WO2013158782A2 - Methods and compositions for treating cardiac arrhythmias - Google Patents

Abstract

Disclosed herein are methods for treating arrhythmias in subjects which comprise inhibiting or reducing the expression and/or activity of NADPH oxidase 4 (NOX4) in the subjects. Also disclosed are compositions for treating arrhythmias which comprise one or more NOX4 inhibitors.

Description

METHODS AND COMPOSITIONS FOR TREATING CARDIAC ARRHYTHMIAS

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Application No. 61/625,763, filed

18 April 2012, which is herein incorporated by reference in its entirety.

[0003] REFERENCE TO A SEQUENCE LISTING SUBMITTED VIA EFS-WEB

[0004] The content of the ASCII text file of the sequence listing named

"20130417_034044_103WOl_seq_ST25" which is 2.68 kb in size was created on 9 April 2013 and electronically submitted via EFS-Web herewith the application is incorporated herein by reference in its entirety.

[0005] ACKNOWLEDGEMENT OF GOVERNMENT SUPPORT

[0006] This invention was made with Government support under Grant Nos.

HL077440, HL081571, and HL088975 awarded by the National Institutes of

Health/National Heart, Lung and Blood Institute (NHLBI). The Government has certain rights in this invention.

[0007] BACKGROUND OF THE INVENTION

[0008] 1. FIELD OF THE INVENTION

[0009] The present invention generally relates to methods and compositions for

treating cardiac arrhythmia.

[0010] 2. DESCRIPTION OF THE RELATED ART

[0011] Atrial fibrillation (AF) is a common type of cardiac arrhythmia that is rapidly developing into an epidemic. AF is associated with markedly increased risk of stroke, due to dislocation of thombi that are most often originated from left atrial appendage (LAA). Although AF is clearly associated with aging, and cardiovascular conditions such as hypertension, mitral valve stenosis and heart failure, molecular mechanisms underlying its etiology have remained elusive.

[0012] SUMMARY OF THE INVENTION

[0013] In some embodiments, the present invention is directed to a method of treating a subject for an arrhythmia which comprises inhibiting or reducing the expression and/or activity of NADPH oxidase 4 (NOX4) in the subject. In some embodiments, the arrhythmia is associated with an elevated level of reactive oxygen species (ROS) caused by NOX4 activity in the subject. In some embodiments, the ROS is superoxide or hydrogen peroxide. In some embodiments, the arrhythmia is atrial fibrillation. In some embodiments, the method comprises administering to the subject at least one NOX4 inhibitor. In some embodiments, the NOX4 inhibitor is a peptide, an antibody, a polynucleotide, or a small molecule. In some embodiments, the small molecule is an apocynin compound, a GTPase inhibitor, a fulvene compound, or a pyrazolo pyridine compound, or a triphenylmethane compound. In some

embodiments, the small molecule is apocynin, Fulvene-5, 6-(dimethylamino)fulvene, NSC 23766, GKT 137831, Imipramine Blue (IB), Carbazole Blue, or Proton Sponge (or an analogue thereof such as Proton Sponge Blue). In some embodiments, the polynucleotide is a NOX4 siRNA, a NOX4 shRNA, a NOX4 antisense oligo, or a morpholino (e.g., an antisense oligo in zebrafish). In some embodiments, the polynucleotide is SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In some embodiments, the one or more NOX4 inhibitors are administered in a therapeutically effective amount. In some embodiments, the method comprises administering to the subject one or more reactive oxygen species (ROS) scavengers and/or one or more antioxidants. In some embodiments, the method comprises administering to the subject an inhibitor of calcium/calmodulin-activated protein kinase II (CaMKII).

In some embodiments, the present invention is directed to the use of a composition comprising one or more NOX4 inhibitors for the treatment of an arrhythmia. In some embodiments, the arrhythmia is associated with an elevated level of reactive oxygen species (ROS) caused by NOX4 activity in the subject. In some embodiments, the ROS is superoxide or hydrogen peroxide. In some embodiments, the arrhythmia is atrial fibrillation. In some embodiments, the NOX4 inhibitor is a peptide, an antibody, a polynucleotide, or a small molecule. In some embodiments, the small molecule is an apocynin compound, a GTPase inhibitor, a fulvene compound, or a pyrazolo pyridine compound, or a triphenylmethane compound. In some embodiments, the small molecule is apocynin, Fulvene-5, 6- (dimethylamino)fulvene, NSC 23766, GKT 137831, Imipramine Blue (IB), Carbazole Blue, or Proton Sponge (or an analogue thereof such as Proton Sponge Blue). In some embodiments, the polynucleotide is a NOX4 siRNA, a NOX4 shRNA, a NOX4 antisense oligo, or a morpholino. In some embodiments, the polynucleotide is SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In some embodiments, the one or more NOX4 inhibitors are present in a therapeutically effective amount. In some embodiments, the composition further comprises one or more reactive oxygen species (ROS) scavengers and/or one or more antioxidants. In some embodiments, the composition further comprises an inhibitor of calcium/calmodulin-activated protein kinase II (CaMKII).

[0015] In some embodiments, the present invention is directed to the use of one or more NOX4 inhibitors for the manufacture of a medicament for treating an

arrhythmia. In some embodiments, the arrhythmia is associated with an elevated level of reactive oxygen species (ROS) caused by NOX4 activity in the subject. In some embodiments, the ROS is superoxide or hydrogen peroxide. In some embodiments, the arrhythmia is atrial fibrillation. In some embodiments, the NOX4 inhibitor is a peptide, an antibody, a polynucleotide, or a small molecule. In some embodiments, the small molecule is an apocynin compound, a GTPase inhibitor, a fulvene compound, or a pyrazolo pyridine compound, or a triphenylmethane compound. In some embodiments, the small molecule is apocynin, Fulvene-5, 6- (dimethylamino)fulvene, NSC 23766, GKT 137831, Imipramine Blue (IB), Carbazole Blue, or Proton Sponge (or an analogue thereof such as Proton Sponge Blue). In some embodiments, the polynucleotide is a NOX4 siRNA, a NOX4 shRNA, a NOX4 antisense oligo, or a morpholino. In some embodiments, the polynucleotide is SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In some embodiments, the one or more NOX4 inhibitors are present in a therapeutically effective amount. In some embodiments, the composition further comprises one or more reactive oxygen species (ROS) scavengers and/or one or more antioxidants. In some embodiments, the composition further comprises an inhibitor of calcium/calmodulin-activated protein kinase II (CaMKII).

[0016] In some embodiments, the present invention is directed to the use of one or more NOX4 inhibitors for the manufacture of a medicament for treating an

arrhythmia, wherein the medicament is prepared to be administered in a

therapeutically effective amount. In some embodiments, the arrhythmia is associated with an elevated level of reactive oxygen species (ROS) caused by NOX4 activity in the subject. In some embodiments, the ROS is superoxide or hydrogen peroxide. In some embodiments, the arrhythmia is atrial fibrillation. In some embodiments, the NOX4 inhibitor is a peptide, an antibody, a polynucleotide, or a small molecule. In some embodiments, the small molecule is an apocynin compound, a GTPase inhibitor, a fulvene compound, or a pyrazolo pyridine compound, or a triphenylmethane compound. In some embodiments, the small molecule is apocynin, Fulvene-5, 6- (dimethylamino)fulvene, NSC 23766, GKT 137831, Imipramine Blue (IB), Carbazole Blue, or Proton Sponge (or an analogue thereof such as Proton Sponge Blue). In some embodiments, the polynucleotide is a NOX4 siRNA, a NOX4 shRNA, a NOX4 antisense oligo, or a morpholino. In some embodiments, the polynucleotide is SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13. In some embodiments, the composition further comprises one or more reactive oxygen species (ROS) scavengers and/or one or more antioxidants. In some embodiments, the composition further comprises an inhibitor of calcium/calmodulin-activated protein kinase II (CaMKII).

[0017] In some embodiments, the present invention is directed to a NOX4 inhibitor for use in treating an arrhythmia. In some embodiments, the arrhythmia is associated with an elevated level of reactive oxygen species (ROS) caused by NOX4 activity in the subject. In some embodiments, the ROS is superoxide or hydrogen peroxide. In some embodiments, the arrhythmia is atrial fibrillation. In some embodiments, the NOX4 inhibitor is a peptide, an antibody, a polynucleotide, or a small molecule. In some embodiments, the small molecule is an apocynin compound, a GTPase inhibitor, a fulvene compound, or a pyrazolo pyridine compound, or a triphenylmethane compound. In some embodiments, the small molecule is apocynin, Fulvene-5, 6- (dimethylamino)fulvene, NSC 23766, GKT 137831, Imipramine Blue (IB), Carbazole Blue, or Proton Sponge (or an analogue thereof such as Proton Sponge Blue). In some embodiments, the polynucleotide is a NOX4 siRNA, a NOX4 shRNA, a NOX4 antisense oligo, or a morpholino. In some embodiments, the polynucleotide is SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.

[0018] Both the foregoing general description and the following detailed description are exemplary and explanatory only and are intended to provide further explanation of the invention as claimed. The accompanying drawings are included to provide a further understanding of the invention and are incorporated in and constitute part of this specification, illustrate several embodiments of the invention, and together with the description serve to explain the principles of the invention.

[0019] DESCRIPTION OF THE DRAWINGS

[0020] This invention is further understood by reference to the drawings wherein:

[0021] Figure 1 A is a graph showing the total superoxide production levels in patients with (AF) and without atrial fibrillation (Non-AF). LAA were homogenated and subsequently analyzed for superoxide production using ESR. [0022] Figure IB is a graph showing the hydrogen peroxide production levels in patients with (AF) and without atrial fibrillation (Non-AF). LAA lysates were analyzed for hydrogen peroxide production using the Amplex Red assay known in the art.

[0023] Figure 2 A is a graph showing the upregulation of NOX4 mRNA expression in patients with (AF) and without atrial fibrillation (Non-AF). NOX4 mRNA expression was determined by RT-PCR analysis and normalization to endogenous amplicon of GAPDH.

[0024] Figure 2B is a graph showing the upregulation of NOX4 mRNA expression and its correlation with hydrogen peroxide production in patients with (AF) and without atrial fibrillation (Non-AF).

[0025] Figure 3 A shows the NOX1 mRNA expression in patients with (AF) and

without atrial fibrillation (Non-AF). mRNA expression was determined by RT-PCR analysis and normalization to endogenous amplicon of GAPDH.

[0026] Figure 3B shows the NOX2 mRNA expression in patients with (AF) and

without atrial fibrillation (Non-AF). mRNA expression was determined by RT-PCR analysis and normalization to endogenous amplicon of GAPDH.

[0027] Figure 4 A shows representative Western blots of NOX4 and AT1R expression in Ang II treated HL-1 cells (Ang II) and controls (CTRL). Data are represented as

Mean ± SEM (N = 4, *p<0.05 vs CTRL).

[0028] Figure 4B is a graph providing densitometic grouped data of NOX4

expression in Ang II treated HL-1 cells (Ang II) and controls (CTRL). Data are represented as Mean ± SEM (N = 4, *p<0.05 vs CTRL).

[0029] Figure 4C is a graph providing densitometic grouped data of AT-1R

expression in Ang II treated HL-1 cells (Ang II) and controls (CTRL). Data are represented as Mean ± SEM (N = 4, *p<0.05 vs CTRL).

[0030] Figure 4D is a graph providing hydrogen peroxide production in Ang II treated

HL-1 cells. Data are represented as Mean ± SEM (N = 4, *p<0.05 vs CTRL).

[0031] Figure 4E is a graph providing NOX4 mRNA expression in Ang II treated

HL-1 cells (Ang II) and controls (CTRL). Data are represented as Mean ± SEM (N =

4, *p<0.05 vs CTRL).

[0032] Figure 5 is Table 1 providing the primer sequences for RT-PCR. The

sequence identifiers for the sequences are SEQ ID NOs: l-10.

[0033] Figure 6 is Table 2 that summarizes the patient characteristics. [0034] Figure 7 is Table 3 that summarizes the blood pressures in the patient subgroups.

[0035] Figure 8 is Table 4 that summarizes hydrogen peroxide levels in the patient subgroups.

[0036] Figure 9 A are graphs summarizing the beat-to-beat intervals in control

embryos (top) and NOX4 RNA injected embryos (bottom). Dotted lines mark average beat-to-beat intervals from each embryo, and the standard deviation (SD) are calculated from grouped data.

[0037] Figure 9B is a graph showing the distributions of beat-to-beat variation of embryos (standard deviation, SD) in control and NOX4 embryos. One dot represents SD of one embryo. **p<0.01 compared to control group. n=l 1-17.

[0038] Figure 1 OA is a graph showing the distribution of standard deviation (SD) of the distributions of beat-to-beat variations of embryos in control and NOX4-P437H RNA injected zebrafish embryos at 24-30 hpf. n=15. No significant difference was observed.

[0039] Figure 10B is a graph showing superoxide production in control and NOX4-

P437H RNA injected zebrafish embryos. n=5. No significant difference was observed.

[0040] Figure 11 A is a table summarizing the percentages of arrhythmia in controls

(Control), NOX4 embryos treated with 300 pg NOX4 RNA (NOX4 300 pg), NOX4 embryos co-injected with 300 pg NOX4 RNA and 3 ng of NOX4 morpholino (NOX4 300 pg + MO 3 ng), NOX4 embryos co-injected with 300 pg NOX4 RNA and 25 U/ml of PEG-SOD (NOX4 300 pg + pegSOD), and NOX4 embryos treated with NSC23766 (10 μΜ), Fulvene-5 (10 μΜ), or KN93 (10 μΜ). **p<0.001, compared to control group; ##p<0.001, compared to NOX4 group.

[0041] Figure 1 IB is a graph showing the superoxide production in controls (control

RNA injected embryos), NOX4 embryos injected with 300 pg NOX4 RNA (NOX4 300 pg), NOX4 embryos injected with 450 pg NOX4 RNA (NOX4 450 pg), and NOX4 embryos co-injected with 300 pg and 3 ng of NOX4 morpholino (NOX4 300 pg + MO). Superoxide production from control and NOX4 RNA injected zebrafish embryos was determined by electron spin resonance (ESR). ** compare to control group, p<0.01; # compare to NOX4 300 pg group, p<0.05, n = 3-12.

[0042] Figure 12 is a graph showing the percentages of embryos with arrhythmic phenotype in groups of control RNA injected zebrafish embryos, and NOX4 RNA injected zebrafish embryos with or without treatments of NOX4 morpholino (MO), PEG-SOD, NSC23766 or Fulvene-5. Videos of ten to twenty embryos were recorded and analyzed from each injection. **p<0.001, compared to control group; ## p<0.001, compared to NOX4 group. n=3-13. MO, NOX4 morpholino, SOD: PEG-SOD, NSC: NSC23766, Ful: Fulvene-5.

[0043] Figure 13 is a graph showing that NSC23766 attenuates superoxide production in NOX4 overexpressed zebrafish embryos. NOX4 embryos at 22-23 hpf were treated with NSC23766 (10 μΜ). **compare to control group, p<0.01; NS, no significant difference compared to control group. n=5.

[0044] Figure 14 is a graph showing that Fulvene-5 attenuates superoxide production in NOX4 overexpressed zebrafish embryos. NOX4 embryos at 22-23 hpf were treated with Fulvene-5 (10 μΜ). **compare to control group, p<0.01; NS, no significant difference compared to control group. n=4.

[0045] Figure 15 is a graph showing that PEG-SOD attenuates superoxide production in NOX4 overexpressed zebrafish embryos. NOX4 embryos at 22-23 hpf were treated with PEG-SOD (25 U/ml). **compare to control group, p<0.01; NS, no significant difference compared to control group. n=4.

[0046] Figure 16A is a graph showing NOX4 RNA injection activates CaMKII in a superoxide-dependent fashion in NOX4 embryos (NOX4), i.e., CaMKII

phosphorylation (Thr286) at 24 hpf. n=4. *p<0.05, **p<0.01 compared to control group (Con).

[0047] Figure 16B is a graph showing NOX4 RNA injection activates CaMKII in a superoxide-dependent fashion in NOX4 embryos (NOX4), i.e., CaMKII

phosphorylation (Thr286) at 31 hpf. n=4. *p<0.05, **p<0.01 compared to control group (Con).

[0048] Figure 16C is a graph showing that treatment with PEG-SOD (25 U/ml)

prevents CaMKII phosphorylation (Thr286) caused by NOX4 activation. Data is shown for NOX4 embryos at 31 hpf. n=2.

[0049] DETAILED DESCRIPTION OF THE INVENTION

[0050] The present invention is directed to methods for treating an arrhythmia in a subject which comprises inhibiting or reducing the expression or activity of NADPH oxidase 4 (NOX4) in the subject. In some embodiments, the methods of the present invention comprise administering one or more compounds or compositions which inhibit or reduce the expression or activity of NOX4 in the subject. [0051] In the experiments below, total superoxide production (determined by electron spin resonance) was similar in patients with and without atrial fibrillation (AF), but H₂0₂ production was more than double in patients having AF (AF patients) (149.8 ± 26.28 vs. 66.9 ± 7.14 pmol/mg/min, p = 0.0055) which coincided with a doubling in NOX isoform 4 (NOX4) expression. Additionally, AF patients with co-existing hypertension had about a three-fold higher level of H2O2 production compared to those without (239.0 ± 125.1 vs. 83.6 ± 51.3 pmol/mg/min, p = 0.003). Further, treatment of HL-1 atrial cells with angiotensin II (Ang II), a known modulator of atrial structural remodeling, resulted in upregulation of NOX4 and H2O2 production.

[0052] As superoxide (0₂ ^*~) production levels (as well as xanthine oxidase derived

0₂ ^*~ levels, data not shown) in left atrial appendage (LAA) tissues were found to be substantially similar in patients with and without AF and H2O2 regulates electrical properties of pulmonary vein and atrial cells, overproduction of H2O2 is associated with AF, these results indicate that arrhythmias, such as AF, may be treated by inhibiting or reducing the expression or activity of NOX4. In addition, these results indicate that local cardiac production of elevated levels of H2O2 is involved in arrhythmogenesis (in addition to its proinflammatory the prothombotic effects) such that arrhythmogenesis may be inhibited or reduced by inhibiting or reducing the expression or activity of NOX4. The discovery that H₂0₂ overproduction resulting from NOX4 is involved in arrhythmogenesis such that one may inhibit or reduce the expression or activity of NOX4 to inhibit or treat arrhythmias, such as AF, is surprising since (1) the expression levels and activities of NOX 1 and NOX2 are substantially the same in patients with and without AF, (2) NOX3 and NOX5 are not detectable in LAA tissues of patients with and without AF, and (3) the severity of heart failure is not linked to NOX4.

[0053] Therefore, the present invention is directed to compositions and methods for treating arrhythmias, such as AF, in subjects which involve inhibiting or reducing the expression or activity of NOX4. Arrhythmias according to the present invention include atrial cardiac arrhythmias (e.g., premature atrial contractions, wandering atrial pacemaker, multifocal atrial tachycardia, atrial flutter, atrial fibrillation, postoperative arrhythmia including atrial fibrillation, etc.), junctional arrhythmias (e.g., supraventricular tachycardia, AV nodal reentrant tachycardia, paroxysmal supraventricular tachycardia, junctional rhythm, junctional tachycardia, premature junctional complex, etc.), atrio-ventricular arrhythmias, ventricular arrhythmias (e.g., premature ventricular contractions, accelerated idioventricular rhythm, monomorphic ventricular tachycardia, polymorphic ventricular tachycardia, ventricular fibrillation, etc.), and the like. In some embodiments, the arrhythmia is atrial fibrillation (AF).

[0054] In some embodiments, the subjects are mammalian, and include humans, non- human primates, canines, pigs, rabbits, rodents, and the like, preferably humans. In some embodiments, the subjects are not mammalian, e.g., zebrafish. In some embodiments, the subject is a model organism for an arrhythmia, e.g., AF. In some embodiments, the subjects to be treated are in need thereof. According to the present invention, a subject "in need thereof is one who has, is suspected of having, or is at risk of having an arrhythmia, such as atrial fibrillation. In some embodiments, the subject to be treated is one who has, is suspected of having, or is at risk of having atrial fibrillation.

[0055] In some embodiments, the methods according to the present invention

comprise the administration of one or more NOX4 inhibitors. Similarly, in some embodiments, the compositions according to the present invention comprise one or more NOX4 inhibitors. As used herein, a "NOX4 inhibitor" refers to a compound or composition that inhibits or reduces the activity and/or expression levels of NOX4 as compared to a negative control. In some embodiments, the NOX4 inhibitor selectively inhibits or reduces the expression or activity of NOX4 (e.g., by about 1- fold to about 1000-fold more) over that of another NADPH oxidases, such as NOX1, NOX2, NOX3, and NOX5. Suitable NOX4 inhibitors are known in the art. Also known in the art are various methods for screening compounds and compositions for their ability to inhibit NOX4 expression and activity.

[0056] In some embodiments, the NOX4 inhibitor is a peptide which is referred to as a "NOX4 inhibitor peptide". As used herein, the terms "peptide", "polypeptide", and "protein" are used interchangeably to refer to two or more natural, non-natural and/or chemically modified amino acid residues connected one to the other by peptide bonds. In some embodiments, the NOX4 inhibitor peptide is one that disrupts the binding between the B-loop and DH domain of NOX4, e.g., a peptide comprising the penultimate 22 amino acids of NOX4 (1) or a peptide having an amino acid sequence which is the B-loop sequence with one or more mutations (e.g., R96E) (2) or an analogue thereof. As used herein, an "analogue" of a peptide refers to a peptide that exhibits about 85-99%, preferably about 90-99%, more preferably about 95-99%), homology to the peptide. In some embodiments, the analogue exhibits the same or similar biological activity as the protein. In some embodiments, the analogue exhibits at least about 50%, preferably at least about 60%>, more preferably at least about 70%>, even more preferably at least about 80%, and most preferably at least about 90%, of the biological activity of the protein.

In some embodiments, the NOX4 inhibitor is an antibody which is referred to as a "NOX4 inhibitor antibody". As used herein, an "antibody" refers to

immunoglobulin molecules comprising four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, and antigen-binding fragments thereof. Antigen-binding fragments include Fab, Fab', F(ab')₂, Fd, Fv, and dAb fragments, and single-chain (scFv) antibodies. Antibodies according to the present invention may be polyclonal or monoclonal. The antibodies may be chimeric, humanized, or human antibodies. Antibodies according to the present invention may be made using methods known in the art, e.g., by recombinant techniques, or by enzymatic or chemical cleavage of intact antibodies. See e.g., Helguera et al.

"Monoclonal Antibodies, Human, Engineered" in ENCYCLOPEDIA OF INDUSTRIAL BIOTECHNOLOGY: BIOSEPARATION, AND CELL TECHNOLOGY, ed. Michael C.

Flickinger (2010) John Wiley & Sons, Inc., which is herein incorporated by reference. In some embodiments, the antibodies according to the present invention bind to and/or block the activity of NOX4. In some embodiments, the NOX4 inhibitor antibody is selected from the group consisting of ab55832, ab60940, ab61248, ab79971, abl 16502, abl54244, ab81965, abl09225, and abl33303 (which are commercially available from Abeam, Cambridge, MA); sc-30141, sc-55142, and sc- 21860 (which are commercially available from Santa Cruz Biotechnology, Inc., Dallas, TX); those available from Novus Biologicals, LLC (Littleton CO); and antigen-binding fragments and/or analogues thereof. As used herein, an "analogue" of a given antibody (or antigen-binding fragment) refers to an antibody (or an antigen- binding fragment thereof) that exhibits about 85-99%, preferably about 90-99%, more preferably about 95-99%, homology to the given antibody (or antigen-binding fragment). In some embodiments, the analogue exhibits the same or similar biological (e.g., binding) activity as the given antibody (or antigen-binding fragment). In some embodiments, the analogue exhibits at least about 50%, preferably at least about 60%, more preferably at least about 70%, even more preferably at least about 80%, and most preferably at least about 90%, of the biological activity of the given antibody (or antigen-binding fragment). [0058] In some embodiments, the NOX4 inhibitor is a nucleic acid molecule which is referred to as a "NOX4 inhibitor polynucleotide". As used herein, the term "nucleic acid molecule" is used interchangeably with "polynucleotide" and refers to compounds having two or more nucleotides linked together. The nucleotides may be ribonucleotides, deoxyribonucleotides, or synthetic analogs thereof. In some embodiments, the nucleic acid molecules, e.g., siRNA, shRNA, and antisense oligo, cause RNA interference (RNAi) and inhibit the expression of NOX4. In some embodiments, the NOX4 inhibitor polynucleotide is a NOX4 siRNA or a NOX4 shRNA, such as those available from Dharmacon/Thermo Scientific, Waltham, MA, including NOX4 sense: CAUGCUGCUGCUGUUGCAUGUUUCA (SEQ ID NO:

11) and NOX4 antisense: CCCUCUGAUGUAAUGGAACUCCGUA (SEQ ID NO:

12) . In some embodiments, the NOX4 inhibitor polynucleotide is a morpholino which inhibits the proper transcription and/or processing of NOX4, such as the NOX4 morpholino as described herein, i.e., 5'-GCCAGCTCCTCCAGGACACAGCCAT-3' (SEQ ID NO: 13). In some embodiments, the NOX4 inhibitor polynucleotide is a NOX4 gene silencer, such as the NOX4 siRNA, NOX4 shRNA plasmids, and NOX4 shRNA lentiviral particles (e.g., sc-41586, sc-41586-SH, sc-41586-V, sc-41587, sc- 41587-SH, sc-41587-V, sc-61887, sc-61887-SH, and sc-61887-V) available from Santa Cruz Biotechnology, Inc. In some embodiments, the NOX4 inhibitor polynucleotide is a NOX4 human shRNA such as that available from OriGene Technologies, Inc., Rockville, MD (Gene ID 50507). In some embodiments, the NOX4 inhibitor polynucleotide is a NOX4 RNAi such as that available from Novus Biologicals, LLC.

[0059] In some embodiments, the NOX4 inhibitor is a small molecule which is

referred to as a "NOX4 inhibitor compound". In some embodiments, the NOX4 inhibitor compound is apocynin, Fulvene-5, 6-(dimethylamino)fulvene, NSC 23766, GKT 137831, Imipramine Blue (IB), Carbazole Blue, Proton Sponge, Proton Sponge Blue, and derivatives and analogs thereof. In some embodiments, the NOX4 inhibitor compound is an apocynin compound such as those disclosed in US 20090203653, a GTPase inhibitor such as those disclosed in US 20060004032, a fulvene compound such as those disclosed in US 20080275016, including those having the structural formula

as described therein, a pyrazolo pyridine compound such as those disclosed in WO 2010/035221, including compound 135 as disclosed therein, or a triphenylmethane such as Imipramine Blue (IB), Carbazole Blue, and Proton Sponge or an analogue thereof such as Proton Sponge Blue which has the following structural formula

[0060] Examples of suitable NOX4 inhibitors and compositions comprising such include those as described in US 20060004032, 20070037883, 20080275016, 20090203653, 20100056445, 20100273854, 20110288155, 20120136044,

20120141461, and 20120172244, each of which is herein incorporated by reference in its entirety. Those skilled in the art may readily identify and select NOX4 inhibitors using screening methods known in the art.

[0061] In some embodiments, the NOX4 inhibitor is administered in a therapeutically effective amount. As used herein, a "therapeutically effective amount" is an amount which ameliorates the disease or disorder (e.g., an arrhythmia) or symptom thereof as compared to a control (e.g., a placebo).

[0062] A therapeutically effective amount may be readily determined by those skilled in the art using methods known in the art. The dosages to be administered can be determined by one of ordinary skill in the art depending on the clinical severity of the disease or disorder (e.g., an arrhythmia) or symptom thereof and the age and weight of the subject. Preferred therapeutically effective amounts of the NOX4 inhibitors range from about 0.01 to about 20 mg/kg body weight, 0.01 to about 10 mg/kg body weight, about 0.01 to about 3 mg/kg body weight, about 0.01 to about 2 mg/kg, about 0.01 to about 1 mg/kg, or about 0.01 to about 0.5 mg/kg body weight for parenteral formulations. Effective amounts for oral administration may be up to about 10-fold higher. Moreover, treatment of a subject with a NOX4 inhibitor or composition of the present invention can include a single treatment or, preferably, can include a series of treatments. In some embodiments, the therapeutically effective amounts of the NOX4 inhibitors range from about 0.01 to about 20 mg/kg body weight, 0.01 to about 10 mg/kg body weight, about 0.01 to about 3 mg/kg body weight, about 0.01 to about 2 mg/kg, about 0.01 to about 1 mg/kg, or about 0.01 to about 0.5 mg/kg body weight, per day.

[0063] It will be appreciated that the actual dosages will vary according to the

particular NOX4 inhibitor, composition, formulation, mode of administration, and the particular site, host, and disease or disorder (e.g., an arrhythmia) or symptom being treated. It will also be appreciated that the effective dosage used for treatment may increase or decrease over the course of a particular treatment. Optimal dosages for a given set of conditions may be ascertained by those skilled in the art using

conventional dosage-determination tests in view of the experimental data for a given NOX4 inhibitor or composition. Changes in dosage may result and become apparent by standard diagnostic assays known in the art. In some conditions chronic administration may be required. In some embodiments, administration is for a given period of time, e.g., a few days, a few weeks, or a few months.

[0064] In some embodiments, the one or more NOX4 inhibitors are administered as a prophylactic treatment. A "prophylactic treatment" is a treatment administered to a subject who does not display signs or symptoms of the disease or disorder (e.g., an arrhythmia) or symptom thereof, or displays only early signs or symptoms of the disease or disorder (e.g., an arrhythmia) or symptom thereof, such that treatment is administered for the purpose of diminishing, preventing, or decreasing the risk of developing the disease or disorder (e.g., an arrhythmia) or symptom thereof. In these embodiments, the one or more NOX4 inhibitors are administered in a

"prophylactically effective amount" which is an amount that inhibits or reduces the development of the disease or disorder (e.g., an arrhythmia) or symptom thereof as compared to a control.

[0065] In some embodiments, the NOX4 inhibitor is administered in a form of a pharmaceutical composition. Pharmaceutical compositions of the invention may be prepared in a unit-dosage form appropriate for the desired mode of administration. The compositions of the present invention may be administered for therapy by any suitable route including oral, rectal, nasal, topical (including buccal and sublingual), vaginal and parenteral (including subcutaneous, intramuscular, intravenous and intradermal). A variety of administration routes can be used in accordance with the present invention, including oral, topical, transdermal, nasal, pulmonary,

transpercutaneous (wherein the skin has been broken either by mechanical or energy means), rectal, buccal, vaginal, via an implanted reservoir, or parenteral. Parenteral includes subcutaneous, intravenous, intramuscular, intraperitoneal, intra-articular, intra-synovial, intrasternal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques, as well as injectable materials (including polymers) for localized therapy. In some embodiments, the route of administration is subcutaneous. In some embodiments, the composition is in a sealed sterile glass vial. In some embodiments, the composition contains a preservative. Pharmaceutical compositions may be formulated as bulk powder, tablets, liquids, gels, lyophilized, and the like, and may be further processed for administration. See e.g. REMINGTON: THE SCIENCE AND PRACTICE OF PHARMACY. 22^ND ed. (2012) Lippincott Williams & Wilkins. Baltimore, MD, which is herein incorporated by reference. It will be appreciated that the preferred route will vary with the condition and age of the recipient, the nature of the condition to be treated, and the chosen NOX4 inhibitor and formulation.

[0066] Pharmaceutical compositions of the present invention comprise a

therapeutically effective amount of at least one NOX4 inhibitor as disclosed herein, and a pharmaceutically acceptable carrier or diluent, which may be inert. As used herein the language "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, bulking agent, coatings, antibacterial and antifungal agents, preservatives, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration and known in the art. Except insofar as any conventional media or agent is incompatible with the given NOX4 inhibitor, use thereof in the compositions is contemplated. [0067] Supplementary compounds can also be incorporated into the compositions.

Supplementary compounds include beta blockers (such as metoprolol and atenolol), calcium channel blockers (such as diltiazem and verapamil), digoxin, and blood thinners (such as warfarin, dabigatran, heparin, and aspirin), free-radical scavengers (i.e., ROS scavengers) (such as superoxide dismutase (SOD), catalase,

manganese(III)-tetrakis(4-benzoic acid)porphyrin (MnTBAP), 2,2,6,6- Tetramethylpiperidine 1-oxyl (Tempol), N-acetyl cysteine, and the like), and antioxidants (such as vitamin E, vitamin C, polyphenol such as resveratrol, and the like).

[0068] Toxicity and therapeutic efficacy of the NOX4 inhibitors and compositions of the present invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD₅₀ (the dose lethal to 50% of the population) and the ED₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD₅₀/ED₅₀. NOX4 inhibitors which exhibit large therapeutic indices are preferred. While NOX4 inhibitors that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such NOX4 inhibitors to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.

[0069] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of NOX4 inhibitors of the present invention lies preferably within a range of circulating concentrations that include the ED₅₀ with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any NOX4 inhibitor used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC₅₀ (i.e., the concentration of the test compound which achieves a half- maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography or by mass spectroscopy.

[0070] In some embodiments, the present invention relates to pharmaceutical

compositions comprising a pharmaceutically acceptable carrier and one or more NOX4 inhibitors. As used herein, the term "pharmaceutically acceptable carrier" means a chemical composition with which the active ingredient (e.g., NOX4 inhibitor) may be combined and which, following the combination, can be used to administer the active ingredient to a subject.

[0071] A pharmaceutical composition of the invention may be prepared, packaged, or sold in bulk, as a single unit dose, or as a plurality of single unit doses. As used herein, a "unit dose" is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject or a convenient fraction of such a dosage such as, for example, one -half or one-third of such a dosage. In some embodiments, the present invention provides doses of the one or more NOX4 inhibitors in the range of 0.01 mg to 1000 mg. In some embodiments, a NOX4 inhibitor of the present invention is provided in a pharmaceutical composition at a concentration in the range of 0.1 mg/ml to 100 mg/ml. The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w/w) active ingredient.

[0072] The one or more NOX4 inhibitors of the present invention may be

administered alone, or in combination with other therapies. For example, the one or more NOX4 inhibitors may be administered in combination with medications, electrical cardioversion, radiofrequency ablation, surgery, atrial pacemakers, etc. As used herein, the term "administration" refers to the act of giving a drug, prodrug, or other agent, or therapeutic treatment (e.g., compositions of the present invention) to a subject (e.g., a subject or in vivo, in vitro, or ex vivo cells, tissues, and organs).

Exemplary routes of administration are through the eyes (ophthalmic), mouth (oral), skin (transdermal), nose (nasal), lungs (inhalant), oral mucosa (buccal), ear, rectal, by injection (e.g., intravenously, subcutaneously, intratumorally, intraperitoneally, etc.) and the like.

[0073] In some embodiments, the NOX4 inhibitor is co-administered with another drug, composition, or treatment for treating arrhythmia. As used herein, the terms "co-administration" and "co-administer" refer to the administration of at least two agent(s) (e.g., a NOX4 inhibitor and a supplementary compound) or therapies to a subject. In some embodiments, the co -administration of two or more agents or therapies is concurrent. In these embodiments, the one or more NOX4 inhibitors and the second agent may be administered as a single composition, e.g., an admixture, or as two separate compositions. In some embodiments, the one or more NOX4 inhibitors are administered before and/or after to a second agent/therapy. Where the co-administration is sequential, the administration of the one or more NOX4 inhibitors and the administration of the second agent/therapy may be separated by a period of time, e.g., minutes, hours, or days. Those of skill in the art understand that the formulations and/or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents or therapies are co-administered, the respective agents or therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co-administration of the agents or therapies lowers the requisite dosage of a potentially harmful (e.g., toxic) agent(s).

[0074] In some embodiments, one or more NOX4 inhibitors of the present invention are delivered to the site of application (e.g., heart) via any acceptable route (e.g., catheter, needle, laparoscopically, surgically, systemically, injection apparatus, etc.). In some embodiments, one or more NOX4 inhibitors are delivered via a catheter). In some embodiments, one or more NOX4 inhibitors are delivered via an injection apparatus. In some embodiments, one or more NOX4 inhibitors are delivered via direct injection, e.g., intravenously, intraatrially and/or intraventricually (for example, during a surgical procedure). In some embodiments, one or more NOX4 inhibitors are applied directly to the site of action. In some embodiments, one or more NOX4 inhibitors access the site of action through diffusion, or moving through the vasculature. In some embodiments, one or more NOX4 inhibitors are topically applied (e.g., to the heart).

[0075] The following examples are intended to illustrate but not to limit the

invention.

[0076] EXAMPLES

[0077] To determine whether reactive oxygen species (ROS) resulting from NADPH oxidase (NOX) is important in the development of arrhythmias mediated by angiotensin II (Ang II), cardiac tissues from heart transplant patients were examined for ROS production and expression of NOX isoforms. Interestingly, patients suffering from atrial fibrillation (AF) exhibited NOX4 upregulation and H2O2 overproduction. Changes in the regulation of other NOX isoforms were not observed in the patients suffering from atrial fibrillation (AF patients). AF patients with coexisting hypertension had more than 3 -fold increase in H2O2 production compared to those without. Atrial HL-1 cells treated with Ang II exhibited increased ATI receptor expression, upregulation of NOX4, and increased H2O2 production. These human and cell culture data together indicate that NOX4 inhibitors may be used to treat arrhythmias, preferably those mediated by Ang II such as AF, in subjects.

[0078] Methods and Materials

[0079] Patient Population

[0080] Left atrial appendage (LAA) tissues isolated from randomly recruited patients undergoing cardiac transplant surgeries were subjected to electron spin resonance (ESR) determination of superoxide radical (0₂ ^*~) production, and RT-PCR analysis of gene expression. The study was carried out in a double-blinded fashion. Clinical information was gathered upon completion of laboratory analyses. Approval from UCLA's IRB was obtained for these studies.

[0081] Electron Spin Resonance Detection of Superoxide Radical

[0082] The specific 0₂ ^*~ spin trap CMH (0.5 mmol/L; Noxygen) solution was

prepared freshly in nitrogen gas bubbled Krebs/HEPES buffer containing

diethyldithiocarbamic acid (DETC; 5 μιηοΐ/ΐ; Sigma) and deferoxamine (25 μιηοΐ/ΐ; Sigma). The LAA homogenates (in 50 mmol/L Tris-HCl, pH 7.4, 0.1 mmol/L EDTA, 0.1 mmol/L EGTA, and 1% (v/v) of protease inhibitor cocktail from Sigma) were then mixed with the spin trap solution and loaded into glass capillary (Fisher

Scientific) for analysis of 0₂ ^*~ production using electron spin resonance (ESR) spectrometer (Bruker), following the method previously published for cultured endothelial cells (3, 4, 5) intact mouse aortas (3, 4, 6), and tissue homogenates (7). The ESR settings used were as follows: bio-field 3,410, field sweep 100 G, microwave frequency 9.73 GHz, microwave power 13.26 mW, modulation amplitude 9.82 G and 512 points of resolution.

[0083] Amplex Red Assay of Hydrogen Peroxide Production

[0084] The LAA lysates (in 20 mmol/L Tris-HCl, pH 7.4, 150 mmol/L NaCl, 1

mmol/L EGTA, 1 mmol/L EDTA, 1% (v/v) Triton X-100, 2.5 mmol/L sodium pyrophosphate, 1 mmol/L Na₃V0₄, 1 mmol/L β-glycerolphosphate, 1 mmol/L PMSF, 1% (v/v) of protease inhibitor cocktail from Sigma) were analyzed for H₂0₂ production using a fluorometric horseradish peroxidase assay (Amplex-Red assay; Molecular Probes). Fluorescence was measured (excitation 530 nm and emission 590 nm) after 1 hour of incubation at 37°C in the dark against background fluorescence of buffer. Polyethylene gly col-conjugated catalase (500 U/ml, Sigma) inhibited fraction reflects specific H₂0₂ signal. The rate of H₂0₂ production was presented as picomoles per milligram protein per minute after calculation, according to a standard curve generated using fresh H₂0₂ in reaction buffer.

[0085] RT-PCR Analysis ofNOXmRNA Expression

[0086] Total RNA was extracted from the LAA using TRIzol (Invitrogen) according to the manufacturer's instructions. Reverse transcription was performed in standard fashion with iScript cDNA synthesis Kit (Bio-Rad). The primer sequences used for PCR reactions are summarized in Table 1. PCR reactions were carried out using an iCycler (Bio-Rad) with the protocol of ((95°C/2 min), (95°C/25 sec, 57°C/5 sec, 68°C 5 min) x 35, (72°C/10 min)). The PCR mix contained GAPDH primers to generate GAPDH amplicon that served as an internal control.

[0087] HL-1 Cell Culture and Stimulation by Ang II

[0088] HL-1 cardiomyocytes, derived from atrial cardiac muscle cells from the ATI mouse atrial cardiomyocyte tumor lineage, maintains the differentiated adult cardiomyocyte phenotype (8). HL-1 cells have been proved to possess the organized sarcomere, ion channels, functional receptors and intracellular signaling proteins so that it contracts spontaneously, divides, generates action potential, and responds to agonists. Therefore, HL-1 cells are widely accepted as in vitro models for studing the cellular and molecular mechanisms underlying cardiac pathophysiologies, including AF. Therefore, HL-1 cells were employed as the cellular model to investigate whether NOX4 is modulated by Ang II. The HL-1 cells were obtained as generous gifts from Dr. William Claycomb from Louisiana State University that have been extensively characterized to maintain its differentiated cardiac phenotype using microscopic, genetic, immunohistochemical, electrophysiological, and

pharmacological techniques (8, 9). These beating cells were cultured following exact protocols as established by the Claycomb group and were found to keep their phenotype during the 24 hours exposure period to Ang II. The confluent cells were kept quiescent in media containing 0.01% FBS overnight and then stimulated with Ang II (100 nmol/L) for 24 hours prior to analysis of NOX4 protein expression by Western blot (primary antibody from Abeam) and H₂O₂ production by Amplex Red assay. NOX4 mRNA expression from identically treated cells was determined by RT-PCR.

[0089] Statistical Analysis

[0090] All data are presented as Mean ± SEM. Differences in O₂ ^*" production, H₂O₂ production, and mRNA expression of different NOX isoforms between AF and non- AF groups were compared using t tests. ANCOVA were performed to examine the correlation between H₂O₂ and NOX4 mRNA expression in patients with and without AF. Statistical significance was set as p<0.05.

[0091] Patient Characteristics

[0092] Patient characteristics are summarized in Table 1. Eighteen patients with AF were older than those without (n = 17) (p = 0.047). Patients with AF were older than those without (58.8 ± 11.7 vs. 47.8 ± 19.2, p = 0.047). The gender distribution was not different. Both groups had similar incidence of co-existing cardiovascular conditions including hypertension, diabetes and coronary artery disease. The percentages of patients receiving treatment with an angiotensin converting enzyme inhibitor (ACEI), an angiotensin type 1 receptor blocker (ATIRB), a calcium channel blocker, or a beta-adrenergic receptor blocker were also similar between the two groups (Table 2). Of note, there was no significant difference in ejection fraction between the AF and non-AF groups. Whereas diastolic blood pressure, total cholesterol and triglyceride levels were not different in the AF vs. non-AF groups, systolic blood pressure (SBP) was higher in the AF patients (Table 2). ACEI -treated AF group had modestly higher SBP than those of non-AF group receiving ACEI (Table 3).

[0093] Reactive Oxygen Species Production

[0094] Among biologically relevant and abundant reactive oxygen species, 0₂ ^*~ and

H₂O₂ appear to be most important in redox signaling. Because O₂ ^*" predominantly induces endothelial dysfunction by rapidly inactivating nitric oxide (NO^*), whereas H₂O₂ influences different aspects of endothelial cell function via complex

mechanisms, O₂ ^*" and H₂O₂ may have differential roles in the regulation of cardiac functions. Thus, both species were quantitatively and specifically determined by electron spin resonance (ESR) and Amplex Red assay, respectively. Although total 0₂ ^*~ production was not different between AF and non-AF groups (Fig. 1 A), surprisingly H₂0₂ production was more than doubled in AF patients compared to those without (149.8 ± 26.28 vs. 66.9 ± 7.14 pmol/mg/min, p = 0.0055, Fig. IB).

[0095] H₂O ₂ Production in AF Patients with Coexisting Hypertension

[0096] Interestingly, AF patients with co-existing hypertension had about a 3 -fold higher H₂0₂ production compared to those without (239.0 ± 125.1 vs. 83.6 ± 51.3 pmol/mg/min, p = 0.003, Table 4). Older AF patients (>50) also had higher tissue levels of H₂0₂ compared to younger AF patients (<50) (165 ± 118.8 vs. 95.0 ± 64.9 pmol/mg/min). In contrast, hypertension or age had no effect on H₂0₂ levels in patients without AF (Table 4).

[0097] Expression of Different NOX Isoforms and Relationship to H₂O₂

[0098] Surprisingly, NOX4 mRNA expression was significantly upregulated in AF patients (Fig. 2A) alone with a marked increase in H₂0₂ production (Fig. 2B).

However, the expression of NOX 1 and NOX2 was not different in patients with and without AF (Figs 3A-3B). NOX3 and NOX5 were not detectable in LAA. No correlation between ejection fractions and NOX4/H₂0₂ levels was observed in both groups. This indicates that severity of heart failure is not linked to NOX4-H₂0₂ axis (hydrogen peroxide production as a result of NOX4 activation) as is AF.

[0099] NOX4 Expression and H₂O₂ Production in Ang Il-Stimulated HL-1 Atrial Cells

[0100] Whether Ang II activates NOX4 in HL-1 atrial cells that have been well

characterized to maintain a differentiated, adult cardiomyocyte and atrial cell-like phenotype was examined. Following the published Claycomb conditions (8), beating HL-1 cells was observed. Of note, the Ang II receptor AT-1 was abundantly expressed in these cells, and it was upregulated by Ang II (Fig. 4A and Fig. 4C). Ang II stimulation resulted in upregulation of NOX4 expression and an associated increase in H₂0₂ production (Figs. 4A-4B, Fig. 4D). NOX4 mRNA expression determined by RT-PCR was also found upregulated by Ang II in HL-1 cells (Fig. 4E).

[0101] INHIBITION OF NOX4 EXPRESSION, ACTIVITY, AND EFFECT ALLEVIATES ATRIAL FIBRILLATION IN SUBJECTS

[0102] Materials and Methods

[0103] Cloning and RNA in vitro Transcription [0104] Human NOX4 (NM O 16931) full-length coding region was amplified from pCMV6-hNOX4 (OriGene, #SC310253, Rockville, MD) by PCR and cloned into pCS2+ at Cla I and Xho I sites. NOX4-P437H was generated by PCR based site- directed mutagenesis (KOD Hot Start, Novagen/EMD Millipore, Darmstadt,

Germany). All of the plasmids were confirmed by sequencing. Capped mRNA of human NOX4 and mutant NOX4-P437H were synthesized by in vitro transcription with the mMESSAGE mMACHINE kit (Ambion).

[0105] Zebrafish Strains and Studies

[0106] Transgenic strain cmlc2:GFP zebrafish were maintained as previously

described (10, 11). In this colony, Green Fluorescent Protein (GFP) expression is driven by a cardiac specific promoter of Cardiac Myosin Light Chain 2 (cmlc2). The developmental stages of fish were determined by morphological features of fish raised at 28.5°C.

[0107] Micro-Injection

[0108] Wild type human NOX4 or mutant NOX4-P437H RNA (300 pg unless

indicated otherwise) was injected into cmlc2:GFP transgenic embryos at one-cell stage. In some experiments, injection was achieved by co-injection of 3 ng antisense morpholino (5'-GCCAGCTCCTCCAGGACACAGCCAT-3' (SEQ ID NO: 13), Gene Tools, Philomath, OR) complementary to the translation start codon ATG of human NOX4 coding region. This antisense morpholino is referred to herein as "NOX4 morpholino".

[0109] Pharmacological Interventions

[0110] PEG-SOD (25 U/ml, Sigma), NSC23766 (10 μΜ, Calbiochem) or Fulvene-5

(10 μΜ, a generous gift from Dr. Jack Arbiser, Emory University, Atlanta, GA) were added to the media soaking the embryos (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl₂, 0.33 mM MgS0₄) before 24 hours post fertilization (hpf). Titrations of PEG-SOD, NSC23766, and Fulvene-5 were carried out with cmlc2:GFP embryos (not injected with NOX4 RNA) to find the optimal concentrations which did not cause any dys- morphology when used alone.

[0111] Video Analyses

[0112] Digital videos were taken under UV illumination from embryos of similar developmental stages at 24-30 hpf. Embryos were randomly chosen for video recording. Each embryo was recorded for 1 minute, after stabilized for 1-2 minutes in 0.01% tricaine (Sigma-Aldrich). The videos were split into consecutive frames by Quicktime Player at 30 frames per second, which were then converted to a line- scanning result of atrial contraction by custom-made LQ-1 program as previously described (12, 13). Each vertical line in LQ-1 result represents one contraction. The horizontal axis indicates time of contraction, 1/30 second/pixel. By measuring the number of pixels between every vertical line (contraction) by another custom-made software, we acquired the precise time for one contraction, considered as beat-to-beat interval (beat-to-beat interval = number of pixels * 1/30 second). To represent the beat-to-beat variation, the standard deviation (SD) of beat-to-beat intervals of one embryo was calculated. Statistic comparison was carried out between SDs of control and NOX4 or NOX4-P437H RNA injected embryos. All the video analyses were done blindly without knowing the genotypes.

[0113] ROS Measurement

[0114] More than 20 embryos were harvested and homogenized in cold lx lysis

buffer (supplemented with protease inhibitor cocktail) at 27-33 hpf. On average 5 μΐ lysis buffer was used per embryo. The samples were centrifuged at 12,000 rpm at 4°C for 15 minutes after sitting on ice for 10 to 15 minutes, and then the supernatant transferred the to a new 1.7-mL Eppendorf tube for superoxide determination using electron spin resonance (ESR) (eScan, Bruker) immediately (14-19). For each measurement, 5 μΐ protein lysate was loaded. The rate of superoxide production was presented as μΜ/min/mg protein after normalizing ESR data to protein.

[0115] Immunoblot Analysis

[0116] Tissue lysates of zebrafish embryos were prepared as mentioned above.

Phosphotase inhibitors cocktail 2 and 3 (1 : 100, Sigma-Aldrich) were added when necessary. For phosphorylation of CaMKII (Thr286) detection, 200 μg protein were loaded into 10% SDS-PAGE with 1 :500 primary antibody dilution (Cell Signaling Technology, CST). Densitometry was performed with Image J and normalized to internal control.

[0117] Statistical Analysis

[0118] All the data are shown as mean±SEM. Data were analyzed by Student's t test, or ANOVA followed by a Newman-Keuls post-hoc analysis. Statistical significance is set as p<0.05.

[0119] 1. Inhibiting or Reducing NOX4 Expression [0120] To show that arrhythmias, such as AF, can be treated by inhibiting or reducing the expression of NOX4, cmlc2:GFP transgenic embryos at one-cell stage were injected with human NOX4 RNA, encoding full length human NOX4 (Accession No. NM 016931), were used to model NOX4 overexpression. The injected embryos are referred to herein as "NOX4 embryos". To quantify the intervals among heart rates of each NOX4 embryo and control embryo (not injected with NOX4 RNA), consecutive digital images (30 frame/seconds) were recorded for each embryo and analyzed by a line-scanning analysis of the atrial contractions. Remarkably, about 53.0% of the NOX4 embryos developed arrhythmia at about 24-30 hpf (as observed using video- recordings of the GFP-labeled beating hearts) compared to about 10% (18/159) of control embryos. As shown in Figures 9A-9B, mean of standard deviation (SD) of beat-to-beat intervals of each embryo was 0.024 sec/beat in control embryos, vs. 0.035 sec/beat for NOX4 embryos (p<0.01 vs. control).

[0121] To ensure that the arrhythmias were the result of NOX4, 300 pg of an RNA encoding a catalytically inactive NOX4 (having proline 437 substituted with histidine, NOX4-P437H, in the NADPH binding domain) was injected into the cardiac specific GFP transgenic zebrafish (cmlc2:GFP) and failed to induce arrhythmia as well as any increase in 0₂ ^*~ production (n = 5, p = 0.67) (Fig. 10A and Fig. 10B).

[0122] To determine whether the inhibition or reduction of the expression levels of

NOX4 will be effective in treating (e.g., reduce or inhibit) arrhythmias (such as AF) caused by overexpressed NOX4, the NOX4 morpholino was used to knock down the translation of the NOX4 RNA in the NOX4 embryos. In these experiments, 3 ng of NOX4 morpholino was co-injected with the NOX4 RNA. Administration of the NOX4 morpholino caused a decrease in the percentage of NOX4 embryos developing arrhythmia (from 53% to 20%) as well as a decrease in 0₂ ^*~ production as compared to controls. Specifically, of the embryos co-injected with the NOX4 morpholino, 20% (12/59) developed arrhythmia (Fig. 11).

[0123] To investigate the mechanism underlying NOX4-induced arrhythmia,

superoxide production was measured at 27-33 hpf when AF appears. Superoxide production in NOX4 RNA injected zebrafish embryos, determined by electron spin resonance (ESR), was increased more than about 2-fold to 10.9 μΜ/min/mg, from 5.3 μΜ/min/mg in the controls; however, superoxide production in the NOX4 morpholino co-injection group was significantly attenuated to near control level (Fig. 9B). [0124] The results of these experiments indicate that arrhythmias induced by NOX4 can be treated by inhibiting or reducing the expression of NOX4.

[0125] 2. Inhibiting or Reducing NOX4 Activity

[0126] a. NSC 23766

[0127] To determine whether the inhibition or reduction of the activity of NOX4 will be effective in treating (e.g., reduce or inhibit) arrhythmias (such as AF) caused by NOX4, a NOX4 inhibitor, i.e., NSC 23766 (CAS 733767-34-5), was administered to NOX4 embryos. Treatment of NOX4 embryos at 24 hpf (when heart starts contracting) with 10 μΜ NSC 23766 caused a decrease in the percentage of NOX4 embryos developing arrhythmia (Fig. 12) as well as a decrease in 0₂ ^*~ production (Fig. 13).

[0128] b. Fulvene-5 and Analogs

[0129] To determine whether the inhibition or reduction of the activity of NOX4 will be effective in treating (e.g., reduce or inhibit) arrhythmias (such as AF) caused by NOX4, NOX4 embryos were treated at 24 hpf with 10 μΜ Fulvene-5. Administration of Fulvene-5 caused a decrease in the percentage of NOX4 embryos developing arrhythmia (Fig. 14) as well as a decrease in 0₂ ^*~ production (Fig. 13).

[0130] An analogue of Fulvene-5, i.e. 6-(dimethylamino)fulvene (Santa Cruz

Biotechnology, Inc., Dallas, TX) was also tested in the same manner. Administration of 10 μΜ of 6-(dimethylamino)fulvene caused a decrease in the percentage of NOX4 embryos developing arrhythmia (22% from >50% in NOX4 embryos) as well as a decrease in 0₂ ^*~ production (data not shown).

[0131] The results of these experiments indicate that arrhythmias induced by NOX4 can be treated by inhibiting or reducing the activity of NOX4.

[0132] c. Proton Sponge Blue

[0133] To determine whether the inhibition or reduction of the activity of NOX4 with other NOX4 inhibitors will be effective in treating (e.g., reduce or inhibit) arrhythmias (such as AF) caused by NOX4, NOX4 embryos were treated at 24 hpf with 5 μΜ Proton Sponge Blue. Administration of Proton Sponge Blue caused a decrease in the percentage of NOX4 embryos developing arrhythmia as well as a decrease in 0₂ ^*~ production.

[0134] 3. Inhibiting or Reducing the Downstream Effect ofNOX4 Activity

[0135] a. PEG-SOD [0136] To determine whether reducing the levels of ROS resulting from NOX4 activity will be effective in treating (e.g., reduce or inhibit) arrhythmias (such as AF) caused by NOX4, NOX4 embryos were treated with PEG-SOD (25 U/ml) at 24 hpf. Administration of PEG-SOD (polyethylene glycol covalently linked to superoxide dismutase) significantly reduced the number of NOX4 embryos exhibiting arrhythmia (Fig. 11) and the amount of 0₂ ^*~ levels (Fig. 15) resulting from NOX4.

[0137] b. KN93

[0138] Calcium/calmodulin-activated protein kinase II (CaMKII) is a potential pro- arrhythmic enzyme and phosphoryation at Thr286/287 results in persistent CaMKII activity. Thus, whether activation of CaMKII mediates NOX4-induced

arrhythmogenesis was examined. Interestingly, at 24 hpf, the time point right before AF is observed and when the zebrafish heart starts beating, CaMKII Thr286 phosphorylation was significantly increased in NOX4 injected embryos (Fig. 16A). This can be followed up to 31 hpf (1.38 fold) (Fig. 16B), although less potent than 24 hpf (1.65 fold, when phenotype starts to appear) (Fig. 16A). Phosphorylation of CaMKII was also inhibited by PEG-SOD treatment (Fig. 16C), implicating redox- sensitive activation of CaMKII.

[0139] Treatment of embryos with 20 μΜ KN93, a selective CaMKII inhibitor,

completely abolished the arrhythmic phenotype induced by NOX4 RNA injection (Fig. 11 A and Figure 12). KN93 had no effect on superoxide levels (data not shown), implicating that it is downstream rather than upstream of superoxide production, which is consistent with the observation that PEG-SOD inhibited CaMKII Thr286 phosphorylation. Taken together, these data demonstrate a NOX4/ROS/CaMKII pathway in inducing cardiac arrhythmia.

[0140] The results of these experiments indicate that arrhythmias induced by NOX4 can be treated by inhibiting or reducing the downstream effect of NOX4 activity and/or reducing the levels of ROS, such as 0₂ ^*~ and/or H₂0₂, resulting from NOX4 activity. Therefore, in some embodiments, the present invention is directed to methods of treating a subject for an arrhythmia which comprises inhibiting or reducing the downstream effect of NOX4 activity and/or reducing the levels of ROS, such as 0₂ ^*~ and/or H₂0₂, resulting from NOX4 activity in the subject, by

administering to the subject an inhibitor of CaMKII and/or a ROS scavenger such as superoxide dismutase (SOD), catalase, manganese(III)-tetrakis(4-benzoic acid)porphyrin (MnTBAP), 2,2,6,6-tetramethylpiperidine 1-oxyl (Tempol), N-acetyl cysteine.

[0141] REFERENCES

[0142] Each of the following references are herein incorporated by reference in their entirety:

[0143] 1. von Lohneysen K, Noack D, Jesaitis AJ, Dinauer MC, Knaus UG. J Biol

Chem. 2012 Mar 16;287(12):8737-45.

[0144] 2. Jackson GM, Dourron HM, Liu J, Carretero OA, Reddy DJ, Andrzejewski

T, Pagno PJ. J Biol Chem. 2010 April 2; 285(14): 10281-10290.

[0145] 3. Chalupsky K and Cai H. Endothelial dihydrofolate reductase: critical for nitric oxide bioavailability and role in angiotensin II uncoupling of endothelial nitric oxide synthase. Proc Natl Acad Sci U S A 102: 9056-9061. Epub 2005 Jun 9057,

2005.

[0146] 4. Gao L, Chalupsky K, Stefani E, and Cai H. Mechanistic insights into folic acid-dependent vascular protection: dihydrofolate reductase (DHFR)-mediated reduction in oxidant stress in endothelial cells and angiotensin Il-infused mice. A Novel HPLC-based Fluorescent Assay for DHFR Activity. J Mol Cell Cardiol 47: 752-760, 2009.

[0147] 5. Gao L, Pung YF, Zhang J, Chen P, Wang T, Li M, Meza M, Toro L, and

Cai H. Sepiapterin reductase regulation of endothelial tetrahydrobiopterin and nitric oxide bioavailability. Am J Physiol Heart Circ Physiol 297: H331-339, 2009.

[0148] 6. Oak JH and Cai H. Attenuation of angiotensin II signaling recouples eNOS and inhibits nonendothelial NOX activity in diabetic mice. Diabetes 56: 118-126, 2007.

[0149] 7. Lu G, Sun H, Korge P, Koehler CM, Weiss JN, and Wang Y. Functional characterization of a mitochondrial Ser/Thr protein phosphatase in cell death regulation. Methods Enzymol 457: 255-273, 2009.

[0150] 8. Claycomb WC, Lanson NA, Jr., Stallworth BS, Egeland DB, Delcarpio JB,

Bahinski A, and Izzo NJ, Jr. HL-1 cells: a cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. Proc Natl Acad Sci USA 95: 2979-2984, 1998.

[0151] 9. White SM, Constantin PE, and Claycomb WC. Cardiac physiology at the cellular level: use of cultured HL-1 cardiomyocytes for studies of cardiac muscle cell structure and function. 10.1152/ajpheart.00986.2003. Am J Physiol Heart Circ Physiol 286: H823-829, 2004.

[0152] 10. Langenbacher, A. D., Dong, Y., Shu, X., Choi, J., Nicoll, D. A.,

Goldhaber, J. I., Philipson, K. D., and Chen, J. N. (2005) Proc Natl Acad Sci U S A 102, 17699-17704.

[0153] 11. Burns, C. G., Milan, D. J., Grande, E. J., Rottbauer, W., MacRae, C. A., and Fishman, M. C. (2005) Nat Chem Biol 1, 263-264

[0154] 12. Nguyen, C. T., Lu, Q., Wang, Y., and Chen, J. N. (2008) Drug Discov

Today Dis Models 5, 135-140.

[0155] 13. Lu, G., Ren, S., Korge, P., Choi, J., Dong, Y., Weiss, J., Koehler, C,

Chen, J. N., and Wang, Y. (2007) Genes Dev 21, 784-796.

[0156] 14. Oak, J. H., and Cai, H. (2007) Diabetes 56, 118-126.

[0157] 15. Chalupsky, K., and Cai, H. (2005) Proc Natl Acad Sci U S A 102, 9056-

9061.

[0158] 16. Gao, L., Chalupsky, K., Stefani, E., and Cai, H. (2009) J Mol Cell Cardiol

47, 752-760.

[0159] 17. Zhang, J., and Cai, H. (2010) J Mol Cell Cardiol 48, 1060-1070.

[0160] 18. Youn, J. Y., Gao, L., and Cai, H. (2012) Diabetologia 55, 2069-2079.

[0161] 19. Li, J., Umar, S., Iorga, A., Youn, J. Y., Wang, Y., Regitz-Zagrosek, V.,

Cai, H., and Eghbali, M. (2012) Basic Res Cardiol 107, 271.

[0162] To the extent necessary to understand or complete the disclosure of the present invention, all publications, patents, and patent applications mentioned herein are expressly incorporated by reference therein to the same extent as though each were individually so incorporated.

[0163] Having thus described exemplary embodiments of the present invention, it should be noted by those skilled in the art that the within disclosures are exemplary only and that various other alternatives, adaptations, and modifications may be made within the scope of the present invention. Accordingly, the present invention is not limited to the specific embodiments as illustrated herein, but is only limited by the following claims.

Claims

WHAT IS CLAIMED IS:

1. A method of treating a subject for an arrhythmia which comprises inhibiting or reducing the expression and/or activity of NADPH oxidase 4 (NOX4) in the subject.

2. The method of claim 1, wherein the arrhythmia is associated with an elevated level of reactive oxygen species (ROS) caused by NOX4 activity in the subject.

3. The method of claim 2, wherein the ROS is superoxide or hydrogen peroxide.

4. The method of claim 1, wherein the arrhythmia is atrial fibrillation.

5. The method according to claim 1, which comprises administering to the subject at least one NOX4 inhibitor.

6. The method according to claim 5, wherein the NOX4 inhibitor is a peptide, an antibody, a polynucleotide, or a small molecule.

7. The method according to claim 6, wherein the small molecule is an apocynin compound, a GTPase inhibitor, a fulvene compound, or a pyrazolo pyridine compound, or a

triphenylmethane compound.

8. The method according to claim 6, wherein the small molecule is apocynin, Fulvene-5, 6- (dimethylamino)fulvene, NSC 23766, GKT137831, Imipramine Blue (IB), Carbazole Blue, Proton Sponge, or Proton Sponge Blue.

9. The method according to claim 6, wherein the polynucleotide is a NOX4 siRNA, a NOX4 shRNA, a NOX4 antisense oligo, or a morpholino.

10. The method according to claim 6, wherein the polynucleotide is SEQ ID NO: 11, SEQ ID NO: 12, or SEQ ID NO: 13.

11. The method according to any one of claims 5-10, wherein the one or more NOX4 inhibitors are administered in a therapeutically effective amount.

12. The method according to any one of claims 1-10, which further comprises administering to the subject one or more reactive oxygen species (ROS) scavengers and/or one or more antioxidants.

13. The method according to any one of claims 1-10, which further comprises administering to the subject an inhibitor of calcium/calmodulin-activated protein kinase II (CaMKII).

13. Use of a composition comprising one or more NOX4 inhibitors for the treatment of an arrhythmia.

14. Use of one or more NOX4 inhibitors for the manufacture of a medicament for treating an arrhythmia.

15. The use of one or more NOX4 inhibitors for the manufacture of a medicament for treating an arrhythmia, wherein the medicament is prepared to be administered in a therapeutically effective amount.

16. A NOX4 inhibitor for use in treating an arrhythmia.