WO2013159021A1 - Engineered collagen binding mscramm with enhanced affinity for collagen - Google Patents

Abstract

The present invention includes a collagen binding MSCRAMMs AceC4 (1) and AceC1C4 (2) with altered collagen specificity and collagen affinity having (1) an Ace_32-367 amino acid sequence with the following substitution; the Ace_32-367 C-D loop, D-strand and D-D' loop from the N₁ subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna_31-344 or (2) an Ace_32-367 amino acid sequence with the following substitutions; the Ace_32-367 C-D loop, D-strand and D-D' loop from the N₁ subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna3_31-344 and the Ace_32-367 N₁N₂ interdomain linker is replaced with the Cna_31-344 N₁N₂ inter-domain linker, wherein the substitutions provide a tight interaction with a collagen helix.

Description

ENGINEERED COLLAGEN BINDING MSCRAMM WITH ENHANCED

AFFINITY FOR COLLAGEN

Technical Field of the Invention

The present invention relates in general to the field of collagen-binding proteins, specifically to compositions of matter and methods of making and using collagen-binding MSCRAMMs, Ace and Cna proteins.

Background Art

Without limiting the scope of the invention, its background is described in connection with collagen- binding proteins. For example, U.S. Patent No. 7,638,135 entitled Collagen-Binding Proteins from Enterococcal Bacteria, incorporated herein by reference, discloses a collagen-binding MSCRAMM Ace from enterococcal bacteria which is homologous to the ligand-binding region of Cna, the collagen- binding MSCRAMM from Staphylococcus aureus, and which can be utilized to inhibit adhesion of enterococcal bacteria to extracellular matrix proteins. The N-terminal region of Ace contains a region or A domain and contains several 47-residue tandem repeat units between the collagen-binding site and cell wall-associated regions. The Ace protein can be utilized in methods of preventing and/or treating enterococcal infection, and in addition, antibodies raised against Ace, or its A domain, can be used to effectively inhibit the adhesion of enterococcal cells to a collagen substrate.

U.S. Patent No. 6,617,156 entitled Nucleic Acid and Amino Acid Sequences Relating to Enterococcus Faecalis for Diagnostics and Therapeutics, incorporated herein by reference, discloses an isolated polypeptide and nucleic acid sequences derived from Enterococcus faecalis that are useful in diagnosis and therapy of pathological conditions; antibodies against the polypeptides; and methods for the production of the polypeptides. The invention also provides methods for the detection, prevention and treatment of pathological conditions resulting from bacterial infection.

U.S. Patent No. 6,908,994 entitled Collagen-Binding Proteins from Enterococcal Bacteria, incorporated herein by reference, discloses a collagen-binding MSCRAMM Ace from enterococcal bacteria which is homologous to the ligand-binding region of Cna, the collagen-binding MSCRAMM from Staphylococcus aureus, and which can be utilized in a similar manner as other collagen-binding MSCRAMMs to inhibit adhesion of enterococcal bacteria to extracellular matrix proteins. The N-terminal region of Ace contains a region, or A domain, which appears to be equivalent to the minimal ligand-binding region of the collagen-binding protein Cna, and contains several 47-residue tandem repeat units, called B domain repeat units, between the collagen-binding site and cell wall-associated regions. The Ace protein of the invention can thus be utilized in methods of preventing and/or treating enterococcal infection, and in addition, antibodies raised against Ace, or its A domain, can be used to effectively inhibit the adhesion of enterococcal cells to a collagen substrate. The Ace protein of the present invention is thus a functional collagen-binding MSCRAMM and can be utilized to treat or prevent invention in the same manner as other isolated MSCRAMMs have been utilized, namely in methods of treating or preventing infections and diseases caused by enterococcal bacteria.

U.S. Patent No. 6,288,214, entitled Collagen Binding Protein Compositions and Methods of Use, incorporated herein by reference, discloses the Cna gene and Cna-derived nucleic acid segments from Staphylococcus aureus, and DNA segments encoding Cna from related bacteria. Also disclosed are Col binding protein (CBP) compositions and methods of use. The CBP protein and antigenic epitopes derived therefrom are contemplated for use in the treatment of pathological infections, and in particular, for use in the prevention of bacterial adhesion to Col. DNA segments encoding these proteins and anti- (Col binding protein) antibodies will also be of use in various screening, diagnostic and therapeutic applications including active and passive immunization and methods for the prevention of bacterial colonization in an animal such as a human. These DNA segments and the peptides derived therefrom are contemplated for use in the preparation of vaccines and, also, for use as carrier proteins in vaccine formulations, and in the formulation of compositions for use in the prevention of S. aureus infection.

U.S. Patent No. 5,491,130 entitled Peptide Inhibitors of Fibronectin and Related Collagen-Binding Proteins, incorporated herein by reference, discloses peptides derived from the second type 1 repeat of human endothelial cell thrombospondin which bind to the gelatin-binding domain of fibronectin which have been isolated and synthetically produced. The peptides Cna be used to bind to fibronectin or other related collagen-binding proteins to inhibit fibronectin-dependent cell adhesion to collagen matrices and to inhibit interactions with collagen of other proteins that share homologies with the gelatin-binding domain of fibronectin.

U.S. Patent No. 7,638,135 entitled Collagen-Binding Proteins from Enterococcal Bacteria, incorporated herein by reference, discloses a collagen-binding MSCRAMM Ace from enterococcal bacteria which is homologous to the ligand-binding region of Cna, the collagen-binding MSCRAMM from Staphylococcus aureus, and which can be utilized to inhibit adhesion of enterococcal bacteria to extracellular matrix proteins. The N-terminal region of Ace contains a region, or A domain, and contains several 47-residue tandem repeat units between the collagen-binding site and cell wall-associated regions. The Ace protein can be utilized in methods of preventing and/or treating enterococcal infection, and in addition, antibodies raised against Ace, or its A domain, can be used to effectively inhibit the adhesion of enterococcal cells to a collagen substrate.

Disclosure of the Invention

The present invention provides collagen-binding MSCRAMMs, Ace and Cna proteins. In spite of overall structural similarity, recombinant forms of the ligand-binding domains exhibit significantly different affinities and binding kinetics for type I collagen (CI) in vitro. The present invention provides, in sub- molecular detail, the bases for these differences. Using a structure-based approach, the present invention provides engineered Cna and Ace variants by altering specific structural elements within the ligand- binding domains. Surface Plasmon Resonance-based binding analysis demonstrates that the orientation of the Ace and Cna Ni and N₂ sub-domains significantly affects the interaction between the MSCRAMM and CI in vitro, including affinity, dissociation rate and binding ratio. Moreover, the present invention provides an Ace variant with a CI affinity that was about 11000 fold higher than the parent protein. The present invention provides several engineered proteins that exhibited a weak interaction with CI, recognized more sites on CI, suggesting an inverse correlation between affinity and specificity.

One embodiment of the present invention provides a process of designing collagen binding MSCRAMMs with altered specificity and affinity. For example, the present invention provides recombinant proteins, AceC4 and AceClC4, that demonstrate a dramatic increase in affinity for collagen. AceC4 and AceClC4 are protein chimeras containing amino acid sequences from two well-characterized collagen- binding proteins; Ace from Enterococcus faecalis (Rich et al. 1999) and Cna from Staphylococcus aureus (Patti et al. 1993). Native Cna and Ace proteins reside on the bacterial surface and results obtained using animal models indicate that these proteins are adhesins and important virulence factors. S. aureus strains that do not produce the Cna protein exhibited decreased virulence in animal models of arthritis, osteomyelitis, endocarditis, mastitis and keratitis (Patti et al. 1993, 1994; Hienz et al. 1996; Mamo et al. 2000; Rhem et al. 2000; Elasri et al. 2002). Furthermore, antibodies raised against Cna are protective in a mouse model of septic death (Nilsson et al. 1998).

One embodiment of the present invention provides a collagen binding MSCRAMMs AceC4 (1) and AceClC4 (2) with altered collagen specificity and collagen affinity having (1) an Ace₃₂-367 amino acid sequence with the following substitution; the Ace₃₂-367 C-D loop, D-strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna₃1.344 and (2) an Ace₃₂-367 amino acid sequence with the following substitutions; the Ace₃₂-367 C-D loop, D-strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna3i_344 and the Ace₃₂-367 iN₂ interdomain linker is replaced with the Cna₃i_34₄ NiN₂ inter-domain linker. These substitutions provide a tight interaction with a collagen helix.

One embodiment of the Cna31-344 Ni subdomain comprises a β-strand and two loops connecting the β- strand. In one embodiment the AceC4 and AceClC4 collagen binding MSCRAMMs have an affinity for type I collagen that is 630-13,000 fold higher than Ace₃₂-367- In one embodiment the AceC4 and AceClC4 collagen binding MSCRAMMs have an affinity for type I collagen that is 10 to 500-fold higher than Cna31-344. In one embodiment the AceC4 and AceClC4 collagen binding MSCRAMMs has an affinity for type I collagen that is about 630-13,000 -fold higher than Ace₃₂-367 and about 20-fold higher than Cna31-344. In one embodiment the AceC4 and AceClC4 collagen binding MSCRAMMs has an affinity for type I collagen that is more than 630-13,000 -fold higher than Ace₃₂-367 and more than 20-fold higher than Cna31-344. The ranges used herein may include every value within that range and incremental values listed there in, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 50, 100, 125, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 630, 700, 725, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500,2000, 2500, 3000, 4000, 5000, 6000, 7000, 8000, 9000, 10000, 11000, 12000, 13000- fold increase; a range of 10 to 500 may include any value from 10 to 500 (10, 15, 20, 25, 50, 100, 125, 150, 200, 250, 300, 350, 400, 450, 500 and be 20-500, 50-400, 100-300, 125-150 etc.)

One embodiment of the present invention provides a AceC4 (1) and AceClC4 (2) binding proteins with specificity and affinity for a collagen like molecule includes (1) an Ace₃₂-367 amino acid sequence with the following substitution; the Ace32-367 C-D loop, D-strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna₃1.344 and (2) an Ace₃₂-367 amino acid sequence with the following substitutions; the Ace₃₂-367 C-D loop, D-strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna₃i_34₄ and the Ace₃₂-367 iN₂ inter-domain linker is replaced with the Cna₃i_34₄ NiN₂ inter-domain linker. One embodiment of the rod-like molecule comprises a collagen and/or coiled-coil motif.

One embodiment of the present invention provides a collagen binding modified MSCRAMMs for enhanced ligand binding comprising: a Ni subdomain and a N₂ subdomain connected by an inter-domain linker. 10. In one embodiment the C-D loop, D-strand, D-D' loop within the Ni subdomain is a Cna31- 344 C-D loop, D-strand, D-D' loop Ni subdomain. In one embodiment the N₂ subdomain is a Ace₃₂_3₆7 N₂ subdomain. In one embodiment the inter-domain linker is an Ace 32-367 inter-domain linker (AceC4) or a Cna31-344 inter-domain linker (AceClC4).

One embodiment of the present invention provides a AceC4 and AceClC4 collagen binding modified MSCRAMM wherein the modified MSCRAMM is Cna31-344, wherein the modified MSCRAMM is Ace32-367, wherein the modified MSCRAMM further comprises a N3 subdomain connected to the Ni subdomain or the N₂ subdomain.

One embodiment of the present invention provides a collagen binding modified MSCRAMM for imaging comprising: a modified MSCRAMM that exhibits optimal collagen binding a fluorophore attached to the modified MSCRAMM to form a MSCRAMM-Fluorophore that allows visualization of collagen. In one embodiment the modified MSCRAMM is Cna31-344. In one embodiment the modified MSCRAMM is a ligand-binding domain comprising subdomains Ni and N₂. In one embodiment the modified MSCRAMM is a ligand-binding domain comprising subdomain N3. The modified MSCRAMM is Ace₃₂_367. In one embodiment the modified MSCRAMM is a ligand-binding domain comprising subdomains Ni and N₂. In one embodiment the fluorophore is Oregon Green 488. In one embodiment the MSCRAMM-Fluorophore allows real-time monitoring of collagen synthesis. In one embodiment the MSCRAMM-Fluorophore allows real-time monitoring of collagen within atherosclerotic plaques.

Description of the Drawings

For a more complete understanding of the features and advantages of the present invention, reference is now made to the detailed description of the invention along with the accompanying figures and in which: FIGURES 1A-1C are images of model and crystal structures of Ace and Cna Ligand-binding domains.

FIGURE 2A is a crystal structure of Ace32-367 demonstrating location of inter-domain linker (blue) and C-D loop, D-strand, D-D' -loop (red) within the Ni subdomain where sequences were altered.

FIGURE 2B is a diagram of Ni and N₂ subdomains with labelled beta-strands.

FIGURE 2C is a table of parent and mutant recombinant proteins and corresponding sequences of the inter-domain linker (blue) and the C-D loop, D-strand, D-D' -loop (red).

FIGURE 2D is an image of the structure-based amino acid alignment of the Cna and Ace inter-domain linkers.

FIGURES 3A-3H are graphs of the biacore analysis of the interactions between collagen and recombinant Cna proteins.

FIGURES 4A-4H are graphs of the biacore analysis of the interactions between collagen and recombinant Ace proteins.

FIGURE 5 is a schematic of the Conformational change model of the collagen/Cna31-344 interaction.

FIGURE 6 is a plot of the estimation of Rmax for the binding of collagen to immobilized Cna31-344.

FIGURES 7A-7B are images of crystal structures of FIGURE 7A Ace and Cna and FIGURE 7B the overlap of Ace and Cna.

FIGURES 8A-8C are graphs of the biacore analysis of the interactions between collagen and recombinant Cna, ACE proteins.

Description of the Invention

While the making and using of various embodiments of the present invention are discussed in detail below, it should be appreciated that the present invention provides many applicable inventive concepts that can be embodied in a wide variety of specific contexts. The specific embodiments discussed herein are merely illustrative of specific ways to make and use the invention and do not delimit the scope of the invention.

To facilitate the understanding of this invention, a number of terms are defined below. Terms defined herein have meanings as commonly understood by a person of ordinary skill in the areas relevant to the present invention. Terms such as "a", "an" and "the" are not intended to refer to only a singular entity, but include the general class of which a specific example may be used for illustration. The terminology herein is used to describe specific embodiments of the invention, but their usage does not delimit the invention, except as outlined in the claims.

As used herein, DNA "coding sequence" or a "nucleotide sequence encoding" a particular protein, is a DNA sequence which is transcribed and translated into a polypeptide in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, procaryotic sequences, cDNA from eucaryotic mRNA, genomic DNA sequences from eucaryotic (e.g., mammalian) DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

As used herein, the term "functionally equivalent" intends that the amino acid sequence of the subject protein is one that will elicit an immunological response, as defined above, equivalent to the specified A. pleuropneumoniae immunogenic polypeptide.

Adherence of pathogenic bacteria to the host tissue, mediated by adhesins, is the first event in a multi- step process that may lead to clinically manifested infections. For organisms such as Staphylococcus aureus and E. faecalis, which are primarily extracellular pathogens, ECM (extracellular matrix) components are the targets for adherence. MSCRAMMs (microbial surface components recognizing adhesive matrix molecules) represent a subfamily of bacterial adhesins that recognize and bind to ECM components. Several MSCRAMMs have been isolated and characterized from staphylococci and streptococci, among them the S. aureus collagen-binding MSCRAMM, Cna, such as disclosed in U.S. Patent No. 6,288,214, incorporated herein by reference.

Cna is a mosaic protein with a molecular mass of 135 kDa. This protein features an N-terminal signal sequence followed by a 500-residue long A domain of unique amino acids sequence and a B domain that contains a 110-residue long unit repeated tandemly one to four times in Cna isolated from different strains of S. aureus. The C-terminal region of Cna contains a cell wall-associated domain, which includes the LPXTG motif that is a putative recognition site for the hypothetical enzyme sorotase that covalently links Cna to the cell wall. A hydrophobic transmembrane region is followed by a short cytoplasmic tail rich in positively charged residues. Earlier work showed that the presence of Cna is necessary and sufficient to allow S. aureus cells to adhere to collagenous tissues such as cartilage, and Cna was shown to be a virulence factor in experimental septic arthritis. Vaccination of mice with a recombinant form of the Cna A domain protected against induced staph sepsis.

The Ace proteins, or active fragments thereof, are useful in a method for screening compounds to identify compounds that inhibit collagen binding of enterococci to host molecules. In accordance with the method, the compound of interest is combined with one or more of the Ace proteins or fragments thereof and the degree of binding of the protein to collagen or other extracellular matrix proteins is measured or observed. If the presence of the compound results in the inhibition of protein-collagen binding, for example, then the compound may be useful for inhibiting enterococci in vivo or in vitro. The method could similarly be used to identify compounds that promote interactions of enterococci with host molecules. The method is particularly useful for identifying compounds having bacteriostatic or bacteriocidal properties. Ace is a collagen-binding MSCRAMM. Analyses of the ace gene sequence revealed many elements including the cell wall-anchoring motif characteristic of cell wall-associated surface proteins from Gram- positive bacteria.

Bacterial colonization of host tissues is a critical step in the process of most infections and as a result, many pathogenic bacteria produce proteins that promote bacterial adhesion. One such family of proteins, the MSCRAMMs (microbial surface components recognizing adhesive matrix molecules) interact with components of the host extracellular matrices (Hawiger, Timmons et al. 1982; Patti, Allen et al. 1994; Greene, McDevitt et al. 1995). MSCRAMMs found on Gram-positive bacteria typically belong to a family of cell wall anchored proteins that have similar structural organizations. In general, the amino- terminal (N-terminal) portion of these proteins contains the ligand-binding domain in the so called A region, while the carboxy-terminal (C -terminal) half, contains repeated motifs often known as the B domains that appear to extend and project the ligand-binding domain away from the bacterial surface (Foster and Hook 1998). The C-terminus also contains the cell wall sorting motifs, including the LPXTG sequence, which is essential for sortase dependant anchoring to the cell wall, followed by a stretch of hydrophobic residues and a short segment of positively charged amino acids (Schneewind, Model et al. 1992; Schneewind, Fowler et al. 1995).

Despite the conserved structural organization, this family of MSCRAMMs is largely species specific and homologues with substantial sequence similarities within the ligand-binding domains are not found in other bacteria. One exception is the collagen binding MSCRAMMs, which include Cna from Staphylococcus aureus (Patti, Boles et al. 1993), Ace from Enterococcus faecalis (Rich, Kreikemeyer et al. 1999), Acm of Enterococcus faecium (Nallapareddy, Weinstock et al. 2003), Cne of Streptococcus equi (Lannergard, Frykberg et al. 2003), Cnm of Streptococcus mutans (Sato, Okamoto et al. 2004), RspA and RspB of Erysipelothrix rhusiopathiae (Shimoji, Ogawa et al. 2003) and BA0871 and BA5258 of Bacillus anthracis (Xu, Liang et al. 2004).

The ligand binding regions of Ace and Cna are composed of two subdomains, Ni and N₂, that each adopts a variant of the IgG fold (Symersky, Patti et al. 1997; Zong, Xu et al. 2005; Liu, Ponnuraj et al. 2007). Structural comparisons of Cna₃1.344 in the apo form and in complex with a synthetic collagen peptide lead to the proposal of a multi-step ligand-binding mechanism called the Collagen Hug (Zong, Xu et al. 2005). In this model, ligand binding is initiated by a low-affinity interaction between the ligand and residues present within a shallow "trench" located on the N₂ subdomain. Next, the inter-domain linker wraps around the triple helical collagen and repositions the Ni subdomain. Finally, the complex is stabilized when the C-terminal N₂ extension acts as a "latch," inserting into a cleft and complementing a β-sheet within the neighboring Ni sub-domain (Zong, Xu et al. 2005). In the resulting complex the MSCRAMM forms an inter-domain hole through which the collagen triple helix ligand projects. Structural comparisons and mutagenesis studies indicate that Ace employs this ligand-binding mechanism (Liu, Ponnuraj et al. 2007). Crystal structures of Cna₃i_344 and Ace₃₂-367 indicate that the hole created by ligand hugging (of the inter- domain linker and the Ni and N₂ subdomains) can only accommodate a single collagen triple helix. Therefore it is likely that Cna and Ace interact with monomelic triple helix collagen but not with fibrillar collagen (Zong, Xu et al. 2005; Liu, Ponnuraj et al. 2007). Furthermore, Cna₃1.344 does not recognize gelatin or denatured collagen indicating that the rod-like shape of the triple helix is critical for binding (Zong, Xu et al. 2005).

Expression of Ace and Cna on the surface of E. faecalis and S. aureus, respectively, results in increased bacterial adherence to immobilized collagen type I (CI) (Switalski, Speziale et al. 1989; Patti, Bremell et al. 1994; Rich, Kreikemeyer et al. 1999; Xu, Liang et al. 2004). In addition, surface expression of Ace, mediates E. faecalis adherence to collagen type IV (CIV), laminin and dentin (Nallapareddy, Qin et al. 2000; Hubble, Hatton et al. 2003), while the presence of the cna gene has been associated with adherence of S. aureus clinical isolates to laminin and CIV (de Bentzmann, Tristan et al. 2004). Furthermore, several studies demonstrate that Ace and Cna are virulence factors in different animal models. S. aureus strains harboring the cna gene exhibit increased virulence in animal models of staphylococcal infection, including endocarditis, arthritis, osteomyelitis, mastitis and keratitis (Patti, Bremell et al. 1994; Hienz, Schennings et al. 1996; Mamo, Froman et al. 2000; Rhem, Lech et al. 2000; Elasri, Thomas et al. 2002). It has also been demonstrated that ace-null strains of E. faecalis are attenuated in a murine model of urinary tract infection and a rat endocarditis model (Singh, Nallapareddy et al. 2010). In addition, recombinant forms of Cna can be used as effective vaccine components, while passive immunization with Cna antibodies are protective in a mouse model of S. awrews-induced septic death (Nilsson, Patti et al. 1998). Also, active immunization of rats with Ace₃₂-367 significantly decreases the incidence of endocarditis, while prophylactic treatment of rats with purified Ace antibodies significantly reduces the numbers of E. faecalis isolated from vegetations (Singh, Nallapareddy et al. 2010).

Despite the high degree of structural similarity between Ace₃₂-367 and Cna₃1.344, these proteins demonstrate significantly different affinities and binding kinetics for CI in vitro (Rich, Kreikemeyer et al. 1999; Zong, Xu et al. 2005; Liu, Ponnuraj et al. 2007). To understand the basis for these differences, we used a structure-based approach to engineer proteins harboring alterations within specific structural elements. SPR-based binding analysis demonstrates that the orientation of the Ace and Cna Ni and N₂ sub-domains significantly affects the stability of the interaction between the MSCRAMM and the ligand in vitro. Changes to the inter-domain orientation affected collagen affinity, dissociation rate and binding- site preference. We also found that the sequence and length of the inter-domain linker influenced binding of the proteins to immobilized CI and determined that although there is an optimal length for the inter- domain linker, the sequence of the inter-domain linker is more important.

FIGURES 1A-1C are images of the crystal structures of Ace and Cna Ligand-binding domains. FIGURE 1 A is an image of the crystal structure of Ace₃₂-367 the open conformation exhibited by rAce allows the A- B-loop within the N₂ subdomain (yellow ribbon) to avoid steric conflicts with the C-D loop of the Ni sub- domain (green ribbon). FIGURE IB is an image of the crystal structure of Cna₃i_34₄. The Ni and N₂ domains of Cna₃i_344 are in a more closed conformation and are altered by about 36 degrees compared to Ace₃₂-367- There is no steric clashing between the C-D loop within the Nl subdomain and the A-B loop within the N2 subdomain. FIGURE 1C is an image of the structural model of Ace₃₂-367 in the Cna₃1.344 conformation. The long C-D loop within the Ni subdomain (green ribbon) makes severe clashes with the A-B loop of the N₂ sub-domain (yellow ribbon) suggesting that Ace cannot adopt Cna-like conformation.

FIGURE 2A is a crystal structure of Ace32-367 demonstrating location of inter-domain linker (blue) and C- D loop (red) within the N₂ subdomain where sequences were altered. FIGURE 2B is a topology diagram of Ni and N₂ subdomains with labeled beta-strands. FIGURE 2C is a table of parent and mutant recombinant proteins and corresponding sequences of the inter-domain linker (blue) and C-D loop region (red). FIGURE 2D is an image of the structure-based amino acid alignment of the Cna and Ace NiN₂ inter-domain linkers.

FIGURES 3A-3H are graphs of the biacore analysis of the interactions between collagen and recombinant Cna proteins. Two-fold increasing concentration of Cna proteins were injected over the immobilized type I collagen (180 RU for A, D, and E; and 400 RU for B, C, F, G and H). Sensorgrams are shown in black with lower curve corresponding to lower concentration of Cna protein injected. Kinetic analysis for A, C, D and E (the fitted curves are shown in red) was performed to obtain rate constants (shown in Table), Κ_Ό ^Άρρ and R_max. For steady-state interactions (B, F, G and H), a binding isotherm was created (inset) to determine equilibrium Κ_Ό and R_m^. Cartoons in each graph indicate the general location of the mutations. The presence of the mutations within the inter-domain linker is represented as a filled-in arc and the mutations affecting the inter-domain orientation are represented as a filled-circle.

FIGURES 4A-4H are graphs of the biacore analysis of the interactions between collagen and recombinant Ace proteins. Ace proteins were injected over the immobilized type I collagen (440 RU for A, B, C, D, E and F; and 150 RU for G and H). For steady-state interaction (A, B, C, D, E and F), a binding isotherm was created (inset) to determine equilibrium Κ_Ό and ?_max. Kinetic analysis was performed for G and H to obtain rate constants, K_O ^m and R_miBi. Cartoons in each graph indicate the general location of the mutations. The presence of the mutations within the inter-domain linker is represented as a filled-in arc and the mutations affecting the inter-domain orientation are represented as a filled-circle.

Comparisons of the Cna31.3 4 and Ace₃₂_367 structures and interactions with collagen. Consistent with previous studies, Ace₃₂_3₆7 and Cna₃1.344 exhibit different binding affinities and kinetics in SPR analysis of MSCRAMM binding to immobilized CI (FIGURES 3A and 4A) (Rich, Kreikemeyer et al. 1999; Zong, Xu et al. 2005; Liu, Ponnuraj et al. 2007). Cna₃i_34₄ exhibits a higher affinity for collagen (Κ_Ό ^Άνρ ~ 66.0 nM) than Ace₃₂_3₆7 (¾_> ~ 43.2 μΜ). Also, the association and complete dissociation of Ace₃₂_3₆7 with immobilized CI is rapid, and the reaction follows a one-step steady-state binding model (FIGURE 4A). CI + Ace 32-367 CI:: Ace 32-367

However, the interaction of CI with Cna₃1.344 is more complex, consistent with a two-state conformational change model (FIGURE 3A). a1 a2

CI + Cna 31-344 CI:: Cna 31-344 (CI::Cna_31.344)*

d2

This simplified two-state reaction model involves two steps; (1) the formation of the CI::Cna₃i_3₄₄ complex (£_ai and ka) and (2) a conformational change that may occur after formation of the complex (&_a2 and k_d2) (Table 1). The interaction of Cna₃i_34₄ with collagen involves several steps.

Table 1.

FIGURE 5 is a schematic of the conformational change model of the collagen/Cna₃1.344 interaction. Initially, the collagen molecule (gold rod) interacts with the N₂ subdomain (yellow oval) of a Cna₃i_34₄ molecule in the closed form (PDB accession number, 2F68). This interaction induces conformational changes. First, the Ni (green oval) and N₂ subdomains open, allowing the inter-domain linker (blue) to wind around the triple helix. Finally, the latching step occurs when the N₂ C-terminal extension binds within the latching trench on the Ni subdomain. The final inter-domain orientation of the Ni-N₂ subdomains is similar to the apo-structure (PDB accession number, 2F6A). Notably, the two-step binding observed in the biacore assays also explains the closed conformation observed in the crystal structure of the apo-form of CNA with respect to the collagen-hug binding model.

After the initial interaction between collagen and the N₂ subdomain of a Cna₃i_34₄ molecule in the closed form, additional conformational changes occur including, opening of the NiN₂ sub-domains, reorientation of the Ni subdomain which allows the inter-domain linker to wrap around the collagen, and the latching event which stabilizes the collagen/Cna₃1.344 complex.

The structures of the Ace and Cna ligand-binding domains were compared and significant variation in the inter-domain orientation and inter-domain linkers were found. The inter-domain hole of Ace₃₂_367, formed by the inter-domain linker and the NiN₂ subdomains is more spacious than that of Cna₃i_344. Notably, structure based sequence alignment showed that the Ace₃₂_367 inter-domain linker is 40% longer than that of Cna₃1.344 and likely contributes to the larger inter-domain space (FIGURE 2D). In addition, the crystal structure of Cna₃1.344 in complex with a collagen peptide shows the inter-domain linker tightly wrapped around the ligand, suggesting that eight amino acids is the optimal inter-domain linker length. Therefore, it is possible that the Ace₃₂-367 inter-domain linker may be longer than required for monomelic collagen binding. Furthermore, the sequences of the Ace and Cna inter-domain linkers share little sequence homology (FIGURE 2D). Considering that structural data demonstrate specific contacts between the Cna₃1.344 inter-domain linker and residues within a synthetic collagen peptide, it is possible that sequence differences within this structural element could influence ligand binding (Zong, Xu et al. 2005).

Structural comparisons also revealed that the inter-domain orientation of the Ace₃₂-367 Ni and N₂ subdomains are altered by about 36° compared to that of Cna3i_344 (Liu, Ponnuraj et al. 2007). As a result, the apo-Ace structure is in a partially open conformation with the latch partially closed (Liu, Ponnuraj et al. 2007). While it is possible that this altered orientation represents apo-Ace₃₂-367 in equilibrium between the open and closed conformation (Liu, Ponnuraj et al. 2007), molecular modeling predicts that Ace₃₂-367 cannot adopt the inter-domain orientation exhibited by Cna₃ i_34₄. Specifically, the C-D loop at the N- terminus of strand "D" located within the Ace₃₂-367 Ni subdomain is longer than the corresponding C-D loop of Cna₃ i_344 (Fig 1A and IB). Modeling of Ace₃₂-367 in the Cna₃i_344 conformation demonstrates that the Ace₃₂-367 C-D loop located within the Ni sub-domain would clash with the A-B loop of the Ace₃₂-367 N₂ sub-domain (FIGURE 2C). Therefore, it is likely that Ace₃₂-367 must utilize a more open confirmation than Cna₃i_344 to avoid an apparent steric conflict between the two sub-domains.

The altered inter-domain orientation of the Ace₃₂-367 iN₂ subdomains and/or the more spacious inter- domain hole of Ace₃₂-367 could result in a loose or "slippery" binding region which might contribute to the lower binding affinity and less stable binding, reflected by a faster dissociation compared to Cna₍3i_3₄₄) (FIGURE 3A and FIGURE 4A). To understand how these structural differences contribute to the observed differences in ligand binding behavior, we evaluated the binding kinetics of several recombinant Ace and Cna proteins containing mutations that alter the orientation of the Ni and N₂ subdomain as well as the sequence and length of the inter-domain linkers (FIGURE 2B).

Linker length affects binding to type I collagen. To address the contribution of inter-domain linker length to collagen binding, we engineered Cna and Ace proteins containing elongated and/or modified inter- domain linkers and compared the affinity and binding kinetics to immobilized CI using Surface Plasmon Resonance (SPR) (FIGURES 3 and 4). We determined that the length of the inter-domain linker influenced multiple aspects of in vitro CI binding, including affinity and binding ratio.

Purified Cna proteins containing inter-domain linkers harboring insertions or deletions demonstrated CI binding affinities that were significantly lower than those exhibited by Cna₃i_344 indicating that the length of the Cna inter-domain linker is optimal for CI affinity in vitro (FIGURES 3A, 3B and 3C, Table 1). The addition of three amino acids to the Cna inter-domain linker, resulted in a protein (Cna^Ay ) with a ~40-fold decrease in binding affinity (Table 1, FIGURE 3B), while deleting three residues from the inter- domain linker yielded a protein (Cna^AEAG) with a ~9-fold decrease in affinity for CI (Table 1 , FIGURE 3C). The length of the inter-domain linker also influenced the number of sites in CI recognized by the MSCRAMM; Cna^AQIE exhibited an increased binding ratio of 16 and Cna^AEAG exhibited a decreased binding ratio of 5. A binding ratio of 13 was calculated for Cna₃i_344 (Table 1). Taken together, these data demonstrate that the native Cna inter-domain linker length is optimal for CI binding in vitro as revealed by affinity calculations. However, a longer inter-domain linker may allow the protein to recognize a greater number of binding sites within the collagen molecule (Table 1).

Removing residues from within the Ace inter-domain linker yielded proteins with CI affinities that were only marginally higher than the parent protein, Ace₃₂-366 (Κτ> ~ 43.2 μΜ); Ace^AQIE, exhibited a Κ_Ό of -29.0 μΜ and Ace^AETGQIE exhibited a Κ_Ό of -30.1 μΜ (FIGURES 4A, 4B and 4C, and Table 1). However, deleting residues within the Ace inter-domain linker negatively affected the number of sites recognized on the collagen molecule. While the parent protein exhibited a binding ratio (N) of 14, binding ratios of 1 1 and 10 were calculated for Ace^AQIE and Ace^AETGQIE, respectively (Table 1). These results indicate that while decreasing the length of the Ace inter-domain linker does not strongly influence affinity of Ace for CI, the longer inter-domain linker may allow the protein to recognize a larger number of binding sites within the CI molecule, which was also observed for the purified Cna proteins.

FIGURE 6 is a plot of the estimation of Rmax for the binding of collagen to immobilized Cna₃i_34₄. SPR Sensorgrams were generated by injecting collagen in PBST onto Cna₃ i_34₄-coated surface (270 RU). R_max of 200 RU was estimated based on the almost saturated binding when 25.6 nM of collagen was injected. Because of the repetitive nature and linear structure of the CI molecule, the multiple MSCRAMM binding sites observed in SPR studies represent independent binding sites. However, to confirm that the data is not due to aggregation of the injected proteins, we examined binding of solubilized CI to immobilized Cna₃ i_34₄ (FIGURE 6). The resulting binding ratio of -0.091 (1/11) demonstrates that one CI molecule was recognized by -1 1 Cna₃ i_₃₄₄ molecules on the sensor surface which is similar to the /V of 1 1.7 observed in experiments utilizing soluble Cna₃ i_₃₄₄ and immobilized CI. (Table 1). Furthermore, the extremely slow off-rate observed in the SPR sensograms in FIGURE S2 is due to the effects of valency, which occurs when multiple Cna₃₁_₃₄₄ bind to a single CI.

Linker sequence affects affinity and binding site recognition for type I collagen. The sequences of the Ace and Cna inter-domain linkers share little homology and structural analysis of the MSCRAMM/ ligand complex revealed that amino acids within the Cna inter-domain linker make specific contacts with the collagen peptide (Zong, Xu et al. 2005). Specifically, Vall72, located near the C-terminus of the inter-domain linker, interacts with a proline residue from the leading chain of the collagen peptide. This interaction may facilitate repositioning of the Ni subdomain, which is an important step in the ligand binding process of Cna (Zong, Xu et al. 2005). It is likely that residues from the C-terminal portion of the Ace inter-domain linker (i.e. Y176 and/or PI 77) play a role similar to that of Vail 72 and make contact with the collagen ligand.

To understand how the sequence of the inter-domain linker contributes to collagen binding, we replaced the eight amino acid inter-domain linker from Cna31.3 4 with; (1) the full-length, 14 amino acid Ace₃₂-367 linker, (2) a 12 amino-acid Ace linker lacking two N-terminal residues and (3) a 10 amino-acid Ace linker lacking two N- and two C-terminal residues, creating chimeric proteins CnaAl , CnaA2 and CnaA3, respectively (FIGURE 2). Similarly, the Ace₃₂-367 inter-domain linker was replaced with; (1) the eight amino acid Cna linker, (2) a 10 amino acid sequence containing the Cna inter-domain linker plus two C-terminal Ace linker residues and (3) a 12 amino acid sequence containing the Cna inter-domain linker flanked by two amino acids each from the N- and C-termini of the Ace linker, to generate the chimric proteins AceCl, AceC2 and AceC3, respectively (FIGURE 2). We found that changes to the length and sequence of the inter-domain linkers impacted the binding kinetics of the proteins and underscored the importance of specific residues within the inter-domain linker sequence.

SPR analysis revealed that the sequence of the inter-domain linker influenced CI affinity and binding ratio. CnaAl , which contains the full-length Ace inter-domain linker, exhibited a higher affinity for CI (AT_D ^app ~ 19.0 nM) than the native Cna₃i_34₄, indicating that the sequence of the longer Ace inter-domain linker can facilitate high affinity binding to CI in vitro (FIGURES 3A and 3D, Table 1). Additionally, removing the two N-terminal Ace inter-domain linker residues, as in CnaA2, yielded a protein with an affinity (Κ_Ό ^Άνρ ~ 88.5 nM) similar to that of Cna₃i.₃₄4 (FIGURES 3A and 3E, Table 1) while CnaA3, which is lacking the N- and C-terminal Ace inter-domain linker residues, exhibited a much lower affinity for CI (Κ_Ό ~ 1 1.6 μΜ) (FIGURES 3A and 3F, Table 1). The binding ratio for CnaA3 was the highest (N ~ 16), while the binding ratios of CnaAl (N ~ 13) and CnaA2 (N ~ 10) were more similar to Cna₃i_34₄ (N ~ 12) (Table 1).

We found that changes to the length and sequence of the inter-domain linkers of the Ace proteins resulted in modest changes in CI affinity (Table 1, FIGURES 4A, 4D and 4E). However, the numbers of CI binding sites were significantly altered (Table 1). Specifically, Ace₃₂-367 and AceC3, which harbor inter- domain linkers containing the Ν-terminal residues, VI 64 and T165 and the C-terminal residues, Y176 and PI 77, exhibited binding ratios of 14. Proteins containing inter-domain linkers lacking the N- and C- terminal residues, AceCl (lacks Ace residues V164, T165, Y176 and P177) and AceC2 (lacks Y176 and PI 77), exhibited binding ratios ranging from four to five.

Taken together, the SPR data obtained from the engineered Cna and Ace proteins harboring inter-domain linkers with altered sequences and lengths, suggest that the N- and C- terminal residues of the Ace inter- domain linker positively influence binding to CI in vitro. Moreover, it is possible that the C-terminal residues, YP, present within the Ace inter-domain linker sequence, stack better with the CI proline residues than the corresponding SV amino acids from the Cna inter-domain linker (FIGURE 2). As a result, proteins containing the YP residues may be able to anchor the collagen molecule within the N₂ domain, suggesting that the ligand affinity is affected more by the sequence than the length of the inter- domain linker.

The inter-domain orientation affects affinity and binding kinetics for type I collagen. Changes to the Ace inter-domain sequence and length did not result in recombinant proteins that demonstrate stable interactions with immobilized CI, as was observed for the engineered Cna proteins, indicating that another aspect of the Ace32-367 structure is responsible for the low affinity and fast on- and off-rate. Analysis of the structure of apo-Ace32-367 reveals a protein with a partially open conformation. The Ace32- 367 Ni sub-domain contains a short D-D' loop, a short D strand and a large C-D loop, while the Cna₃i_34₄ Ni subdomain contains a large D-D' loop, a longer D strand and a short C-D loop (FIGURES 1 and 2C). The larger C-D loop precludes the Ace32-367 protein from adopting a conformation that is optimal for ligand binding, thus preventing a tight interaction with collagen (FIGURE 1). In addition, the larger D- D' loop found in Cna₃i_34₄, forms part of the latching trench and may yield a stronger latching event than the shorter Ace32-367 D-D' loop. The open conformation and/or weaker latching event may explain why Ace32-367 has a lower affinity and more rapid off-rate for immobilized CI compared to Cna₃1.344.

To understand how the orientation of the Ni and N₂ subdomains affects ligand binding, we engineered chimeric proteins with altered Ni subdomains. Specifically, we replaced the amino acid sequence spanning the Ace₃₂-367 C-D loop, D-strand and D-D' loop with the corresponding residues from Cna, creating AceC4 (FIGURE 2), a protein that should adopt a more closed conformation than Ace32-367- In addition, we replaced the Cna₃i_344 C-D loop, D-strand and the D-D' loop with the corresponding sequence from Ace, to create CnaA4 (FIGURE 2), which should adopt a conformation that is more open than that exhibited by Cna₃i_34₄.

SPR analysis demonstrated that that changes predicted to alter the Ni and N₂ inter-domain orientation affect several aspects of the MSCRAMM/CI interaction. The CI affinity of AceC4 was ~1 1,000-fold higher than Ace32-367 (FIGURES 4A and 4G, Table 1), while CnaA4 exhibited a ~25-fold decrease in affinity for CI compared to Cna31.344 (FIGURES 3A and 3F, Table 1). These results suggest that a more closed conformation allows a tighter interaction with CI.

The partially open conformation observed for apo-Ace32-367 explains why the purified Ace proteins containing the shortest inter-domain linkers (AceCl and Ace^AETGQIE) exhibited the lowest binding ratios for CI. In an effort to assess the relationship between the inter-domain linker and the inter-domain orientation, we created AceClC4, which contains the shorter Cna inter-domain linker and the shorter Cna C-D loop and CnaAl A4 that harbors the full-length Ace inter-domain linker and the larger Ace C-D loop (FIGURE 3). AceClC4 showed a 600-fold increase in CI affinity compared to AceCl, which harbors the Cna linker but not the smaller C-D loop (FIGURES 4A and 4F, Table 1). However, CnaAlA4 (Κ_Ό ~ 26.2 μΜ) which contains the Ace inter-domain linker sequence and the larger C-D loop, showed an affinity for CI that was comparable to CnaA4 (Κ_Ό ~ 37.7 μΜ). Taken together, these data suggest that removing the apparent steric hindrance from the Ace Ni and N₂ subdomains allows the Ace protein to accommodate a shorter inter-domain linker.

Altering the inter-domain orientation of Ace₃₂-367 and Cna₃1.344 proteins significantly altered the over-all binding kinetics of the engineered proteins, resulting in an Ace-like Cna and Cna-like Ace. The Cna proteins (CnaA4 and CnaAlA4) containing the larger C-D loop exhibited similar affinities and binding profiles (a rapid association and complete dissociation) to CI as those of Ace₃₂-366 (FIGURES 3G and 3H, FIGURE 4A, Table 1). On the other hand, SPR analysis of the AceC4 and AceClC4 interaction with immobilized CI revealed kinetic data that was more similar to the data obtained with Cna₃1.344 (FIGURE 3A, FIGURES 4G and 4H, Table 1). This is most evident when comparing the dissociation of the purified proteins. Dissociation from CI by AceC4 and AceClC4 is slow and incomplete (FIGURES 4G and 4H, Table 2) as the interaction with CI that is more complex than the parent protein Ace₃₂-367 and may involve a conformational change.

Altering the inter-domain orientation also affected the number of CI binding sites recognized by the proteins. The binding ratios (N) for the purified Ace proteins containing the smaller C-D loop were significantly lower (AceC4 N ~ 5, AceClC4 N ~ 4) than the parent protein (Ace₃₂-367 N ~ 14), while the binding ratios for CnaA4 (N ~ 15.5) and CnaAlA4 (N ~ 13.6) were higher than the binding ratio for Cna₃i_344 (N ~ 11.7) (Table 1), suggesting that a more open conformation may allow the protein to recognize a greater number of binding sites within the CI molecule (Table 1).

Taken together, this demonstrates that the lower affinity and unstable binding kinetics for immobilized CI exhibited by Ace₃₂-367 are in large part due to the presence of a longer loop that connects the C and D strands of the Ace₃₂-367 Ni sub-domain, which results in an altered orientation of the Ni and N₂ sub- domains compared to Cna₃1.344. Furthermore, these results indicate that the longer Ace inter-domain linker may be necessary to accommodate the altered inter-domain orientation. Surprisingly, the SPR data revealed that a more open conformation may allow the proteins to recognize a greater number of binding sites on the CI molecule, as all proteins containing the Ace Ni sequence, and presumably a more open conformation, exhibited higher binding ratios.

The present invention provides structural aspects of the Cna and Ace Ni and N₂ subdomains affect CI affinity and binding site recognition surface-localized proteins. The present invention points to an inverse correlation between affinity and binding site specificity. It seems logical that a high affinity interaction between a surface-anchored protein and a host ligand would facilitate attachment and proliferation. On the other hand, recognition of a greater number of binding sites would result in an increased avidity and disassociation at low affinity motifs by a fraction of the MSCRAMMs may not result in detachment of the bacterium from the substrate. The present invention provides that the MSCRAMM/CI interaction is complex as several structural features influence ligand binding affinity, specificity and kinetics. For the Cna-like MSCRAMMs, the inter-domain orientation appears to be most important, followed by the inter-domain linker sequence and finally inter-domain linker length. Our data indicate that while the regions within Ace₃₂-367 that are predicted to interact with collagen should facilitate a tighter interaction, the more open orientation and larger inter-domain hole adopted by Ace₃₂.367 is not optimal for high affinity CI binding. This structural variation may allow Ace to bind additional rod shaped ligands with a relatively larger diameter or recognize different collagen arrangements. Therefore, it is possible that small variations in the structure could dictate ligand specificity, underscoring the need to study key MSCRAMM-ligand interactions individually in sub-molecular detail.

Media and Growth Conditions. Overnight cultures of E. coli strains were grown at 30°C in LB medium (37°C for plasmid extraction) with shaking (200 rpm). For protein expression, E. coli TOPP3 was diluted 1 : 100 into fresh LB medium and grown at 37°C with shaking (250 rpm). During logarithmic growth phase, 200 μΜ IPTG was added and growth was continued at 30°C for 16 h after which cells were harvested by centrifugation at 3500 rpm for 20 min. using a Sorvall RC 3B Plus centrifuge. Pellets were frozen at -20°C. Ampicillin (Sigma-Aldrich, St. Louis, MO) or carbenicillin (Sigma-Aldrich, St. Louis, MO) was used at concentrations of 100 μ /πι1.

DNA manipulation and plasmid construction. Sequence changes to the DNA regions encoding the inter- domain linker and the C-D loop of ace and cna were introduced using site-directed mutagenesis (Papworth C 1996) or overlap extension PCR (Ho, Hunt et al. 1989) using primers listed in Table 2 in a mixture containing Phusion polymerase (Thermo Scientific, Vantaa, Finland), HF buffer (Thermo Scientific, Vantaa, Finland), 50 ng of DNA template and 200-250 nM dNTP mix (Invitrogen, Grand Island, NY). Following digestion with Dpnl (NEB, Ipswich, MA), PCRs generated from site-directed mutagenesis were transformed into E. coli TOPP10 using standard procedures. Purified overlap PCRs were incubated at 72°C with Taq polymerase (NEB, Ipswich, MA) and 200nM dATP (Invitrogen, Grand Island, NY) and purified using DNA clean and concentrator - 5 (Zymo Research, Carlsbad, CA) prior to ligation into pGEMTeasy (Promega, Madison, WI).

Table 2. Oligonucleotides used:

Primer Sequence (5 '-3 ')

SEQ ID NO: 1 CR308 5'-GGATCCGCACGAGATATTTCATCAAC-3' SEQ ID NO: 2 CR320 5^,-GGATCCGAATTGAGCAAAAGTTC-3^,

SEQ ID NO: 3 CR321 5^,-AACACTACTTGTTCCCGCTTCACTTCCTTCAATCGTCAAACG-3^, SEQ ID NO: 4 CR322 5'-AGTGAAGCGGGAACAAGTAGTGTTTTCTTCTATAAAGT AGGCGATTTGGC-3 '

SEQ ID NO: 5 CR323 5'-GTCGACTTAGTCTGTCTTTTCACTTG-3'

SEQ ID NO: 6 CR324 5'-CTGTTTTACTATAACCCTCTATCTTTACTGTACCGCTT GTT GGTAA AG TTAAAGTAATAG-3'

SEQ ID NO: 7 CR325 5'-AGAGGGTTATAGTAAAACAGTACCATTAACTGTTAAAGGTGAA GG TTTAGGGGAAGTTTT-3'

SEQ ID NO: 8 CR326 5'-CAACGTTTGACGATTGAAGGAGTGACTAGTGAAGCG GGAACAAGTAG-3'

SEQ ID NO: 9 CR327 5'-CTACTTGTTCCCGCTTCACTAGTCACTCCTTCAATCGTCAAA CGTTG- 3'

SEQ ID NO: 10 CR328 5'-GTGAAGCGGGAACAAGTAGTGTTTATCCGTTCTTCTATAAA GT AGGCG ATTTG-3 '

SEQ ID NO: 11 CR329 5'- CAAATCGCCTACTTTATAGAAGAACGGATAAACACTAC TTGTTCCCGCTTCAC-3 '

SEQ ID NO: 12 CR330 5'-TCGCTCAATTTGGCCAGTCTCTGTGTTAGTCACTTTATGAACC GTAACATTCGTTG-3'

SEQ ID NO: 13 CR331 5'-ACAGAGACTGGCCAAATTGAGCGAGACTATCCGTTCTATTATA AAACGGG AGATATG-3 '

SEQ ID NO: 14 CR332 5 '-GTCGACTT AAGCCTTGGTATCTTTATCCTG-3 '

SEQ ID NO: 15 CR333 5'-TCGCTCAATTTGGCCAGTCTCTGTGTTTTTATGAACCGTAAC ATTCGTTG-3'

SEQ ID NO: 16 CR334 5'-ACAGAGACTGGCCAAATTGAGCGAGACTTCTATTATAA AACGGGAGATATG-3 '

SEQ ID NO: 17 CR367 5-GGTGAACTATCGTTCTCGGTCATTCCAACTAGTGCGTCCG GCCATGCCACTTTAATCAT-3

SEQ ID NO: 18 CR368 5-GACCGAGAACGATAGTTCACCACGAAAAATCAATTTAAAT CAGGTGGGTCAAGCAGTTAT-3 SEQ ID NO: 19 CnaQIE 5'-GAACGGGACAGATTGAAACAAGTAGTGTTTTCTA TT ATAAAACG-3 '

Sequencing was performed to verify site-directed mutagenesis and pGEMTeasy constructs containing inserts (Genewiz, Houston, TX). Following digestion with BamHI and Sail (NEB, Ipswich, MA), the sequence of interest was were purified from pGEMTeasy using the Gel extraction kit (Zymo Research, Carlsbad, CA) and ligated into the previously digested expression vector, pQE30 using T4 DNA ligase (Promega, Madison, WI). Standard procedures were followed for DNA transformation into E. coli TOPP10 cells. Final plasmids are described in Table 3.

Piasmids Relevant Primer pairs (technique) !erttp!ate S urce characleristic(s)'' or reference pGEMTeasy Ί7Α clonin vector, Promega pQE30 E. coli expression vector Qiagen for His-taggcd proteins,

pQE30Cna3S pQE30 conatining ONA. (19) encoding the Cna )

arid sub-domains.

pQE30Ace₃¾-}« pQE30 containing DNA (16) encoding the Ace N; and

N ) sub-domains.

pQE30CnaQIE pQE30 containing D A CnaQIE IF/CnaQ!E IR (site- _t)QE30Cita3S This encoding Cna^"Vm. directed mutagenesis) work pQE30CnaBAG pQE30 vector CnaEAG DP/CnaE DR pQE30Cna35 This containing DN A (s ! te-di rected mutagenes is) work encoding C»a^;)BA .

pQB3 Crm.AJ pQE30 vector CR3Q8 CR330. pQE30Cna35 This containing DNA CR33 i/CR332 (overlap PCR) work. encoding CnaAl.

pQE30CnaA2 pQE3G vector CR308 CR333 CR331/ pQE30Cna 5 This containing DNA CR332 (overlap PCR) work. encoding CrtiiA.2,

QE30CnaA3 pQE30 vector CR308 CR333- pQ£30Cns35 This containing DNA CR.334/CR3.32 (overiap work encoding CnaA3. PCR)

pQE30CnaA4 pQE30 vector CR308 C 367, pQB30Cn¾ 5 This containing DNA CR36S/CK332 (overlap PCR) work encoding CnaA4,

pQE30CnaA l A4 pQE30 vector CR30S/CR367, pQ OCnaA 1 Urn

containing DNA CR368 CR332 (overlap PCR) work encoding Cna A 1 A4,

pQEJOAceQIE PQE30 containing DNA AceQiE DF/AeeQffi DR pQE30Ace 0 This encoding the Ace "^s. (site-directed mutagenesis) work pQE3 pQE30 containing DNA AceETGQIE pQE30AceQIE

AceETGQIE encoding the DF/AceETGQIE DR (site- work

_AceDETGQIE directed mutagenesis)

pQE30AceC1 pQE30 vector CR320/CR321, pQE30Ace40 This containing DNA CR322/CR323 (overlap PCR) work encoding AceCl.

pQE30AceC2 pQE30 vector CR326/CR327 (Site-directed _PQE30AceCl This containing DNA mutagenesis work encoding AceC2.

pQE30AceC3 pQE30 vector CR328/CR329 (Site-directed pQE30AceC2 This containing DNA mutagenesis) work encoding AceC3.

pQE30AceC4 pQE30 vector CR320/CR324, pQE30Ace40 This containing DNA CR325/CR323 (overlap PCR) work encoding AceC4.

pQE30AceCIC4 pQE30 vector CR320/CR324, pQE30AceCl Ί^{^}ΐπιΐ s containing DNA CR325/CR323 (overlap PCR) work encoding AceClC4.

Protein Purification. The His-tagged recombinant proteins were purified with a 5 ml nickel-charged HiTrap chelating column (GE Healthcare Uppsala, Sweden) and a 5 ml anion exchange Sepharose column (GE Healthcare Uppsala, Sweden) as described by Barbu and Hook (Barbu, Ganesh et al. 2010). Fractions obtained from the anion exchange column were concentrated and dialyzed against PBS, 10 mM EDTA pH 7.4. Recombinant proteins were >95% pure.

Molecular modeling studies were performed using Coot (Emsley and Cowtan 2004) and Insightll (Accelrys, Inc., San Diego, CA). To build a model of Ace in the Cna conformation, individual Nl and N2 domains of Ace (pdb id:2ZlP) were superimposed on corresponding Nl and N2 domains of the crystal structures of Cna (pdb id:2F68). Superposition based on secondary structure matching (SSM) available in Coot (Emsley and Cowtan 2004) was used for the superposition. One hundred eighteen Ca atoms in the Nl subdomain and 137 Ca atoms in the N2 subdomain aligned with RMS deviations of 1.67A and 1.50A, respectively. The model of the Ace molecule in the Cna conformation showed steric clashes between the Nl and N2 subdomain. To build a molecular model of the AceC4 harboring the Cna Nl region (C-D loop, D-strand and D-D' loop), a homology model was built using HOMOLOGY module in the Insightll package (Accelrys, Inc., San Diego, CA). After building a model of the Ace Nl domain with the Cna Nl region, this domain was superimposed on the Ace with Cna conformation to build a model of AceC4.

Surface Plasmon Resonance (SPR) analysis. The interactions of Cna₃i_344, Ace₃₂-367 and the mutant derivatives with immobilized rat tail type I collagen (CI) (R&D Systems, Inc., Minneapolis, MN, USA) were characterized using a Biacore 3000 (GE Healthcare/Biacore, Uppsala, Sweden) at 25°C. Sensor chip CI and amine-coupling kits were obtained from the same company and used to covalently attach CI onto the sensor surface using amine coupling procedure as recommended by the manufacturer. The matrix- free CI chip was chosen because it can achieve low density immobilization and avoid mass transfer limitation. Also, the flat surface allows interactions to take place closer to the surface which is beneficial when working with multivalent interaction partners and large molecules. Briefly, after the surface was activated for 2 minutes, 10 μΐ of 5 g/ml CI solution (stock of 5 mg/ml in 0.01 N HC1 was diluted in 10 mM sodium acetate, pH5.5) was injected into the flow cell at a flow rate of 5 μΐ/min. Approximately 440 response units (RU) of collagen were immobilized. Lower (-150 and 180 RU) density collagen surfaces were also prepared by adjusting the activation time and volume of CI injected. A Cna surface was prepared on a separate sensor chip using 5 μg/ml of Cna₃₁_34₄ in 10 mM sodium acetate buffer, pH5.5. The reference flow cells were prepared with activation and deactivation steps where no protein was coupled. Phosphate -buffered saline (PBST: 8 mM Na₂HP0₄, 1.5 mM KH2PO4, pH7.4, 2.7mM KC1, 137 mM NaCl, and 0.005% Tween-20) was used as running buffer. Binding was performed at a relatively high flow rate of 30 μΐ/min, even though no mass transfer was observed in the system. To regenerate the sensor surface, bound protein was removed by flowing 10 mM glycine (pH 1.5) over the surface for 1 min.

Baseline corrected SPR response curves (with buffer blank run further subtracted) were used for affinity determination. For steady-state analysis, equilibrium response (Req) of each injection was collected and plotted against the concentration (A) of injected protein. A binding isothern was fitted to the data using equation 1 (GraphPad Prism 4, GraphPad Software, Inc., La Jolla, CA, USA) to obtain the equilibrium dissociation constant (Κ_Ό) and binding response maximum CK_max).

Req = tf_max x A I (Κ_Ό + A) (Eq. 1)

Non-equilibrium data were globally fit to a predefined two-state model using BIAevaluation software (Version 4.1). The R_m^, association and dissociation rate constants (k^ ¾i) for the binding state (A + B <→ AB), and forward and backward rate constants (&_a2, ^2) for the conformational change state (AB <→ AB*) were obtained from the fitting (with T-value >100 as criteria for acceptable fit), and described by the equations 2-5 listed below. This model describes 1 :1 binding of analyte to immobilized ligand followed by a conformational change in the complex (BIA evaluation Software Handbook, edition 2004). It simply assumes that the only way AB* can dissociate to release free A is through prior conversion to the form AB, where A is Cna or Ace protein in solution, B is immobilized collagen, AB is the complex formed by binding A to B, and AB* is the complex formed by conformational change from AB. At t = 0,

A = concentration, B[0] = R_max, AB[0] = 0, and^5*[0] = 0 (Eq. 2)

dB / dt = - [k^ x A x B - k_tn x AB] (Eq. 3) dAB / dt = [k^ x A x B - k_M x AB] - [£_a2 AB - k_A1 AB *] (Eq. 4) dAB * / dt = [ha x AB - k_d2 AB *] (Eq. 5)

Apparent dissociation constant (.¾ ^pp) was calculated from the kinetic parameters obtained from the curve fitting. J¾^{a p} = l / ((Aai / Adi) x (l+¾>2 / Ad2)) (Eq. 6)

Theoretical maximum response for 1 : 1 binding (Rmax^{1 1}) was calculated using equation 7, where R_m- _m„h is the SPR response of the protein immobilized on the sensor surface, MW_S0\ and MW_i-_mmoh are molecular weight of soluble and immobilized protein respectively. MW for Ace and Cna are ~39 kDa and ~36 kDa respectively. Since the collagen molecule was kept at very low concentration in a low salt and low pH buffer during immobilization, the monomer (-300 kDa) conformation was maintained.

max" = (MW_sol I MW_immob) R_immob (Eq. 7)

Molar binding ratio (N) is determined by comparing the experimental value ?_max with R_ma ^'1.

Cna is also used in imaging studies. Cna₃i_34₄, a truncated version of Cna that exhibits optimal collagen binding, labeled with the fluorophore Oregon Green 488 (Cna₃i_₃₄4-OG₄₈₈) allows visualization of collagen in microscopic images of bovine and rat tissues (Krahn et al.2006) and high resolution images of collagen within a mouse carotid artery vessel and engineered cardiovascular constructs (Boerboom et al. 2007). The labeled Cna₃i_344 also permits real-time monitoring of collagen synthesis in cell culture (Boerboom et al 2007). Furthermore, Cna₃i_344-OG488 was successfully administered to mice intravenously for the purpose of visualizing collagen within atherosclerotic plaques (Megens et al 2007). Other fluorophores may be used as replacements for the Oregon Green 488 and include fluorescein, 6- FAM, rhodamine, Texas Red, tetramethylrhodamine, a carboxyrhodamine, carboxyrhodamine 6G, carboxyrhodol, carboxyrhodamine 110, Cascade Blue, Cascade Yellow, coumarin, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy-Chrome, phycoerythrin, PerCP (peridinin chlorophyll-a Protein), PerCP-Cy5.5, JOE (6- carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein), NED, ROX (5-(and -6)-carboxy-X-rhodamine), HEX, Lucifer Yellow, Marina Blue, Oregon Green 500, Oregon Green 514, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, 7-amino-4-methylcoumarin-3-acetic acid, BODIPY FL, BODIPY FL-Br.sub.2, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665, BODIPY R6G, BODIPY TMR, BODIPY TR, conjugates thereof, and combinations thereof.

Cna and Ace exhibit similar domain organization. Both Ace and Cna contain an amino-terminal ligand- binding domain and a carboxy-terminal B domain that is likely involved in presenting the ligand-binding domain away from the cell surface, similar to a stalk. The Cna ligand-binding domain is composed of three subdomains (Ni N₂N₃), however recombinant forms of Ni N₂ (Cna₃i_₃₄₄) exhibit a higher affinity for collagen than recombinant protein consisting of Ni N₂ N₃ (Patti et al 1993; Xu et al 2004). The Ace ligand-binding domain (Ace₃₂__36?) consists of the two subdomains Ni N₂ (Rich et al 1999). Biochemical studies and structural analysis of Ace₃₂-367 and Cna₃1.344 reveal that these proteins bind to monomeric, but not fibrillar, collagen.

Comparisons of Ace32-367 and Cnasu^ crystal structures reveal a high degree of overall structural similarity (FIGURE 7A) (Zong et al 2005 and Liu et al 2007). However, compared to Cna₃i_34₄, the interdomain orientation of Ace₃₂-367 is altered by 36 degrees and contains a larger interdomain hole, where the ligand-binding pocket is located (Liu et al 2007) (FIGURE 7B). Structure based sequence alignment reveals that the Ace₃₂-367 interdomain linker, which connects the Ni and N₂ subdomains, is 75% longer than the Cna₃i_34₄ linker. Furthermore, the sequences of the Ace₃₂-367 and Cna₃i_34₄ interdomain linkers share little similarity.

In addition to the interdomain linker, careful visual examination of the two structures revealed that a region within the Ni subdomain could also influence ligand affinity. Specifically, a loop connecting β- strands could restrict the range of motion of the Ace₃₂-367 Ni and N₂ subdomains. This restricted movement is likely a contributing factor for the low affinity of Ace₃₂-367 for collagen.

AceC4 and AceClC4 are protein chimeras consisting largely of Ace₃₂-367 amino acid sequence. However, the region within the Ace₃₂-367 Ni subdomain, containing a β-strand and two loops connecting the β- strand, have been replaced with the corresponding regions from the Cna₃1.344 Ni subdomain in AceC4 and AceClC4 and the Ace₃₂-367 linker has been replaced with the shorter Cna₃1.344 linker in AceClC4. Together, these changes should allow additional Ni-N₂ movement and a tighter interaction with the collagen helix.

Remarkably, these alterations resulted in a recombinant protein with an affinity for type I collagen that is 200,000-fold higher than Ace₃₂-367 and 500-fold higher than Cna₃i_34₄ (Table below).

These results implicate that the affinity of this family of collagen binding proteins can be changed dramatically by manipulating specific structures within the proteins. Modifying sequence within critical regions can also alter ligand and sequence specificity in addition to the affinity. Molecular modeling and comparing other collagen binding MSCRAMMs such as ACM, CNE, CNM, is an effective method of identifying the critical sequences. The above design methods can also be used to design MSCRAMMs that could recognize additional rod like bio-molecules such as a coiled-coil motif. Recombinant proteins AceC4 and AceClC4 exhibit a higher affinity for type I collagen than recombinant Ace₃₂-367 and Cna₃1.344. The addition of the Cna₃1.344 sequences impart AceC4 and AceClC4 with increased collagen binding ability. The increased affinity to type I collagen exhibited by AceC4 and AceClC4 provides a variety of applications including: Fluorescently labeled AceC4 and AceClC4 proteins or other chimeric variants of collagen binding MSCRAMMs can be used as a probe to assess tissue damage and fibrotic events. Immobilized AceC4 and AceClC4 or other chimeric variants of collagen binding MSCRAMMs can facilitate the attachment of biomaterial to monomeric collagen. AceC4 and AceClC4 or other chimeric variants of collagen binding MSCRAMMs can be used to target a drug to a wounded area where monomeric collagen is produced. AceC4 and AceClC4 or other chimeric variants of collagen binding MSCRAMMs can be used as an imaging tool. AceC4 and AceClC4 or other chimeric variants of collagen binding MSCRAMMs can be used in the purification of monomeric collagen from complex mixtures. AceC4 exhibits an affinity for monomeric collagen that is 630- fold stronger than Cna₃i_34₄, making it a more efficient protein for many applications.

Surface Plasmon resonance analysis demonstrates that AceC4 and AceClC4 exhibits an affinity for immobilized type I collagen that is 20-13,000 and 630 fold greater than recombinant Ace₃₂-367 and Cna₃ i_ 344, respectively. This increased affinity is largely due to the fact that AceC4 and AceClC4 dissociate from type I collagen more slowly than both Cna₃ i_34₄ than Ace₃₂-367 (FIGURE 8). Design of several other chimeric molecules is underway. These designs include engineering chimeric molecules with high affinity and specificity towards a specific type of collagen, laminin and other molecules with rod-like structures such as a collagen helix or coiled-coil structures.

It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, kit, reagent, or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.

It will be understood that particular embodiments described herein are shown by way of illustration and not as limitations of the invention. The principal features of this invention can be employed in various embodiments without departing from the scope of the invention. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, numerous equivalents to the specific procedures described herein. Such equivalents are considered to be within the scope of this invention and are covered by the claims.

All publications and patent applications mentioned in the specification are indicative of the level of skill of those skilled in the art to which this invention pertains. All publications and patent applications are herein incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference. The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one." The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

The term "or combinations thereof as used herein refers to all permutations and combinations of the listed items preceding the term. For example, "A, B, C, or combinations thereof is intended to include at least one of: A, B, C, AB, AC, BC, or ABC, and if order is important in a particular context, also BA, CA, CB, CBA, BCA, ACB, BAC, or CAB. Continuing with this example, expressly included are combinations that contain repeats of one or more item or term, such as BB, AAA, AB, BBC, AAABCCCC, CBBAAA, CABABB, and so forth. The skilled artisan will understand that typically there is no limit on the number of items or terms in any combination, unless otherwise apparent from the context.

All of the compositions and/or methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the compositions and/or methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

Claims

CLAIMS:

1. A collagen binding MSCRAMMs AceC4 (1) and AceClC4 (2) with altered collagen specificity and collagen affinity comprising:

(1) an Ace₃₂-367 amino acid sequence with the following substitution; the Ace₃₂-367 C-D loop, D- strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from

(2) an Ace₃2-367 amino acid sequence with the following substitutions; the Ace₃2-₃67 C-D loop, D- strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna₃i_₃₄₄ and the Ace₃2-₃67 iN₂ interdomain linker is replaced with the Cna₃i_₃₄₄ NiN₂ inter-domain linker, wherein the substitutions provide a tight interaction with a collagen helix.

2. The AceC4 and AceClC4 collagen binding MSCRAMMs of claim 1, wherein the Cna31-344 Nj subdomain comprises a β-strand and two loops connecting the β-strand.

3. The AceC4 and AceClC4 collagen binding MSCRAMMs of claim 1 , wherein the AceC4 and AceClC4 collagen binding MSCRAMMs have an affinity for type I collagen that is 630-13,000 fold higher than Ace₃₂.₃67.

4. The AceC4 and AceClC4 collagen binding MSCRAMMs of claim 1 , wherein the AceC4 and AceClC4 collagen binding MSCRAMMs have an affinity for type I collagen that is 10 to 500-fold higher than Cna31-344.

5. The AceC4 and AceClC4 collagen binding MSCRAMMs of claim 1 , wherein the AceC4 and AceClC4 collagen binding MSCRAMMs has an affinity for type I collagen that is about 630-13,000 - fold higher than Ace₃₂.₃67 and about 20-fold higher than Cna₃i_₃₄₄.

6. The AceC4 and AceClC4 collagen binding MSCRAMMs of claim 1 , wherein the AceC4 and AceClC4 collagen binding MSCRAMMs has an affinity for type I collagen that is more than 630-13,000 -fold higher than Ace₃₂.₃₆₇ and more than 20-fold higher than Cna₃i_₃₄₄.

7. The AceC4 (1) and AceClC4 (2) binding proteins with specificity and affinity for a collagen like molecule comprising:

(1) an Ace₃₂.₃67 amino acid sequence with the following substitution; the Ace₃₂.₃₆7 C-D loop, D- strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna₃i_₃₄₄.

(2) an Ace₃₂.₃67 amino acid sequence with the following substitutions; the Ace₃₂.₃₆7 C-D loop, D- strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna₃i_₃₄₄ and the Ace₃₂.₃67 NiN₂ inter-domain linker is replaced with the Cna₃i_₃₄₄ NiN₂ inter-domain linker.

8. The AceC4 and AceClC4 binding proteins of claim 7, wherein the rod-like molecule comprises a collagen and/or coiled-coil motif.

9. A collagen binding modified MSCRAMMs for enhanced ligand binding comprising:

a Ni subdomain within the Ni subdomain is a Cna31.344 C-D loop, D-strand, D-D' loop Ni subdomain and

a N₂ subdomain , wherein the N₂ subdomain is a Ace₃₂-367 N₂ subdomain connected by an inter- domain linker.

10. The collagen binding modified MSCRAMMs of claim 9, wherein the inter-domain linker is an Ace 32-367 inter-domain linker (AceC4) or a Cna₃1-344 inter-domain linker (AceClC4).

11. The AceC4 and AceClC4 collagen binding modified MSCRAMM, further comprising a N3 subdomain connected to the Ni subdomain or the N₂ subdomain.

12. A collagen binding modified MSCRAMM for imaging comprising:

a modified MSCRAMM that exhibits optimal collagen binding, wherein the modified MSCRAMM is a ligand-binding domain comprising subdomains Ni and N₂ ; and

a fluorophore attached to the modified MSCRAMM to form a MSCRAMM-Fluorophore that allows visualization of collagen.

13. The collagen binding modified MSCRAMMs of claim 12, wherein the modified MSCRAMM is

14. The collagen binding modified MSCRAMMs of claim 12 or 13, wherein the modified MSCRAMM

15. The collagen binding modified MSCRAMMs of claim 12, wherein the Ni subdomain is a Cna₃ i.34₄ C-D loop, D-strand, D-D' loop Ni subdomain and the N₂ subdomain a Ace₃₂_3₆7 N₂ subdomain connected by an inter-domain linker.

16. The collagen binding modified MSCRAMMs of claim 12, wherein the modified MSCRAMM is a ligand-binding domain comprising subdomain N3.

17. The collagen binding modified MSCRAMMs of claim 12, wherein the fluorophore is Oregon Green 488, fluorescein, 6-FAM, rhodamine, Texas Red, tetramethylrhodamine, a carboxyrhodamme, carboxyrhodamine 6G, carboxyrhodol, carboxyrhodamme 110, Cascade Blue, Cascade Yellow, coumarin, Cy2, Cy3, Cy3.5, Cy5, Cy5.5, Cy-Chrome, phycoerythrin, PerCP (peridinin chlorophyll-a Protein), PerCP-Cy5.5, JOE (6-carboxy-4',5'-dichloro-2',7'-dimethoxyfluorescein), NED, ROX (5-(and - 6)-carboxy-X-rhodamine), HEX, Lucifer Yellow, Marina Blue, Oregon Green 500, Oregon Green 514, Alexa Fluor 350, Alexa Fluor 430, Alexa Fluor 488, Alexa Fluor 532, Alexa Fluor 546, Alexa Fluor 568, Alexa Fluor 594, Alexa Fluor 633, Alexa Fluor 647, Alexa Fluor 660, Alexa Fluor 680, 7-amino-4- methylcoumarin-3 -acetic acid, BODIPY FL, BODIPY FL-Br.sub.2, BODIPY 530/550, BODIPY 558/568, BODIPY 564/570, BODIPY 576/589, BODIPY 581/591, BODIPY 630/650, BODIPY 650/665, BODIPY R6G, BODIPY TMR, BODIPY TR, conjugates thereof, and combinations thereof.

18. The collagen binding modified MSCRAMMs of claim 12, wherein the MSCRAMM-Fluorophore allows real-time monitoring of collagen synthesis.

19. The collagen binding modified MSCRAMMs of claim 12, wherein the MSCRAMM-Fluorophore allows real-time monitoring of collagen within atherosclerotic plaques.

20. A method of making a collagen binding MSCRAMMs with altered collagen specificity and collagen affinity comprising the steps of:

providing a Ace₃₂-367 amino acid sequence;

replacing the Ace₃₂-367 C-D loop, D-strand and D-D' loop from the Ni subdomain with the C-D loop, D-strand, D-D' loop from Cna₃ i_34₄; or

replacing the Ace₃₂-367 amino acid sequence the Ace₃₂-367 C-D loop, D-strand and D-D' loop from the Ni subdomain was replaced with the C-D loop, D-strand, D-D' loop from Cna₃i_₃₄₄ and the Ace₃₂_₃₆7 NiN₂ interdomain linker is replaced with the Cna₃i_₃₄₄ NiN₂ inter-domain linker to provide a tight interaction with a collagen helix.

21. A method of making a collagen binding MSCRAMM with altered collagen specificity and collagen affinity comprising the steps of:

providing a MSCRAMM amino acid sequence comprising a Ni subdomain and a NiN₂ interdomain linker, wherein the Ni subdomain comprising a C-D loop, a D-strand and a D-D' loop; replacing the C-D loop, D-strand and D-D' loop from the Ni subdomain with a modified C-D loop sequence, a modified D-strand sequence, a modified D-D' loop sequence or a combination thereof; and

replacing the NjN₂ interdomain linker with a modified NiN₂ interdomain linker.

22. The method of claim 21 , wherein the MSCRAMM amino acid sequence comprising an Ace₃₂.₃67 amino acid sequence.

23. The method of claim 21 or 22, wherein the modified NiN₂ interdomain linker comprises a modified Cna₃i_₃₄₄ NiN₂ interdomain linker.

24. The method of claim 21, wherein the modified C-D loop sequence, a modified D-strand sequence, a modified D-D' loop sequence comprise a the Cna₃ i_₃₄₄ modified C-D loop sequence, a Cna₃ i_₃₄₄ modified D-strand sequence, a Cna₃1.344 modified D-D' loop sequence.