WO2013159710A1

WO2013159710A1 - Method for improving xylose consumption rate of clostridium beijerinckii

Info

Publication number: WO2013159710A1
Application number: PCT/CN2013/074670
Authority: WO
Inventors: 杨晟; 肖晗; 顾阳; 李治林; 蒋宇; 陈军; 董枫; 姜卫红
Original assignee: 中国科学院上海生命科学研究院; 上海工业生物技术研发中心
Priority date: 2012-04-25
Filing date: 2013-04-25
Publication date: 2013-10-31
Also published as: CN103374542B; CN103374542A

Abstract

Provided is a method for improving the xylose consumption rate of Clostridium beijerinckii. By knocking out a transcription regulation factor xylR of Clostridium beijerinckii, knocking out araR of Clostridium beijerinckii and/or enhancing the activity of xylose transport protein, a higher concentration of xylose and/or arabinose in a culture medium can be used up by Clostridium beijerinckii, with a higher concentration of products being produced, such as ethanol, acetone and butanol.

Description

Method for improving xylose consumption rate of Clostridium beijerinckii

The present invention is in the field of genetic engineering technology and, in particular, relates to a method for increasing the consumption rate of xylose and/or arabinose of C. beijerinckii. Background technique

Due to the limited nature of petroleum resources and the volatility of international crude oil prices, the use of renewable resources to produce bioenergy has received widespread attention from countries around the world. Butanol is expected to become a new generation of biofuels in the future due to its excellent combustion characteristics and better storage and transportation characteristics than ethanol. Since the Second World War, with the development of the petroleum industry, bio-butanol fermentation has been stagnant due to its high raw material cost, and with the rising food prices in recent years and the formulation of relevant national food security strategies, The production of fuel butanol by grain fermentation has been severely restricted.

Clostridium beijerinckii is one of the four Clostridium strains that can ferment to produce butanol [1], which produces butanol, acetone, ethanol and a small amount of acetic acid and butyric acid during fermentation [2]. In addition to the use of glucose, Clostridium beijerii can also utilize a variety of carbon sources such as xylose, fructose, galactose, and glucose alcohol [3]. Since glucose and xylose are the main components after hydrolysis of cellulose and hemicellulose, respectively, Clostridium beijerincii can utilize cellulose and hemicellulose hydrolyzate as raw materials for biobutanol fermentation. Cellulose and hemicellulose account for more than 50% of the plant's carbon in nature. The use of cellulose and hemicellulose hydrolyzate for biobutanol fermentation is expected to significantly reduce raw material costs. Unlike many other bacteria, Clostridium beijerinckii can successfully metabolize five-carbon sugars such as xylose in the presence of glucose, indicating that there is no carbon catabolite repression (CCR). However, whether it is glucose or xylose fermentation, the bacteria have a low sugar consumption rate [4], which is particularly evident in xylose fermentation. Therefore, increasing the xylose consumption rate has become one of the key technologies for the application of lignocellulose raw materials to acetone butanol fermentation of Clostridium beijerinckii.

Clostridium beijerincii is a Gram-positive bacterium with a GC content of 30%. Complete genome sequencing in 2007 (http://www.ncbi.nlm.nih.gov/nuccore/CP000721), which contains predicted xylose transcription The xylR gene of the regulatory protein, which is available in the NCBI Nucleic Acid Database under the accession number gi: 149903712. Gram Among the positive bacteria, XylR negatively regulates the transcription of xylose metabolism genes [5, 6]. It has been reported that knocking out xylR can enhance the enzyme activity of xylose metabolism-related genes in mutant strains in the presence of low-concentration xylose [7], but when xylose concentration is high, xylR-deficient strains are involved in the xylose metabolism-related genes. Live and wild type are at a considerable level, and negative transcriptional regulation of xylR can be completely abolished [8, 9]. For example, in another Solvent-producing Clostridium acetobutylicum C/^tr w acetobMty/i'oim ATCC 824, knocking out xylR (CAC3673) did not increase the xylose of the strain at higher xylose concentrations. The consumption rate indicates that XylR has no research value in the transformation of the xylose metabolic pathway of the strain. Xylose metabolism catalyzed by xylose isomerase in microorganisms mainly includes: 1) xylose transports from extracellular to intracellular via transporters; 2) intracellular xylose through two steps (xylose isomerase and xylulokinase) The catalytic reaction produces 5-phosphate-xylulose; 3) 5-phospho-xylulose enters the pentose phosphate pathway for metabolism, and the final metabolic flux enters the glycolysis pathway. In Clostridium beijerinckii, there are no studies on xylose or arabinose metabolic pathways and regulatory genes. Summary of the invention

It is an object of the present invention to provide a method for increasing the consumption rate of xylose and/or arabinose of Clostridium beijerincii, thereby efficiently utilizing glucose-xylose or glucose-xylose-arabinose fermentation in a hydrolyzate to produce butanol, Acetone and ethanol.

The present invention achieves by inhibiting the expression of the xylR gene of Clostridium beijerinckii, inhibiting the expression of the araR gene and/or enhancing the activity of the xylose transporter.

According to a preferred embodiment of the present invention, an exogenous DNA fragment is inserted into the araR gene of Clostridium beijerincii by inserting an exogenous DNA fragment into the Xylerbium hanseii xylR gene to allow expression of the araR gene to be The present invention can be achieved by inhibiting, and/or overexpressing, the xylT gene (e.g., introducing pIMP1-ptb-xylT).

Still another object of the present invention is to provide a recombinant strain of C. beijerincki having its xylR gene expression suppressed, araR gene expression inhibited and/or its xylT gene overexpressed.

According to a preferred embodiment of the present invention, the exogenous DNA fragment has been inserted into the xyl gene of the genome of the recombinant strain of Clostridium botulinum, and the exogenous DNA fragment and/or the overexpressed xylT gene have been inserted into the ara gene.

Still another object of the present invention is to provide an application of the recombinant strain for efficiently utilizing glucose-xylose or glucose-xylose-arabinose mixed sugar to produce butanol, acetone and ethanol. Still another object of the present invention is to provide a method for improving the ability of C. beijerinckii to produce butanol, acetone and ethanol by fermentation of glucose-xylose or glucose-xylose-arabinose mixed sugar by inhibiting Bethleb. Bacterial xylR gene expression, inhibition of araR gene expression and / or overexpression of the xylT gene.

The present invention also provides a method of consuming xylose and/or arabinose, the method comprising adding a recombinant strain of Clostridium beijerii described herein to a substance containing xylose and/or arabinose, and is suitable for the strain Fermentation is carried out under fermentation conditions such that xylose and/or arabinose in the substance is consumed.

Accordingly, the present invention provides a method for increasing the xylose and/or arabinose consumption rate of Clostridium beijerincii, which comprises inhibiting the activity of a Clostridium beijerinckii xylR protein and/or the expression of a gene encoding the same, and inhibiting Clostridium beijerinckii The activity of the araR protein and/or the expression of its coding gene and/or increase the activity of the xylose transporter (eg, xylT protein) and/or the expression of its coding gene, thereby increasing the xylose and/or the xylose of Clostridium beijerinckii Arab sugar consumption rate.

The present invention provides a method for preparing a Clostridium beijerincii strain having an increased consumption rate of xylose and/or arabinose, which comprises inhibiting the activity of a Clostridium beijerinckii xylR protein and/or the expression of a gene encoding the same, and inhibiting the Bayesian carboxylate The activity of the araR protein and/or the expression of its coding gene and/or the increase of the activity of the xylose transporter (such as xylT protein) and/or the expression of its coding gene, thereby increasing the consumption rate of xylose and/or arabinose Clostridium beijerii.

The method for improving the xylose and/or arabinose consumption rate of Clostridium beijerinckii or the method for preparing the increased consumption rate of xylose and/or arabinose, including the genetic engineering of Clostridium beijerinckii a step of inhibiting the activity of xylR gene and/or xylR protein of Clostridium beijerinckii relative to wild-type C. beijerinckii, inhibiting the activity of araR gene expression and/or araR protein of Clostridium beijerinckii, and/or overexpression A xylose transporter gene (eg, the xylT gene) and/or an increase in expression or viability of a xylose transporter (eg, xylT protein).

In the method of the present invention for increasing the xylose and/or arabinose consumption rate of Clostridium beijerinckii or the method for preparing an increased rate of consumption of xylose and/or arabinose, by one or a group selected from the group consisting of Inhibition of Clostridium beijerinckii xylR gene expression in a variety of ways: insertion of an exogenous DNA fragment into the xylR gene of the C. beijerinckii genome, knockout of all or part of the xylR gene by homologous recombination, and use of antisense nucleic acid technology Inhibition of expression of the xylR gene; inhibition of the expression of the araR gene of Clostridium beijerincii by one or more selected from the group consisting of: insertion of an exogenous DNA fragment into the araR gene of the Clostridium beijerii genome, knocking by homologous recombination In addition to all or part of the araR gene, and the use of antisense nucleic acid technology to inhibit the expression of araR gene

In another embodiment, inhibition of C. beijerinckii xylR gene expression can be achieved by introducing a xylR gene expression inhibitor. In another embodiment, inhibition of C. beijerinckii araR gene expression can be achieved by introducing an araR gene expression inhibitor.

In a specific embodiment, the sequence of the xylT gene is as shown in SEQ ID NO: 3, or has 90% or more (eg, 95%, 97%, 98% or more) homology to the sequence of SEQ ID NO: Sexual molecule.

Increasing the viability of the xylose transporter (eg, the xylT protein) and/or the expression of its coding gene can be achieved by one or more selected from the group consisting of introducing an additional xylose transporter into the genome of Clostridium beijerinckii, A mutation that increases expression or viability of the xylose transporter is introduced; or an expression vector that transiently expresses a xylose transporter is provided.

In a specific embodiment, the exogenous DNA fragment is inserted into the xylR gene using the targetron technique. In a specific embodiment, the inserted exogenous DNA fragment is from lOObp to 1000 bp in length.

In a specific embodiment, the exogenous DNA fragment is inserted using the plasmid pWJl-xylR.

In a specific embodiment, the exogenous DNA fragment is inserted into the araR gene using the targetron technique. In a specific embodiment, the inserted exogenous DNA fragment is from lOObp to 1000 bp in length.

In a specific embodiment, the exogenous DNA fragment is inserted using the plasmid pWJl-araR.

In a specific embodiment, the overexpression recombinant plasmid vector carries the xylT gene into the strain for expression, and the xylT gene is overexpressed.

In the present invention, the xylT gene encodes an amino acid sequence as shown in SEQ ID NO:41. In a specific embodiment, the xylT gene comprises or consists of the nucleotide sequence set forth in SEQ ID NO:4.

In the present invention, the xylR gene encodes an amino acid sequence as shown in SEQ ID NO:40. In a specific embodiment, the xylR gene comprises or consists of the nucleotide sequence set forth in SEQ ID NO:3.

In a specific embodiment, the overexpressing recombinant plasmid vector comprises a promoter derived from Clostridium acetobutylicum ATCC824 ptb gene and a C. beijerinckii NCIMB 8052 xylT gene.

In a specific embodiment, the overexpressing recombinant plasmid vector is pIMP1-xylT _ptb .

In a specific embodiment, the xylose transporter is a protein derived from xylose-utilizing organisms for xylose transport or a biologically active fragment thereof, or the protein or biologically active fragment thereof is passed through a Or a substitution, deletion or addition of a plurality of amino acid residues to form an amino acid sequence that still functions to transport xylose.

In a specific embodiment, the xylose transporter is encoded by the xylT gene.

In a specific embodiment, the sequence of the xylT gene is as shown in SEQ ID NO: 4, or has 90% or more (eg, 95%, 97%, 98% or more) homology to the sequence of SEQ ID NO: Sexual molecule. In a specific embodiment, the C. beijerinckii is transformed with one or more of the following plasmids: pWJl-xylR (SEQ ID NO: 1), pIMP 1 -ptb-xylT (SEQ ID NO: 2), and pIMP 1 -xylT _thl (SEQ ID NO: 39), which was genetically engineered.

In a specific embodiment, the C. beijerinckii is NCIMB 8052.

The present invention provides a recombinant Clostridium beijerii prepared by the method of the present invention.

In a specific embodiment, the recombinant C. beijerinckii of the present invention is inhibited from xylR gene expression and/or xylR protein activity, araR gene expression and/or araR protein activity compared to wild-type P. acnes. The expression or viability of the inhibitory and/or xylose transporter gene (e.g., xylT gene) overexpression and/or xylose transporter (e.g., xylT protein) is increased.

In a specific embodiment, the recombinant C. beijerinckii is genetically engineered to NCIMB 8052.

In a specific embodiment, the recombinant Clostridium beijerincii is selected from the group consisting of: Clostridium beijerinckii 8052xylR, 8052xylR-xylT _ptb , 8052xylR-xylT _thl , 8052xyl ara , 8052xyl -xylTptb-ara .

In a specific embodiment, an exogenous DNA fragment of from 1 bp to 1000 bp is inserted into the xylR gene of the C. beijerinckii genome.

In a specific embodiment, the exogenous DNA fragment is inserted between the first to the 798th bases of the xylR gene in the C. beijerinckii genome.

In a specific embodiment, the exogenous DNA fragment is inserted between the first to the 171th bases of the xylR gene in the C. beijerinckii genome, or foreign DNA is inserted between the 240th and the 798th positions. Fragment. In a specific embodiment, the exogenous DNA fragment is inserted between the 30th to the 171th base of the xylR gene in the C. beijerinckii genome, or the foreign DNA is inserted between the 787th and 788th positions. Fragment.

In another preferred embodiment, the method comprises the steps of: inserting an exogenous DNA fragment between bases 1 to 1074 of the araR gene; preferably, from position 15 to position 219 of the araR gene Insert a foreign DNA fragment between, or between positions 252 and 1005.

In a specific embodiment, the recombinant C. beijerinckii introduces a recombinant plasmid vector for overexpressing the xylT gene.

In a specific embodiment, the overexpressing recombinant plasmid vector is pIMP1 - xylT _ptb . In a specific embodiment, the recombinant C. beijerinckii is introduced with one or more of the following plasmids to transform the C. beijerinckii: pWJl -xylR (SEQ ID NO: l), pIMP l - xylT _ptb (SEQ ID NO : 2 ) and pIMP 1 -xylT _thl (SEQ ID NO: 39).

The present invention includes recombinant C. beijerincii deposited under the accession number CCTCC M 2012014.

The present invention also provides a method of consuming xylose and/or arabinose, the method comprising: contacting a recombinant Clostridium beijerii of the present invention with a material containing xylose and/or arabinose, and being suitable for the recombination Fermentation is carried out under conditions of fermentation of Clostridium beijerii to consume xylose and/or arabinose in the material.

The present invention also provides a method for preparing butanol, the method comprising: contacting the recombinant Clostridium beijerii of the present invention with a material containing xylose and/or arabinose, and a condition suitable for fermentation of the recombinant Clostridium beijerii Fermentation is carried out to consume xylose and/or arabinose in the material to produce butanol.

The present invention also provides an acetone ethanol butanol fermentation method, the method comprising: contacting the recombinant Clostridium beijerinckii of the present invention with a material containing xylose and/or arabinose, and being suitable for fermentation of the recombinant Clostridium beijerii Fermentation is carried out under the conditions.

In a specific embodiment, the material further contains glucose.

In one embodiment, the material is a xylose material obtained by directly preparing xylose, or a xylose-containing material obtained by fermenting or hydrolyzing a polymer compound.

In a specific embodiment, the xylose-containing material is selected from the group consisting of: a hydrolyzate of cellulose or hemicellulose, grain, cotton, and the like.

The invention also encompasses the use of the genetically engineered C. beijerinckii of the invention in the production of butanol, acetone and/or ethanol. DRAWINGS

Figure 1 A shows the residual sugar content of 3% glucose: 3% xylose XHP2 fermentation 0-72 hr of C. beijerincki NCIMB8052; Figure 1 B shows 3% xylose XHP2 fermentation 0-72 hr of Bayer The residual sugar content of Clostridium NCIMB8052 was tested.

Figure 2 shows the results of gel electrophoresis assay for colony PCR identification of xylR disrupted strains. The template used for WT is C. beijerinckii NCIMB 8052 genome, and the template for xylR mutant is transformant 8052Axyl l -2 , labeled as lkb DNA ladder .

Figure 3 shows the transcriptional analysis of various genes for xylose metabolism in 8052xylR and 8052 cultured in a neutral carbon source. Figure 4 shows the fermentation indexes of 8052xylR and 8052 of 6% xylose XHP2 fermentation 0-8 lhr. A: residual sugar; B: growth curve; C: pH curve; D: butanol and ABE concentration curve.

Figure 5 shows the results of xylose consumption of 8052xylT, 8052-xylT _thl and 8052 fermented by 6% xylose XHP2 for 96 hr.

Figure 6 shows 805 xylose XHP2 fermented at 96 hr for 8052, 8052xyl, 8052xyl -xylT _ptb and

8052xyl -xylT _thl xylose consumption test results.

Figure 7 shows the fermentation indexes of 8052 and 8052xylR- _X ylT _ptb of 5.5% xylose mother liquor XHP2 fermentation 0-72hr. A: residual sugar; B: growth curve; C: pH curve; D: butanol and ABE concentration curve.

Figure 8 shows the sequencing results of the xylR gene inserted into the intron.

Figure 9 shows the structure of a class II intron, into which any DNA fragment can be inserted at the IV domain of the intron.

Figure 10 shows the results of colony PCR identification of xylRaraR disrupted strains. The template used in lane 2 is C. beijerinckii NCIMB 8052 genome, the template of lanes 3-6 is xylRaraR mutant, and lane 1 is lkb DNA ladder.

Figure 11 shows the TargetronTM Gene Knockout using Sigma-Aldrich

The System (TAOlOO) kit performs PCR amplification of the araR-targetron fragment.

Figure 12 shows the results of colony PCR identification of the constructed pWJl-araR recombinant plasmid vector E. coli transformant. Lane Marker is the lkb DNA ladder, and lane 1_9 is the pWJl_araR recombinant plasmid vector transformant to be identified.

Figure 13 shows the results of colony PCR identification of the araR disrupted strain, wherein the template used for lane C is C. beijerinckii NCIMB 8052 genome, the template for lanes 1-12 is the araR mutant genome, and lane M is lkb DNA ladder. detailed description

In the present application, "xylR protein" refers to a protein corresponding to the xylR protein (SEQ ID NO: 40) of NCIMB 8052 in Clostridium beijerinckii. "xylR gene" refers to a gene corresponding to the xylR gene of C. beijerinckii NCIMB 8052 (NCBI Nucleic Acid Database Accession No. gi: 149903712, also see SEQ ID NO: 3) in the genome of Clostridium beijerii (including the genome) Position and corresponding sequence); or a molecule having more than 90%, 95% or more, 97% or more, or 98% or more homology with the xylR gene. "xylT protein" refers to a protein corresponding to the xylT protein of NCIMB 8052 (SEQ ID NO: 41) in C. beijerinckii. "xylT gene" refers to the Clostridium beijerii genome a gene corresponding to the xylT gene of C. beijerinckii NCIMB 8052 (NCBI Nucleic Acid Database Accession No. gi: 149901466, also see SEQ ID NO: 4), including the position in the genome and the corresponding sequence, or with xylT The gene has more than 90%, 95% or more, 97% or more, or 98% or more homologous molecules. It should be understood that there may be some differences between the xylR gene and the xylT gene in different strains of C. beijerinckii, but these xylR genes and xylT genes should all be within the scope of the "xylR gene" and "xylT gene" of the present application; Similarly, there may be some differences between the xylR protein and the xylT protein in different C. beijerinckii, but these xylR proteins and xylR proteins are also included in the scope of the "xylR protein" and "xylT protein" of the present invention.

In the present application, "inhibiting the expression of the xylR gene of Clostridium beijerinckii" may be such that the expression of the xylR gene of C. beijerinckii is decreased, or the protein of the Xylococcus baumannii xylR gene is not expressed or cannot be expressed correctly.

According to one embodiment of the invention, the "inhibition" is achieved by interrupting the expression of the C. beijerinckii xylR gene. This interruption can increase the consumption rate of C. beijerincis. In another embodiment, antisense nucleic acid technology is used to inhibit expression of the xylR gene, and the amount of xylR expression is downregulated.

"Interruption of Clostridium beijerinckii xylR gene expression" can be achieved by inserting an exogenous DNA sequence into the xylR gene or by knocking out part or all of the xylR gene by homologous recombination. Interruption of the C. beijerinckii xylR gene can be achieved by inserting exogenous DNA at any site within the gene using a second class of intron insertion techniques. "Exogenous DNA" or "exogenous DNA fragment" as used herein refers to a DNA fragment which is not present or produced by Clostridium beijerincii itself, and which is required to be introduced from the outside of Clostridium beijerii. As an illustrative example, the targetron technique was developed based on the second class of introns (Ll.ltrB) of Lactococcus lactis. LI. ltrB RNA has the function of ribozyme, which can be directly inserted into the target DNA site by reverse cleavage, and then inverted by this intron-encoded protein (IEP). cDNA is generated and the resulting cDNA intron can be fully integrated into genomic DNA by homologous recombination or repair enzyme mechanisms of the host. See Lambowitz, AM, G. Mohr, and S. Zimmerly, eds. Group II intron homing endonucleases: Ribonucleoprotein complexes with programmable target specificity. Homing endonucleases and inteins. Nucleac acids and molecular biolgyed. M. Belfort. Vol. 16. 2005 , Springer-Verlag: Heidelbeerg. 121-145.

This application is not limited to the second class of introns. Figure 9 shows the structure of a class II intron in which any DNA fragment can be inserted in the IV domain of the intron. Preferably, the fragment is from 100 bp to lkb. For example, the fragment may be 100-300 bp, 300-1000 bp, 500-1000 bp, and 300-500 bp in length. In a specific embodiment of the invention, the inserted fragment is shown in Figure 17 at bases 173-1087. Through the two types of inclusion The DNA fragment can be inserted into any site of xylR.

The insert for interrupting the xylR gene can be inserted at any position in the xylR gene, and only needs to be able to interrupt or inhibit the expression of the xylR gene.

The XylR protein functions to regulate transcription by binding to a promoter region of a gene involved in xylose metabolism. Therefore, if the region where the protein binds to DNA is destroyed, xylR cannot function properly. For many of the gram-positive bacteria hypothesized xylR proteins, there is a helix-turn-helix structure at the N-terminus and a leucine zipper motif at the C-terminus, all of which are involved in DNA binding [7].

The prediction of the xylR protein structure of Clostridium beijerinckii shows that the structure is a helix-turn-helix at the 10th to 57th amino acids (the corresponding number of bases is 30bp to 171bp of SEQ ID NO: 3). The 266th amino acid (corresponding base number is 240bp to 798bp of SEQ ID NO: 3) belongs to the ROK (Repressor, Open reading fram, Kinase) family conserved domain. Thus, in a preferred embodiment of the invention, the exogenous DNA fragment is inserted at the l-798 bp of SEQ ID NO:3. In another preferred embodiment of the invention, an exogenous DNA fragment is inserted between bases 1 to 171, or an exogenous DNA fragment is inserted between positions 240 and 798. In a specific embodiment of the invention, a DNA fragment is inserted between positions 787/788 of SEQ ID NO:3. In other embodiments, an exogenous DNA fragment is inserted between 30 and 798 bp of SEQ ID NO: 3, and further, an exogenous DNA fragment is inserted between bases 37-171.

In a specific embodiment of the present invention, the insertion of a DNA fragment is carried out using the recombinant plasmid vector pWJ1-xylR, and the xylR-targetron fragment used in the plasmid is modified for use in the IBS, EBS2, and EBSld sites. A fragment of the xylR gene which is part of the Ll.LtrB intron, which is a prokaryotic intron comprising the ltrA gene. However, it should be understood that when repeating the assay of the present invention, other insertion sites may be selected for the assay, and even the recombinant plasmid vector may be used for the assay, as long as the nucleic acid fragment can be inserted into the xylR gene to interrupt the expression of the xylR gene.

The xylR gene can also be interrupted by homologous recombination. Homologous recombination disruption The xylR gene involves knocking out part or all of the sequence of xylR by homologous recombination, such that expression of the xylR gene is interrupted or inhibited or an incomplete XylR protein is expressed. The "recombinant knockout plasmid vector" used in the homologous recombination method includes a recombinant plasmid vector for knocking out the xylR gene, which has a specific pairing site with a specific sequence of the xylR gene, and is specific for the xylR gene. Fragment of sexual knockout.

The above method is used to inactivate the xylR gene. In addition, antisense nucleic acid technology can be used to inhibit xylR. Gene expression, down-regulated the expression of xylR. Methods for accomplishing the above objects are well known to those of ordinary skill in the art, for example, see Tummala, S. Β,, NE Welker et al, (2003). J Bacteriol 185(6): 1923-1934; Sambrook et al. Molecular Cloning: A Laboratory Guide (New York: Cold Spring Harbor Laboratory Press, 1989).

According to a preferred embodiment of the invention, overexpression of xylT increases the xylose consumption rate of C. beijerinckii. Methods for overexpressing the xylT gene include, but are not limited to, expression of a xylT gene carried by a free overexpressing recombinant plasmid vector.

According to the invention, "overexpression recombinant plasmid vector" includes recombinant plasmid vectors for overexpression of the xylT gene. In a specific embodiment, the overexpressed recombinant plasmid vector of the present invention may comprise a promoter derived from the C. acetobutylicum ATCC824 ptb gene and a C. beijerinckii NCIMB 8052 xylT gene. In a specific embodiment, the overexpression recombinant plasmid vector used in the invention is pIMP1-xylT _ptb .

Accordingly, the present application provides a method of increasing the xylose consumption rate of Clostridium beijerinckii, which comprises inhibiting the expression of the xylR gene and/or overexpressing the xylT gene by the above method.

The present application also provides a method of transforming C. beijerinckii to increase its xylose consumption rate, which comprises inhibiting the expression of the xylR gene and/or overexpressing the xylT gene by the above method.

After preparation or modification by the above method, it is possible to verify whether the xylR gene expression of the resulting strain has been inhibited and/or whether the xylT gene is overexpressed by conventional techniques in the art. For example, it can be verified by PCR and/or sequencing methods whether the foreign DNA fragment has been inserted into the xylR gene (for an exemplary example, see Sections 3.2 and 3.3 of Example 3 of the present application), and PCR can also be used to verify the overexpression of xylT. Whether the recombinant plasmid has been transferred into the strain (see Example 8 for an exemplary example).

The present application thus encompasses recombinant C. beijerinckii (i.e., genetically engineered C. beijerinckii) prepared or engineered using the methods described above. In a specific embodiment, the recombinant C. beijerinckii of the present invention is engineered to insert an exogenous DNA fragment, a partial or total deletion of the xylR gene, and/or a xylT gene overexpression in its genomic xylR gene. Furthermore, the recombinant Clostridium beijerinckii can also be characterized by reduced expression of the xylR gene by modification by antisense nucleic acid technology.

It should be understood that, in the present application, the expression of the xylR gene of Clostridium beijerinckii is decreased, the expression of the xylR protein is not expressed or can not be expressed, and the overexpression of the xylT gene is compared with the modified C. beijerinckii before the transformation of Clostridium beijerii. In terms of. Any Clostridium beijerii strain whose xylR gene and xylT gene are both wild-type genes before transformation is included in the engineered object of the present invention, and the thus modified Clostridium beijerinckii is also included in the recombinant Bayer of the present invention. Within the scope of Clostridium. In still another aspect, the present invention provides a negative regulatory gene for the production of arabinose and the production of organic solvents in C. sphaeroides fermentation: araR gene. The araR gene is reported in the NCBI Nucleic Acid Database as gi: 150019267c. Preferably, the amino acid sequence of the AraR polypeptide is set forth in SEQ ID NO:53.

The polynucleotide of the present invention may be in the form of DNA or RNA. DNA forms include: DNA, genomic DNA, or synthetic DNA. DNA can be single-stranded or double-stranded. The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of polypeptides having the same amino acid sequence as the present invention. Variants of this polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants, and insertion variants. As is known in the art, an allelic variant is an alternative form of a polynucleotide which may be a substitution, deletion or insertion of one or more nucleotides, but does not substantially alter the function of the polypeptide encoded thereby. .

The nucleic acid encoding of the present invention can be conveniently prepared by a variety of general methods based on the nucleotide sequences described herein. These methods are for example but not limited to: PCR, DNA synthesis, etc. For specific methods, see J. Sambrook, Molecular Cloning Experiment Guide. As an embodiment of the present invention, the coding nucleic acid sequence of the present invention can be constructed by a method of segmentally synthesizing a nucleotide sequence and performing overlap extension PCR.

It will be appreciated that the coding sequences of the invention are preferably obtained from Clostridium beijerii, obtained from other bacteria or organisms, and highly homologous to coding sequences obtained from Clostridium beijerinckii (e.g., having more than 50%, preferably more than 55%, 60%) Other coding sequences above, above 65%, above 70%, above 75%, above 80%, more preferably above 85%, such as 85%, 90%, 95%, or even 98% sequence identity are also preferred considerations of the present invention. Within the equivalent range. Methods and tools for aligning sequence identity are also well known in the art, such as BLAST.

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptides of the invention may be naturally purified products, either chemically synthesized or produced recombinantly from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect, and mammalian cells). The polypeptide of the invention may be glycosylated, or may be non-glycosylated, depending on the host used in the recombinant production protocol. Polypeptides of the invention may also or may not include an initial methionine residue.

The invention also encompasses protein fragments and analogs thereof having AraR and XylR polypeptide activities. As used herein, the terms "fragment" and "analog" refer to substantially retaining the native AraR and XylR polypeptides of the invention. A polypeptide of the same biological function or activity.

The polypeptide fragment, derivative or analog of the present invention may be: (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues The base may or may not be encoded by the genetic code; or (ii) a polypeptide having a substituent in one or more amino acid residues; or (iii) a mature polypeptide and another compound (such as a compound that extends the half-life of the polypeptide, For example, a polyethylene glycol) fusion formed polypeptide; or (iv) a polypeptide formed by fused an additional amino acid sequence to the polypeptide sequence (eg, a leader sequence or a secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or Fusion protein). These fragments, derivatives and analogs are within the purview of those skilled in the art in accordance with the definition herein.

As used herein, the term "gene transfer" refers to the process of introducing exogenous genetic material from a donor bacterium into a recipient bacterium, which can be accomplished by transformation, conjugative transfer, transduction, cell fusion, and the like.

As used herein, the term "joined transfer" refers to the communication of bacteria through interstitial connections to transfer genetic material (primarily plasmid DNA) from a donor bacterium to a recipient bacterium.

As used herein, the term "gene inactivation" refers to reducing the activity or expression of a gene of interest, or reducing the production and secretion of a polypeptide encoded by a gene of interest, including, but not limited to, gene disruption, gene knockout, RNA interference, gene deletion based on homologous recombination, inactivation of gene insertion based on a class II intron or transposon, RNA interference based on siRNA or shRNA, miRNA, and the like.

In this aspect, the mRNA expression level of the gene is reduced by more than 10% (more preferably by 20% or more, more preferably by more than 40%, and more preferably by more than 60%) compared to wild-type C. beijerinckii. , more preferably 80% or more, optimally no expression of the gene at all; or the activity of the polypeptide is reduced by more than 10% (more preferably 20% or more, more preferably 40% or more, more preferably The soil is reduced by more than 60%, more preferably by more than 80%, and optimally without the activity of the polypeptide.

As used herein, the term "conversion" refers to the percentage of the yield of the product compared to the amount of the input material. As used herein, refers to the percentage of ethanol, butanol, and/or acetone produced as a percentage of total sugar in the feedstock, where total sugar refers to all sugars contained in the feedstock, including but not limited to glucose, xylose in the feedstock, And arabinose.

As used herein, the term "utilization" refers to the percentage of the amount of raw material consumed by Clostridium beijerii which is greater than the amount of raw material input.

As used herein, the term "increased conversion", or "increased utilization" is relative to a wild-type strain, specifically referring to a higher yield or higher utilization than a wild-type strain. As used herein, the term "inhibiting the expression of the araR gene of C. beijerinckii" may either reduce the expression level of the araR gene of C. beijerinckii, or may cause the araR gene of C. beijerincii to be completely absent or not express correctly. Active functional protein.

One of ordinary skill in the art can achieve the above objectives using conventional methods including, but not limited to, gene disruption, gene knockout, RNA interference, gene deletion based on homologous recombination, gene insertion based on a class II intron or transposon. Inactivation, RNA interference based on siRNA or shRNA, miRNA, etc. Reference may be made to Molecular Cloning: A Laboratory Guide, etc., which are not specifically described herein.

In another preferred embodiment of the present invention, the expression of the araR gene in the genome of the provided recombinant strain of Clostridium beijerii is inhibited, and the araR protein having a complete structure cannot be expressed.

According to the present invention, the disruption of the araR gene of Clostridium beijerii can be inserted into the DNA at any position within the gene using a second type of intron insertion technique (for example, an intron or a resistance gene of no more than lkb, such as the pIMP1 vector The erythromycin resistance gene on the backbone is realized; the araR gene can also be interrupted by homologous recombination, and the insert for interrupting the ara gene can be inserted at any position in the araR gene, and only the araR gene expression needs to be interrupted. Or inhibition can be achieved; it can also be achieved by knocking out part or all of the araR sequence by homologous recombination, as long as the expression of the araR gene is interrupted or inhibited or the incomplete araR protein is expressed. The above method can be used to inactivate the araR gene.

The AraR protein structure prediction of Clostridium beijerinckii shows that the 5th to 73th amino acids (the corresponding number of bases is 15bp to 219bp) are the structure of the helix-turn-helix, the 84th to the 335th amino acid (corresponding The number of bases is 252 bp to 1005 bp), which are the sugar-binding regions of the Lacl family, which belong to the GntR family conserved domain. Therefore, in a preferred embodiment of the present invention, the exogenous DNA fragment is inserted at the l-1074 bp of araR; preferably, the exogenous DNA fragment is inserted between the 30th to the 171th base, or Insert a foreign DNA fragment between 440 and 873; a DNA fragment can also be inserted between positions 540/541 of araR. In other embodiments, an exogenous DNA fragment is inserted between 15-29 bp of araR, and more preferably, an exogenous DNA fragment is inserted between bases 252-1005.

In addition, it is also possible to suppress the expression of the araR gene by using an antisense nucleic acid technique or the like conventionally used in the art for inhibiting the expression of a specific gene, and down-regulate the expression of araR. Methods for accomplishing the above objects are well known to those of ordinary skill in the art (e.g., but not limited to, Tummala, SB, NE Welker et al. (2003). J Bacteriol 185(6): 1923-1934; Sambrook et al., Molecular Cloning: Experiments Room Guide (New York: Cold Spring Harbor Laboratory Press, 1989)), and therefore is not specifically described herein. "Recombinant knockout plasmid vector pWJl-araR" refers to a recombinant plasmid vector for knocking out the araR gene, which vector is understood to be a recombinant plasmid vector having a specific pairing site with a specific sequence of the araR gene, in the above recombinant plasmid A fragment for specifically knocking out the araR gene is included in the vector.

In a preferred embodiment of the invention, the recombinant knockout plasmid vector pWJl-araR used is: based on Escherichia coli and the C. jejuni shuttle plasmid pWJl (which expresses the erythromycin resistance gene in C. beijerinckii, A recombinant plasmid vector constructed to knock out the araR gene, constructed as shown in SEQ ID NO.: 1 . In this vector, the araR-targetron fragment used is a fragment which is used to knock out the araR gene after the bases of the IBS, EBS2, and EBSld are modified, and the fragment belongs to a part of the Ll.LtrB intron, The Ll.LtrB class II intron is a prokaryotic class II intron comprising the ltrA gene. However, one of ordinary skill in the art can select other insertion sites for experimentation when practicing the method of the present invention, and may even perform experiments without using a recombinant plasmid vector, as long as a nucleic acid fragment can be inserted into the araR gene to interrupt the expression of the araR gene. Just fine.

It is to be understood that in addition to inhibiting the expression of the araR gene at the gene level, the activity of the araR protein can be inhibited for the purpose of the present invention.

In a further aspect, the invention also relates to the simultaneous inhibition of expression or polypeptide activity of the xylR gene and the araR gene. In the present invention, it is preferred to inhibit the expression or protein activity of the xylR gene while inhibiting the expression or protein activity of the araR gene.

The above preferred embodiments can be carried out by methods conventional in the art. For example, Clostridium beijerinckii can be transformed with a plurality of plasmids simultaneously or sequentially, for example, by pWJl-xylR transformation followed by pWJl-araR.

In a preferred embodiment of the present invention, Clostridium beijerinckii xylRaraR means that the xylR gene is disrupted by the recombinant knockout plasmid vector pWJ1-xyl to inhibit expression of the gene, and the araR gene is disrupted by the recombinant knockout plasmid vector pWJl-araR to inhibit A recombinant C. beijerincoi strain constructed by expressing the gene. According to a preferred embodiment of the present invention, knocking out the araR gene in 8052xylR further enhances the utilization of arabinose in the fermentation of the mixed sugar of C. beijerinckii.

According to the present invention, the recombinant strain used may be a strain which inhibits the expression of Clostridium beijerinckii xylR gene and inhibits the expression of the araR gene of Clostridium beijerii provided by the present invention, or may be prepared according to the teachings of the present invention and the prior art. Other strains that inhibit the expression of the C. beijerinckii xylR gene and inhibit the C. beijerincki araR gene, such as strains that reduce the expression level of xylR using antisense nucleic acid technology. The present invention thus provides a recombinant strain prepared by the above method, which improves the consumption rate of xylose and efficiently utilizes xylose and/or arabinose for fermentation. The method and the strain of the invention significantly increase the utilization rate of xylose and/or arabinose in the fermentation raw material, and at the same time, the concentration of ABE formed by the conversion is correspondingly increased, so that it can be used for fermentation production of acetone, butanol and ethanol. Moreover, the engineered strain constructed by the present invention increases the consumption rate of arabinose in the mixed sugar, and can efficiently utilize glucose-xylose-arabinose for fermentation, and therefore these strains can improve the ability of the lignocellulosic hydrolyzate to carry out acetone butanol fermentation.

Accordingly, the present application includes a method of consuming xylose, preparing butanol, and performing acetone butanol fermentation using the recombinant Clostridium beijerii of the present application, the method comprising contacting the recombinant Clostridium beijerii of the present application with a material containing xylose And performing fermentation under conditions suitable for fermentation of the recombinant C. beijerinckii.

In the present application, the term "fermentation" refers to a process of producing a product of acetone, butanol, ethanol or the like by biotransformation using a xylose-containing material using the recombinant Clostridium beijerii of the present application. The process can be carried out using fermentation equipment and processes conventionally used in the art, and one of ordinary skill in the art can select equipment and processes based on actual needs and conditions. In the present invention, conventional fermentation of Clostridium beijerincii can be carried out to carry out the fermentation of the recombinant Clostridium beijerii of the present invention. For example, Examples 1, 4, and 5, etc. in Example 1 of the present application give exemplary conditions for the fermentation using the recombinant C. beijerinckii of the present invention, and those skilled in the art can use the actual production conditions and production scales. The fermentation conditions are appropriately modified.

The xylose-containing material may also contain other ingredients such as glucose and/or arabinose. The xylose-containing material may be a material obtained by directly using ingredients such as xylose, or a material obtained by fermenting or hydrolyzing a polymer compound such as hydrolyzed cellulose or hemicellulose. Xylose-containing materials can be obtained from conventional foods, but are more preferably obtained from non-grain materials such as inexpensive lignocellulosic resources or agricultural and forestry waste such as straw, straw, and the like.

The raw materials used in the fermentation production of the present invention may be a single sugar or a mixed sugar such as xylose-arabinose, glucose-xylose-arabinose. The sugar-containing raw material used may be a single sugar or a mixed sugar (such as glucose-xylose-arabinose) obtained by directly using glucose, xylose and arabinose, or may be a fermented or hydrolyzed polymer compound (such as hydrolyzed cellulose). Or hemicellulose, etc.), obtained mixed sugar. Sugary feedstocks are available from conventional foods, but are more preferably obtained from non-grain feedstocks such as inexpensive lignocellulosic resources or agricultural and forestry waste such as straw, straw, and the like. The concentration of each sugar in the mixed sugar may be 2-5% glucose: 0.3-2% xylose: 0.05%-5% arabinose, preferably 2-5% glucose: 0.3-2% xylose: 0.05%- 0.5% arabinose, more preferably 3.9% glucose: 1.5% xylose: 0.3% arabinose (% shown is w/v) (Aristidou, A. and M. Penttila (2000). Curr Opin Biotechnol 1 1 (2): 187- 198). In an embodiment of the invention,

The xylose-containing material is a material containing xylose and glucose. In one embodiment, the xylose content of the material may range from 0.1 to 70 g/L. In the case of further containing glucose, the content of glucose may be 0.1 - 70 g / L. The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are merely illustrative of the invention and are not intended to limit the scope of the invention. The experimental methods in the following examples, which do not specify the specific conditions, are usually manufactured according to the conditions described in the conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Guide (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions. The conditions recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. The concentration of sugar in the fermentation broth or sugar solution is the mass to volume ratio w/v% (please check if it is accurate). In addition, any methods and materials similar or equivalent to those described can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only. Embodiment 1

In the following examples of the present invention, the xylR gene of the strain C/aytr wm beijerinckii NCIMB 8052 used was identified by the identification of this experiment, which is GI: 149903712 in the NCBI nucleic acid database; the strain C/aytr wm beijerinckii used The xylT gene of NCIMB 8052 was identified by the identification of this experiment, and its accession number in the NCBI nucleic acid database is gi: 149901466.

In the following examples of the invention, ABE is an abbreviation for Acetone-butanol-ethanol, and ABE concentration refers to the total concentration of acetone, butanol, and ethanol in the solution.

In the following examples of the present invention, the recombinant plasmid vector pIMP l -P _ptb refers to a recombinant plasmid vector expressing the xylT gene, and the ptb promoter is a promoter derived from the Clostridium acetobutylicum ATCC 824 ptb gene.

In the following examples of the present invention, the recombinant plasmid vector pIMP l -P _thl refers to a recombinant plasmid vector expressing the xylT gene, and the th1 promoter is a promoter derived from the Clostridium acetobutylicum ATCC 824 thl gene.

The recombinant knockout plasmid vector pWJ1-xylR refers to a recombinant plasmid vector for inserting an exogenous DNA fragment into the xylR gene, wherein the xylR-targetron fragment used refers to the bases in the IBS, EBS2, EBS ld sites. After modification, the fragment for inserting the xylR gene belongs to a part of the Ll.LtrB intron, and the Ll.LtrB class II intron is a prokaryotic class II intron comprising the ltrA gene. The strains and plasmids used in the present invention are:

The plasmid pWJl-xylR is a plasmid for knocking out the xylR gene, which is a shuttle plasmid of E. coli and Clostridium, and expresses an erythromycin resistance gene in C. beijerinckii, and the sequence of the plasmid is shown in SEQ ID NO.: 1.

The plasmid pIMP1-xylTptb is a plasmid for overexpressing the y/r gene, and is a shuttle plasmid of Clostridium, which expresses an erythromycin resistance gene in C. ηίϋ', and the sequence of the plasmid is shown in SEQ ID NO.: 2.

The sequence of the y/R gene of Clostridium beijerinckii, see SEQ ID NO.: 3.

The sequence of the Clostridium beijerincon gene, see SEQ ID NO.: 4. The PCR purification and DNA gel recovery and purification kits used in the present invention were purchased from Huasheng Biological Products Co., Ltd., TargetronTM Gene Knockout System (TA0100) Kit was purchased from Sigma-Aldrich, and the genome extraction kit was purchased from Shanghai Health. Engineering Bioengineering Co., Ltd. In the following examples of the invention, the medium and buffer used were as follows:

The CGM medium is as follows (Joseph W. oos et al, Biotechnology and Bioengineering,

P681-694, Vol 557, 1985): 2g (NH ₄ ) ₂ SO ₄ , lg Κ ₂ ΗΡΟ ₄ ·3Η ₂ Ο, 0.5g KH ₂ PO ₄ , O.lg MgSO ₄ -7H ₂ O, 0.015g FeSO ₄ -7H ₂ O, 0.01 g CaCl ₂ , O. Olg MnSO ₄ -H ₂ O, 0.002 g CoCl ₂ , 0.002 g ZnSO ₄ , 2 g Tryptone, lg Yeast Extraction, 50 g Glucose, 2% agar was dissolved in 1 L of water.

The preparation method of XHP2 medium is as follows:

Solution 1: 40g D-glucose, 20g D-xylose or 50g D-xylose, add H ₂ O to 850mL; solution 2: KAC 7.85g, NH ₄ C12.14g, Κ ₂ ΗΡΟ ₄ ·3Η ₂ Ο 0.5g, KH ₂ PO ₄ 0.5g, force H ₂ O to dissolve to 100mL;

Solution 3: 2.0 g MgSO ₄ «7H ₂ O, O.lg MnSO ₄ «H ₂ O, O.lgNaCl, O.lg FeSO ₄ «7H ₂ O; Solution 4: 100 mg of distilled water was added with 100 mg of aminobenzoic acid (p- Aminobenzoic acid), lOOmg vitamin B1 (thiamine), lmg biotin (biotin);

Solution 1 and solution 2 are sterilized by high temperature damp heat, and solution 3 and solution 4 are filtered and sterilized. Solution 1 and solution 2 are cooled and mixed uniformly. Then, 10 mL of solution 3 and 1 mL of solution 4 are added, and the mixture is mixed and packed into 95 mL/bottle. Filter the sterilized N _{2 to} remove air from the bottle. The ETM buffer formulation is as follows: 270 mM sucrose, 0.6 mM Na ₂ HPO ₄ , 4.4 mM NaH ₂ PO ₄ , lOmM MgCl

The ET buffer formulation was as follows: 270 mM sucrose, 0.6 mM Na ₂ HPO ₄ , 4.4 mM NaH ₂ PO ₄ . The restriction enzymes used in the present invention, Taq DNA polymerase, T4 DNA ligase and calf alkaline phosphatase (CIAP) were purchased from TaKaRa, and KOD plus DNA polymerase was purchased from Toyobo.

Other conventional reagents are domestic or imported. The present invention amplifies a fragment for expressing the xylT gene and/or a targetron fragment that interrupts the xylR gene by PCR, and then double-digested and ligated with the same pIMP1-ptb and/or pWJl vector to obtain plasmid pIMP1-ptb. -xylT and / or pWJl-xylR, electroporation Clostridium beijerinckii NCIMB 8052, and then colony PCR identified recombinant plasmids with the presence of exogenous gene fragments and/or introns inserted into the genome, confirmed by fermentation to confirm the recombinant wood The sugar consumption rate is increased as shown in the following examples. Sequence table description

Table 1: Bacterial strains and plasmids

Strain or plasmid related feature ^a source

Strain

C. acetobutylicum ATCC wild type ATCC

824

C. beijerinckii NCIMB wild type NCIMB

8052

8052xyl xyl ::intron/pWJl-xyl This application

8052xyl -P 8052xylR / pIMPl-P _ptb present application

_{8052xyl -X 8052xylR / pIMP 1 -xyl xy} i R of the present application

8052xylT xylT::intron/pWJl-xylT This application

8052WT-P 8052WT / pIMPl-P ptb present application

8052WT-xylT 8052WT/pIMPl-xylT _thlThis application

_{8052xyl -xylT ptb 8052xylR / pIMPl-xylT} ptb present application 8052xyl -xylT _thl 8052χγ1Κ/ρΙΜΡ1-χγ1Τ, this application

8052xyl -lacZ _ptb 8052xylR/pIMPl-lacZj This application

_{8052xyl -lacZ thl 8052xylR / pIMPl-lacZ} t present application

E.coli DH5a Commonly used cloning host strain Takara

Plasmid

pWJl class II intron, ItrA [10]

pWJl-xyl is derived from pWJl, inserting introns

787/788nt bit of xyl gene xylR

pWJl-xylT is derived from pWJl, inserts introns

852/853nt of the xylT gene

pIMPl -P _ptb ColEl ORI, Amp ^r , pIM13 ORI, Papoutsakis ET

MLS ^r , C. acetobutylicum Professor ATCC provides ptb (cac3076) promoter SEQ ID NO: !) pIMPl -P _thl ColEl ORI, Amp ^r , pIM13 ORI, [10]

MLS ^r , C. acetobutylicum ATCC

824 thl (cac2873) promoter

pIMPl -xylT _{ptb is} derived from pIMPl-P _ptb and has been added to xylT

Expression cassette of gene (cbei0109)

_P IMPl -xylT _{thl is} derived from pIMPl-P _thl , added xylT

Expression cassette of gene (cbei0109)

placZFT Amp ^r from Papoutsakis ET

Thermoanaerobacterium Professor provides lacZ a xylR of thermosulfuro genes EMI, a transcriptional regulator of xylose metabolism; xylT, xylose transporter; Itrk, LtrA protein, required for reverse cleavage; ColEl ORI, copying ColEl origin; Αη3⁄4, ammonia Penicillin resistance; pIM13 ORI, Gram-positive origin of replication; ML erythromycin resistance; ptb, phosphotransbutyrylase; thl, thiolase. Table 2: Primer primers used in this application Primer Sequence Number Description xyl 787|788s-IBS AAAACTCGAGATAATTATCCTTAC xylR Targetron Primer

ATACCCATCTAGTGCGCCCAGATA

GGGTG (SEQ ID NO: 5)

Xyl 787|788s-EBSld CAGATTGTACAAATGTGGTGATA xylR Targetron Primer

ACAGATAAGTCCATCTATGTAACT

TACCTTTCTTTGT ( SEQ ID NO: 6 )

Xyl 787|788s-EBS2 TGAACGCAAGTTTCTAATTTCGG xylR Targetron Primer

TTGTATGTCGATAGAGGAAAGTG

TCT (SEQIDNO: 7)

xylR— 569-588 ATTTATCTGCTTACTACGAG ( forward 引 inside SEQ xylR

IDNO: 8) object, from 569th to the first

588 bases

Xyl _918-937 AATTCGATAGACCTAAAGAC xylR internal reverse

(SEQ ID NO: 9) object, from 918th to the

937 bases

Xyl -up AAAACTGCAGATATATTAAAGAT xylR Promoter Forward

AGAAATCAATCATCTTAG (SEQ ID

NO: 10)

Xyl -dn CGGGGTACCTTATTTAATTTCTAA xylR Reverse Primer

GAATTCTTCTATAGGC ( SEQ ID

NO:ll)

xylT852|853s-IBS AAAACTCGAGATAATTATCCTTAG Targetron Primer

CTTTCCTCGCTGTGCGCCCAGAT AGGGTG (SEQ ID NO: 12)

xylT852|853s-EBSl d CAGATTGTACAAATGTGGTGATA xylT Targetron bow |

ACAGATAAGTCCTCGCTCATAAC TTACCTTTCTTTGT ( SEQ ID

NO: 13) xylT852|853s-EBS2 TGAACGCAAGTTTCTAATTTCGA xylT Targetron bow|object

TTAAAGCTCGATAGAGGAAAGTG TCT (SEQ ID NO: 14)

xylT— 579-596 AGATGGACGAGCAGATGA ( forward 引 inside SEQ xylT

IDNO: 15) object, from 579 to the first

596 bases

xylT_ 1006- 1023 GATTGAGGCAACGAAAGA (Reverse introduction inside SEQ xylT)

IDNO: 16) object, from 1006 to the first

1023 base

xylT-up ACGCGTCGACATGAAAATAAAAA xylT forward primer

TTAGTAACTCTG ( SEQ ID NO: 17 )

xylT-dn CGGGGTACCCTAAGCCTTAGTTG xylT reverse primer

TAGCATCTTGAGTG ( SEQ ID

NO: 18)

dpIMPl-fw GCAAGAGGCAAATGAAATAG is located in plasmid pIMPl bone

(SEQIDNO: 19) The forward primer dpIMP 1 -rev TGCTGCAAGGCGATTAAGTTGG is located on the plasmid pIMPl bone

(SEQ ID NO: 20) Reverse primer on the scaffold dxyl -dn TCGGTGTTAGTGCGACTCC (reverse introduction inside SEQ xylR)

IDNO: 21)

dpIMP 1 -P _ptb -up TAAATGAGCACGTTAATC ( SEQ ID plasmid pIMPl-P _ptb

NO: 22) Forward primer inside the ptb promoter

dpIMP 1 -P _thl -up TTAGGGATAAACTATGGAAC ( SEQ plasmid pIMPl-P _thl

ID NO : 23) forward primer inside the thl promoter

dxylT-dn CAGCCGATGTAAGAATTAGC inside xylT

(SEQ ID NO: 24) to primer

rxylF-up ACTAATCCATATTGGCTTGA (for the positive direction of SEQ xylF ID NO :25) RT-PC Primer

TATGCCACTCACCTTTGC (reverse RT-PCR of SEQ ID xylF NO: 26) Primer

GGTGGACGTGAAGGATAT ( forward RT-PCR ID of SEQ xyM/ ID NO: 27) Primer

TATTGGTGCTTTGTTGGT (SEQ ID xyM/ reverse RT-PCR NO: 28) primer

TCTTAGCTTGTAATGCGCCT (Positive ID of SEQ xylAII: NO) 29 RT-PC Primer

ATGCTAGCTATAACGTCTGG (reverse IDNO: 30 of SEQ xylAII) RT-PC Primer

GCGGCAACTGATACACCT ( forward RT-PCR of SEQ xylB IDNO: 31) primer

Reverse RT-PCR of CTCGCTTTCTTCAACTTCTTTA xylB

(SEQIDNO:32) Primer

Forward RT-PCR of ATAGAAGCAGCAAAAGCAGGC to/

(SEQIDNO:33)

Reverse RT-PCR of GCTGCTGCCCAGTCTGCTTTA to/

(SEQIDNO: 34)

AGATGGACGAGCAGATGA (forward RT and fluorescein IDNO of SEQ: 35) Quantitative PCR primers

AACCAAAGCCTATGACTA (reverse RT and fluorescein IDNO of SEQ: 36) Light quantitative PCR primers

CGCACAAGCAGCGGAGCAT (forward RT IDNO: SEQ cbeirOOOl: 37) and fluorescent quantitative PCR primers

Forward RT (SEQ ID NO: 38) and real-time PCR primers for AACCCAACATCTCACGACACGA cbeirOOOl The in-line design ^a tool (www.clostron.com) strains 1.8052 Example 3% w / v Glucose: synthetic medium 3% w / v xylose and 3% w / v xylose fermentation in a single

Single bacteria were picked from CGM plate and inserted into 5 mL CGM liquid medium, cultured overnight, and 5% inoculated into 95 mL of 6% w/v xylose XHP2 medium, and cultured for 12 hr, so that the bacteria concentrated OD _{6 ( K)} Up to 0.5 to 1.0, cultured in 95 ml of XHP2 medium, and the fermentation broth was used to detect the residual sugar content (measured by Agela 1200 HPLC using WATERS's sugar-park column, the results are shown in Figure 1). Before the determination of the residual sugar content in the fermentation liquid, the following pretreatment is carried out: After the fermentation liquid is centrifuged, the supernatant is separately taken, and diluted with H ₂ O for 20 times to be used for the determination of residual sugar.

The results showed that: 8052 can simultaneously utilize glucose and xylose, and its carbon metabolism repression effect is not obvious. Whether it is 3% w/v glucose: 3% w/v xylose fermentation or 3% w/v monoxylose fermentation, the bacteria can not completely consume the xylose in the medium within 72 hours, indicating the 8052 xylose metabolism pathway There are natural problems. Therefore, there is a need to find a new method that can improve this metabolic pathway. Example 2. Construction of pWJl-xylR plasmid vector

The xylR targetron fragment was amplified by PCR, and then digested with X/wI and ^rG I, and ligated with the pWJ1 vector which was also digested with X/wI and I to obtain the disruption plasmid pWJl -xylR, wherein PC amplification The template and primer design method for xylR targetron was derived from Sigma-Aldrich's TargetronTM Gene Knockout System (TA0100) kit. The specific steps are as follows:

2.1 PCR amplification primers

The primers xylR787|788s-IBS, xyl 787|788s-EBSld and xylR787|788s-EBS2 were designed by the method provided by the TargetronTM Gene Knockout System (TAOlOO) kit to construct the pWJl-xylR plasmid vector.

The EBS universal primer (EBS universal) required for PCR amplification is supplied by the TargetronTM Gene Knockout System (TAO 100) kit.

2.2 PCR amplification PCR amplification using Sigma-Aldrich's TargetronTM Gene Knockout System (TAO100) kit (PCR reaction conditions: 94 ° C for 30 s, 94 ° C for 30 s, 55 ° C for 30 s, 72 ° C for 30 s 30 cycles, 72 ° C for 2 min, 4 ° C The template and reagents required for amplification are provided by the kit, and the PCR product is subjected to agarose gel electrophoresis, and then the strip at 350 bp is purified by using the Huayu company's gel recovery kit.

2.3 Construction of pWJl-xylR recombinant plasmid vector

The vector pWJl and xylR-targetron fragments were digested with X/w I and ^rGI, respectively, and then the digested product was purified using a gelatin recovery kit from Huaying Company.

The digested xylR-targetron fragment was ligated with the digested vector fragment using T4DN A ligase, and the ligation reaction was carried out in a 16 ° C water bath for 10 hr, and the obtained ligation product was transformed into Escherichia coli by CaCl ₂ heat shock method. DH5a competent cells: heat shock at 42 °C for 90 sec, then add 4 °C LB liquid medium for 1 hr, then centrifuge the cells at 4500 rpm for 5 min, and apply to LB solid medium plates containing 100 g/mL ampicillin. 16-18hr.

Colonies obtained by colony PCR (reagents supplied by Sigma-Aldrich of Targetron ^TM Gene Knockout System (TAOlOO) kit conditions: 95 ° C5min, 94 ° C30s , 55 ° C30s, 72 ° C30s 30 cycles, 72 ° C2min, 4 ° C preservation), to detect whether the 350 bp targetron fragment was ligated into the pWJ1 vector, and the PCR amplification primers were IBS and EBSld.

PCR results showed that colony PCR amplified a 350 bp specific band. The PCR-positive colonies were picked and expanded in LB liquid medium to extract the plasmid. Then, using dpIMPl-fw as a primer, the extracted plasmid was used as a template for sequencing, and the result was as expected: the targetron fragment was indeed ligated into the pWJl vector). Example 3. Clostridium beijerincii; construction, detection and knockout of cWR mutants

The pWJl-xylR plasmid was electroporated into C. beijerinckii NCIMB8052. After overnight resuscitation, 200 μl of the cell solution was applied to a CGM plate supplemented with 10 g/mL erythromycin, and cultured in an anaerobic chamber at 37 ° C for 48-72 hours. After that, single bacteria were picked for colony PCR verification. The specific process is as follows:

3.1 pWJl-xylR plasmid electroporation into C. beijerinckii 8052

After C. jejuni NCIMB8052 was streaked on CGM medium plate for 48 hr, single colony was picked and cultured in 5 mL CGM liquid medium for 16 hr, and then inoculated into 50 mL CGM liquid culture according to 1% inoculum. In the medium culture, when the OD _{6 (K)} of the cultured cells reaches between 0.6 and 0.7, the culture bacteria are taken out for preparation of electrotransformed competent cells. Take 30mL of bacterial solution, centrifuge at 4 ° C, 4500rpm for 10min, discard the supernatant, add 30mL 4 ° C ETM buffer suspension, then centrifuge at 4 ° C, 4500rpm for 10min, discard the supernatant, add lmL 4 ° C ET Buffer, obtained suspension suspension.

Take 190 L of the above suspension solution, add lO L (about l~3 g) of pWJl-xylR plasmid (operating on ice), mix and transfer to an electric rotor (2 mm diameter), and rotate with Bio-Rad MicroPulserTM , voltage 1.8kV, the rest of the reference manual, after the electric shock, quickly add 1mL of normal temperature CGM medium, after incubation at 37 ° C for 8hr, 200 L of cell solution was applied to CGM plate with 10 g / mL erythromycin , culture in anaerobic chamber at 37 ° C for about 2 to 3 days.

3.2 PCR verification of colonies

After transformation of the pWJl-xylR plasmid into C. beijerinckii NCIMB8052, a partial sequence of the second intron may be inserted into the xylR gene of the genome, and if there is an intron insertion, the primer upstream and downstream of the insertion site may be used. Colony PCR was performed to verify that the wild-type strain without the intron will amplify a 400 bp band, and the recombinant strain inserted with the intron will amplify the band to a 1.3 Kb band. Therefore, random picking Two transformants were verified, in which the C. beijerinckii NCIMB 8052 genome was used as a negative control. The specific process was as follows:

The PCR reagent used was xylR-569-588 and xylR-918-937;

PCR reaction system: system ΙΟΟμΙ; 10x Taq Buffer ΙΟμΙ; dNTP(2 mM) ΙΟμΙ; MgCl ₂ (25 mM) ΙΟμΙ; Taq enzyme Ιμΐ; forward primer (100 mM) 2μ1; reverse primer (100 mM) 2μ1; colony (toothpicks accounted for Take a trace); water 65μ1.

PCR reaction conditions: 95 ° C for 5 min; 95 ° C for 30 s, 55 ° C for 30 s, 72 ° C for 1.5 min, 30 cycles; 72 ° C for 5 min.

The product obtained by the PCR reaction was subjected to agarose gel electrophoresis, and the results are shown in Fig. 2. According to the results of Fig. 2, the two transformants obtained were all mutants in which an intron was inserted.

3.3 Sequencing verification of positive transformants

The positive transformants corresponding to those labeled 3 in Figure 2 were randomly picked and cultured in CGM liquid medium supplemented with 10 g/mL erythromycin, and the genome was extracted. Using the extracted genome as a template, with xylR- -569-588 and xylR-918-937 were PCR amplified for the primer pair, and the amplified 1.3 kb DNA band was recovered and sequenced. The results are shown in Fig. 8. The sequencing results showed that the 1730-87 DNA of the sequence of the sequence was an inserted intron sequence, that is, the intron sequence was accurately inserted between the predicted 787|788 sites. 3.4 Loss of 8052/pWJl-xylR knockout plasmid

The 3μ1 transformants grown to logarithmic growth phase were transferred to 5 ml CGM-free and erythromycin-containing (20 g/ml) tubes, and transferred once every 12 to 15 hours until the resistant tubes no longer grew. This process takes about 2 days. The corresponding non-anti-test tube liquid is coated at this time. Colony PCR and sequencing verification (same as 3.2 and 3.3) ensure the insertion of the intron, and the mutant strain with the missing knockout plasmid is named 8052xylR. For subsequent metabolic engineering. Example 4. RT-PCR detection of transcription of xylose metabolism-related genes in 8052 and 8052xylR

Pick 8052xylR single bacteria from the CGM plate and transfer it to 5mL CGM liquid medium. Incubate overnight to OD _6(X) = 0.8~1.0, and add 2% inoculum to 50mL CGM medium for 8~10hr. The concentration of OD _{6Q() is} 0.5-1.0, and 500ml SP2 is added (30 g/L glycerol as carbon source, 0.1 g/L L-cysteine and 6 g/1 yeast extract are added to XHP2) The medium was fermented, and 8052 was used as a control. When OD ₆₀₀ = 0.5, 250 ml of the cells were collected by centrifugation at 4 ° C, 6000 rpm, lOmin and frozen with liquid nitrogen. Cellular RNA extraction and cDNA preparation are similar to the literature [11].

The results showed (Fig. 3): xylT, xylAK xylAII and xylB were significantly up-regulated in 8052xylR compared with control 8052, and the transcriptional changes of xylF and tal genes were not obvious, indicating that most of xylose metabolism after knocking out the xylR gene The genes are all upregulated. Example 5. Fermentation of 8052x _V lR mutant strain in synthetic medium

The procedure of Example 3, step 3.4, in which the xylR gene was disrupted, was carried out in XHP2 medium, and the fermentation broth was detected. The specific process is as follows:

Single bacteria were picked from CGM plate and inserted into 5 mL CGM liquid medium, cultured overnight, and 5% inoculated into 95 mL of 6% w/v xylose XHP2 medium, and cultured for 12 hr, so that the bacteria concentrated OD _{6 ( K)} 0.5 to 1.0, 5% into 95 ml of 6% w/v xylose XHP2 medium, fermented, and the fermentation broth was used to detect the residual sugar content (using the WATERS-park column of WATERS) by Agela 1200 HPLC. As shown in Figure 4A And acetone, butanol and ethanol content (measured using an Agela 7890A gas chromatograph, the results are shown in Figure 4D), OD600 and pH, and using 8052 as a control, wherein the residual sugar content in the fermentation broth and acetone, Before the content of butanol and ethanol, the following pretreatment is required:

After the fermentation broth was centrifuged, the supernatant was taken to determine residual sugar and acetone, butanol and ethanol:

The supernatant was diluted to 3⁄40 and used for residual sugar determination. The 400 L supernatant was mixed with 100 L of internal standard to determine acetone, butanol and ethanol. The internal standard formula was: 25 g isobutanol, 5 g isobutyl Acid, 50mL 37% concentrated hydrochloric acid, add water to 1L).

The results showed that: At 72 hours after the end of the fermentation, the xylR gene was inactivated after insertion, and the xylose utilization rate was 76%. At the same time, the wild type could only use 54% of xylose. Correspondingly, the production of 8052xylR, butanol and ABE were better than wild type (Fig. 4). After the interruption of xylR gene, the xylose utilization rate of the cells was improved. Example 6. Complementation of 8052xyl Mutant

The complementary plasmid pIMPl-xylR xylR was _constructed , together with the control plasmid pIMP1-P _ptb , and the positive clone was obtained by genotype identification. The phenotype of xylose utilization and solvent production of the complementary strain was investigated by fermentation. Wherein, PCR, restriction enzyme digestion, ligated and transformed, colony PCR method with Example 2, the specific implementation of the project as follows: 6.1 Construction of plasmid pIMP 1 -xyl _xylR

The xylR fragment was amplified by using the NCIMB8052 genome of C. beijerinckii as a template and using xylR-up and xylR-dn as primers. The vector pIMP1-Pp nxylR fragment was digested with 3⁄41 and Acc65I, and the two were ligated and transformed into DH5 (after identification with the same primers, the colonies with positive bands were extracted, and the bacteria were confirmed by sequencing.

6.2 Plasmid

pIMPl-P _ptb electric to 8052xylR

Same as 3·1

6.3 PCR verification of colonies

The PCR system, method, and DNA agarose electrophoresis were verified as 3.2, and the positive control was used to construct the correct plasmid, and the negative control was 8052xylR colony.

6.3.1 Identification of Clostridium beijerinckii 8052xylR (pIMP 1 -P _ptb ) The primers were dpIMP 1 -P _ptb -up and dpIMP 1 -rev; the positive colonies obtained were referred to as 8052xylR-P.

6.3.2 beijerinckii 8052xylR _(pIMPl-xylR xylR) Identification

The primers were dpIMP 1 -fw and dxylR-dn; the positive colonies obtained were referred to as 8052xylR-X.

6.4 Fermentation of complementary strains

Same as embodiment 5

The results are shown in Table 3. The complementary strain 8052xylR-X returned to the wild-type level in terms of xylose consumption, butanol and ABE solvent production, indicating that the increased phenotype of 8052xylR xylose utilization was caused by the disruption of the xylR gene.

Table 3: Complementation of the gene xylR (cbei2385) in strain 8052xylR

Strain ^{a a} xylose consumption (g/L) butanol (g/L) ABE (g/L)

8052WT 34.26 ± 0.64 7.51 ±0.30 9.01 ±0.48

8052xyl 44.40 ± 3.70 9.68 ± 1.25 11.35 ±0.78

8052xyl -P 43.90 ± 1.62 9.79 ± 0.43 12.47 ±0.83

8052xyl -X 35.17 ± 1.00 7.17 ±0.74 9.53 ± 1.85

a8052WT: C. beijerinckii NCIMB 8052 wild-type strain; 8052xyl: xylR-interrupted strain; 8052xyl-P: xy/R-interrupted strain carrying a blank plasmid control pIMP1-P _ptb ; 8052xyl -X: xylR disrupted strain, carrying _pIMPl-xylR xylR. The fermentation was carried out in XHP2 medium containing 60 g of D-xylose/liter. Samples were taken 96 hours later. Fermentation is set in three parallels. Example 7. Determining cbei0109 as a candidate gene for xylose transporters

The amino acid sequence of 14 in the 8052 genome annotated as a sugar transporter was homologously aligned with an amino acid sequence identified as a xylose transporter in 824 (completed by BioEdit software). The results are shown in Table 4, cbei0109 and The amino acid sequence of the known protein has the highest similarity, which is 37%, so it is identified as a candidate gene for the xylose transporter. Table 4: Comparison of amino acid identity between 14 predicted sugar transporters in C. beijerinckii and XylT (cac!345) in C. acetobutylicum

Cbei0109 cbei0232 cbei0770 cbei0771 cbeil835 cbei2377 cbei2380 cbei3764 cbei4125 cbei4443 cbei4448 cbei4461 cbei4545 cbei4588 XylT(cac cbei0109 0.07 0.08 0.06 0.09 0.05 0.05 0.12 0.10 0.06 0.09 0.08 0.35 0.08 0.3 cbei0232 0.12 0.32 0.06 0.05 0.04 0.07 0.07 0.24 0.05 0.05 0.07 0.05 0.05 cbei0770 0.10 0.03 0.07 0.04 0.06 0.06 0.1 1 0.04 0.06 0.05 0.05 0.05 cbei0771 0.04 0.07 0.06 0.05 0.05 0.22 0.06 0.06 0.06 0.06 0.05 cbeil 835 0.05 0.05 0.21 0.26 0.04 0.08 0.07 0.10 0.10 0.10 cbei2377 0.13 0.06 0.08 0.05 0.06 0.05 0.06 0.04 0.06 cbei2380 0.07 0.07 0.05 0.06 0.05 0.05 0.07 0.05 cbei3764 0.31 0.05 0.06 0.06 0.1 1 0.13 0.10 cbei4125 0.04 0.08 0.06 0.10 0.1 1 0.1 1 cbei4443 0.05 0.03 0.07 0.08 0.06 cbei4448 0.07 0.09 0.08 0.07 cbei4461 0.09 0.07 0.07

Example 8. Knockout and overexpression of genes in 8052 cbei0109

The knockout plasmid pWJl-xylT and the overexpression plasmid pIMPl-xylT thl were _constructed , and positive clones were obtained after electroporation at 8052 and the xylose utilization phenotype was determined by fermentation. The specific implementation process is as follows:

8.1 Building a knockout plasmid pWJl -xylT

The method is the same as that of Example 2 except that the primers used in the construction are: xylT852|853s-IBS, xylT852|853s- EBSl d and xylT852|853s- EBS2.

8.2 Construction of the overexpression plasmid pIMPl -xylT _thl

A fragment of the gene cbeiO 109 was amplified by using the C. yumii NCIMB8052 genome as a template and xylT-up and xylT-dn as primers. Using Sa/I and Acc (55I, respectively, the vector pIMP 1 -Ρ _Λ ^Π cbeiO 109 fragment was digested, and the two were ligated and transformed with DH5a and identified with the same primers. The colonies with positive bands were extracted and the plasmid was verified correctly. After the preservation of bacteria.

8.3 plasmid pWJl-xylT and pIMP 1 -xylT _thl electroporation 8052

Same as 3.1

8.4 PCR verification of colonies

The PCR system, method, and DNA agarose electrophoresis were verified as 3.2, and the positive control constructed the correct plasmid, and the negative control was 8052 colonies.

8.4.1 Identification of Clostridium beijerii 8052 (pWJl-xylT)

The primers were xylT-579-596 and xylT-1006-1023; the positive colonies obtained were referred to as 8052xylT. 8.4.2 Identification of Clostridium beijerinckii 8052 (pIMPl-xylT _thl )

The primers were dpIMP 1 -P _thl -up and dxylT-dn; the positive colonies obtained were referred to as 8052-xylT _thl . 8.5 Fermentation of engineering strains in synthetic medium

Same as embodiment 5

Compared with the wild type, the overexpressed gene cbei0109 resulted in an increase in the transcription amount of the gene. As shown in Figure 5, the wild type knockout gene cbei0109 resulted in a 45% reduction in xylose utilization, and the overexpression gene cbei0109 resulted in a 33% increase in xylose utilization. As shown in Table 5, the wild-type overexpressed gene cbei0109 causes xylose consumption. The amount increased by 32%, and the yield of butanol and total solvent also increased correspondingly, 44% and 53% higher than the wild type, respectively, indicating that the gene cbei0109 is the main responsible for the transport of 8052 xylose, hereinafter named x; y / r . Table 5: Strain ₈₀₅₂ 11 ¾1 8052WT and 6% XHP2 fermentation parameters in the fermentation 96 hours

Product (g/L)

Strain xylose consumption (g/L) acetone ethanol butanol ABE

8052WT 32.14±0.38 1.27±0.05 1.47±0.10 5.36±0.05 8.09±0.13

8052xylT _th i 47.08±1.32 3.03±0.25 1.59±0.07 7.71±0.29 12.34±0.45

Example 9. Construction of plasmid pIMP 1 -xvlT^

9.1 Construction of plasmid pIMPl-xylTptb

A fragment of the gene cbei0109 was amplified by using the C. yumii NCIMB8052 genome as a template and xylT-up and xylT-dn as primers. The cbei0109 fragment was digested with Sa/I and Acc65I, respectively, and ligated with the same double-digested pIMP lP _ptb , and transformed into DH5 (after identification with the same primers, the colonies with positive bands were extracted, and the sequencing was confirmed to be correct. Example 10. Construction and detection of Clostridium beijerii SOSSxylR/pIMPl-xylT^ and SOSSxylR/pIMP l-xylT^)

The correct pIMP 1 -xylT _ptb and pIMP 1 -xylT _{thl were} electrically transferred into the examples 8 and 9.

8052xyl, the specific process is as follows:

10.1 Electrical rotation of each plasmid

The method is the same as 3.1.2. Colony PCR verification of each engineering bacteria

The PCR system, method, and DNA agarose electrophoresis were verified as 3.2, and the positive control was constructed correctly. The negative control was 8052xylR.

10.2.1 Identification of Clostridium beijerinckii 8052xylR (pIMP l-xylT _ptb )

The primers were dpIMPl-P _ptb -up and dxylT-dn ; the positive colonies obtained were referred to as 8052xylR-xylT _ptb . 10.2.2 Identification of Clostridium beijerinckii 8052xylR (pIMPl-xylT _thl )

The primers were dpIMP 1 -P _thl -up and dxylT-dn; the positive colonies obtained were referred to as 8052xylR-xylT _thl . The 8052xylR (pIMPl-xylT^) obtained from the above construction was deposited with the China Center for Type Culture Collection (Lushan, Wuchang, Wuhan, China, 430072) on February 15, 2012, and the accession number is CCTCC.

Example 1 1. Fermentation of Clostridium beijerii 8052, 8052xyl, 8052xyl (pIMP 1 -xy!T^ and SOSSxylRipIMPl-xylT^) in synthetic medium

The method is the same as in Example 5.

The results are shown in Figure 6. Overexpression of the gene xylT was overexpressed in 8052xylR with different promoter strengths. The ptb promoter carried xylT overexpressing engineered bacteria and 8052xylR significantly improved xylose utilization by 23%, thl promoter Xylose overexpression was increased by 1.7 g/L compared to 8052xylR. That is, strain 8052xylR- _X ylT _ptb is the strain with the highest utilization of xylose in the synthetic medium. Example 12. Quantitative PCR for detection of xylT transcription in 8052xylR, 8052xylR-xylT^ and 8052XV1R-XV1T

Single bacteria were picked from CGM plates and placed in 5 mL CGM liquid medium containing 10 g/ml erythromycin. The cells were cultured overnight to OD _{6 (K)} = 0.8 to 1.0, and 5% inoculum was added to 95 mL 6% w/ v Xylose XHP2 medium, cultured for 12 hr, so that the concentrated OD ₆ oo reached 0.5-1.0, and 25 ml into 475 ml of XHP2 (with 6% w/v xylose as carbon source) culture medium, and used 8052xylR as Control, when OD _{6 (K)} = 0.6 and 2.5, 250 ml of the cells were collected by centrifugation at 4 ° C, 6000 rpm, lOmin and snap frozen with liquid nitrogen. Cellular RNA extraction and cDNA preparation are similar to the literature [11].

Each 20 μl real-time PCR reaction system includes: ΙΟμΙ iQ SYB Green Supermix (Bio-Rad), 200 nM primer, ll cDNA template. Real-time PCR was performed in a real-time PCR detector (Bio-Rad). The PCR procedure was: 95 °C for 3 min; 95 °C for 20 s, 55 °C for 20 s, 72 °C for 20 s, 40 cycles; 65-95 °C for dissolution. Curve analysis. All samples were subjected to three parallel experiments and averaged for analysis. To calculate relative expression levels, the cDNA was diluted 200-fold for analysis, see [12]. 16S was used as the internal reference gene, and the primers were r 16S-up and r 16S-dn. The xylT primers for real-time PCR were rxylT-up and rxylT-dn. The results are shown in Table 6. Compared with the control 8052xylR, xylT was up _- regulated in the acid-producing and solvent-producing periods of 8052xylR _- XylT _ptb , and the expression strategy was successful.

Table 6: Changes in xylT transcriptional fold in strain 8052xvlR-xvlT^P 8052xlyR-xylT _ptb (with strain 8052xylR as control)

Transcription level (mean fold change ± SD)

Strain

Acid production period

8052xly -xylT _thl 2.38 ± 0.39 3.27 ± 0.34

8052xly -xylT _ptb 4.53 ± 0.69 2.20 ± 0.37

a The OD _6Q() obtained during the acid production period and the solvent production period is about 0.6 and 2.5 _, respectively. 16S r NA ( cbeirOOO l ) was used as an internal reference gene. The fermentation was carried out in XHP2 medium containing 60 g/L xylose. Example 13. Clostridium beijerinckii 8052 and 8052xylR (pIMP l -xylT _E ^ in xylose mother liquor fermentation picking single bacteria from CGM plate into 5mL CGM liquid medium containing 10 g / ml erythromycin, Incubate overnight until OD _{6 (K)} = 0.8~1 .0, and add 5% inoculum to 95 mL of 6% w/v xylose in XHP2 medium for 12 hr, so that the concentrated OD _{6 (K)} reaches 0.5- 1.0, 5 ml of the culture solution was added to 95 ml of XHP2 (using 5.5% w/v xylose mother liquor as a carbon source) medium for fermentation, and 8052 was used as a control to measure the residual sugar content; acetone, butanol and ethanol content; OD600 and pH. The same procedure as in Example 5.

As shown in Figure 7, 8052xylR- _X ylT _ptt ^ can more thoroughly utilize the various sugars in the xylose mother liquor within 61 hours, showing the growth advantage and finally producing 16.91 g / L of ABE in 61 hours, solvent yield It was 0.3 1 g/g, which was 35% higher than the wild type. Embodiment 2

The terms, materials and methods used in this example are as follows - the strain C. beijerinckii: Clostridium beijerinckii 8052, purchased from NCIMB. The cy/R and araR genes in the strain C. beijerinckii are known in the art, and their numbers in the genome of the NCBI nucleic acid database are: cbei2385 and cbei4456, respectively.

"8052xylR" refers to a strain constructed based on Clostridium beijerinckii NCIMB 8052, in which xy/R gene expression is inhibited or not expressed.

"8052xylRaraR" refers to the xy/R gene and araR gene constructed based on Clostridium beijerii 8052xylR The expression of the strain is inhibited at the same time or even not expressed.

The "recombinant knockout plasmid vector pWJl-xylR" refers to a recombinant plasmid vector for knocking out the gene cy/R, wherein the xy/R-targetron fragment used refers to the base modification at the IBS, EBS2, EBSld sites. Thereafter, a fragment for knocking out the cy/R gene, which belongs to a part of the LLLtrB intron, which is a prokaryotic second intron comprising the ltrA gene.

"Recombinant knockout plasmid vector pWJl-araR" refers to a recombinant plasmid vector for knocking out the gene a R , wherein the araR-targetron fragment used is defined after the bases of the IBS, EBS2, EBSld sites have been modified. The fragment of the a R gene is deleted, and the fragment belongs to a part of the Ll.LtrB intron, and the Ll.LtrB intron is a prokaryotic intron comprising the ltrA gene.

Plasmid pWJl is a shuttle plasmid for Escherichia coli and C. beijerinckii (will be derived from Clostridium butyricum)

The replicon of DSM10702, pCB102, replaced the replicon of pSY6 (pIM13), and expressed the erythromycin resistance gene in C. beijerinckii. The entire sequence of this plasmid is shown in SEQ ID NO.: 1. One of ordinary skill in the art can construct the plasmid using conventional methods and be capable of molecular biological manipulation of the plasmid gold.

The PCR purification and DNA gel recovery and purification kits used in the present invention were purchased from Huasheng Biological Products Co., Ltd., TargetronTM Gene Knockout System (TA0100) Kit was purchased from Sigma-Aldrich, and the genome extraction kit was purchased from Shanghai Shenggong. Bioengineering Ltd.

The CGM medium is as follows (Joseph W. Roos et al, Biotechnology and Bioengineering, P681-694, Vol 557, 1985): 2g(NH ₄ ) ₂ SO ₄ , lg Κ ₂ ΗΡΟ ₄ ·3Η ₂ Ο, 0.5g KH ₂ PO ₄ , O.lg MgSO ₄ -7H ₂ O, 0.015g FeSO ₄ -7H ₂ O, O.Olg CaCl ₂ , O.Olg MnSO ₄ -H ₂ O, 0.002g CoCl ₂ , 0.002g ZnSO ₄ , 2g tryptone , lg Yeast Extraction, 50 g glucose, 2% agar dissolved in 1 L water.

The preparation method of E-JL medium (per liter) is as follows:

Solution 1: ll. BgD-glucose: 19.51 g D-xylose: 8.94 g L-arabinose, dissolved in H ₂ O to 850 mL;

Solution 2: (NH ₄ ) ₂ SO ₄ 2 g, Na ₂ SO ₄ 5.24 g, NaAC 2.89 g, dissolved in H ₂ O to 100 mL; Solution 3: 2.0 g MgSO ₄ -7H ₂ O, O.lg MnSO ₄ - H ₂ O, O.lgNaCl, O.lg FeSO ₄ -7H ₂ O; Reagent 4: 5 g CaCO ₃ .

Solution 1, solution 2 and reagent 4 are sterilized by high temperature damp heat, solution 3 is filtered and sterilized, solution 1 and solution 2 are cooled and mixed uniformly, then 10 mL of solution 3 is added, mixed with reagent 4, and then deoxidized by anaerobic tank. The ETM buffer formulation is as follows: 270 mM sucrose, 0.6 mM Na ₂ HPO ₄ , 4.4 mM NaH ₂ PO ₄ , l OmM MgCl

The ET buffer formulation was as follows: 270 mM sucrose, 0.6 mM Na ₂ HPO ₄ , 4.4 mM NaH ₂ PO ₄ . Restriction enzymes used in the invention, Taq DNA polymerase and T ₄ DNA ligase were purchased from TaKaRa, KOD plus DNA polymerase commercially available from Toyobo Company.

Other conventional reagents are domestic or imported.

Table 1 provides information on the strains and plasmids required for this application.

Table 1

Strain or plasmid related features

Strain

C. beijerinckii wild type NCIMB

NCIMB 8052

8052xyl xylR:: intron/pWJ 1 -xylR This application

8052xyl ara 8052xylR/pWJl-ara This application

E.coli DH5a Commonly used cloning host strain Takara

Plasmid

pWJl class II intron, ItrA full of this plasmid

SEQ ID NO.:

pWJl-xyl is derived from pWJl and can be included in this application.

Sub-insertion of the xylR gene

787/788nt bit xylR

pWJl-ara is derived from pWJl and can be included in this application.

Sub-insertion of the araR gene

540/54 lnt

a xylR, a transcriptional regulator of xylose metabolism; araR, a transcriptional regulator of arabinose metabolism; ItrA, LtrA protein, required for reverse cleavage.

The following table provides the primers used in this application. Primer sequence number description xylR787|788s— IBS AAAACTCGAGATAATTATCCTTAC xylR Targetron bow | ATACCCATCTAGTGCGCCCAGATA

GGGTG

SEQIDNO.: 42

Xyl 787|788s-EBS CAGATTGTACAAATGTGGTGATA xylR Targetron bow | Id ACAGATAAGTCCATCTATGTAACT

TACCTTTCTTTGT SEQIDNO.: 43

Xyl 787|788s-EBS TGAACGCAAGTTTCTAATTTCGG xylR Targetron bow | 2 TTGTATGTCGATAGAGGAAAGTG

TCT

SEQIDNO.: 44

xylR— 569-588 ATTTATCTGCTTACTACGAG xylR internal positive

SEQ ID NO.: 45 Primer, from 569th to 588th base xyl _918-937 AATTCGATAGACCTAAAGAC xylR Internal reversal

SEQIDNO.: 46 Primers, from 918 to 937 bases ara 540|541s-IBS AAAACTCGAGATAATTATCCTTAA araR Targetron bow |

ATTCCGCATATGTGCGCCCAGATA

GGGTG

SEQIDNO.: 47

Ara 540|541s-EBSl CAGATTGTACAAATGTGGTGATA araR Targetron bow | d ACAGATAAGTCGCATATATTAACT

TACCTTTCTTTGT SEQIDNO.: 48

Ara 540|541s-EBS2 TGAACGCAAGTTTCTAATTTCGG araR Targetron bow |

TTGAATTCCGATAGAGGAAAGTG

TCT SEQIDNO.: 49

Ara _N 159 TTTAGTACAAGAAGGCTGGAT araR internal positive

SEQ ID NO.: 50 primers starting from the 159th base

Ara _983 CATTTGGCTGCTCTTATTCC araR internal reversal

SEQ ID NO.: 51 Primer, starting with the 983th base

dpIMPl-fw GCAAGAGGCAAATGAAATAG is located in plasmid pIMPl

SEQIDNO.: 52 Forward Primers on the Skeleton

Overview of the embodiment

The targetron fragment for interrupting the xy/R gene and the araR gene was amplified by PCR, and then ligated with the pWJ1 vector digested with the same restriction enzyme to obtain plasmids pWJl-xylR and pWJl-araR, and electroporation was carried out. Clostridium NCIMB 8052 and Clostridium beijerii 8052xylR were then identified by Clostridium plasmid PCR to identify recombinant bacteria with introns inserted into the genome. Fermentation verification confirmed that the consumption rate of xylose and arabinose in the mixed sugar was increased. Specifically, it is as shown in the following examples. Example 1

Construction of pWJl-xylR plasmid vector

The xylRtargetron fragment was amplified by PCR, and then digested with X/w nfisrG I and ligated with the pWJ1 vector which was also digested with X/wI and ^rGI to obtain the disruption plasmid pWJl-xylR, wherein PCR amplification xy/ Rtargetron's template and primer design method was derived from Sigma-Aldrich's TargetronTM Gene Knockout System (TAO100) kit. The specific steps are as follows:

1.1 PCR amplification of the bow I

The primers xylR787|788s-IBS, xyl 787|788s-EBSld and xylR787|788s-EBS2 were designed to construct the pWJl-xyl plasmid vector by the method provided by the TargetronTM Gene Knockout System (TAOlOO) kit. The EBS universal primer (EBS universal) required for PC amplification is supplied by the TargetronTM Gene Knockout System (TAO100) kit.

1.2 PCR amplification PCR amplification using Sigma-Aldrich's TargetronTM Gene Knockout System (TAO100) kit (PCR reaction conditions: 94 ° C for 30 s, 94 ° C for 30 s, 55 ° C for 30 s, 72 ° C for 30 s 30 cycles, 72 ° C for 2 min, 4 ° C preservation), the template and reagents required for amplification are provided by the kit, and the PCR product is subjected to agarose gel electrophoresis, and then the strip at 350 bp is recovered by using Huayan's gel recovery kit.

1.3 Construction of pWJ l-xylR recombinant plasmid vector

Colonies obtained by colony PCR (reagents supplied by Sigma-Aldrich of Targetron ^TM Gene Knockout System (TAOlOO) kit conditions: 95 ° C 5min, 94 ° C 30s, 55 ° C 30s, 72 ° C30s 30 cycles , 72 ° C 2 min, 4 ° C preservation), to detect whether the 350 bp targetron fragment is ligated into the pWJl vector, PCR amplification primers for IBS and EBSld.

PCR results (Figure 1) show that colony PCR can amplify a 350 bp specific band.

The PCR-positive colonies were picked and expanded in LB liquid medium to extract the plasmid. Then, using dpIMPl-fw as a primer, the extracted plasmid was used as a template for sequencing. The results showed that the targetron fragment was indeed ligated into the pWJ1 vector, and the successfully constructed pWJ1-xylR recombinant plasmid vector was obtained. Example 2

Construction and detection of Clostridium beijerinckii xylR mutant and loss of knockout plasmid

2.1 pWJ l-xylR plasmid electroporation into C. beijerinckii 8052

Take 190 L of the above suspension solution, add 10 L (about l~3 g) of pWJl-xylR plasmid (operating on ice), mix and transfer to an electric rotor (2 mm diameter), and rotate with a Bio-Rad MicroPulserTM electrorotator. , voltage 1.8kV, the rest of the reference manual, after the electric shock, quickly add 1mL of normal temperature CGM medium, after incubation at 37 ° C for 8hr, 200 L of cell solution was applied to CGM plate with 10 g / mL erythromycin , culture in anaerobic chamber at 37 ° C for about 2 to 3 days.

2.2 PCR verification of colonies

The PCR reagent used was xylR-569-588 and xylR-918-937;

The product obtained by the PCR reaction was subjected to agarose gel electrophoresis, and the results are shown in Fig. 2. According to the results of Fig. 1, the two transformants obtained were all mutants in which an intron was inserted.

2.3 Loss of 8052/pWJ l-xylR knockout plasmid

The 3μ1 transformants grown to logarithmic growth phase were transferred to 5 ml CGM-free and erythromycin-containing (20 g/ml) tubes, and transferred once every 12 to 15 hours until the resistant tubes no longer grew. This process takes about 2 days. The corresponding anti-intestinal solution is coated at this time. Colony PCR and sequencing verification ensure the insertion of the intron. The mutant strain with the missing knockout plasmid is named 8052xylR for subsequent metabolism. Engineered. Example 3

Construction of pWJ 1-araR plasmid vector

The construction method is the same as that of Example 1, except that the primers used in the construction are: ara 540|541 s-IBS, araR540|541s- EBSld and araR540|541 s- EBS2. Example 4

Construction, detection and knockout of the knockout of the xylRaraR mutant strain of Clostridium beijerii

The method was the same as in Example 2 except that the electrotransformed host was 8052xylR, the plasmid was pWJl-araR, and the identified primers were araR-N159 and araR-C983. According to the results of Fig. 2, all the four transformants obtained were inserted into the inclusion. Mutant of the child. Example 5

Fermentation of Clostridium beijerii xylR, Clostridium beijerinckii xylRaraR in E-JL

Single bacteria were picked from CGM plate and inserted into 5ml CGM liquid medium, cultured to log phase, transferred to lml to 9ml E-JL medium for fermentation and fermentation, and the fermentation broth was used to detect residual sugar content (using WATERS company's sugar) -park column determined by Agela 1200 HPLC) and acetone, butanol and ethanol content (determined using an Agela 7890A gas chromatograph), wherein the following pretreatment is required before determining the residual sugar content in the fermentation broth: after the fermentation broth is centrifuged, respectively The supernatant was taken and diluted to a temperature of 3⁄40 and used for the determination of residual sugar. When measuring the solvent, 400 L of the supernatant was mixed with 100 L of internal standard to determine acetone, butanol and ethanol. The internal standard formula was: 25 g of isobutanol, 5 g of isobutyric acid, 50 mL of 37% concentrated hydrochloric acid, and the volume was adjusted to a volume of water. 1L).

The results are shown in the table below.

NCIMB 8052 13.64

0.00 0.00 0.00 0.28 0.34 xyl ara According to the results in Table 3, the arabinose consumption rate, production efficiency and conversion rate of the 8052xylR mutant strain were higher than that of the wild strain, while the 8052xylRaraR was based on 8052xylR, the arabinose consumption rate, production efficiency and conversion rate. Further improve.

Therefore, the inactivation of the xy gene after inactivation of the second intron and the inactivation of the araR gene by the insertion of the second intron are significantly improved by the ability to mix arabinose in the mixed sugar, and the concentration of ABE produced by the transformation is correspondingly raised. Example 6

Examples 1 and 2 were repeated except that the xylR gene was replaced with the araR gene, and fermentation assay was carried out in accordance with the method of Example 5.

The results showed that the Arabidopsis consumption rate, production efficiency, and transformation rate of the mutant strain in which the araR gene alone was inactivated were higher than those of the wild strain. Embodiment 3

The terms, materials and methods used in this example are as follows - the strain C. beijerinckii: Clostridium beijerinckii NCIMB 8052, purchased from NCIMB. The cy/R and araR genes in the strain C. beijerinckii are known in the art, and their numbers in the genome of the NCBI nucleic acid database are: cbei2385 and cbei4456, respectively.

"8052xyl ara" refers to a strain constructed based on Clostridium beijerinckii 8052xylR, in which the expression of the xy/R gene and the araR gene are simultaneously inhibited or not expressed.

The "recombinant knockout plasmid vector pWJl-xylR" refers to a recombinant plasmid vector for knocking out the gene cy/R, wherein the xy/R-targetron fragment used refers to the bases in the IBS, EBS2, EBS ld sites. After modification, a fragment for knocking out the cy/R gene, which belongs to a part of the L LLtrB intron, which is a prokaryotic second intron comprising the ltrA gene. "Recombinant knockout plasmid vector pWJl-araR" refers to a recombinant plasmid vector for knocking out the gene a R , wherein the araR-targetron fragment used refers to the modification of the bases of the IBS, EBS2, EBS Id sites, A fragment for knocking out the a R gene, which belongs to a part of the L1.LtrB intron, and the L1.LtrB class II intron is a prokaryotic class II intron comprising the ltrA gene.

The preparation method of E-JL medium (per liter) is as follows:

Solution 1, solution 2 and reagent 4 are sterilized by high temperature damp heat, solution 3 is filtered and sterilized, solution 1 and solution 2 are cooled and mixed uniformly, then 10 mL of solution 3 is added, mixed with reagent 4, and then deoxidized by anaerobic tank.

The ETM buffer formulation is as follows: 270 mM sucrose, 0.6 mM Na ₂ HPO ₄ , 4.4 mM NaH ₂ PO ₄ , lOmM MgCl

The ET buffer formulation was as follows: 270 mM sucrose, 0.6 mM Na ₂ HPO ₄ , 4.4 mM NaH ₂ PO ₄ .

The formula of A-JL fermentation medium is as follows:

A—Several — Glucose A-JL-GXA Total sugar 60 g/L (glucose) 60 g/L mixed sugar (Glu : Xyl : Ara=23. 06 : 15· 08 : 1.85)

(NH ₄ ) ₂ S0 ₄ 2 g/L 2 g/L

MgS0 ₄ . 7H ₂ 0 0. 2 g/L 0. 2 g/L

MnS0 ₄ . H ₂ 0 0. 01 g/L 0. 01 g/L

NaCl 0. 01 g/L 0. 01 g/L

FeS0 ₄ . 7H ₂ 0 0. 01 g/L 0. 01 g/L

CaC0 ₃ 5. 0 g/L 5. 0 g/L

Potassium acetate 3. 12 g/L 3. 12 g/L

Anhydrous sodium sulfate 3. 85 g/L 3. 85 g/L The restriction enzymes used in the present invention, Taq DNA polymerase and T ₄ DNA ligase were purchased from TaKaRa, and KOD plus DNA polymerase was purchased from Toyobo. the company.

Other conventional reagents are domestic or imported.

Table 1

Strain or plasmid related features

Strain

MM1588 C. beijerinckii NCIMB 8052 NCIMB

Wild type

8052/pIMPl-Pptb 8052/pIMPl-Pptb This application

MM 1643 8052xylR/pWJl-ara This application

CIBTS0795 8052xyl araR/pIMP 1 -xylTptb This application

E. coli DH5a Commonly used clonal host strain Takara

Plasmid

pWJl class II intron, ItrA See the entire sequence of this plasmid

SEQ ID NO. : 1

pWJl-ara is derived from pWJl and can be inserted into the inline

540/54 lnt into the araR gene

xylR, a transcriptional regulator of xylose metabolism; a R, a transcriptional regulator of arabinose metabolism. The following table provides the primers used in this application.

Primer sequence number description

Ara 540|541s-IBS AAAACTCGAGATAATTATCCTTAA araR Targetron bow |

ATTCCGCATATGTGCGCCCAGATA

GGGTG

SEQIDNO.: 47

TACCTTTCTTTGT SEQIDNO.: 48

Ara 540|541s-EBS2 TGAACGCAAGTTTCTAATTTCGG araR Targetron bow |

TTGAATTCCGATAGAGGAAAGTG

TCT

SEQIDNO.: 49

Ara N159 TTTAGTACAAGAAGGCTGGAT araR internal positive

SEQ ID NO.: 50 primers starting from the 159th base

Ara C 983 CATTTGGCTGCTCTTATTCC araR internal reversal

SEQ ID NO.: 51 Primer, from the 983th base of the female, 厶 dpIMPl-fw GCAAGAGGCAAATGAAATAG located in the plasmid pIMPl

SEQIDNO.: 52 Forward Primers on the Skeleton

Overview of the embodiment

The targetron fragment of the araR gene was amplified by PCR, and then ligated with the pWJl vector which was digested with the same restriction enzyme to obtain the plasmid pWJl-araR, which was electrotransformed into Clostridium beijerii 8052::xylR/pIMPl-xylTptb, and then A recombinant strain having an intron inserted into the genome was identified by Clostridium plasmid PCR. Four transformant fermentation comparison experiments were performed on NCIMB8052 8052/pIMP1-Pptb, 8052xylR/pIMP 1 -xylTptb, 8052xyl araR/pIMP 1 -xylTptb. Specifically as the following examples Do not.

1 . Construction of pWJ l-araR plasmid vector

The araR targetron fragment was amplified by PCR, then digested with Xhol and BsrG I, and ligated with the pWJ1 vector which was also digested with Xhol and BsrG I to obtain the disruption plasmid pWJl-araR, wherein the template for PCR amplification of araR targetron was obtained. And the primer design method was derived from Sigma-Aldrich's TargetronTM Gene Knockout System (TA0100) kit. The specific steps are as follows:

1.1 PCR amplification primers

PrimerTM Gene Knockout System (TA0100) kit was used to construct the primers araR-540|541s-IBS, ara-540|541s-EBSld and araR-540|541s-EBS2, respectively, for constructing pWJl-araR plasmid vector . The EBS universal primer (EBS universal) required for PCR amplification is supplied by the TargetronTM Gene Knockout System (TAO100) kit. The araR gene sequence is shown in SEQ ID NO: 54:

araR Targetron bow 1

Ara -540|541s-IBS primer:

LACTCGAGA]

(SEQ ID NO: 55)

Ara -540|541s-EBSld primer:

rATTGTACAAATGTGC

CTTTGT ( SEQ ID NO: 56 )

Ara -540|541s-EBS2 primer:

ID NO: 57 )

EBS universal primer: CGAAATTAGAAACTTGCGTTCAGTAAAC ( SEQ ID NO: 58 )

1.2 PCR amplification

PCR amplification using Sigma-Aldrich's TargetronTM Gene Knockout System (TAO100) kit (PCR reaction conditions: 94 30s, 94 30s °C °C, 55 30s °C, 72 30s 30 °C Cycles, 72 2min V, 4°C preservation), the template and reagents required for amplification are provided by the kit, the PCR product is subjected to agarose gel electrophoresis, and then the strip at 350 bp is purified by Axygen's gel recovery kit. band. The results are shown in Figure 11. 1.3 Construction of pWJl-araR recombinant plasmid vector

The vectors pWJl and araR-targetron were digested with Xho I and BsrGI, respectively, and then purified by Axygen's gel recovery kit. The digested araR-targetron fragment was ligated with the digested vector fragment using T4 DNA ligase, and the ligation reaction was carried out in a 16 ° C water bath for 10 hr, and the obtained ligation product was transformed into Escherichia coli DH5 α by CaC12 heat shock method. Competent cells: heat shock at 42 °C for 90 sec, then add 4 LB °C liquid medium for 1 hr, then centrifuge the cells at 4500 rpm for 5 min, and apply to LB solid medium plates containing 100 g/mL ampicillin for culture. -18hr.

Colony PCR was performed on the obtained colonies (reaction reagents were supplied by Sigma-Aldrich's TargetronTM Gene Knockout System (TA0100) kit, conditions: 95 5 min, 94 °C 30s °C, 55 30s °C, 72 30s 30 cycles, 72 2 min V , 4 ° C preservation), to detect whether the 350 bp targetron fragment was ligated into the pWJ1 vector, and the PCR amplification primers were IBS and EBSld. The results are shown in Figure 12.

PCR results showed that colony PCR amplified a 350 bp specific band. The PCR-positive colonies were picked and expanded in LB liquid medium to extract the plasmid. Then, using dpIMPl-fw as a primer, the extracted plasmid was used as a template for sequencing, and the result was as expected: the targetron fragment was indeed ligated into the pWJ1 vector).

2. Construction, detection and knockout of the knockout plasmid of the araR mutant strain of Clostridium beijerii

The pWJl-araR plasmid was electroporated into C. beijerinckii 8052xylR/pIMPl-xylTptb (S卩MM1643). After overnight resuscitation, 200 μl of cell solution was applied to CGM plate supplemented with 10 g/mL erythromycin in an anaerobic chamber. After 48-72 hours of incubation at 37 ° C, single bacteria were picked for colony PCR verification. The specific process is as follows:

2.1 pWJl-ara plasmid electroporation into C. beijerinckii 8052

After C. jejuni 8052xylR/pIMPl-xylTptb was streaked on CGM medium plate for 48 hr, single colony was picked and cultured in 5 mL CGM liquid medium for 16 hr, then 1% inoculum was added to 50 mL CGM liquid medium. Medium culture, when the OD600 of the cultured cells reaches between 0.6 and 0.7, the culture bacteria are taken out. For the preparation of electroporation competent cells. Take 30mL of bacterial solution, centrifuge at 4 ° C, 4500rpm for 10min, discard the supernatant, add 30mL 4 ° C ETM buffer suspension, then centrifuge at 4 ° C, 4500rpm for 10min, discard the supernatant, add lmL 4 ° C ET Buffer, obtained suspension suspension. Take 190 L of the above suspension solution, add lO L (about l~3 g) of pWJl-araR plasmid (operating on ice), mix and transfer to an electric rotor (2 mm diameter), and transfer with a Bio-Rad MicroPulserTM electrorotator. , voltage 201.8kV, the rest of the reference manual, after the electric shock, quickly add 1mL of CGM medium at room temperature, after incubation at 37 ° C for 8hr, 200 L of cell solution was applied to CGM plate with lO g / mL erythromycin , culture in anaerobic chamber at 37 ° C for about 2 to 3 days.

2.2 PCR verification of colonies

After transformation of pWJl-ara plasmid into C. beijerinckii 8052xylR/pIMP1-xylTptb, partial sequences of the second intron may be inserted into the araR gene of the genome, and intron insertion may be used upstream and downstream of the insertion site. The primers were verified by colony PCR (the wild type bacteria without the intron inserted will amplify the 825 bp band, and the recombinant strain inserted with the intron will amplify the band to the 1.8 Kb band). Two transformants were randomly selected for verification. Among them, the C. yumii NCIMB8052 genome was used as a negative control. The specific process is as follows:

The primers used in the PC reaction were araR-N159 and araR-C983;

Ara -N159: TTTAGTACAAGAAGGCTGGAT (SEQ ID NO: 59)

Ara -C983 :CATTTGGCTGCTCTTATTCC ( SEQ ID NO:60)

PCR reaction system: system 100 μ ΐ; 10 X Taq Buffer 10 μ 1; dNTP (2 mM) 10 1; MgC12 (25 mM) 10 1; Taq enzyme 1 μ 1; forward primer (100 mM) 2 μ 1; Primer (100 mM) 2 μl _; colony (toothpick takes up a small amount); water 65 μl.

PCR reaction conditions: 95 5min °C; 95 30s °C, 55 30s °C, 72 1.5min °C, 30 cycles; 72 5min V.

The product obtained by the PCR reaction was subjected to agarose gel electrophoresis, and the results are shown in Fig. 13. According to the results of Fig. 13, the obtained seven transformants were all mutants in which an intron was inserted.

2.3 Sequencing verification of positive transformants

The positive transformants corresponding to those in Figure 2 were randomly picked and cultured in CGM liquid medium supplemented with 10 g/mL erythromycin, and the genome was extracted. Using the extracted genome as a template, with araR-N159 and araR-C983 was subjected to PCR amplification of the primer pair, and the amplified 1.8 kb DNA band was recovered and sequenced. The sequencing results showed that the 381-1925 DNA of the sequence of the sequence was an inserted intron sequence, that is, the intron sequence was accurately inserted between the predicted 540|541 sites. 2.4 8052xyl araR/pIMP 1 -xylTptb /pWJl-ara knockout plasmid pWJl -araR loss 3μ1 transformant to logarithmic growth phase transferred to 5ml CGM no anti-antibody and erythromycin (20 g/ml) In the test tube, transfer it once every 12~15 hours until the resistant test tube no longer grows. This process takes about 2 days. At this time, the corresponding anti-test tube liquid is coated, colony PCR, sequencing verification (same as 2.2, 2.3) Guarantee the insertion of the intron, and rename the mutant strain with the knockout plasmid named 8052xylRaraR/pIMPl-xylTptb (ie CIBTS0795) for subsequent metabolic engineering.

3. NCIMB8052, 8052/pIMPl-Pptb, 8052xylR/pIMP 1 -xylTptb (MM 1643), 8052xyl araR/pIMP 1 -xylTptb (CIBTS0795) Fermentation comparison test for strain 8052/pB!Pl-Pptb, NCIMB8052, 8052xylR/pIMPl -xylTptb (MM1643) ,

8052xylRaraR/pIMPl-xylTptb (CIBTS0795), respectively, single bacteria, each strain picked 3 single bacteria to 0. 8 ml CGM medium test tube overnight, add 2 ml CGM medium, 3-6 hours later, OD0. 6 -1 was inoculated with 10% into fermentation medium A-JL, and fermentation was carried out for 48 hours. The fermentation results were analyzed by liquid chromatography to obtain the following data:

0 hour medium component content (g / liter)

48 hours analysis result

From the above table, it can be concluded that 8052xylRaraR/pIMPl-xylT can significantly improve the utilization of arabinose in the mixed sugar medium compared with 8052xylR/pIMPl-xylT.

In summary, the method provided by the present invention interrupts the expression of the xylR gene in Clostridium beijerinckii and/or increases the activity of the xylose transporter. In the strain provided by the present invention, the xylR gene is inserted into the second class of introns. The ability of the strain after the live and/or xylT gene is excessively increased by using xylose, and the concentration of ABE produced by the transformation is correspondingly increased, and a similar phenotype is also observed in the fermentation of lignocellulose hydrolyzate, so the strain is hydrolyzed by lignocellulose. The application prospect of liquid for acetone butanol fermentation. References 1. Keis, S., . Shaheen, and DT Jones, Emended descriptions of Clostridium acetobutylicum and Clostridium beijerinckii, and descriptions of Clostridium saccharoperbutylacetonicum sp. no v. and Clostridium saccharobutylicum sp. nov. Int J Syst Evol Microbiol, 2001. 51(Pt 6): p. 2095-103.

2. Parekh, Μ·, J. Formanek, and H.P. Blaschek, Development of a cost-effective glucose corn steep medium for production of butanol by Clostridium beijerinckii.

Journal of Industrial Microbiology & Biotechnology, 1998. 21(4-5): p. 187-191.

3. Mitchell, WJ, Carbohydrate uptake and utilization by Clostridium beijerinckii NCIMB 8052. Anaerobe, 1996. 2(6): p. 379-384.

Lee, J. and H.P. Blaschek, Glucose uptake in Clostridium beijerinckii NCIMB 8052 and the solvent-hyperproducing mutant BA101. Appl Environ Microbiol, 2001. 67(11): p. 5025-31.

Stephens, C, et al, Regulation of D-xylose metabolism in Caulobacter crescentus by a Lacl-type repressor. J Bacteriol, 2007. 189(24): p. 8828-34.

Rodionov, D.A., A.A. Mironov, and M.S. Gelfand, Transcriptional regulation of pentose utilisation systems in the Bacillus/Clostridium group of bacteria. FEMS Microbiol Lett, 2001. 205(2): p. 305-14.

Heo, G.Y., et al., Deletion of xylR gene enhances expression of xylose isomerase in Streptomyces lividans TK24. J Microbiol Biotechnol, 2008. 18(5): p. 837-44.

Sizemore, C, et al" Regulation of Staphylococcus xylosus xylose utilization genes at the molecular level. J Bacteriol, 1992. 174(9): p. 3042-8.

Scheler, A., et al" Molecular cloning, structure, promoters and regulatory elements for transcription of the Bacillus licheniformis encoded regulon for xylose utilization. Arch Microbiol, 1991. 155(6): p. 526-34.

Xiao, Η·, et al., Confirmation and Elimination of Xylose Metabolism Bottlenecks in Glucose Phosphoenolpyruvate-Dependent Phosphotransferase System-Deficient Clostridium acetobutylicum for Simultaneous Utilization of Glucose, Xylose, and Arabinose. Appl Environ Microbiol, 2011. 77(22): p . 7886-95.

Ren, C, et al., Identification and inactivation of pleiotropic regulator CcpA to eliminate glucose repression of xylose utilization in Clostridium acetobutylicum. Metab Eng, 2010. 12(5): p. 446-54.

Pfaffl, M.W., A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res, 2001. 29(9): p. e45.

Claims

Claim

A recombinant Clostridium beijerincii which inhibits the activity of xylR gene expression and/or xylR protein, and the activity of arar gene and/or aar protein is inhibited, and/or The activity of the xylose transporter and/or the expression of its coding gene are increased.

2. The recombinant C. beijerinckii according to claim 1, wherein the recombinant Bayer's bacterium is obtained by genetic engineering treatment selected from one or more of the following groups: in the C. beijerinckii genome Inserting an exogenous DNA fragment into the xylR gene, knocking out all or part of the xylR gene by homologous recombination, and inhibiting the expression of the xylR gene by antisense nucleic acid technology; inserting foreign DNA into the araR gene of the Clostridium beijerii genome Fragmenting, knocking out all or part of the araR gene by homologous recombination, and inhibiting the expression of the araR gene by antisense nucleic acid technology; introducing an additional xylose transporter into the genome of Clostridium beijerincii, and introducing an increased xylose transporter A mutant that expresses or viable, or provides an expression vector that expresses a xylose transporter.

The recombinant Mycobacterium baumannii according to claim 2, wherein the exogenous DNA fragment is inserted between the first to the 798th bases of the xyl gene in the C. beijerinckii genome.

The recombinant C. beijerinckii according to claim 3, wherein an exogenous DNA fragment is inserted between the first to the 171th bases of the xylR gene, or the first of the xylR genes An exogenous DNA fragment was inserted between the 240 and the 798th position.

The recombinant C. beijerincii according to claim 3, wherein an exogenous DNA fragment is inserted between the 787th and 788th positions of the xylR gene.

The recombinant C. beijerincii according to claim 2, wherein an exogenous DNA fragment is inserted between the first to the 1074th bases of the araR gene in the C. beijerinckii genome.

7. The recombinant C. beijerinckii according to claim 6, wherein an exogenous DNA fragment is inserted between bases 15 to 219 of the araR gene, or in the araR gene. An exogenous DNA fragment was inserted between 252 and the 1005th position.

The recombinant Bayer's bacterium according to claim 2, wherein the C. beijerinckii is introduced with a recombinant plasmid vector overexpressing a xylose transporter.

9. The recombinant C. beijerinckii according to claim 8, wherein the overexpressing recombinant plasmid vector comprises a promoter derived from Clostridium acetobutylicum ATCC824 ptb gene and a C. beijerinckii NCIMB 8052 xylT gene. Or a promoter derived from Clostridium acetobutylicum ATCC824 thl gene and Clostridium beijerinckii NCIMB 8052 xylT gene.

10. Recombinant C. beijerincii with CCTCC NO: M 2012014.

11. A method selected from one or more of the group consisting of:

(1) Increasing the consumption rate and/or utilization rate of xylose and/or arabinose in the fermentation of Clostridium beijerinckii;

(2) Improve the ability of C. beijerincis to produce solvents;

(3) Increasing the efficiency of production of solvent by Clostridium beijerii fermentation;

The method comprises the steps of: inhibiting the activity of the Clostridium beijerinckii xylR protein and/or the expression of the gene encoding the same, inhibiting the activity of the araR protein of Clostridium beijerinckii and/or the expression of the gene encoding the same, and/or increasing the xylose transporter The viability of the protein and/or the expression of its coding gene.

12. The method according to claim 11, wherein the expression of the Clostridium beijerinckii xylR gene is inhibited by a method selected from the group consisting of: inserting an exogenous DNA fragment into the xylR gene of the Clostridium beijerii genome, Homologous recombination knocks out all or part of the xylR gene, and inhibits expression of the xylR gene using antisense nucleic acid technology; inhibits expression of the araR gene of C. beijerincii by a method selected from the group consisting of: Inserting an exogenous DNA fragment into the araR gene, knocking out all or part of the araR gene by homologous recombination, and inhibiting the expression of the araR gene by using an antisense nucleic acid technique; increasing the xylose transport of the B. jejuni by a method selected from the group consisting of Expression of the protein: introduction of an additional xylose transporter in the C. beijerinckii genome, introduction of a mutation that increases the expression or viability of the xylose transporter, and expression of an expression vector expressing the xylose transporter.

The method according to claim 12, wherein the expression of the Clostridium beijerinckii xylR gene is inhibited by inserting between the first to the 798th bases of the xylR gene in the C. beijerinckii genome. Exogenous DNA fragments.

14. The method according to claim 13, wherein an exogenous DNA fragment is inserted between bases 1 to 171 of the xylR gene, or an exogenous DNA fragment is inserted between positions 240 and 798. .

15. The method according to claim 14, wherein an exogenous DNA fragment is inserted between positions 787 and 788 of the xylR gene.

The method according to claim 12, wherein the expression of the araR gene of Clostridium beijerii is inhibited by inserting between the first to the 1074th bases of the araR gene in the genome of the C. beijerinckii Exogenous DNA fragments.

17. The method according to claim 16, wherein an exogenous DNA fragment is inserted between bases 15 to 219 of the araR gene, or 252 and 1005 Foreign DNA fragments were inserted between the positions.

The method according to claim 12, wherein the overexpression recombinant plasmid vector carries the xylose transporter gene into the strain for expression, thereby realizing overexpression of the xylose transporter gene.

19. The method according to claim 18, wherein the overexpressing recombinant plasmid vector comprises a promoter derived from Clostridium acetobutylicum ATCC824 ptb gene and a C. beijerinckii NCIMB 8052 xylT gene, or is derived from The promoter of the C. acetobutylicum ATCC824 th1 gene and the C. beijerinckii NCIMB 8052 xylT gene.

20. The recombinant Clostridium beijerii prepared by the method of any one of claims 11-19.

The use of Clostridium beijerincundi according to any one of claims 1 to 10, characterized in that it is used for the production of an organic solvent; preferably, the solvent is selected from the group consisting of: ethanol, acetone , butanol, or a combination thereof.

22. A method of producing an organic solvent, the organic solvent being: ethanol, acetone, butanol, or a combination thereof, comprising the steps of:

(A) cultivating the C. beijerincii according to any one of claims 1 to 10 and 20, under suitable conditions, to obtain a culture containing the organic solvent;

(B) separating and/or purifying the organic solvent from the culture.

23. The method according to claim 22, wherein the suitable condition comprises: the recombinant Clostridium beijerii according to any one of claims 1 to 10 and 20 and xylose and/or arabinose. The material is contacted and fermented under conditions suitable for fermentation of the recombinant C. beijerinckii.

24. The method of claim 23, wherein the xylose and/or arabinose-containing material is selected from the group consisting of: a hydrolysate of cellulose or hemicellulose, grain, and cotton.