the absence of trypsin, a feature facilitating high throughput screening, cross-validation of ADAMTS7, CPE, DPP3, MST1, and PRSS12 genes was performed in A549 cells with A/New Caledonia/20/99. Using the same siRNAs previously used to validate the genes (Figure 1C), A549 cells treated with 100 nM of the siRNAs significantly (p<0.05) reduced A/New Caledonia/20/99 virus replication (Figure 4). The differences in viral titer were at least 1.5 logs lower compared to siNEG-treated cells for all five genes examined. These results show that ADAMTS7, CPE, DPP3, MST1, and PRSS12 contribute to influenza A virus replication, and provide promising disease intervention targets. Cell pathways associated with the validated host genes affect influenza replication
Expanding from the primary screen toward defining host cell pathways involved in influenza virus replication requires assessment of the signaling pathways, molecular networks, and biological processes that are linked to the five validated host genes. Dynamic pathway analysis identified three major pathways for the five validated genes, i.e. NF-κΒ pathway, CRE/CREB signaling pathway, and cellular apoptosis (Figure 5). To verify the host genes in these pathways, A549 cells were transfected with a luciferase assay reporter plasmid governed by the promoter of interest linked to a firefly luciferase gene. The level of pathway activation was determined by luciferase expression, which was normalized to a control plasmid expressing Renilla luciferase to account for transfection efficiency. Pathway analysis suggested that MST1 and PRSS12 genes participate in the CRE/CREB signaling pathway. RNAi of MST1 by siRNA targeting (siMSTl ) led to a significant (p<0.05) increase in CRE/CREB signaling compared to the siNEG and CRE controls in the presence or absence of influenza virus infection (Figure 6A). RNAi of PRSS12 by siPRSS12 did not affect CRE/CREB activation relative to controls. Interestingly, RNAi of DPP3 using siDPP3 significantly (p<0.05) increased CRE/CREB activation under mock-infected conditions despite DPP3 not being implicated in the CRE/CREB pathway, and silencing of ADAMTS7 significantly (p<0.05) abrogated CRE/CREB activation during infection. Pathway
analysis also indicated that ADAMTS7, CPE, and MST1 genes were potentially involved in the NF-KB activation pathway (Figure 5). siADAMTS7 significantly (p<0.01) abrogated NF-KB activation regardless of infection or mock-treatment (Figure 6B). Interestingly, a similar finding was observed for DPP3, a gene not previously linked to the NF-κΒ signaling pathway by our analysis. siCPE did not affect NF-κΒ activation under mock conditions, but during infection NF- KB activation levels were significantly (p<0.05) downregulated. siMSTl also had a negative effect on NF-κΒ activation regardless of infection. Elevated NF-KB levels were also seen in controls receiving the NF-i B plasmid alone but this was not significant compared to siNEG controls.
Dynamic pathway analysis predicted DPP3 to be involved in apoptotic pathways (Figure
5), and as a luciferase/Renilla pathway reporter system was unavailable, a human apoptosis array was performed to determine the level of mRNA expression of various pro- and anti-apoptotic host genes in relation to DPP3 expression (Figure 7). After confirming RNAi silencing (>95%) of DPP3 by PCR (data not shown), gene expression was compared in cellular RNA extracted from infected A549 cells treated with either siDPP3 or siNEG (50 nM). While most genes tested did not vary in expression levels relative to siNEG-treated cells, four pro-apoptotic genes were found to be substantially increased when DPP3 was silenced: BCL2L10, TNFSFIO, TNFRSF25, and TNFSF8. Of these four genes, TNFSFIO was significantly (p<0.05) increased 6-fold, and TNFSF8 was significantly (p<0.05) increased 5-fold compared to siNEG control treated cells. TNFRSF25 was substantially increased as well. These findings show that inhibition of DPP3 expression initiates higher expression of pro-apoptotic factors, features that may negatively impact influenza virus replication and associated modulation of cellular apoptosis. Silencing of the other four target protease genes did not significantly affect levels of pro- or anti-apoptotic genes compared to cells treated with siNEG as predicted by the Ingenuity pathway analysis, although TNFSFIO was substantially increased when cells were treated with siADAMTS7 (Table 3).
Table 3: Expression ratios for pro- and anti-apoptotic genes in A549 cells treated with siRNA for protease gene targets3'13
Gene siADAMTS7 siCPE siDPP3 siMSTl siPRSS12
ABL1 0.74 ± 0.02 0.69 ± 0.05 1.48 ± 0.36 0.73 ± 0.05 0.92 ± 0.09
AKT1 0.95 ± 0.08 0.83 ± 0.08 1.12 ± 0.48 0.86 ± 0.23 1.28 ± 0.10
APAF1 1.29 ± 0.05 1.07 ± 0.06 1.26 ± 0.42 1.20 ± 0.08 1.19 ± 0.09
BAD 1.04 ± 0.11 0.86 ± 0.03 1.43 ± 0.25 0.94 ± 0.12 1.07 ± 0.10
BAG1 0.73 ± 0.02 0.46 ±0.01 0.86 ±0.19 0.59 ± 0.03 0.89 ±0.15
BAG3 0.80 ±0.02 0.72 ±0.07 0.91 ±0.17 0.84 ±0.07 0.73 ± 0.08
BAG4 0.90 ±0.07 1.05 ±0.01 1.47 ±0.68 1.27 ±0.11 1.30 ±0.12
BAK1 0.49 ±0.06 0.64 ±0.06 0.78 ±0.19 0.50 ±0.09 0.63 ± 0.05
BAX 0.27 ±0.01 0.28 ±0.02 0.46 ±0.19 0.45 ± 0.06 0.49 ±0.05
BCL10 1.10 ± 0.03 0.52 ±0.05 0.95 ±0.15 1.01 ±0.02 0.76 ±0.12
BCL2 1.10 ± 0.12 1.09±0.10 1.11 ±0.40 1.24 ±0.11 1.41 ±0.12
BCL2A1 0.50 ±0.07 0.25 ± 0.02 1.15 ±0.41 0.74 ± 0.04 0.33 ± 0.03
BCL2L1 0.75 ±0.08 0.50 ±0.05 1.02 ±0.54 0.77 ±0.18 0.90 ±0.15
BCL2L10 0.87 ±0.07 0.65 ±0.07 5.90 ±3.79 1.15 ±0.28 1.23 ±0.23
BCL2L11 0.81 ±0.03 0.55 ±0.04 1.22 ±0.16 0.56 ±0.04 0.64 ±0.10
BCL2L2 0.98 ±0.05 0.92 ±0.01 0.79 ±0.14 0.93 ± 0.06 1.11 ± 0.10
BCLAF1 0.72 ± 0.06 0.75 ±0.01 0.98 ±0.18 J 0.76 ± 0.04 0.84 ±0.07
BFAR 1.13 ±0.07 1.03 ±0.03 1.33 ±0.34 1.07 ±0.08 1.11 ±0.07
BID 0.87 ±0.04 0.78 ± 0.03 1.30 ±0.38 0.82 ±0.04 0.97 ±0.13
BIK 0.26 ±0.01 0.27 ± 0.02 0.48 ±0.13 0.28 ±0.07 0.31 ±0.05
NAIP 0.71 ±0.09 0.68 ±0.06 0.64 ±0.06 1.26 ±0.07 0.95 ±0.12
BIRC2 1.17 ±0.03 0.82 ±0.06 0.78±0.11 0.93 ± 0.04 0.90 ±0.08
BIRC3 0.67 ±0.05 0.95 ±0.12 0.96 ± 0.23 1.06 ±0.01 0.81 ±0.07
BIRC4 0.77 ±0.10 0.63 ±0.11 0.93 ±0.17 0.72 ± 0.08 0.88 ±0.09
BIRC6 0.69 ± 0.02 0.47 ± 0.07 0.90 ±0.08 0.61 ±0.02 0.53 ±0.08
BERC8 0.93 ±0.12 0.74 ± 0.08 3.01 ± 1.44 1.31 ±0.32 1.40 ±0.26
BNIP1 0.81 ±0.03 0.57 ± 0.02 0.82 ±0.11 0.53 ±0.01 0.57 ± 0.02
BNIP2 1.00 ±0.05 0.73 ± 0.01 0.95 ±0.26 1.05 ±0.08 0.97 ±0.13
BNIP3 0.99 ±0.06 0.87 ±0.02 0.88 ±0.09 0.92 ±0.001 1.01 ±0.08
BNIP3L 1.61 ±0.03 1.36 ±0.07 1.97 ±0.31 1.65 ±0.08 1.64±0.14
BRAF 0.77 ±0.05 0.65 ± 0.03 0.82 ±0.10 0.89 ±0.01 0.69 ±0.05
NODI 1.10± 0.09 0.65 ± 0.06 1.16 ±0.20 0.85 ±0.14 0.79 ± 0.07
CARD6 1.00 ±0.02 0.54 ±0.01 1.20 ±0.19 0.45 ± 0.05 0.44 ±0.10
CARD8 0.56 ±0.11 0.51 ±0.10 0.79 ±0.16 0.51 ±0.11 0.69 ±0.11
CASP1 1.13 ±0.41 0.45 ±0.12 2.20 ±0.49 0.69 ±0.08 0.58 ±0.14
C ASP 10 0.91 ±0.07 0.61 ±0.06 0.93 ±0.19 0.75 ± 0.08 1.10 ± 0.19
CASP14 0.93 ±0.12 0.74 ±0.08 1.42 ±0.98 1.31 ±0.32 1.40 ±0.26
CASP2 1.20 ±0.05 0.86 ±0.05 1.12± 0.37 1.09 ±0.02 1.26 ±0.15
CASP3 0.55 ±0.05 0.39 ±0.001 0.83 ±0.10 0.55 ±0.03 0.48 ± 0.04
CASP4 1.62 ±0.06 0.55 ± 0.05 1.71 ±0.34 0.71 ±0.05 0.97 ±0.20
CASP5 0.60 ± 0.22 0.54 ± 0.26 1.20 ±0.59 0.89 ±0.74 1.40 ±0.26
CASP6 0.88 ±0.06 0.60 ±0.01 1.00 ±0.24 0.66 ±0.03 0.60 ±0.05
CASP7 1.82 ±0.09 0.88 ±0.05 2.04 ±0.77 0.72 ±0.04 0.92 ±0.11
CASP8 1.12± 0.14 0.88 ±0.06 1.80 ±0.81 0.90 ± 0.04 0.83 ± 0.05
CASP9 1.19 ± 0.16 0.65 ± 0.03 1.25 ±0.04 0.84 ±0.03 1.22 ±0.17
CD40 1.22 ±0.14 0.83 ± 0.03 1.74 ±0.50 1.11 ±0.09 1.45 ±0.19
CD40LG 0.93 ±0.12 0.74 ± 0.08 1.42 ±0.98 1.31 ±0.32 1.40 ±0.26
CFLAR 1.00 ±0.07 0.61 ±0.06 1.37 ±0.43 1.06 ±0.06 0.93 ±0.10
CIDEA 0.93 ±0.12 0.74 ± 0.08 0.35 ±0.18 0.71 ± 0.29 1.40 ±0.26
CIDEB 1.33 ±0.18 0.90 ± 0.02 1.19± 0.38 1.05 ±0.08 1.10 ±0.20
CRADD 0.99 ±0.07 0.73 ± 0.04 0.73 ±0.10 0.52 ±0.03 0.80 ±0.10
DAPKl 0.68 ±0.03 0.56 ±0.02 0.94 ±0.21 0.59 ±0.01 0.66 ±0.08
DFFA 0.70 ±0.03 0.56 ±0.02 0.59 ±0.08 0.64 ± 0.02 0.63 ± 0.04
FADD 1.19± 0.08 1.26 ±0.07 1.24 ±0.42 1.20 ±0.21 1.32 ±0.05
FAS 0.72 ±0.05 0.45 ± 0.04 0.96 ±0.37 0.69 ±0.05 0.66 ±0.07
FASLG 0.93 ±0.12 0.74 ±0.08 1.42 ±0.98 1.31 ±0.32 0.71 ±0.59
GADD45A 0.64 ±0.02 0.27 ± 0.02 0.77 ±0.19 0.54 ±0.001 0.60 ±0.07
HRK 0.67 ±0.09 0.47 ±0.08 0.40 ±0.07 0.64 ±0.02 1.16±0.12
IGF1R 0.75 ± 0.04 0.72 ± 0.06 1.04 ±0.17 0.52 ±0.01 0.71 ±0.10
LTA 0.92 ±0.12 0.73 ± 0.08 0.52 ±0.34 1.29 ±0.31 1.02 ±0.49
LTBR 1.11 ± 0.15 0.65 ± 0.03 0.98 ± 0.24 0.65 ±0.001 0.93 ± 0.08
MCL1 0.97 ±0.04 0.98 ±0.05 1.49 ±0.31 1.02 ±0.05 0.88 ±0.08
NOL3 1.22 ±0.10 1.18 ± 0.10 1.74 ±0.42 1.17 ±0.08 1.75 ±0.07
PYCARD 0.60 ±0.03 0.39 ±0.02 1.00 ± 0.11 0.59 ±0.01 0.58 ±0.04
RIPK2 1.15 ±0.04 0.64 ±0.02 0.90 ±0.16 0.69 ±0.01 0.85 ±0.09
TNF 0.56 ±0.07 0.45 ± 0.05 1.65 ±0.78 0.63 ± 0.35 0.89 ±0.29
TNFRSF10A 1.03 ±0.04 0.58 ± 0.02 0.80 ±0.23 0.70 ±0.01 0.75 ±0.12
T FRSF10B 1.13 ±0.07 0.87 ±0.02 0.89 ± 0.26 0.94 ± 0.02 0.83 ± 0.06
T FRSF11B 2.27 ±0.25 2.35 ±0.28 1.19 ±0.34 0.97 ±0.10 2.33 ±0.33
TNFRSF1A 1.14 ±0.09 0.73 ± 0.04 1.58 ±0.34 0.93 ±0.01 1.00 ±0.13
TNFRSF21 2.11 ± 0.11 0.90 ±0.02 1.04 ±0.32 0.98 ±0.01 0.92 ± 0.09
TNFRSF25 1.24 ±0.37 0.60 ±0.13 6.40 ±3.02 1.05 ±0.27 1.04 ±0.21
CD27 0.59 ±0.10 0.38 ±0.05 2.30 ± 1.22 0.60 ±0.27 0.89 ±0.53
T FRSF9 0.88 ±0.08 1.20 ±0.06 1.70 ±0.66 1.03 ±0.10 0.93 ±0.31
TNFSF10 7.50±2.11 1.12 ±0.34 6.32 ± 1.33* 0.75 ± 0.04 0.94 ±0.35
CD70 1.47 ±0.22 0.36 ±0.001 0.90 ±0.05 0.57 ±0.01 0.88 ±0.28
TNFSF8 1.86 ±0.39 0.68 ±0.13 20.77 ±5.79* 1.31 ±0.32 1.19± 0.36
TP53 0.59 ±0.05 0.75 ± 0.02 0.89 ±0.23 0.77 ± 0.05 1.03 ±0.14
TP53BP2 0.62 ±0.04 0.61 ±0.001 0.71 ±0.16 0.65 ± 0.07 0.80 ±0.19
TP73 0.76 ± 0.22 0.74 ±0.08 0.32 ±0.10 1.31 ±0.32 1.01 ±0.50
TRADD 0.93 ± 0.04 0.53 ± 0.02 1.19 ±0.23 0.75 ± 0.05 0.96 ±0.17
TRAF2 0.58 ±0.02 0.88 ±0.04 1.50 ±0.76 1.06 ±0.20 1.19±0.14
TRAF3 0.83 ± 0.04 0.83 ± 0.03 0.96 ±0.33 1.11 ±0.06 1.21 ±0.23
TRAF4 0.73 ± 0.04 0.60 ±0.01 0.71 ±0.31 0.65 ±0.06 1.02 ±0.26
Gene expression in A549 cells treated with 50 nM of the appropriate siRNA was compared to cells treated with 50 nM of siNEG. The experiment was performed as described in Figure 4. bGene expression was normalized to GAPDH.
*p < 0.05
miRNAs govern host genes required for influenza replication
Pathway analysis of the five validated host genes revealed potential miRNA interaction (Figure 8) with eight miRNAs (miR-1254, miR-1272, miR-17-5p, miR-17-3p, miR-106B, miR- 106B*, miR-124-a, and miR-124*). To determine the role of these miRNAs in regulating ADAMTS7, CPE, DPP3, MST1, and PRSS12, A549 cells were treated with miRNA hairpin inhibitors as previously described (Vermeulen et al., 2007, RNA 13:723-730), or treated with a negative control from C. elegans that shares no homology with known human miRNA sequences, and gene expression levels determined by qPCR. As gene modulation by miRNAs is usually subtle and multi-targeted, the effect of the miRNA inhibitors on host gene mRNA levels was determined 24 hours post-treatment. All 8 miRNA inhibitors were tested for their effect on each of the 5 validated genes; however, only those inhibitors that affected gene expression are
shown (Figure 9). At 24 h post-treatment, ADAMTS7 gene expression levels increased 20-fold when miR-106B was inhibited, and 40-fold when miR-124* was inhibited (Figure 9). Treatment with siRNA targeting the gene examined was performed as a control. CPE expression was slightly decreased by miRNA inhibitors, as there was no response above 1.0 (Figure 9). In contrast, inhibition of miR-106B and miR-124* resulted in a >20-fold and >40-fold increase of DPP3 gene expression, respectively (Figure 9), while miR-1254, miR-1272, and miR-17-3p inhibition caused a decrease of DPP3 expression. MST1 expression was increased to similar levels as DPP3 with the same miRNA inhibitors, while the other miRNA inhibitors resulted in a slight (but significant for miR-17-3p) decrease in expression (Figure 9). Finally, PRSS12 expression levels were significantly (p<0.05) increased in response to miR-106B inhibition, but a slight decrease was detected by inhibition of miR-1254 (Figure 9). These results show the same miRNAs can regulate different genes both subtly and robustly.
Given the evidence that miR-1254, miR-1272, miR-17-5p, miR-17-3p, miR-106B, miR- 106B*, miR-124-a, and miR-124* are involved in governing aspects of ADAMTS7, CPE, DPP3, MST1, and PRSS12 gene expression (Figure 9), the role of these miRNAs in the regulation of influenza virus replication was determined (Figure 10). A549 cells were treated with individual miRNA inhibitors and the cells infected with A/WSN/33 to determine the effect on virus replication (Figure 10). Of the 8 miRNA inhibitors tested, inhibition of miR-106B was associated with a decrease in influenza virus replication, while inhibition of miR-124 resulted in an increase in virus replication with respect to the negative control. Inhibition of the other eight miRNAs had more subtle effects with slight increases or decreases of influenza virus replication. The decrease of virus replication associated with inhibition of miR-106B is likely associated with a decrease of CPE gene expression as RNAi silencing of CPE was associated with low levels of virus replication (Figures 1 and 4). The level of virus replication was confirmed by qPCR M gene levels and was consistent with the findings observed in Figure 9. The results show that some of the miRNAs modulate host genes critical for influenza virus replication, thus it likely that the tempo of host gene expression is differentially regulated in response to influenza virus infection. Further, the results provide evidence that targeting miRNAs may offer an alternative disease intervention approach to control influenza virus replication.
Discussion
Some human proteases are known to have a direct function in the replication of influenza virus (Bottcher-Friebertshauser et al., 2010, Journal of Virology 84:5605-5614, Kido et al., 2008, J Mol Genet Med 3 : 167-175), but the role of other proteases in the biology of virus replication and host cell pathways they affect are not fully elucidated. To better understand protease gene requirements for influenza virus replication, and discover novel disease intervention targets, we conducted an R Ai screen of 481 genes comprising the human protease genome and validated five genes, ADAMTS7, CPE, DPP3, MSTl, and PRSS12 that are required for influenza replication. The primary and secondary RNAi screens were performed with A/WSN/33 influenza virus because of its ability to replicate in the absence of trypsin in a type II respiratory epithelial (A549) cell line. All five genes showed reduced A/WSN/33 titers and some showed a substantial decrease in NP staining to the level where NP was not detected using a NP- specific monoclonal antibody. This may have been due to an inability of the virus to reenter the host cells for subsequent infection as a consequence of protease gene silencing. To confirm the findings for WSN/33 infection, the five validated genes were assessed against a clinical influenza virus strain, i.e. A/New Caledonia/20/99. RNAi silencing of all five genes resulted in decreased levels of A/New Caledonia/20/99 replication. Although previous RNAi host factor screens for influenza virus replication did not identify any of the five protease genes in this study, the same host cell pathways were identified which included the genes validated in this study (Konig et al., 2009, HNature 463:813-817, Brass et al., 2009, Cell 139:1243-1254, Hao et al., 2008, Nature 454:890-893, Karlas et al., 2010, Nature. Shapira et al., 2009, Cell 139:1255-1267).
Specifically, our pathway analysis for this study showed that ADAMTS7, CPE, DPP3, MSTl, and PRSS12 were involved in three previously identified host cell pathways, specifically CRE/CREB signaling, NF- Β activation, and apoptosis. It is likely that different pathway interaction is co-opted by the virus at different stages in the virus replication process, but further study is needed to determine the exact process. An additional caveat may be the use of an immortalized cell line to identify gene hits. Clonal cell lines can have misregulated gene expression relative to primary cells, particularly for genes involved in cell growth and differentiation (Ostano et al., 2012, Omics:a journal of integrative biology 16:24-36). Use of a primary human cell line to perform this study, e.g. normal human bronchial epithelial (NHBE) cells may be more desirable; however, primary cells often have reduced transfection efficacy and
issues with maintenance of a uniform stage of differentiation that makes it difficult to perform high-throughput screening (Meliopoulos et al., 2012, The FASEB J). Therefore, it is possible that some genes discovered may not translate to a primary cell line, so further evaluation is needed to confirm the results of this study.
CRE/CREB signaling is an important cellular process that serves a variety of functions.
Most notably with respect to influenza infection, CRE/CREB signaling has been shown to activate protein kinase A (PKA) and thus have a role in protein synthesis (Stakkestad et al., 2011, BMC biochemistry 12:7). In this study, MST1 and PRSS12 were implicated in
CRE/CREB signaling; however, in response to influenza infection, CRE signaling levels in cells treated with siPRSS 12 were unchanged compared to both pathway reporter and siNEG controls. However, RNAi of the MST1 gene resulted in significantly higher CRE signaling levels regardless of infection. These findings may suggest that MST1 is involved in some aspect of CRE signaling or the cAMP response, and without MST1, the calcium response element is not activated.
ADAMTS7, CPE, and MST1 have been shown to have a role in tissue injury and inflammation (Mallakin et al, 2006, Am J Respir Cell Mol Biol 34:15-27, Luan et al., 2008, Osteoarthritis Cartilage 16:1413-1420, Johnston et al, 2006, Am J Physiol Regul Integr Comp Physiol 290 :R126-133), and pathway analysis performed in this study identifying their linkage to NF-KB pathway activation is consistent with these earlier findings. However, there was no significant effect of these genes on the NF-κΒ pathway relative to controls. However, A549 cells treated with siRNAs targeting ADAMTS7 and DPP3, a gene not predicted to be involved in the NF-KB pathway, resulted in complete abrogation of NF- B regardless of influenza infection. This finding suggests that NF-κΒ signaling may involve ADAMTS7 and DPP3. As ADAMTS7 plays a role in maintenance of the extracellular matrix (Luan et al, 2008, Osteoarthritis Cartilage 16:1413-1420) and DPP3 is a metallopeptidase, it is possible that silencing these genes is decreasing the inflammatory response because less damage is being done to basement tissue. ADAMTS7 has also been shown to be upregulated by TNF-a and IL-Ιβ secretion (Luan et al., 2008, Osteoarthritis Cartilage 16:1413-1420), both of which are activated upon influenza infection (Wang et al., 2010, The Journal of Infectious Diseases 202:991-1001).
DPP3 is involved in apoptosis modulation and is over-expressed in cancerous cells
(Shulda et al., 2010, The FEBS journal 277:1861-1875). RNAi of the DPP3 gene was performed
to evaluate the effect on apoptotic gene expression. The results showed induction of BCL2L10, TNFSF10, TNFRSF25 and TNFSF8 pro-apoptotic genes. BCL2L10 is a pro-apoptotic gene that interacts with caspase 9 to signal apoptosis (Kim et al, 2009, Cellular physiology and biochemistry: international journal of experimental cellular physiology, biochemistry, and pharmacology 23 :43-52), and TNFSF8 and TNFRSF25 are involved in the pro-inflammatory response through NF-κΒ signaling (Wright et al., 2007, The Journal of biological chemistry 282:10252-10262, Fang et al., 2008, The Journal of experimental medicine 205:1037-1048). TNFSF10, also known as TRAIL, has been shown to be involved in H5N1 virus-induced apoptosis in human monocyte-derived macrophages (Ekchariyawat et al., 2011, Innate immunity). Since DPP3 silencing resulted in a sharp decrease of influenza replication as quantified by TCID50 and NP staining, the findings suggest that reducing DPP3 gene expression causes influenza virus infected cells to initiate apoptosis without interference by the known anti- apoptosis activities of the influenza NSl protein (Hale et al., 2008, J Gen Virol 89:2359-2376). It is possible that without the NSl -mediated apoptosis delay, the virus is not able to replicate and bud before the host cell is eliminated. Furthermore, as NF-κΒ appears to have a role in apoptosis modulation, the effect of DPP3 silencing onNF-κΒ activation observed in this study is predictable and consistent with earlier findings (Kumar et al, 2008, Journal of Virology
82:9880-9889).
Host gene expression is governed by miRNAs (Carthew et al., 2009, Cell 136:642-655, Djuranovic et al, 2011, Science 331 :550-553), thus it is important to understand potential miRNA regulation of host genes validated as required for influenza virus replication. The results from the miRNA hairpin inhibitor studies showed that targeting the predicted miRNAs had a considerable and significant outcome on most host gene expression. For example, inhibition of miR-106B and miR-124* resulted in 20-fold and 40-fold increased ADAMTS7 gene expression levels, respectively, while CPE gene expression was slightly reduced by miRNA inhibitors. As expected, some miRNA inhibitors had differential effects on host genes required for influenza virus replication. For example, inhibition of miR-106B had little effect on CPE gene expression, but dramatically increased DPP3 gene expression. These findings show that expression of host genes required for influenza virus replication can be regulated by multiple miRNAs, and suggests that targeting miRNAs to regulate host gene expression may be a strategy to regulate influenza virus replication.
As predicted from the host gene expression studies, miRNA inhibitors also affected influenza virus replication. For example, inhibition of miR-106B, a miRNA known to cause cell cycle arrest when inhibited in a laryngeal cancer model (Cai et al., 2011, Journal of experimental & clinical cancer research:CR 30:73), resulted in substantially decreased virus replication.
Human papillomavirus oncoproteins E6 and E7 have also been reported to dysregulate miR-
106B (Zheng et al., 2011, Biochimica et biophysica acta). Inhibition of miR-124-a resulted in an increase of influenza virus replication relative to the negative control. Although miR-124-a was not found to regulate any of the 5 host protease genes from our screen, it is reported to have a putative target in both swine influenza virus and the 2009 pandemic H1N1 strain (He et al., 2009, Bioinformation 4: 112-118). Inhibition of other miRNAs also subtly modulated infectious virus levels, but not to a level significantly different from the NEG control. In this study, inhibition of miR-106B increased ADAMTS7, DPP3, MST1 and PRSSS12 gene expression, but subtly reduced CPE gene expression, an effect that resulted in reduced influenza virus replication, implying the effect of miR-106B inhibition on CPE may be dominant. Additionally, inhibition of miR-1254 resulted in slightly decreased CPE, DPP3, MST1 and PRSS12 gene expression levels, and this translated to slightly decreased influenza virus replication. Since none of the 5 validated genes were increased by inhibition of miR-124-a, it is likely miR-124-a affects influenza replication through other genes yet identified. These findings indicate that while miRNAs do modulate host gene expression, they likely modulate influenza replication indirectly and perhaps at different points in the replication pathway. Further study is needed to validate miRNA involvement and mechanism of virus inhibition or assistance. Taken together, these findings suggest novel targets and potentially new therapies for regulating influenza replication and the pathways co-opted during infection. Example 2
Identification of Host Kinase Genes Required for Influenza Virus Replication
and the Regulatory Role of MicroRNAs
Human protein kinases (HPKs) have profound effects on cellular responses. To better understand the role of HPKs and the signaling networks that influence influenza virus
replication, a small interfering RNA (siRNA) screen of 720 HPKs was performed. From the screen, 17 HPKs (NPR2, MAP3K1, DYRK3, EPHA6, TPK1, PDK2, EXOSC10, NEK8, PLK4, SGK3, NEK3, PANK4, ITPKB, CDC2L5 (CDK13), CALM2, PKN3, and HK2) were validated as essential for A/WSN/33 influenza virus replication, and 6 HPKs (CDK13, HK2, NEK8, PANK4, PLK4 and SGK3) were identified as vital for both A/WSN/33 and A/New
Caledonia/20/99 influenza virus replication. These HPKs were found to affect multiple host pathways and regulated by miRNAs induced during infection. Using a panel of miRNA agonists and antagonists, miR-149* was found to regulate NEK8 expression, miR-548d-3p was found to regulate MAPKl transcript expression, and miRs -1228 and -138 to regulate CDK13 expression. Upregulation of miR-34c induced PLK4 transcript and protein expression and enhanced influenza virus replication, while miR-34c inhibition reduced viral replication. These data identify HPKs important for influenza viral replication and show the miRNAs that govern their expression.
Materials and Methods
Cell culture and viruses
To minimize biological variation, a single passage of A549 human lung epithelial cells (CCL-185, ATCC) and Madin-Darby canine kidney cells (MDCK, CCL-34, ATCC) were used for all assays from a frozen stock stored in 10% DMSO and 90% fetal bovine serum (FBS), in liquid nitrogen. The cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM, HyClone, ThermoScientific) supplemented with 5% heat-inactivated FBS (HyClone, Thermo Scientific) at 37°C and 5% C02. All cells were confirmed to be free of mycoplasma using a PlasmoTest kit (InvivoGen, San Diego, CA).
Influenza A/WSN/33 (H1N1) virus was obtained from Richard Webby (St Jude's Children Research Hospital, Memphis, TN) and A/New Caledonia/20/99 (H1N1) was obtained from the Centers for Disease Control and Prevention, Atlanta, GA. The influenza viruses were grown in the allantoic cavities of 9-day-old embryonated chicken eggs as previously described (Woolcock et al., 2008, Methods Mol Biol 436:35-46). Virus stocks were titrated in MDCK cells as previously described (Matrosovich et al., 2006, Virology Journal 3:63) and a 50% tissue culture infectious dose (TCID50) was determined using the method described by Reed and Muench (1938, The American Journal of Hygiene 27:493-497).
siRNAs and transfection assay
The siGENOME library is shipped as a series of 96 well plates with 0.5 nmol of lyophilized siRNA per well. The HPK library contains 9 master plates (a total of 720 gene targets). A siRNA arrayed library containing four pooled siRNAs per target gene for 720 different human protein kinase genes (Dharmacon siARRAY siRNA Library (G-003505 Human Protein Kinase Lot 08105), Thermo Scientific) was used for the primary siRNA screen. Controls included a siRNA targeting mitogen-activated protein kinase kinase 1 positive control (siMEK, 5'-GCACAUGGAUGGAGGUUCU (SEQ ID NO: 145), 5 ' -GC AGAGAGAGCAGAUUUGA (SEQ ID NO: 146), 5 ' -G AGC AGAUUUGAAGC AACU (SEQ ID NO: 147), 5'-
CCAGAAAGCUAAUUCAUCU (SEQ ID NO: 148), siGENOME smartpool, Dharmacon M- 003571-01), a negative non-targeting control siRNA (siNEG, 5'-
UAGCGACUAAACACAUCAA (SEQ ID NO: 149), siCONTROL Non-Targeting siRNA #1, Dharmacon D-001210-01-05), and a control for cellular cytotoxicity (TOX, Dharmacon D- 001500-01-05). Each SMARTpool siRNA reagent used in the primary screen was validated for on-target activity by Dharmacon ThermoFisher and consists of four rationally designed siRNAs targeting a distinct region of the target mRNA to achieve gene knockdown and reduce the incidence of off target effects (Table 4). To assure maximum silencing of target gene expression in our system, transfection and detection conditions were first optimized using the validated SMARTpool siMEK positive control (Figure 11). The sequences for all siRNA duplexes provided with Dharmacon' s siGENOME libraries are proprietary and confidential and are not listed; however, the siRNA duplexes are commercially available. A list of the 720 HPK targeted by the library are listed in Table 5, as well as the siRNA sequences used for validation screen. All siRNAs were resuspended in Dharmacon siRNA buffer to a concentration of 1 μΜ and stored at -80°C.
Table 4.
All siRNAs were reverse transfected into A549 cells at a 50 nM final concentration using 0.4% Dharmafect 1 (Dharmacon) and incubated at 37°C and 5% C02 for 48h. Cell cytotoxicity was evaluated in all siRNA transfected cells compared to the TOX positive control and non- target negative control number. A "percent cytotoxicity" of the controls is determined for each experimental siRNA and cytotoxicity was determined to be >20% based on the bioluminescent measurement of adenylate kinase (ToxiLight BioAssay Kit, Lonza) (Table 5). A SafireX2 luminometer (Tecan U.S., Durham, NC) was used for the luminescence readout. All RNA interference (RNAi) experiments were carried out according to the Minimum Information for an RNAi Experiments (MIARE) guidelines (Haney et al, 2007, Pharmacogenomics 8:1037-1049).
Table 5. Dharmacon siRNA sequences.
Infection assays
The infection assay involved lh incubation at 37°C with either A/WSN/33 or A/New Caledonia/20/99 at the indicated multiplicity of infection (MOI). After lh incubation at 37°C, cells were rinsed with PBS and replenished with fresh media without virus. Cells used to study A/WSN/33 were cultured and infected in DMEM supplemented with 5% FBS and cells used to
study A/New Caledonia/20/99 in DMEM supplemented with 0.2% bovine serum albumin (Sigma Aldrich) and lμg/mL of TPCK trypsin (Worthington).
Supernatants were harvested 48h after infection and the viral titers were determined by TCID50 (Cottey et al, 2001, Curr Protoc Immunol Chapter 19:Unit 19 11) or plaque assay on MDCK cells. For TCID50, 2 x 104 MDCK cells per well in 100 μΐ were plated in a 96-well flat- bottom cell culture plate. The virus samples were 1/10 serially diluted and each diluted sample was used to infect the replicate wells by incubating 50 μΐ of the sample on a confluent monolayer of MDCK cells at 37°C and 5% C02. At 72h, the supernatants from all wells were transferred to a V-bottom plate. Chicken red blood cells (50 μΐ at 0.5%) were added and incubated for lh at 4°C. The agglutination wells were counted and used to determine TCID50 values (Reed 1938, The American Journal of Hygiene 27:493-, Hirst 1942, J Exp Med 76:195-209). Plaque assays were performed with 1/10 serial dilutions of the virus samples on a confluent monolayer of MDCK cells, overlaid with Avicel containing either 5% FBS or 1 μg/ml TPCK-trypsin (Matrosovich et al., 2006, Virology Journal 3:63). Cells were incubated for 72 h and then plaques were visualized by staining with 0.1% crystal violet.
Normalization and Z-score analysis
The primary screen data was normalized by correcting the raw data for across plate variation. Specifically, the percent inhibition of infectious virus was calculated for each experimental siRNA such that the difference of the experimental HPK siRNA treated well (XsiHPit) was subtracted from the mean of the negative control well values (XSINEG) and then divided by the difference of the means of the negative control and the TOX control (XsiTox) for each plate:
X siNEG plate A ~ XsiHP plate A
Percent Inhibition =
X siNEG plate A ~X siTOX plate A
The primary screen was performed in at least two mdependent experiments, and each experiment was performed in duplicate, yielding a dataset of > 4 replicates for each XSMPK- The mean of the replicates for each of the 720 XSIHPK was calculated and the resulting dataset was standardized using Z-score analysis (Table 5), whereby the mean (μ) of the data becomes zero and the standard deviation (SD) becomes 1. A "positive hit" in the primary screen was considered to have a Z-score > μ ± 2 SD using the formula below.
(Normalized score - mean of the population)
Z-score = SD of the population
Quantitative Real-time PCR
The RNA from A549 cells was isolated using an RNeasy Mini Kit (Qiagen) according to the manufacturer's instructions. The quantity of total RNA was determined using a NanoDrop ND-1000 Fluorospectrometer (NanoDrop Technologies, Wilmington, DE). Equal amounts of RNA were then reverse transcribed to cDNA using random hexamers and MuLV reverse transcriptase (High-Capacity cDNA Reverse Transcription Kit, Applied Biosystems) in accordance to the manufacturer's protocol.
For quantification of influenza M gene expression, qPCR was performed using 200 nM internal probe (M + 64, 5 '-FAM-TCA GGC CCC CTC AAA GCC GA-BHQ-1 -3 '), 400 nM forward primer (M + 25, 5 ' - AGATGAGTCTTCTAACCGAGGTCG (SEQ ID NO:187), and 400 nM reverse primer (M-124, 5 ' -TGC AA A AAC ATCTTC A AGTCTCTG (SEQ ID NO: 188)) following a previously described TaqMan assay (Spackman et al., 2002, J Clin Microbiol 40:3256-3260). The cycling conditions for qPCR were 95°C for 10 min followed by 40 cycles of 95°C for 15 sec, 60°C for 30 sec, and 72°C for 15 sec. The qPCR was carried out and analyzed
with a Stratagene Mx3005P instrument and software (La Jolla, CA). Copy numbers were determined by generation of a standard curve using plasmid DNA encoding influenza M gene (Spackman et al., 2002, J Clin Microbiol 40:3256-3260). Results reported for these studies were the averages of at least three replicates.
To determine the gene silencing efficiency associated with siRNA treatment, qPCR was performed using QuantiTect SYBR Green PCR Master Mix (Qiagen) according to the manufacturer's instructions with the primer sequences described in Table 6. Relative expression level was calculated using the endogenous control glyceraldehyde 3 -phosphate dehydrogenase (GAPDH). Fold changes were calculated against the mean of negative control siRNA treated cells. Methodology and data analysis for all qPCR experiments were carried out according to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines (Bustin et al, 2009, Clin Chem 55:611-622).
Table 6.
Brass, A.L. Konig, R. et Karlas, A. et
S.D. et al. al. Nature et al. Cell al. Nature al. Nature
Cell 139, 454, 890-
139, 1243- 463, 813- 463, 818- 1255-1267 893
1254 (2009). 817 (2010). 822 (2010).
Hit Gene (2009). (2008).** Total
C14orfl09 1 1 2
C6orf62 1 1 2
CALCOC02 1 1 2
CALM2* 1 2
CAMK2B* 1 1 2
CD81 1 1 2
CDK4* 1 1 2
CFLAR 1 1 2
CLIC4 1 1 2
COPB1 1 1 2
DCLK2 1 1 2
DLG5 1 1 2
DMAP1 1 1 2
EIF2AK2 1 1 2
EIF4A2 1 1 2
EPHB2* 1 1 2
FAM38A 1 1 2
FAU 1 1 2
FGFR2* 1 1 2
FLNC 1 1 2
HA D2 1 1 2
HK2* 1 2
IFIT5 1 1 2
IFITM3 1 1 2
IKBKE* 1 1 2
IL17RA 1 1 2
IRF2 1 1 2
ISG15 1 1 2
ITPKB* 1 2
JUN 1 1 2
KPNB1 1 1 2
KRTCAP2 1 1 2
MAP2K3* 1 1 2
MAP3K12* 1 1 2
MAPK1 * 1 1 2
MFAP1 1 1 2
MYC 1 1 2
ΝΈΚ8* 1 2 HP2L1 1 1 2
NUP153 1 1 2
OSMPv 1 1 2
PANK4* 1 2
PHF2 1 1 2
PIK3R4* 1 1 2
PLK3* 1 1 2
PLK4* 1 2
PLXNA2 1 1 2
Brass, A.L. Konig, R. et Karlas, A. et
S.D. et al. al. Nature
et al. Cell al. Nature al. Nature
Cell 139, 454, 890-
139, 1243- 463, 813- 463, 818- 1255-1267 893
1254 (2009). 817 (2010). 822 (2010).
Hit Gene (2009). (2008).** Total
PRKCA* 1 1
PRKCD* 1 1
RIPK2* 1 1
RPS6KA2* 1 1
RPS6KL1 * 1 1
STK38* 1 1
Indirect immunofluorescence to detect influenza NP
A549 cells were fixed with 3.7% formaldehyde and permeabilized with 0.5% Triton X- 100 (Sigma), 10%> FBS (Hyclone) in PBS. A549 cells were incubated with a primary antibody against the viral NP (25 μg/mL, H16-L10, HB65; ATCC) diluted in PBS with 10% FBS for lh at room temperature. Following this, the cells were incubated with Alexa-488 goat anti-mouse secondary antibody (Al 1001, Invitrogen) diluted 1:500 in PBS with 10% FBS for lh in the dark, and the cells were subsequently stained for 20 min with 1 μg/mL of 4'-6-Diamidino-2- phenylindole stain (DAPI, Invitrogen). The cells were imaged using the EVOS digital inverted fluorescent microscope (Advanced Microscopy Group, Bothell, WA) at two wavelengths, 488 ran to detect Influenza infected cells expressing NP, and 350 nm for nuclear DNA bound by DAPI. For quantification of NP immunofluorescence, cells were fixed, permeabilized and stained as above and 20X images were acquired and analyzed using Cellomics Array Scan VTI High Content Imager and Cellomics ArrayScan software (Thermo Fisher Scientific).
Indirect immunofluorescence to detect HPK expression
A549 cells in 96 well plates were transfected with HPK specific miRNA inhibitors or mimics and incubated for 48h. Cells were fixed with 4% formaldehyde in PBS and
permeabilized with 0.5% TritonX-100 in PBS/20 min/RT. Cells were incubated with biotinylated antibodies against HPKs (lOug/ml) diluted in PBS+5% BSA for 2h at room temperature or 4°C overnight, washed with PBS (10 min X 3) and incubated with Streptavidin-Alexa 488 conjugated secondary antibodies for 3hrs. Excess secondary antibody was removed by washing with PBS thrice (10 min each wash) and nuclei were finally stained with 4'-6-Diamidino-2-phenylindole stain (DAPI, Invitrogen) for 10 min at RT. Plates were scanned with Cellomics ArrayScan VTI scanner using Target Acquisition protocol at 20X magnification. DAPI fluorescence was
measured in channel 1 and Alexa 488 fluorescence was measured in channel 2. A minimum of 5000 valid channel 2 objects were counted per well in triplicate for each mimic/inhibitor treatment. Data was exported into csv files and statistically analyzed using GraphPad Prism version 5.0. miRNA target prediction and literature analysis
miRNAs targeting the selected HPKs were mined using miRWalk (Dweep et al., 2011, J Biomed Inform 44:839-847). Briefly, miRWalk tabulates the miRNAs targeting a gene of interest based on predictions from multiple algorithms and can be used to either find miRNAs targeting a gene(s) or vice versa. Lists were exported into spreadsheets containing data on miRNA deregulation during influenza infection and compared. Most predictions with significant scores have (1) a significant seed region match and (2) are evolutionarily conserved as per TargetScan (Lewis et al., 2005, Cell 120:15-20). miRNA validation
A549 cells (2 x 104) were transfected with either a miRIDIAN miRNA antagonist (25 nM), a miRIDIAN miRNA agonist (12.5 nM) (Dharmacon), or a siRNA targeting the HPK under study using Lipofectamine 2000 (Invitrogen) per the manufacturer's protocol. miRNA- let- 7f (expressed at ~750 copies in A549 cell [Johnson et al., 2007, Cancer Res 67:7713-7722]) was used to optimize inhibitor or mimic concentrations and at 25nM miRNA antagonist
concentration generally reduced miRNA expression by >85%, while transfection with 25nM miRNA agonists led to an increase in miRNA levels (Figure 12). The miRIDIAN miRNA antagonists are chemically modified dsRNAs consisting of a central region complementary to the mature miRNA flanked by 0-16 nt long sequences with reverse complement to pri-miRNA to enhance specificity and reduce RISC incorporation (Esau 2008, Methods 44:55-60, Krutzfeldt et al., 2005, Nature 438:685-689, Vermeulen et al, 2007, RNA 13:723-730). Conversely, agonists are chemically modified dsRNAs that increased the guide strand concentration in RISC complex, thus increasing native miRNA mediated repression (Vermeulen et al., 2007, RNA 13:723-730, Xiao et al., 2007, J Cell Physiol 212:285-292). Cells treated with an equal concentration of a non-targeting control sequence (mock) were used to control for non-sequence-specific effects in miRNA experiments. After 48h post-transfection, the cells were infected (MOI = 0.01) with
A/WSN/33 for 48h. Virus replication and HPK knockdown was assayed by high content microscopy and HPK expression was analyzed using qPCR (for transcript) and high content screening (for protein). For qPCR, 18S rRNA was used as housekeeping control. Fold changes were calculated against the mean of mock treated cells.
Statistical Analysis
Statistical analysis for validation screen, pathway analysis, and miRNA studies were performed using Student's t test with the GraphPad Prism 5 software. Statistical significance (p<0.05) is indicated by a single asterisks or double asterisks if highly significant (pO.001).
RNAi screen identifies host kinase genes important for influenza virus replication.
HPKs are key mediators of signaling events in a cell and inhibition of HPKs has been shown to reduce progeny virus production both in vitro and in vivo (Droebner et al., 2011, Antiviral Res 92:195-203). To better understand the contribution of HPKs during influenza virus replication, an RNAi-based genetic screen was performed and validated (Figure 13). siRNA SMARTpools individually targeting 720 different HPKs were transfected into A549 cells followed by influenza A/WSN/33 infection. Levels of infectious virus were determined by TCID50 and effects of siRNA treatment quantified using a z-score method where a positive z- score (>2.0) indicates HPK knockdown resulting in an increase in viral replication and a negative z score (<-2.0) value indicates a resulting decrease in virus replication. Using the | z | ±> 2.0 identified 22 of the 720 HPK genes as modulators of influenza A/WSN/33 replication (Table 7; Figure 11) of which 3 (NPR, MAP3K1, DYRK3) increased influenza virus replication and were designated as anti-viral HPKs, while silencing 19/22 genes (EPHA6, TPK1, PDK2, C90RF96, EXOSC10, NEK8, PLK4, SGK3, NEK3, PANK4, ITPKB, CDC2L5/CDK13, CDK3, CALM2, PRKAG3, ERBB4, ADK, PKN3, HK2) decreased influenza virus replication compared to siNEG transfected cells and were designated pro-viral HPKs (Table 7, Figure 11, Figure 14). Cells transfected with the positive control, i.e. siMEK, had consistently lower influenza virus titers compared to siNEG transfected cells (Table 4).
Table 7. Human kinase genes identified important for influenza virus replication in primary screen
Symbol Name Z-score Logio TCID50/mL
NPR2 natriuretic peptide receptor B/guanylate cyclase B 2.64 6.5
MAP3K1 mitogen-activated protein kinase kinase kinase 1 2.55 5.7
dual-specificity tyrosine-(Y)-phosphorylation regulated
DYRK3 2.23
kinase 3 5.9
EPHA6 EPH receptor A6 -2.01 3.0
TPKl thiamin pyrophosphokinase 1 -2.01 3.0
PDK2 pyruvate dehydrogenase kinase, isozyme 2 -2.03 2.7
C90RF96 chromosome 9 open reading frame 96 -2.16 2.7
EXOSCIO exosome component 10 -2.16 2.7
EK8* never in mitosis gene a- related kinase 8 -2.18 2.7
PLK4* polo-like kinase 4 -2.18 1.7
serum/glucocorticoid regulated kinase family, member
SGK3 -2.19 2.7
3
NEK3 never in mitosis gene a-related kinase 3 -2.22 2.7
PANK4* pantothenate kinase 4 -2.35 1.7
ITPKB* inositol 1,4,5-trisphosphate 3-kinase B -2.35 1.7
CDC2L5 cell division cycle 2-like 5 -2.38 1.7
CDK3 cyclin-dependent kinase 3 -2.40 1.7
CALM2* calmodulin 2 -2.59 n.v.
protein kinase, AMP-activated, gamma 3 non-catalytic
PRKAG3 -2.59 n.v.
subunit
v-erb-a erythroblastic leukemia viral oncogene
ERBB4 -2.59 n.v.
homolog 4
ADK adenosine kinase -2.59 n.v.
PKN3 protein kinase N3 -2.59 n.v.
HK2* hexokinase 2 -2.59 n.v.
Genes identified important for influenza in a previous screen; n.v., no detectable virus
To rule out false positive/negative hits due to potential siRNA off-target effects (Sigoillot and King 2011, ACS chemical biology 6:47-60), primary hits were retested using a novel synthetic siRNA targeting the same gene but at a different seed site (Table 5), and HPKs that exhibited identical phenotypes as the primary screen were thus validated. Transfection of siRNAs targeting NPR2, MAP3K1, DYRK3, EPHA6, TPKl, PDK2, EXOSCIO, NEK8, PLK4, SGK3, NEK3, PANK4, ITPKB, CDK13, CALM2, ADK, PKN3, and HK2 followed by gene specific qPCR demonstrated >80% silencing of the target mRNA (Figure 12). The novel
siRNAs targeting genes CDK3, PRKAG3, ERBB4, and C90RF96 were unable to knockdown mRNA expression and were excluded from the validation screen. Transfection of A549 cells with the novel siRNAs for the 18 HPKs followed by A/WSN/33 influenza infection modulated influenza replication significantly (pO.01) similar to those obtained in the primary screen confirming the relevance of the HPK genes (Figure 14A). These findings were substantiated with additional endpoint assays that included measurement of viral genome replication by qPCR (Figure 14B), and influenza nucleoprotein high content analysis (Figure 14C). Thus, 17 of 18 HPK hits repeated the original screen phenotype, i.e. increased or decreased virus replication. Identifying 22 hits out of 720 in the primary screen yielded a positive hit rate of 3.1% which is consistent with other related screens (Brass et al., 2009, Cell 139:1243-1254, Hao et al, 2008, Nature 454:890-893, Karlas et al, 2010, Nature, 463:818-22, Konig et al, 2009, Nature 463:813- 817, Shapira et al., 2009, Cell 139:1255-1267). The majority of the hits were novel; however, PANK4, NEK8, PLK4, ITPKB, CALM2 and HK2 have been identified in other influenza screens (Table 6; Table 7) (Brass et al., 2009, Cell 139:1243-1254, Hao et al, 2008, Nature 454:890-893, Karlas et al., 2010, Nature, 463:818-22, Konig et al., 2009, Nature 463:813-817, Shapira et al, 2009, Cell 139:1255-1267). A meta-analysis of the validated HPK hits combined with those previously identified revealed that although specific genes are not consistently identified, many genes are in shared cell pathways important for influenza including PI3K/AKT signaling, NFKB, PKC/CA++ signaling, and p53/DNA damage pathways (Min and Subbarao, 2010, Nat Biotechnol 28:239-240).
For the hit selection, it is important to identify false-negatives in which siRNAs with larger effects are not selected, and false-positives in which siRNAs with negligible effects are selected as hits. Assessment of the false-negative rate in these studies using a z- score > μ ± 2 SD revealed a rate of 87.5%. If the potential hits are expanded to those fitting a z-score > μ ± 1 SD, the false-negative rate decreases to 23% because 37 HPK genes can be identified that overlap with HPK genes discovered in related published screens (Brass et al., 2009, Cell 139:1243-1254, Hao et al., 2008, Nature 454:890-893, Karlas et al, 2010, Nature, 463:818-22, Konig et al, 2009, Nature 463:813-817, Shapira et al, 2009, Cell 139:1255-1267). Since only the ADK gene was not validated, the false-positive rate in the primary screen was 4.5% (1 out of 22). This good false-positive rate is linked to the assay conditions, i.e. using pooled siRNA duplexes reported to
reduce the rate of false-positives (Straka and Boese 2010, Current Topics in RNAi:Why Rational Pooling of siRNAs is SMART. Thermo Fisher Scientific Inc).
Validated HPK genes affect replication of different influenza strains
Influenza virus A/WSN/33 was chosen for the primary and validation screens based on its stability and ability to replicate without exogenous trypsin. However, because it is a lab- adapted strain, a more pertinent influenza virus strain was tested to be sure the validated HPK hits were important for other influenza viruses regarding replication. Therefore, A549 cells were transfected with siRNAs targeting the hit HPKs and subsequently infected with influenza A/New Caledonia/20/99 (Figure 15). Of the 17 HPK genes identified important for A/WSN/33 replication, six (CDK13, HK2, NEK8, PANK4, PLK4, SGK3) emulated the phenotype following A/New Caledonia/20/99 infection, i.e. increased or decreased virus replication as measured by influenza NP localization (Figure 15 A) and influenza M gene levels (Figure 15B). In addition, four of the six (HK2, NEK8, PANK4, PLK4) have also been identified important for influenza virus replication in other influenza-genome screens (Table 6; Table 7) (Hao et al., 2008, Nature 454:890-893, Konig et al., 2009, Nature 463:813-817, Shapira et al, 2009, Cell 139:1255-1267).
Systematic analysis of miRNAs predicted to govern hit HPK genes
While in vivo deregulation of host miRNA expression associated with influenza infection has been established, the pathways by which cellular miRNAs modulate host gene expression during influenza virus infection remain largely unexplored (Li et al., 2010, J Virol 84:3023-3032, Li et al, 2011, Virology). The screen validated six HPKs (CDK13, HK2, NEK8, PANK4, PLK4, SGK3) that modulate A/WSN/33 and A/New Caledonia/20/99 influenza virus replication. To identify the role of miRNAs in regulating these HPKs, a list was compiled of miRNAs deregulated during influenza infection based from the existing literature (Table 8) and this was used to compare how many of these were predicted to regulate the 4 pro-viral (NEK8, PLK4, SGK3 and CDK13) and two anti-viral (MAP3K1 and DYRK3, Lu et al, Cardiovasc Res 86:410- 420) genes (Figure 16A) providing a shortlist of miRNAs for experimental validation (Figure 16B). To validate miRNAs that may govern HPKs a panel of miRNA inhibitors and mimics was used which have been shown to consistently prevent or increase the incorporation of miRNA
guide strand into the RISC complex (Woolcock et al, 2008, Methods Mol Biol 436:35-^6). Previous studies have established that 25nM of miRNA inhibitor reduces native miRNAs >85% in 24h and are not cytotoxic (Figure 17) (Bakre et al, 2012, J Gen Virol 93:2346-2356). Thus, a 25nM concentration was used in all transfection assays. An important caveat when using these reagents is that while miRNA inhibitors are miRNA-specific and able to distinguish between different members of the same miRNA family, miRNA mimics affect native levels of all members of a miRNA family especially when the seed sites are conserved. Based on the dogma of miRNA action, it is expected that miRNA inhibition which increases gene expression and miRNA upregulation which decreases gene repression relative to non-targeting controls are evidence suggestive that miRNAs post-transcriptionally affect target gene expression.
Moreover, it can be expected that the differences in gene expression between inhibitor and mimic treatments are to be subtle but significant (Lu et al., Cardiovasc Res 86:410-420, Kang et al, 2012, FEBS Lett 586:897-904, Truesdell et al, 2012, Sci Rep 2:842, Vasudevan 2012, Wiley Interdiscip Rev RNA 3:311-330). A549 cells were transfected with inhibitors or mimics for targeted miRNAs, assayed for cytotoxicity, and then processed for RNA extraction or stained for HPK expression using HPK-specific antibodies. Transfected cells were also infected in parallel with A/WSN/33 (MOI=0.001) and viral replication was monitored using NP staining and analyzed using a Cellomics Array Scan VTI scanner (ThermoFisher). The data reflect trends from a minimum of 5000 cells counted from at least 20 fields of triplicate wells for each treatment. Transfection of miR-300 and miR-29b reduced DYRK3 transcript expression but did not show any detectable difference between inhibitor/mimic treatments suggesting that miR-29b and miR- 300 do not regulate DYRK3 expression. Similarly, transfection of miR-1227, -18 la*- 30a-3p and -30d inhibitor/mimic did not have any substantial effect on SGK3 (data not shown). Both miR-149* inhibitor and mimic induced NEK8 transcription though inhibitor-mediated induction was significantly higher than mimic (Figure 18). These differences in transcript were not observed for NEK8 protein which showed poor expression in mock and NTC transfected cells, a feature that may be linked to rapid proteasome degradation of NEK8 protein which has been shown previously (Zalli et al., 2012, Hum Mol Genet 21:1155-1171). Thus, analysis of miRs targeting DYRK3 and SGK3 and NEK8 was not pursued further. MAP3K1 transcript expression was significantly up regulated by miR-548d inhibitor treatment but not miR-29a or miR-138* treatments (Figure 19A), suggesting that miR-548d can regulate MAP3K1 expression. In
contrast, miR-548d mimics, but not inhibitor treatment, caused increased MAP3K1 protein (Figure 19B). This is may be due to significant "seed identity" between >20 members of the 68 member strong miR-548 family, and seed shifting between miR-548d members that can lead to off-target effects (Liang et al, 2012, J Biomed Biotechnol 2012:679563). Thus, transfection of miR-548d mimic is expected to deregulate expression of other mRNAs and could explain the upregulation of MAPKl protein seen with mimic transfection. Indeed, replication of A/WSN/33 is reduced in miR-548d inhibitor transfected cells. These finding suggests that miR-548d induced during influenza infection regulates MAP3K1 (Figure 19C). Transfection of miR-1228 and miR- 138 mimics both up regulated CDK13 transcript (Figure 20A), but only miR-128 up regulation caused a statistically significant increase in CDK13 protein expression (Figure 20B) but did not modulate influenza NP staining (Figure 20C). These data show miR-1228 and -138 miRNAs stabilize CDK13 transcription and translation and the mechanisms for this are presently not understood. In the case of PLK4, miR-34b and let-7i inhibitor/mimic treatments had no substantial effects on PLK4 transcript and protein expression (data not shown), but miR-34c mimic considerably upregulated PLK4 transcript (Figure 21 A) and protein expression (Figure 2 IB) as well as influenza NP levels (Figure 17, Figure 21C). These observations suggest that miR-548d in the case of MAP3K1, miR-1228 and miR-138 in the case of CDK13, and miR-34c in the case of PLK4 up regulate HPK expression which is consistent with previous findings (Lu et al., Cardiovasc Res 86:410-420, Kang et al, 2012, FEBS Lett 586:897-904, Truesdell et al, 2012, Sci Rep 2:842, Vasudevan 2012, Wiley Interdiscip Rev RNA 3:311-330) although the exact mechanisms remain to be explored. Interestingly, miR-34c-3p has been shown previously to be a major miRNA induced during infection with both H1N1 and H5N1 influenza viruses (Loveday et al., 2012, J Virol 86:6109-6122), although its role in influenza biology is presently incompletely understood. These data show that HPKs important for influenza virus replication are regulated by influenza deregulated miRNAs.
I l l
Table 8.
Chem, 287:31027; 3. Ma et al., 2012, J Cell Mol Med, 16:2530; 4. Loveday et al, 2012, J Virol, 86:6109; 5. Fang et al, 2012, J Virol, 86:1010.
Discussion
The study of influenza virus biology has revealed complex mechanisms by which the influenza virus co-opts host cellular pathways to facilitate virus replication and evade the antiviral response. With the application of genome-wide screens, interactions between the virus and specific host cell components are now being identified and have led to new insights into viral and host interactions at different stages of the life cycle. A direct outcome of these studies can be the repurposing of old drugs for new conditions as was recently demonstrated for influenza (Perwitasari et al., 2013, Antimicrob Agents Chemother 57:475-483).
The objective of this study was to identify human protein kinases that regulate influenza virus replication and their regulation by miRNAs during influenza infection. A genome-wide siRNA screen of 720 HPK members was evaluated for the HPK family consisting of multiple
kinase classes. This screen identified 22 HPK that upon silencing led to increased or decreased influenza virus replication. Three HPKs (NPR, MAP3K1 and DYRK3) when silenced led to increased viral replication, suggesting that they have anti-viral activity. The remaining 19 HPKs when silenced decreased virus replication significantly, suggesting that they are pro-viral and indispensable for viral replication. The preliminary hits identified from the primary screen were silenced using siRNAs targeting a novel seed site in the same gene and tested for impact on viral replication using multiple endpoint assays that evaluated viral genome, virus replication, and NP staining. A total of 18 HPKs (NPR2, MAP3K1, DYRK3, EPHA6, TPK1, PDK2, EXOSC10, NEK8, PLK4, SGK3, NEK3, PANK4, ITPKB, CDK13, CALM2, ADK, PKN3, and HK2) passed this secondary validation and were tested with a seasonal strain of influenza virus where six HPKs that were identified as necessary for replication. It should be noted that other genes identified in the primary screen, i.e. CDK3, PRKAG3, ERBB4, and C90RF96, were excluded from validation studies only because their expression was not silenced with the novel siRNA, and these HPKs may also have a role in virus replication. One primary screen hit, ADK, showed reduced Ml levels measured by qPCR, but did not validate in our NP localization analysis. Genomic changes would be expected to be subtle compared to changes in NP localization and could account for these findings. To date, five independent genome-wide screens in mammalian cells have characterized host factors important for influenza virus replication (Hao et al., 2008, Nature 454:890-893, Shapira et al., 2009, Cell 139:1255-1267, Karlas et al., 2010, Nature, 463:818-22, Konig et al, Nature 463:813-817, Brass et al., 2008, Science 319:921-926). A minimal overlap between screens was observed, but core pathways were found to be conserved and have been reviewed previously. The minimal overlap between different virus strains is expected since the tempo of signal transduction and host gene expression is differentially induced by different virus strains which is linked to differences in replication dynamics and virus yield (Heynisch et al, 2010, Vaccine 28 : 8210-8218). It is also likely that different influenza viruses may use alternate pathways for virus replication though core pathways were generally found to be conserved between screens (Min and Subbarao, 2010, Nat Biotechnol 28:239-240). This may be particularly relevant as A/WSN/33 which is a mouse-adapted virus and A/New Caledonia is a human virus.
The experimental approach used in this study to analyze influenza virus replication at 48h post-siRNA transfection limits the findings to the later phases of the viral life cycle and may
preclude HPKs that are important in the early phases of the viral life cycle. To avoid an extensive cross-talk due to cellular signaling post-infection, a very low MOI of infection was used to allow sufficient viral replication and avoid excessive cytopathic effect. Importantly, the screen in this study was validated using three endpoints to confirm the effect of host gene silencing on influenza virus replication. These endpoints included determining infectious virus titers as measured in MDCK cells, viral genome replication as determined by qPCR measurement of influenza M gene expression, and influenza NP as determined by high content analysis.
From the HPKs identified in the secondary validation screen, four pro-viral (NEK8, PLK4, SGK3 and CDK13) and two anti-viral (MAP3K1 and DYRK3) HPKs were assessed for miRNA regulation, and identified three HPKs (two pro-viral and one antiviral) (CDK13,
MAP3K1 and PLK4) were found to have differential expression upon corresponding miRNA inhibitor/mimic treatment suggesting that these miRNAs likely regulate these HPKs. Contrary to current dogma that miRNA inhibition relieves native miRNA inhibition and causes increased expression of target genes, and vice versa, it was observed that miRNA inhibition reduced transcript levels for CDK13, MAP3K1 and PLK4 while mimic treatment induced protein expression. This phenomenon has been recently identified in a growing number of studies suggesting that miRNAs may also stabilize target gene expression by various mechanisms that are incompletely understood (Lu et al., Cardiovasc Res 86:410-420, Kang et al., 2012, FEBS Lett 586:897-904, Truesdell et al., 2012, Sci Rep 2:842 ,Vasudevan 2012, Wiley Interdiscip Rev RNA 3:311-330). Influenza infection has been shown to upregulate expression of a large number of proteins (Liu et al, 2012, J Proteome Res 11 :4091-4101, Kroeker et al, 2012, J Proteome Res 11 :4132-4146, Dove et al, 2012, Proteomics 12:1431-1436, Zhu et al., 2012, J Proteomics 75:1732-1741, Lietzen et al, 2011, PLoS Pathog 7:el001340, Zhang et al, 2010, Genomics Proteomics Bioinformatics 8:139-144), and the genes expressing these proteins are likely regulated at some level by miRNAs.
While the findings in this study show that HPKs are important for influenza replication, and key HPKs are regulated by miRNAs that are also deregulated during influenza infection, the number of miRNAs that were validated to be affected was limited. This could be either due to differential temporal expression profiles of the target genes and the miRNAs investigated, and/or affected by cell type-specific features, or the regulation small enough as not to lead to a detectable phenotype. While preliminary pathway analysis identified several key pathways
regulated by the HPKs identified in this study, detailed analysis is needed but outside the scope of this study. Given the large number of potential miRNA targets, it is unlikely that one miRNA governing one HPK gene could sufficiently explain a phenotype, i.e. increased or decreased influenza virus replication. The genetic screen in this study yielded 17 candidate HPK genes based on a z-score > μ ± 2SD; however, lowering the threshold to a z-score > μ ± 1 SD would have added an additional 37 HPK genes that overlapped with HPK genes discovered in related published screens (Brass et al, 2009, Cell 139:1243-1254, Hao et al, 2008, Nature 454:890-893, Karlas et al, 2010, Nature, 463:818-22, Konig et al, 2009, Nature 463:813-817, Shapira et al, 2009, Cell 139:1255-1267). Thus, it is likely that other HPK genes not identified in this study and the miRNAs governing their expression may be required or contribute to influenza virus replication.
There remains a gap in our understanding of the role of miRNA regulation of host genes, and how this interaction affects intracellular signaling pathways used during virus infection and replication. However, this study provides a framework for future studies, and contributes toward a better understanding of host-pathogen interactions which may help in accelerating the rational design of therapeutics aimed to control influenza infection and disease pathogenesis.
Example 3 Methods and Materials:
Cell culture and viruses
Mycoplasma free A549 human lung epithelial cells (CCL-185, ATCC) were cultured in Dulbecco's modified Eagle's medium (DMEM, HyClone, ThermoScientific) supplemented with 5% heat-inactivated FBS (HyClone, Thermo Scientific) at 37°C and 5% C02 and used for all infections. Influenza virus A/NY/1682/wt and A/NY/1682/NS 1-126 were grown in the allantoic cavities of 9-day-old embryonated chicken eggs as previously described (Woolcock et al., 2008, Methods Mol Biol 436:35-46). Virus stocks were titrated in Madin-Darby canine kidney cells (MDCK, CCL-34, ATCC) cells as previously described (Reed and Muench, 1938, The American Journal of Hygiene 27:493-497) and a 50% tissue culture infectious dose (TCID50) was determined using the method described by Reed and Muench.
Respiratory Syncytial Virus (RSV) wild type (wt) and NS 1 mutant viruses were grown in VeroE6 cells and isolated by sonication of infected cells day 3 post infection or when syncytia were clearly visible. Viral stocks were tittered using a standard plaque assay and developed with an immunoassay using anti-RSV F monoclonal 131-2A.
Infections.
T25 flasks containing 0.5e5 A549 cells were incubated overnight in DMEM
supplemented with 5% heat inactivated FBS to allow cells to adhere and grow. Flasks were washed with 5ml of pre-warmed Hanks balanced saline solution before infection. Viral inocula were prepared in DMEM without serum for both viruses and added to washed cells to achieve an moi of 0.5. Viral inocula were removed after a 2 hr incubation, washed thrice with phosphate buffered saline (PBS) and replaced with either complete medium (for RSV) or DMEM containing 2ug/ml TPCK-Trypsin and 2mg/ml BSA for Influenza infection. Each infection was done in triplicate and for 12 and 24 time points each. At the end of incubation, media was removed and cells were lysed in Trizol® (Invitrogen) reagent. RNA was isolated as per manufacturer's protocol and assayed for quality control. Cells treated with allantoic fluid from uninfected eggs and vero E6 cell lysate were used as mock controls for each time point. All RNA samples had A260/280 ratios >1.8 and A260/230 ratios >1.5 indicating that the RNA was of a high quality. miRNA microarray analysis.
RNA samples isolated as above were sent to ThermoFisher scientific for miRNA microarray analysis. Samples were labelled and hybridized to version 16 miRNA microarrays using in house protocols, scanned and data was analyzed to obtain lists of miRNAs deregulated during wild type and NS1 mutant influenza and RSV infections at 12 and 24hr post infection. Hits with p value (False discovery rate multiple test corrected p value) <0.05 were considered significant and were compared between viruses and time points. miRNA inhbitor /mimic transfection.
Lyophilized miRNAs in 96-well plates were diluted with HBSS (HyClone, Logan, UT) and allowed to incubate for 5 minutes. Dharmafect-1 transfection reagent (Lafayette, CO) and
HBSS were added such that each well received 0.004 ml of transfection reagent and 0.096 ml of HBSS. The siR A/transfection reagent mix was allowed to incubate for 20 minutes at room temperature after which 0.08 ml of 1.5 104 A549 cells suspended in DMEM/5% FBS was added to each well, and the plate incubated for 48 hours at 37°C in 5% C02. The final concentration of siRNA for all primary screen transfections was 25 nM.
Determination of cytotoxicity for miRNA inhibitor/mimic transfected cells.
To determine if miRNA gene silencing was cytotoxic, Alamar blue reagent (AbD Serotec) was added to cells 48 hrs post transfection at a concentration of 10% of the total volume of medium (lOul in lOOul medium). Plates were incubated at 37°C in 5% C02 for lhr and Alamar Blue fluorescence was measured at 560nm and 590nm and compared to cells treated with non-targeting controls and transfection reagent alone. Inhibitors/mimics that exhibited >20% decrease in Alamar Blue reduction were deemed cytotoxic and were not analyzed further. Cells were subsequently infected with rgRSV224GFP virus at an MOI=0.5 for 2hr. Viral inoculum was replaced with complete DMEM supplemented with 5% heat inactivated FBS. GFP expression was measured using a Tecan Satire X2 plate reader using excitation at 480nm and emission at 520nm. Percent changes in GFP were calculated by multiplying the ratio of raw GFP fluorescence values between test and non-targeting control treatments) by 100. siRNA against RSV N gene was used as a positive control.
Results
RSV and influenza virus infection deregulate host microRNA expression.
A549 cells were infected (MOI=0.5) with wild type or NS1 mutant RSV or Influenza virus (A/NY/1682) for 12 and 24hrs alongwith mock infected controls.
Influenza wildtype (A/NY/1682) infected cells showed induced expression of miR-451 and mir-663 24hr post infection while infection with A NY/1682/NS1-126 infection induced the expression of numerous miRNAs (miR-944, mIR-762, miR-7-1*, miR-663, miR-629*, miR- 548c-5p, miR-452, miR-424, miR-371-5p, miR-22*, miR-1977, miR-1973, miR-196a, miR- 1915, miR-186, miR-1826, miR-1539, miR-1280, miR-1274a, miR-1268, miR-1260, miR-1181, miR-let-7b*, miR-20a*, miR-142-3p, miR-363, miR-222, miR-7, miR-630, miR-454, miR-31, miR-203, miR-149, miR-1308, miR-1307, miR-lOb, miR-663).
RSV wild type infection induced the expression of miRNAs (miR-769-3p, miR-758, miR-652, miR-541, miR-630, miR-625, miR-582-3p, miR-570, miR-503, miR-489, miR-455-3p, miR-454*, miR-449a, miR-421, miR-378, miR-362-5p, miR-361-5p, miR-34b*, miR-340*, miR-339-3p, miR-324-5p, miR-31*, mIR-30e*, miR-30d*, miR-30c, miR-30a*, miR-27b, miR- 27a, miR-221, miR-19b-l*, miR-186, miR-183*,miR-181b, mIR-181a*, miR-181a-2*, miR- 1246, mIR-lOb, miR-lOa, miR-363, miR-222, miR-7, miR-630, miR-454, miR-31, miR-203, miR-149, miR-1308, miR-1307, miR-lOb, miR-100*) while RSV ANSI virus infection induced expression of miR-let-7b*, miR-20a*, miR-142-3p, miR-363, miR-222, miR-100*. miR-100*, - 363 and -222 were induced in both RSV WT and NSl infection while miR-1268 and -663 were common miRs induced between WT and NSl mutant influenza 24hr post infection. miR-363 and -222 were also induced in Influenza NSl infection. miRNAs let-7b*, -20a*, and -142-3p were common between RSV and Influenza NSl infections while miR-663 was coomon between RSV and Influenza WT infections. Deregulated miRNAs potentially regulate RSV replication.
Multiple miRNAs identified in the miRNA microarray screen above were also found to regulate RSV replication in an independent miRNA agonist/antagonist screen. miRNAs whose inhibition upregulated RSV replication include (miR-769-3p, miR-758, miR-630, miR-625, miR- 582-3p, miR-570, miR-503, miR-455-3p miR-421, miR-362-5p, miR-361-5p, miR-339-3p, miR- 30e, miR-30d* miR-27b miR-27a miR-221 miR-181b miR-181a-2*, mIR-lOb, miR-100*, miR- 889, miR-579, miR-550a, miR-544, miR-19a*, miR-100, miR-363, let-7b*, miR-lOb, miR-454, miR-630, miR-944, miR-762, miR-548c-5p, miR-452, miR-371-5p, miR-186, mil260).
Inhibition of these miRNAs in A549 cells lead to at least 25% increase in replication of a GFP expressing RSV and these are currently being independently validated using traditional plaque assays.
Conclusions
Influenza and RSV infection deregulate host miRNA expression which is driven by NSl gene responsible for regulating host anti- viral response. Many of the deregulated miRNAs are important for regulating RSV replication.
The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incoiporated by reference in their entirety. Supplementary materials referenced in publications (such as supplementary tables, supplementary figures, supplementary materials and methods, and/or supplementary experimental data) are likewise incorporated by reference in their entirety. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.
Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.
All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.
Claims
1. A method for decreasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a protease or a kinase endogenous to the cell, and wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Orthomyxoviridae or a member of the family Paramyxoviridae.
2. The method of claim 1 wherein the virus selected from a member of the family
Orthomyxoviridae, and wherein the protease is selected from an ADAMTS7 polypeptide, a CPE polypeptide, a DPP3 polypeptide, a MSTl polypeptide, a PRSS12 polypeptide, or a combination thereof.
3. The method of claim 1 wherein the virus selected from a member of the family
Orthomyxoviridae, and wherein the kinase is selected from a CDK13 polypeptide, a HK2 polypeptide, a NEK8 polypeptide, a PANK4 polypeptide, a PLK4 polypeptide, a SGK3 polypeptide, or a combination thereof.
4. A method for decreasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Orthomyxoviridae, wherein the polypeptide is selected from a PPARA polypeptide, a RIF1 polypeptide, a P4HA1 polypeptide, a GRIA4 polypeptide, a TWSG1 polypeptide, a SHANK2 polypeptide, or a combination thereof.
5. A method for increasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Orthomyxoviridae, wherein the polypeptide is selected from FGD4, PKD2, MAP3K2, ZNFX1, PDCD1LG2, PLEKHA3, EIF5A2, FYCOl, GPR6, ENPP5, EPHA4, VSX1, STK17B, SACS, C14orf28, ZFYVE26, FGL2, SZT2, MEIR5, RPS6KA5, Cl lorGO, XRN1, FBXL5, CAMTAl, ITPRIPL2, SERFIA, SERFlB, GPR137C, FTSJDl, EPHA5, GUCY1A3, RRAGD, CTSS, GNPDA2, FBX048, DYNC1LI2, F AMI 29 A, CERCAM, FIBIN, EZH1, CYP2U1, RNF128, IRF9, VPS53, DDHD1, ANKRD29, REST, FAM40B, PPP1R3B, RAB11FIP5, ARID4B, C2CD2, PRRG1, TNFRSF21, KLHL2, SGTB, SEMA4B, C2CD4A, LAM A3, PTPN4, MCHR2, TRDN, RUFY2, ARHGAP12, ESR1, ZXDA, SLITRK3, ISM2, RAB22A, SLC46A3, CEP97, UEVLD, BTG3, PGM2L1, IFIT5, CYBRD1, FNBP1L, PURB, SSH2, ATP 12 A, HSPA8, FJX1, SLC11A1, CNRIP1, Clorfl35, RASSF2, ANKRD52, DE ND5B, ATG16L1, BRMS1L, CTDSPL, CCL1, ZFYVE9, SLC40A1, DUSP2, STARD8, ZNF800, TCF7L1, VLDLR, FCH02, MASTL, RBL1, ZNF652, CENPQ, MRPL24, FZD3, ITGB8, GPR133, NR2E3, AN06, UNC80, LIMA1, ARID4A, ARHGAP26, FBX031, ZNF367, ZFP3, GINS4, SARIB, C7orf43, PBX3, E2F5, SEMA7A, HAUS8, LMOD3, RGMA, ITSN2, PTHLH, TGM2, ZADH2, Clorf63, ZIM3, NIN, KLHL28, NAGK, PTPDC1, CTS , TGFBR2,
ST6GALNAC3, TRIP11, ZNF238, TAOK3, WWP2, FRMD6, CRY2, TRIM36, C15orfl7,
VASH2, CXCL6, KIAA1383, TM2D2, KIF23, SERP1, AHNAK, U2SURP, RPGR, C18orf32, DUSP18, NKIRAS1, PFKP, LYST, Cl lorf82, CHRM2, C19orf2, GPATCH2, RGMB,
PAPOLB, FIGNL1, CAPRIN2, CROT, MAP3K5, USP31, MKNK2, TXNIP, BTN3A1, AGFG1, KIF14, LRCH1, C18orfl9, SLAIN2, ZNF512B, BNIP2, RSBN1, DERL2, MMP3, HDHD1, PAG1, GLOl, FAM13C, NCEH1, SDC2, RBM34, MMAA, RPL17-C180RF32, ARL1, CHP2, PRRG4, TOPORS, MED 17, BMPR2, or a combination thereof.
6. A method for increasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide decreases expression of a polypeptide endogenous to the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Paramyxoviridae, wherein the polypeptide is selected from FGF23, HMCN1, GPC4, KIAA0754, PAQR9, H2AFV, C5orfl5, DPY19L4, PRDM16, USP13, ABAT, POU2F3, SHPK, PARP9, MORC3, DE ND1B, SLC25A16, ZNF578, STAT5B, DGKE, NRG1, PCBD2, DNHD1, UNC5D, NUDT12, HNRNPA3, HSD17B13, C2CD4A, LOC100132963, ABCA1,
CLVSl, C3orf79, SEC62, CN M4, CDC42BPA, LRRTM4, WWP2, CNTD2, MCM6, C4orf40, POLDIP2, KIAA0776, FLVCR1, ZNF615, ER01LB, SLIT1, TNRC6A, ZFAND5, PNPT1, IPPK, CCDC142, KCNK2, SAR1B, RRAGD, HNRNPAB, ADPGK, GABRB2, NF2,
ARHGEF3, RAGE, PLAG1, ZNF805, NSUN4, ZNF573, 41525, FKBP5, E2F7, EDAR, CXorB6, JRK, CHM, HOOK3, RALGPSl, GREBl, CACNA1E, LHX8, TRIM67,
TMEM120B, LENEP, MEF2D, ZNF709, FLJ36031 , TD02, PHIP, CLIC2, SAMD12, BEND7, BRPF3, HNMT, PSMC2, PHTF2, MFSD6L, CCNE2, CEP44, CDC 14 A, TFG, ZNF793, ANKRD36B, SAMD13, TOB2, ZC3HAV1L, DCLK1, MECP2, CLDN11, Clorfl06, VAMP2, PEX5, BCLAF1, ASB11, WDR26, KSR2, RLIM, USP38, YIPF6, NEK7, CEP85, TFRC, FAM59A, PPP1R2, TRPSl, CLIPl, DRAM1, ARL8A, LRRK2, UBXN2A, PDX1, KIAA0895, PPP2CA, ACTR10, UCP3, ZNF566, ABHD5, TBL1XR1, PSIP1, DNA2, CHSY1, MYSM1, EIF5A2, GOLPH3L, SLC9A6, LARP1B, TRIM2, GABRA6, PAPD4, PAN3, SYDE2,
FNDC3B, AKR1D1, GPR180, TMEM194B, PCDH11X, RDHl l, RFX7, SLC35F1, MGAT4A, SLC11A2, C9orfl50, GDAP2, CLYBL, TNFSF13B, NDUFA4, IGF1, CMTM4, CMTM6, SUZ12, C20orfl94, NCOA3, PAPD5, FBXO40, AQPEP, NDST3, PCOLCE2, SMAD9, CRIPT, GABRA4, SRSF7, MSN, LY75, ZNF624, UGT2A3, FXRl, EIF2C4, SUSD5, ADCYl, CDKL2, TRIM36, ARFGAP2, ZNF238, AAK1, OTOR, ALS2CR8, SLC1A2, BRWD1, SLC25A3, MATN1, SLAIN 1, C10orfl40, TSC1, MDM4, RPS6KA5, MDFIC, SECISBP2L, HSPC159, FMRl, GJAl, CHSTl, MYBLl, IRFl, SBF2, JARID2, PCDHB4, MBD2, PRKAA2, ANGEL2, SYT6, RNF38, MTMR10, LDLR, KCNJ10, TRIM23, DSEL, FAM35A, UBA3, ESYT3, SPICE1, SATB2, SYT1, DLL1, LGR4, PDE7A, KIAA0889, MET, FGD6, LRPAP1, CCDC50, KLF6, KLRD1, COL4A4, FAM123B, LYST, PRUNE2, AFF4, RHOBTBl, ZBTB11, STRN3, PPP1R9A, GAN, CACNB4, KIAA2026, TESK2, DNAJC27, KIAA1370, ELL2, TMPO, GALNT3, REST, CACNG8, CHST2, WTH3DI, TRDMTl, ZNF828, CELSR3, SDAD1, YAF2, ZFPM2, SLC9A8, AFFl, IL17RD, PLEKHG2, KCNIPl, GNA13, PRR20A, PRR20B, PRR20C, PRR20D, PRR20E, PCSK6, SYNC, SNX18, CLIC4, ABCA13, BTBD7, ANKRD40, ZNF644, TAX1BP1, CMKLR1, TC2N, ELOVL7, ERI2, PANX2, PDE4D, ZNF599, ZNF264, EFHC2, CALM3, DNAH14, ZNF492, CSMD1, NAALADL2, AN06, CD302, LY75-CD302, SCN9A, RTKN2, NR3C1, YTHDC2, KIF2A, RNF141, RPGR, ZMYM6, PABPC4L, KCNQ3, GRB2, TCTEX1D1, ZMYM2, CAB39L, SSH1, LPP, CXorf57, DDX58, NCOA7, CHIC1, PRLR, VPS13B, OAS2, FRMD6, CLK4, KIAA0528, THAP2, DUSP9, KLHL29, CCDC149, LRCH1, GPR183, SEC61A2, PTGFRN, CENPBD1, RIMBP2, ZNF197, ZNF597, VDAC1, SASS6, TMEM135, SPTBN1, EPB41L4B, PDZD2, IDE, NSF, PIK3C2A, USP28, AKAP7, TSGA10, RNF144B, C20orfl77, SIN3B, EGLN3, RFX6, CHMP2B, Clorfl73, SLC35C1, DPY19L1, ZFAND1, ARSJ, CDS1, FBXW7, ARHGEF26, WDR35, MAP2K4, TMEM184A, NRK, LRRCCl, PRDM2, SNX4, RGS6, CDKNIB, CXCL12, IFRDl, ARHGEF38, TCF12, OSTMl, ZNF181, APOLD1, C6, GABRA1, BEAN1, LBR, LRRC19, HECTD2, PHACTR4, KIT, VGLL4, RAB18, WSB2, 41531, SOD2, PAIP1, CPEB3, TP53BP2, NAP1L5, DNAAF1, NBPF3, SPG20, ZNF25, CYP4X1, CCDC126, FBX047, MIS12, CFHR5, KIAA1731,
DNAJC6, IRX5, CBWD1, CBWD5, CBWD3, CBWD6, PANK3, NGRN, PLXNC1, CBWD2, KIF20A, PCMTD1, ATPBD4, DCUN1D1, MRPS7, CLVS2, LRRTM2, STMN1, ETV3, AP3B2, GDF9, PPP3R1, RIMS3, DCAF12, TMSB15B, CAPN7, INPP4B, Cl lorf41, ZNF652, NDUFAl, DMRT3, CCDC64, EML6, AGTPBPl, IL17RB, PLEKHA2, MRAP2, RFX8, KDR, NTF3, LGI2, FAM38B, SCD5, MYNN, C18orf56, ADRB1, S1PR1, BMPR2, STEAP2, ABCC3, FAM116A, RORA, MON2, PRICKLE2, IMPDH1, TMF1, PKHD1L1, SNAPC1, DYNC2H1, RB1CC1, PTAR1, TMPRSS11D, NETOl, KCNK10, RHPN2, SLC25A15, OSBPL3, FIGN, FLT1, ZNF124, SLC25A24, CTDSPL, PRPF18, ZNF845, SYN2, CREBL2, REPS2, NFE2L3, ZNF680, GRHLl, MCTPl, ZNF425, TMEM97, INF2, EDEM1, ONECUT2, CD69, NOX4, PHLPP2, KLF4, PLAC4, C5or£22, C2orf63, Clorf226, KIAA1919, SLC4A4, KBTBD8, TTC39A, C14orf28, ARHGEF38, CDC25A, RRAGD, REST, C2CD2, C2CD4A, CTDSPL, C20orfl94, SMARCA5, SYN2, ZNF845, NOX4, or a combination thereof.
7. The method of claim 1, 5, or 6 wherein the polynucleotide is a double stranded RNA.
8. The method of claim 1, 5, or 6 wherein the polynucleotide is a microRNA.
9. The method of claim 1 , 5, or 6 wherein the polynucleotide is a microRNA inhibitor.
10. The method of claim 1, 5, or 6 wherein the human cell is in vivo.
11. The method of claim 1 , 4, or 5 wherein the member of the Orthomyxoviridae is a member of the genus Influenzavirus A or a member of the genus Influenzavirus B.
12. The method of claim 1 or 6 wherein the member of the Paramyxoviridae is human respiratory syncytial virus.
13. The method of claim 1, 5, or 6 wherein viral replication in a cell is decreased by at least 0.5% compared to a control cell that does not comprise the polynucleotide.
14. The method of claim 1, 5, or 6 wherein viral replication in a cell is increased by at least 0.5% compared to a control cell that does not comprise the polynucleotide.
15. The method of claim 1, 5, or 6 wherein the amount of the polypeptide in the cell is decreased by at least 5% compared to a control cell that does not comprise the polynucleotide
16. The method of claim 1, 5, or 6 wherein the amount of the polypeptide in the cell is increased by at least 5% compared to a control cell that does not comprise the polynucleotide
17. A method for decreasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide decreases viral replication in the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Orthomyxoviridae, wherein the polynucleotide comprises a mature microRNA selected from miR-1254, miR-1272, miR-124a, miR-124*, or a combination thereof.
18. A method for decreasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide decreases viral replication in the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Paramyxoviridae, wherein the polynucleotide comprises a mature microRNA selected from miR-668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR-190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR- 744, miR-942, miR-lOb*, miR-150, miR-124*, miR-17-3p, miR-3944, miR-135a, miR-30d*, miR-876-5p, miR-873, miR-625, miR-520h, miR-491, miR-1234, miR-628, miR-558, miR-544, miR-376a, miR-487b, miR-410, miR-208b, or a combination thereof.
19. A method for decreasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide decreases viral replication in the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Orthomyxoviridae, wherein the polynucleotide comprises a microRNA inhibitor that inhibits a microRNA selected from miR-17-5p, miR-106b, miR-106b*, miR-34c, or a combination thereof.
20. A method for decreasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide decreases viral replication in the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Paramyxoviridae, wherein the polynucleotide comprises a microRNA inhibitor that inhibits a microRNA selected from miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681*, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, miR- 18a* , or a combination thereof.
21. A method for increasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide increases viral replication in the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Orthomyxoviridae, wherein the polynucleotide comprises a mature microRNA selected from miR-17-5p, miR- 106b, miR-106b*, miR-34c, or a combination thereof.
22. A method for increasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide increases viral replication in the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Paramyxoviridae, wherein the polynucleotide comprises a mature microRNA selected from miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663-3p, miR3681, miR3940, miR3614-5p, miR3681*, miR3115, miR3663-5p, miR1273e, miR3136, miR193a, miR-18a*, or a combination thereof.
23. A method for increasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide increases viral replication in the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Orthomyxoviridae, wherein the polynucleotide comprises a microRNA inhibitor that inhibits a microRNA selected from miR-1254, miR-1272, miR-124a, miR-124*, or a combination thereof.
24. A method for increasing viral replication in a cell comprising:
administering to a human cell an effective amount of a polynucleotide, wherein the polynucleotide increases viral replication in the cell, wherein the cell comprises a virus or is at risk of infection by a virus, the virus selected from a member of the family Paramyxoviridae, wherein the polynucleotide comprises a microRNA inhibitor that inhibits a microRNA selected from miR-668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR-154, miR- 190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR-744, miR-942, miR-10b*, miR-150, miR-124*, miR-17-3p, miR- 3944, miR-135a, miR-30d*, miR-876-5p, miR-873, miR-625, miR-520h, miR-491, miR-1234, miR-628, miR-558, miR-544, miR-376a, miR-487b, miR-410, miR-208b, or a combination thereof.
25. The method of claim 17, 18, 19, 20, 21, 22, 23, or 24 wherein the administering comprises administering a polynucleotide that encodes the microRNA or the microRNA inhibitor.
26 The method of claim 25 wherein the polynucleotide that encodes the microR A or the microRNA inhibitor is a vector.
27. The method of claim 17, 18, 19, 20, 21, 22, 23, or 24 wherein the administering comprises administering the microRNA or the microRNA inhibitor.
28. The method of claim 17, 19, 21, or 23 wherein the member of the Orthomyxoviridae is a member of the genus Influenzavirus A or a member of the genus Influenzavirus B.
29. The method of claim 18, 20, 22, or 24 wherein the member of the Paramyxoviridae is human respiratory syncytial virus.
30. The method of claim 17, 18, 19, or 20 wherein viral replication in a cell is decreased by at least 0.5% compared to a control cell that does not comprise the polynucleotide.
31. The method of claim 21, 22, 23, or 24 wherein viral replication in a cell is increased by at least 0.5% compared to a control cell that does not comprise the polynucleotide.
32. An ex vivo cell produced by the method of claim 17, 18, 19, 20, 21, 22, 23, or 24.
33. A method for treating a subject comprising administering to the subject a composition comprising an effective amount of the polynucleotide of claim 1, wherein the subject has or is at risk of developing a viral infection by a virus selected from a member of the family
Orthomyxoviridae or a member of the family Paramyxoviridae.
34. A method for treating a subject comprising administering to the subject a composition comprising an effective amount of the polynucleotide of claim 4, 17, or 19, wherein the subject has or is at risk of developing a viral infection by a virus selected from a member of the family Orthomyxoviridae.
35. A method for treating a subject comprising administering to the subject a composition comprising an effective amount of the polynucleotide of claim 18 or 20, wherein the subject has or is at risk of developing a viral infection by a virus selected from a member of the family Paramyxoviridae.
36. The method of claim 33, 34, or 35 wherein the subject is a human
37. The method of claim 33, 34, or 35 wherein the composition is administered to tissues of the respiratory tract.
38. The method of claim 33, 34, or 35 wherein the subject has a viral infection, and at least one sign of a viral infection is reduced.
39. The method of claim 33, 34, or 35 wherein the polynucleotide is a double stranded RNA.
40. The method of claim 33, 34, or 35 wherein the polynucleotide is a microRNA.
41. The method of claim 34 wherein the polynucleotide comprises a mature microRNA selected from miR-1254, miR-1272, miR-124a, miR-124*, or a combination thereof.
42. The method of claim 35 wherein the polynucleotide comprises a mature microRNA selected from miR-668, miR-509-3p, miR-801, miR-154*, miR-184, miR-18a, miR-127-5p, miR-124a, miR-589, miR-193a, miR-212, miR-218-2*, miR-877, miR-520b, hsa-let-7g, miR- 154, miR-190b, miR-548b-5p, miR-602, miR-129-3p, miR-944, miR-9, miR-765, miR-518b, miR-1236, miR-100*, miR-515-5p, miR-744, miR-942, miR-lOb*, miR-150, miR-124*, miR- 17-3p, miR-3944, miR-135a, miR-30d*, miR-876-5p, miR-873, miR-625, miR-520h, miR-491, miR-1234, miR-628, miR-558, miR-544, miR-376a, miR-487b, miR-410, miR-208b, or a combination thereof.
43. The method of claim 33 or 34 wherein the member of the Orthomyxoviridae is a member of the genus Influenzavirus A or a member of the genus Infl enzavirus B.
44. The method of claim 33 or 34 wherein the member of the Paramyxoviridae is human respiratory syncytial virus.
45. A genetically modified cell comprising the polynucleotide of claim 5, 21, or 23, wherein a virus selected from a member of the family Orthomyxoviridae has increased replication in the cell when compared to replication of the virus in a control cell.
46. The genetically modified cell of claim 45 wherein the genetically modified cell comprises a member of the family Orthomyxoviridae.
47. The genetically modified cell of claim 46 wherein the virus is a member of the genus Influenzavirus A or a member of the genus Influenzavirus B,
48. A genetically modified cell comprising the polynucleotide of claim 6, 22, or 24, wherein a virus selected from a member of the family Paramyxoviridae has increased replication in the cell when compared to replication of the virus in a control cell.
49. The genetically modified cell of claim 48 wherein the member of the Paramyxoviridae is a member of the genus Pneumovirus.
50. The genetically modified cell of claim 49 wherein the virus is human respiratory syncytial virus.
51. The genetically modified cell of claim 45 wherein the polynucleotide comprises a mature microRNA selected from m miR-2116*, miR3922, miR3119, miR3928, miR3929, miR4321, miR4253, miR3670, miR4271, miR4324, miR3656, miR3654, miR4319, miR3119, miR3650, miR2117, miR3671, miR4322, miR3653, miR4317, miR550b, miR3662, miR3124, miR3663- 3p, miR3681, miR3940, miR3614-5p, miR3681 *, miR3115, miR3663-5p, miR1273e, miR3136, miRl 93 a, miR- 18a* , or a combination thereof.
52. The genetically modified cell of claim 46 wherem the polynucleotide comprises a mature microR A selected from miR-1254, miR-1272, miR-124a, miR-124*, or a combination thereof.
53. A method for producing virus comprising:
providing the genetically modified cell of claim 45, wherein the genetically modified cell comprises a virus that is a member of the family Orthomyxoviridae; and
incubating the genetically modified cell under conditions suitable for the production of virus by the cell.
54. A method for producing virus comprising:
providing the genetically modified cell of claim 48, wherein the genetically modified cell comprises a virus that is a member of the family Paramyxoviridae; and
incubating the genetically modified cell under conditions suitable for the production of virus by the cell.
55. The method of claim 53 or 54 further comprising harvesting the virus produced by the genetically modified cell.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201261641664P | 2012-05-02 | 2012-05-02 | |
| US61/641,664 | 2012-05-02 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2013166264A2 true WO2013166264A2 (en) | 2013-11-07 |
| WO2013166264A3 WO2013166264A3 (en) | 2014-01-16 |
Family
ID=49515035
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2013/039234 Ceased WO2013166264A2 (en) | 2012-05-02 | 2013-05-02 | Methods for altering virus replication |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2013166264A2 (en) |
Cited By (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017007784A1 (en) * | 2015-07-06 | 2017-01-12 | University Of Georgia Research Foundation | Methods and compositions related to increased influenza virus production |
| WO2017088018A1 (en) * | 2015-11-24 | 2017-06-01 | Commonwealth Scientific And Industrial Research Organisation | Production of viruses in cell culture |
| WO2017216391A1 (en) | 2016-06-17 | 2017-12-21 | F. Hoffmann-La Roche Ag | Papd5 and papd7 inhibitors for treating a hepatitis b infection |
| CN110261611A (en) * | 2019-06-14 | 2019-09-20 | 上海四核生物科技有限公司 | Application of ZNF709 protein as a serum biomarker for gastric cancer and its kit |
| US10907133B2 (en) | 2015-11-24 | 2021-02-02 | Commonwealth Scientific And Industrial Research Organisation | Production of viruses in avian eggs |
| US10953034B2 (en) | 2017-10-16 | 2021-03-23 | Hoffmann-La Roche Inc. | Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection |
| CN113166776A (en) * | 2019-01-04 | 2021-07-23 | 嘉吉公司 | Engineered nucleases for generating mutations in plants |
| US11279929B2 (en) | 2018-07-03 | 2022-03-22 | Hoffmann-La Roche, Inc. | Oligonucleotides for modulating Tau expression |
| WO2022119560A1 (en) * | 2020-12-01 | 2022-06-09 | National Health Research Institutes | Cell strain having increased virus production ability and production method thereof |
| US11479802B2 (en) | 2017-04-11 | 2022-10-25 | Regeneron Pharmaceuticals, Inc. | Assays for screening activity of modulators of members of the hydroxy steroid (17-beta) dehydrogenase (HSD17B) family |
| US11485958B2 (en) | 2017-01-23 | 2022-11-01 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| JP2023514576A (en) * | 2020-02-14 | 2023-04-06 | ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー | Pan-genetic agents against respiratory viruses and methods of using them |
| US11702700B2 (en) | 2017-10-11 | 2023-07-18 | Regeneron Pharmaceuticals, Inc. | Inhibition of HSD17B13 in the treatment of liver disease in patients expressing the PNPLA3 I148M variation |
| CN118236389A (en) * | 2024-05-28 | 2024-06-25 | 南京晖丽生物科技有限公司 | Application of miR-3120 in the preparation of a pharmaceutical composition for preventing and treating tumors and tumor cachexia |
| EP4355429A4 (en) * | 2021-06-16 | 2025-04-09 | Empirico Inc. | TREATMENT OF MST1-RELATED DISEASES AND DISORDERS |
| US12359201B2 (en) | 2018-03-21 | 2025-07-15 | Regeneron Pharmaceuticals, Inc. | 17ß-hydroxysteroid dehydrogenase type 13 (HSD17B13) iRNA compositions and methods of use thereof |
| EP4603586A1 (en) * | 2024-02-16 | 2025-08-20 | Universität zu Lübeck | Inhibitory oligonucleotides against adamts7 |
| CN120789265A (en) * | 2025-09-05 | 2025-10-17 | 中国人民解放军军事科学院军事医学研究院 | Application of miRNA in preventing or treating postoperative atrial fibrillation diseases |
| US12522827B2 (en) | 2016-03-02 | 2026-01-13 | The Board Of Trustees Of The Leland Stanford Junior University | Pan-genotypic agents against influenza virus and methods of using the same |
| US12618063B2 (en) | 2024-07-16 | 2026-05-05 | The Board Of Trustees Of The Leland Stanford Junior University | Pan-genotypic agents against influenza virus and methods of using the same |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002057461A2 (en) * | 2001-01-18 | 2002-07-25 | Bayer Aktiengesellschaft | Regulation of human adam-ts-like zinc metalloprotease |
| US7485468B2 (en) * | 2004-10-15 | 2009-02-03 | Galapagos Bv | Molecular targets and compounds, and methods to identify the same, useful in the treatment of joint degenerative and inflammatory diseases |
| EP2461745A2 (en) * | 2009-08-05 | 2012-06-13 | University Of South Florida | Method of rapidly visualizing essential neural pathways |
| WO2012045067A2 (en) * | 2010-10-01 | 2012-04-05 | Zirus, Inc. | Mammalian genes involved in infection |
-
2013
- 2013-05-02 WO PCT/US2013/039234 patent/WO2013166264A2/en not_active Ceased
Cited By (42)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017007784A1 (en) * | 2015-07-06 | 2017-01-12 | University Of Georgia Research Foundation | Methods and compositions related to increased influenza virus production |
| US20180273908A1 (en) * | 2015-07-06 | 2018-09-27 | University Of Georgia Research Foundation | Methods and compositions related to increased influenza virus production |
| US10883086B2 (en) | 2015-07-06 | 2021-01-05 | University Of Georgia Research Foundation, Inc. | Methods and compositions related to increased influenza virus production |
| EP3319632A4 (en) * | 2015-07-06 | 2019-05-29 | University of Georgia Research Foundation Inc. | METHODS AND COMPOSITIONS ASSOCIATED WITH INCREASING INFLUENZA VIRUS PRODUCTION |
| US10626379B2 (en) | 2015-11-24 | 2020-04-21 | Commonwealth Scientific And Industrial Research Organisation | Production of viruses in cell culture |
| US12054750B2 (en) | 2015-11-24 | 2024-08-06 | Commonwealth Scientific And Industrial Research Organisation | Production of viruses in cell culture |
| WO2017088018A1 (en) * | 2015-11-24 | 2017-06-01 | Commonwealth Scientific And Industrial Research Organisation | Production of viruses in cell culture |
| US10907133B2 (en) | 2015-11-24 | 2021-02-02 | Commonwealth Scientific And Industrial Research Organisation | Production of viruses in avian eggs |
| US11118166B2 (en) | 2015-11-24 | 2021-09-14 | Commonwealth Scientific And Industrial Research Organisation | Production of viruses in avian eggs |
| US11174466B2 (en) | 2015-11-24 | 2021-11-16 | Commonwealth Scientific And Industrial Research Organisation | Production of viruses in cell culture |
| US12522827B2 (en) | 2016-03-02 | 2026-01-13 | The Board Of Trustees Of The Leland Stanford Junior University | Pan-genotypic agents against influenza virus and methods of using the same |
| WO2017216390A1 (en) | 2016-06-17 | 2017-12-21 | F. Hoffmann-La Roche Ag | Nucleic acid molecules for reduction of papd5 or papd7 mrna for treating hepatitis b infection |
| EP4219767A1 (en) | 2016-06-17 | 2023-08-02 | F. Hoffmann-La Roche AG | Papd5 and papd7 inhibitors for treating a hepatitis b infection |
| WO2017216391A1 (en) | 2016-06-17 | 2017-12-21 | F. Hoffmann-La Roche Ag | Papd5 and papd7 inhibitors for treating a hepatitis b infection |
| US11534452B2 (en) | 2016-06-17 | 2022-12-27 | Hoffmann-La Roche Inc. | Nucleic acid molecules for reduction of PAPD5 or PAPD7 mRNA for treating hepatitis B infection |
| US11191775B2 (en) | 2016-06-17 | 2021-12-07 | Hoffmann-La Roche Inc. | PAPD5 and PAPD7 inhibitors for treating a hepatitis B infection |
| US11845963B2 (en) | 2017-01-23 | 2023-12-19 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| US11753628B2 (en) | 2017-01-23 | 2023-09-12 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| US11485958B2 (en) | 2017-01-23 | 2022-11-01 | Regeneron Pharmaceuticals, Inc. | HSD17B13 variants and uses thereof |
| US11479802B2 (en) | 2017-04-11 | 2022-10-25 | Regeneron Pharmaceuticals, Inc. | Assays for screening activity of modulators of members of the hydroxy steroid (17-beta) dehydrogenase (HSD17B) family |
| US11702700B2 (en) | 2017-10-11 | 2023-07-18 | Regeneron Pharmaceuticals, Inc. | Inhibition of HSD17B13 in the treatment of liver disease in patients expressing the PNPLA3 I148M variation |
| US12286677B2 (en) | 2017-10-11 | 2025-04-29 | Regeneron Pharmaceuticals, Inc. | Inhibition of HSD17B13 in the treatment of liver disease in patients expressing the PNPLA3 I148M variation |
| US10953034B2 (en) | 2017-10-16 | 2021-03-23 | Hoffmann-La Roche Inc. | Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection |
| US11484546B2 (en) | 2017-10-16 | 2022-11-01 | Hoffman-La Roche Inc. | Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection |
| US12303525B2 (en) | 2017-10-16 | 2025-05-20 | Hoffman-La Roche Inc. | Nucleic acid molecule for reduction of PAPD5 and PAPD7 mRNA for treating hepatitis B infection |
| US12359201B2 (en) | 2018-03-21 | 2025-07-15 | Regeneron Pharmaceuticals, Inc. | 17ß-hydroxysteroid dehydrogenase type 13 (HSD17B13) iRNA compositions and methods of use thereof |
| US11753640B2 (en) | 2018-07-03 | 2023-09-12 | Hoffmann-La Roche Inc. | Oligonucleotides for modulating Tau expression |
| US11279929B2 (en) | 2018-07-03 | 2022-03-22 | Hoffmann-La Roche, Inc. | Oligonucleotides for modulating Tau expression |
| US12163131B2 (en) | 2018-07-03 | 2024-12-10 | Hoffmann-La Roche Inc. | Oligonucleotides for modulating Tau expression |
| CN113166776A (en) * | 2019-01-04 | 2021-07-23 | 嘉吉公司 | Engineered nucleases for generating mutations in plants |
| CN110261611A (en) * | 2019-06-14 | 2019-09-20 | 上海四核生物科技有限公司 | Application of ZNF709 protein as a serum biomarker for gastric cancer and its kit |
| CN110261611B (en) * | 2019-06-14 | 2021-06-22 | 上海四核生物科技有限公司 | Application of ZNF709 protein as a serum biomarker for gastric cancer and its kit |
| JP2023514576A (en) * | 2020-02-14 | 2023-04-06 | ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー | Pan-genetic agents against respiratory viruses and methods of using them |
| WO2022119560A1 (en) * | 2020-12-01 | 2022-06-09 | National Health Research Institutes | Cell strain having increased virus production ability and production method thereof |
| EP4355429A4 (en) * | 2021-06-16 | 2025-04-09 | Empirico Inc. | TREATMENT OF MST1-RELATED DISEASES AND DISORDERS |
| EP4643948A3 (en) * | 2021-06-16 | 2026-04-01 | Empirico Inc. | Treatment of mst1 related diseases and disorders |
| EP4603586A1 (en) * | 2024-02-16 | 2025-08-20 | Universität zu Lübeck | Inhibitory oligonucleotides against adamts7 |
| WO2025172551A1 (en) * | 2024-02-16 | 2025-08-21 | Universität Zu Lübeck | Inhibitory oligonucleotides against adamts7 |
| CN118236389A (en) * | 2024-05-28 | 2024-06-25 | 南京晖丽生物科技有限公司 | Application of miR-3120 in the preparation of a pharmaceutical composition for preventing and treating tumors and tumor cachexia |
| US12618063B2 (en) | 2024-07-16 | 2026-05-05 | The Board Of Trustees Of The Leland Stanford Junior University | Pan-genotypic agents against influenza virus and methods of using the same |
| CN120789265A (en) * | 2025-09-05 | 2025-10-17 | 中国人民解放军军事科学院军事医学研究院 | Application of miRNA in preventing or treating postoperative atrial fibrillation diseases |
| CN120789265B (en) * | 2025-09-05 | 2026-01-30 | 中国人民解放军军事科学院军事医学研究院 | Application of miRNA in preventing or treating postoperative atrial fibrillation diseases |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2013166264A3 (en) | 2014-01-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2013166264A2 (en) | Methods for altering virus replication | |
| Li et al. | Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells | |
| US8933046B2 (en) | Influenza targets | |
| EP2954055B1 (en) | Cell lines for virus production and methods of use | |
| Zhao et al. | Identification of cellular microRNA-136 as a dual regulator of RIG-I-mediated innate immunity that antagonizes H5N1 IAV replication in A549 cells | |
| Parrish et al. | piRNAs derived from ancient viral processed pseudogenes as transgenerational sequence-specific immune memory in mammals | |
| Umbach et al. | Influenza A virus expresses high levels of an unusual class of small viral leader RNAs in infected cells | |
| Liang et al. | Identification of Ebola virus microRNAs and their putative pathological function | |
| Jia et al. | Cellular microRNA miR-26a suppresses replication of porcine reproductive and respiratory syndrome virus by activating innate antiviral immunity | |
| Haasnoot et al. | RNAi and cellular miRNAs in infections by mammalian viruses | |
| US20130115683A2 (en) | Method for the preparation of a pharmaceutical composition | |
| Samir et al. | MicroRNAs in the host response to viral infections of veterinary importance | |
| Szabat et al. | RNA secondary structure as a first step for rational design of the oligonucleotides towards inhibition of influenza a virus replication | |
| Shi et al. | Novel microRNA‐like viral small regulatory RNAs arising during human hepatitis A virus infection | |
| Shen et al. | Altered viral replication and cell responses by inserting microRNA recognition element into PB1 in pandemic influenza A virus (H1N1) 2009 | |
| US10219492B2 (en) | Compounds and methods for altering RSV replication rate | |
| Bamunuarachchi et al. | Interplay between host non-coding RNAs and influenza viruses | |
| Zhang et al. | Downregulation of miR-122 by porcine reproductive and respiratory syndrome virus promotes viral replication by targeting SOCS3 | |
| Deffrasnes et al. | Inhibition of human metapneumovirus replication by small interfering RNA | |
| Zhou et al. | MicroRNA profile analysis of host cells before and after wild human rotavirus infection | |
| CN101880677B (en) | siRNA sequence against 2009 new influenza A virus polymerase gene and nucleoprotein gene and application thereof | |
| Ferreira et al. | Inhibition of avian metapneumovirus (AMPV) replication by RNA interference targeting nucleoprotein gene (N) in cultured cells | |
| Owolabi et al. | Processing of genomic RNAs by Dicer in bat cells limits SARS-CoV-2 replication | |
| Hartawan et al. | Improving siRNA design targeting nucleoprotein gene as antiviral against the Indonesian H5N1 virus | |
| Saengchoowong | Enhanced propagation yield of influenza viruses for vaccine production through cellular microRNAs regulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13785192 Country of ref document: EP Kind code of ref document: A2 |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 13785192 Country of ref document: EP Kind code of ref document: A2 |





















