WO2013156785A1 - Gène diagnostique - Google Patents

Gène diagnostique Download PDF

Info

Publication number
WO2013156785A1
WO2013156785A1 PCT/GB2013/050988 GB2013050988W WO2013156785A1 WO 2013156785 A1 WO2013156785 A1 WO 2013156785A1 GB 2013050988 W GB2013050988 W GB 2013050988W WO 2013156785 A1 WO2013156785 A1 WO 2013156785A1
Authority
WO
WIPO (PCT)
Prior art keywords
sptbn2
ιιι
spectrin
gene
canine mammal
Prior art date
Application number
PCT/GB2013/050988
Other languages
English (en)
Inventor
Cathryn Suzanne Mellersh
Oliver Paul FORMAN
Original Assignee
Animal Health Trust
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Animal Health Trust filed Critical Animal Health Trust
Publication of WO2013156785A1 publication Critical patent/WO2013156785A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the invention relates to the use of the ⁇ - ⁇ spectrin gene (SPTBN2) as a biomarker for the in vitro diagnosis of cerebellar cortical degeneration, to in vitro methods of assessing the cerebellar cortical degeneration status in a canine mammal and to primers and diagnostic kits for use in said method.
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • Cerebellar cortical degeneration also known as cerebellar abiotrophy, is a disease characterised by clinical signs of cerebellar dysfunction, such as ataxia- dysmetria, broad based stance, loss of balance and intentional tremors.
  • Cerebellar cortical degeneration has been described in several canine breeds [1- 15], classified as neonatal through to adult onset forms, with breed specific rates and extents of disease progression.
  • Beagles the development of neurological signs is first noticed when affected dogs start to ambulate at around three weeks of age. The affected puppies exhibit wide based-stance, loss of balance and dysmetric gait with inability to regulate rate and range of movement. Progression of the clinical signs has been reported to be minimal [2, 10] .
  • the main histopathological lesions characterising the disease in Beagle dogs are extensive degeneration to loss of Purkinje cells and secondary lesions in the molecular and granular layers [10] .
  • NCD neonatal cerebellar cortical degeneration
  • Beagle [2] A previous case report suggested an autosomal recessive mode of inheritance for neonatal cerebellar cortical degeneration (NCCD) in the Beagle [2] .
  • Neonatal cerebellar cortical degeneration has also been reported in other canine breeds, including the Rhodesian Ridgeback, Samoyed and Irish Setter [1, 9, 15], with retrotransposon disruption of GRMl associated with neonatal cerebellar ataxia in Coton De Tulear dogs [16] .
  • the ⁇ - ⁇ spectrin gene for use as a biomarker for the in vitro diagnosis of cerebellar cortical degeneration in a canine mammal.
  • an in vitro method of assessing the cerebellar cortical degeneration status in a canine mammal comprising the step of detecting genetic variation within the ⁇ - ⁇ spectrin gene (SPTBN2).
  • a primer pair for use in a method of assessing the cerebellar cortical degeneration status in a canine mammal, wherein said primers are capable of amplifying all or part of the ⁇ - ⁇ spectrin gene (SPTBN2), wherein the amplified region is less than 500 nucleotides in length, such as less than 300 nucleotides in length, and wherein the primers are as defined herein.
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • kits for use in a method of assessing the cerebellar cortical degeneration status in a canine mammal comprising:
  • a primer pair wherein said primers are capable of amplifying all or part of the ⁇ - ⁇ spectrin gene (SPTBN2), wherein the amplified region is less than 500 nucleotides in length, such as less than 300 nucleotides in length, and wherein the primers are as defined herein; and
  • a method of treating cerebellar cortical degeneration in a canine mammal comprises assessing the cerebellar cortical degeneration status of a canine mammal by use of a method as defined herein and if the canine mammal is identified as affected by cerebellar cortical degeneration, treating said canine mammal to prevent or reduce the onset of cerebellar cortical degeneration.
  • a method of treating cerebellar cortical degeneration in a canine mammal comprises increasing the level of non-mutant, wild-type ⁇ - ⁇ spectrin gene (SPTBN2) expression and/or ⁇ - ⁇ spectrin gene (SPTBN2) product activity in the canine mammal .
  • SPTBN2 wild-type ⁇ - ⁇ spectrin gene
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • Figure 1 (A) Cerebellar folia of four-week old Beagle puppy with NCCD . Loss of occasional Purkinje cells (grey arrows) . The black arrow identifies a degenerating Purkinje cell with hypereosinophilic cytoplasm and a condensed nucleus. lOOx magnification .
  • NCCD NCCD . Marked loss of Purkinje cells (grey arrows) . Associated granular cell layer depletion secondary to Purkinje cell loss (white double headed arrows) . lOOx magnification .
  • Figure 2 Subacute loss of Purkinje cells (PC) is documented by so- called “empty baskets" (EB) that have been visualised by Bielschowsky ' s impregnation technique. The baskets (white arrows) synapse to the PC perikarya and in order to inhibit PC activity.
  • ML molecular layer
  • GL granule cell layer
  • scale bar 40 ⁇ .
  • Figure 3 Spatial characteristics of cerebellar cortical degeneration in the ⁇ - ⁇ spectrin deficient beagle after calbindin-immunohistochemistry and haematoxylin counterstain .
  • A Navigator figure depicting the sampled areas.
  • B The ventral aspects of the vermis show least numeric loss of calbindin- positive (brown) Purkinje cells (PC), a narrow subarachnoid space (SAS) and remnants of the external germinative cell layer (EGL) . Furthermore, the granule layer (GL) is well populated and its histoarchitecture is preserved . Degenerative changes are restricted to dystrophic dendrites (white arrowhead) .
  • Purkinje cell loss becomes increasingly evident in the dorsal vermis (C) and the ansiforme lobulus of the cerebellar hemispheres (D).
  • Resident PC show thickening and abnormal arborisation (C, white arrowhead) of the dendrites.
  • the EGL is cytodepleted and the granular layer becomes mildly disorganised .
  • a single nucleotide polymorphism (c.5580T>C) is also located 18 bp downstream of the deleted sequence in the NCCD case, and is highlighted by the black rectangle.
  • B Sanger sequencing to confirm the 8 bp deletion in the case, the sire of the case (obligate heterozygote) and a wild-type individual (sibling). The 8 bp sequence upstream of the deletion is identical to the deleted sequence.
  • Figure 5 Location of the canine 8 bp SPTBN2 mutation in the ⁇ - ⁇ spectrin protein.
  • Protein domains ABD, actin binding domain. 4.1, protein 4.1 binding domain.
  • AN K ankyrin binding domain.
  • PH pleckstrin homology domain.
  • MAD1 membrane associated domains. Adapted from Bauer et a/ [35] .
  • Figure 6 Pedigree of the NCCD Beagle family. Squares and circles represent male and female individuals respectively. Shaded symbols represent NCCD cases (all deceased). The distribution and number of affected individuals is consistent with an autosomal recessive mode of inheritance. Homozygous wild- type individuals are represented as wt/wt, heterozygotes as wt/del, and mutant homozygotes as del/del.
  • Figure 7 Western blot analysis of wild-type and NCCD affected cerebellum tissue homogenates. Full length ⁇ - ⁇ spectrin was confirmed in wild- type cerebellum tissue (wt/wt), but no full length or truncated ⁇ - ⁇ spectrin could be identified in cerebellum tissue from the NCCD affected Beagle (del/del). Mouse brain extract (M) was used a positive control. Beta-actin was used as a loading control .
  • the ⁇ - ⁇ spectrin gene for use as a biomarker for the in vitro diagnosis of cerebellar cortical degeneration in a canine mammal.
  • an in vitro method of assessing the cerebellar cortical degeneration status in a canine mammal comprising the step of detecting genetic variation within the ⁇ - ⁇ spectrin gene (SPTBN2).
  • the present inventors have identified a genetic mutation in the canine ⁇ - ⁇ spectrin (SPTBN2) gene that is associated with cerebellar cortical degeneration in canines, such as Beagles.
  • the inventors have developed a genotyping-based diagnostic test that can be used to determine whether a dog is clear, affected by, or a carrier of cerebellar cortical degeneration. This can be used, inter alia, in selective breeding to avoid affected offspring.
  • the inventors have devised a diagnostic genotyping assay that determines the presence or absence of mutation in the canine ⁇ - ⁇ spectrin (SPTBN2) gene in canine DNA.
  • SPTBN2 canine ⁇ - ⁇ spectrin
  • SPTBN2 is a gene associated with spinocerebellar type 5 (SCA5) in humans [26], that fully segregates with the disease providing a strong candidate variant for NCCD in the Beagle.
  • Spectrins are a family of cytoskeletal proteins, with tetrameric structures comprising two a and two ⁇ subunits, with diversity and specialization of function. Spectrins are important structural components of the plasma membrane and play a significant role in restricting and stabilizing membrane spanning proteins within specific subdomains of the plasma membrane. The spectrin cytoskeleton was first discovered in erythrocytes and has since been identified in a variety of cells [27] .
  • ⁇ - ⁇ spectrin is primarily expressed in the nervous system and the highest levels of expression are found in Purkinje cell soma and dendrites [28].
  • ⁇ - ⁇ spectrin has been shown to stabilize the glutamate transporter EAAT4 at the plasma membrane of the Purkinje cells [29], facilitate protein trafficking by linking the microtubule motor to vesicle-bound cargo [30] and maintain a high density of sodium channels within the soma and dendrites of Purkinje cells [31] .
  • ⁇ - ⁇ spectrin is critical for development of Purkinje cells [32] .
  • the identified causal mutations include two in-frame deletions of 39 and 15 bp which alter the structure of the 3 rd of 17 spectrin repeats, and a single base pair substitution causing an amino acid change (L253P) in a highly conserved region of the calponin homology domain [26] .
  • the consequence of the two inframe deletions in p- III spectrin is predicted to be disruption of the highly ordered triple alpha helical structure of the spectrin repeat, causing conformational changes in the tetrametric ⁇ - ⁇ spectrin complex [26] .
  • the L253P missense mutation has been shown to result in loss of interaction with the Arpl subunit of the dynactin-dynein complex, affecting the role of ⁇ - ⁇ spectrin in vesicle trafficking, preventing transport of both ⁇ - ⁇ spectrin and EAAT4 to the cell membrane from the Golgi apparatus in Purkinje cells causing cell dysfunction and death. [33]
  • mice from two independent studies resulted in phenotypes that resemble NCCD in Beagle dogs [31, 34] .
  • One ⁇ - ⁇ spectrin deficient strain was produced by targeting replacement of exon 3 to 6 of SPTBN2 with the neomycin-resistance gene, resulting in a frameshift and a premature stop codon in exon 7.
  • no full length ⁇ - ⁇ spectrin is produced in - ⁇ - ⁇ 7" mice, although a low level of near full length protein is produced due to novel exon 1 (rather than exon 2) to exon 7 splicing [31] .
  • mice Homozygous ⁇ - ⁇ spectrin deficient mice develop characteristics of progressive cerebellar ataxia from a few weeks of age with cerebellar atrophy and Purkinje cell loss.
  • the ⁇ - ⁇ spectrin deficient mouse strain is the result of ⁇ geo insertion between exons 25 and 26 resulting in premature termination in spectrin repeat 14, which is closer to the position to the Beagle mutation, although results in the loss of the ankyrin binding domain [34] .
  • the ⁇ - III spectrin deficient mice from this study display a mild non progressive ataxia by 6 months and a myoclonic seizure disorder by one year [34] .
  • heterozygous mice generated by exon 2-6 replacement, do not display any characteristics of cerebellar ataxia [33], in common with heterozygous dogs in the Beagle population, suggesting that SCA5 in heterozygous humans is caused by dominant negative effects of mutant ⁇ - ⁇ spectrin, rather than haploinsufficiency.
  • Histopathologic examination in heterozygous mice revealed normal size and morphology of the cerebellum and immunostaining studies showed no changes on Purkinje cell morphology.
  • Cerebellar cortical degeneration in dogs is an autosomal recessive condition.
  • the cerebellar cortical degeneration status may be selected from : clear of cerebellar cortical degeneration, affected by (i.e. having or likely to develop) cerebellar cortical degeneration, or a carrier of cerebellar cortical degeneration.
  • the individual animal tested may or may not be entirely symptomless and ⁇ or may be considered to be at risk from cerebellar cortical degeneration (based on pedigree etc.) .
  • the canine mammal is a dog .
  • the canine mammal is a dog which is a breed selected from the list consisting of : Beagle, Rhodesian Ridgeback, Samoyed and Irish Setter.
  • the canine mammal is a Beagle.
  • the method of the invention comprises the steps of:
  • the nucleic acid comprises genomic DNA.
  • the method of the invention may optionally comprise, in addition to detecting genetic variation within the ⁇ - ⁇ spectrin gene (SPTBN2), the assessment from the same sample of other markers which are linked or associated with other canine disorders.
  • the sample is assessed for one or more other markers which are linked or associated with canine disorders.
  • the method may include the step of screening a canine mammal for its cerebellar cortical degeneration status as described herein, and if the animal is identified as a carrier, selecting it for breeding with an animal which is not a carrier of cerebellar cortical degeneration (i .e. is clear of cerebellar cortical degeneration and homozygous for the non-mutant, wild-type allele).
  • the method of the invention additionally comprises the step of establishing whether or not the canine mammal is heterozygous or homozygous for the genetic variation within the ⁇ - ⁇ spectrin gene (SPTBN2) . It will be appreciated that if the canine mammal is homozygous for the genetic variation within the ⁇ - ⁇ spectrin gene (SPTBN2), it is diagnosed as a canine mammal suffering from cerebellar cortical degeneration .
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • the canine mammal is homozygous for the wild-type ⁇ - ⁇ spectrin gene (SPTBN2), it is selected as being suitable for breeding with a canine mammal of the same breed which is homozygous or heterozygous for the wild-type ⁇ - ⁇ spectrin gene (SPTBN2) .
  • the cerebellar cortical degeneration is neonatal cerebellar cortical degeneration (NCCD) .
  • nucleic acid sample is described in more detail hereinafter.
  • the sample from the canine mammal may be prepared from any convenient sample, for example from blood or skin tissue.
  • DNA is extracted from blood or from buccal (cheek) cells on a swab.
  • the DNA sample analysed may be all or part of the sample being obtained.
  • Methods of the present invention may therefore include obtaining a sample of nucleic acid obtained from the canine mammal .
  • the assessment of the ⁇ - ⁇ spectrin gene (SPTBN2) may be performed or based on an historical DNA sample, or information already obtained therefrom e.g. by assessing the ⁇ - III spectrin gene (SPTBN2) in DNA sequences which are stored on a databank.
  • the assessment may be performed using mRNA (or cDNA), rather than genomic DNA.
  • the genetic variations include any variation in the native, non-mutant or wild type genetic code of the ⁇ - ⁇ spectrin gene
  • SPTBN2 canine mammal under analysis.
  • genetic variations include : mutations (e.g. point mutations), substitutions, deletions, single nucleotide polymorphisms (SNPs), haplotypes, chromosome
  • SNP single-nucleotide polymorphism
  • the genetic variation is a functional mutation i.e. one which is causative of cerebellar cortical degeneration. Mutations may be functional in that they affect amino acid encoding, or by disruption of regulatory elements (e.g., which may regulate gene expression, or by disruption of sequences - which may be exonic or intronic - involved in regulation of splicing). However it will be appreciated that other markers showing association with cerebellar cortical degeneration, may also have diagnostic utility and could be used in combination with the assessment of the invention.
  • the genetic variation is an insertion mutation which causes a frameshift in the ⁇ - ⁇ spectrin gene (SPTBN2). This may cause premature termination.
  • the genetic variation is within exon 29 of the ⁇ - ⁇ spectrin gene (SPTBN2).
  • the genetic variation comprises a deletion mutation within the ⁇ - ⁇ spectrin gene (SPTBN2).
  • the deletion mutation comprises an 8 bp deletion between nucleotides 53,691,704 and 53,691,711 on chromosome 18 (as identified in the current whole genome sequence assembly (CanFam 2.0 : http://www.ensembl .org/Canis fami Maris/).
  • the primers used to detect the ⁇ - ⁇ spectrin gene comprise:
  • assessment of the ⁇ - ⁇ spectrin gene will establish whether or not the individual animal is heterozygous or homozygous for the specific length variant in this region.
  • the method of the present invention comprises detecting genetic variation within the ⁇ - ⁇ spectrin gene (SPTBN2) in a genomic DNA sample obtained from the canine mammal as described above e.g. a deletion mutation between nucleotides 53,691,704 and 53,691,711 on chromosome 18 (as identified in the current whole genome sequence assembly (CanFam 2.0 : http://www.ensembl .org/Canis fami Maris/).
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • the genetic variation may be one which is in linkage disequilibrium with the hereinbefore mentioned deletion mutation - this may for example be a microsatellite repeat polymorphism or a single nucleotide polymorphism (SN P), which may be in an intron, exon or promoter sequence of the ⁇ - ⁇ spectrin gene (SPTBN2), or located sufficiently close to the ⁇ - ⁇ spectrin gene (SPTBN2) to be in linkage disequilibrium with the mutation .
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • any such polymorphism will be a common polymorphism (allele frequency >0.05) .
  • linkage disequilibrium is the non-random association of alleles. Further details may be found in Kruglyak (1999) Nature Genetics, Vol 22, page 139 and Boehnke (2001) Nature Genetics 25 : 246-247). For example, results of recent studies indicate significant linkage disequilibrium may extend to around 2 M B depending on the breed of dog (400-700 kb in Golden Retriever and Labrador Retriever, 2.4 Mb in Akita, and 3-3.2 Mb in Bernese Mountain Dog and Pekingese - see
  • a region which is described as 'proximal' or 'sufficiently close' to a polymorphic marker may be within about 3000kb, 2000kb or lOOOkb of the ⁇ - ⁇ spectrin gene (SPTBN2), preferably within about 500kb away, and more preferably within about lOOkb, more preferably within 50 kb, more preferably within 10 kb of the ⁇ - ⁇ spectrin gene (SPTBN2) .
  • the method will generally involve determining the identity of a nucleotide or nucleotides at the position of said polymorphism . In one embodiment, assessment of the SN Ps at the positions described above will establish whether or not the individual is heterozygous or homozygous for the allele at these sites.
  • the invention further provides oligonucleotides for use in probing or amplification reactions, which may be fragments of the ⁇ - ⁇ spectrin gene (SPTBN2) .
  • Nucleic acid for use in the methods of the present invention such as an oligonucleotide probe and/or pair of amplification primers, may be provided in isolated form and may be part of a kit, e.g . in a suitable container such as a vial in which the contents are protected from the external environment.
  • the kit may include instructions for use of the nucleic acid, e.g . in PCR and/or a method for determining the presence of nucleic acid of interest in a test sample.
  • a kit wherein the nucleic acid is intended for use in PCR may include one or more other reagents required for the reaction, such as polymerase, nucleotides, buffer solution etc.
  • the nucleic acid may be labelled.
  • a kit for use in determining the presence or absence of nucleic acid of interest may include one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g . a swab for removing cells from the buccal cavity or a syringe for removing a blood sample (such components generally being sterile) .
  • a diagnostic means for determining the cerebellar cortical degeneration status of a canine mammal may also apply to the following : a diagnostic means for determining the cerebellar cortical degeneration status of a canine mammal; a diagnostic kit comprising such a diagnostic means; and the use, in the manufacture of means for assessing the cerebellar cortical degeneration status of a canine mammal of sequences (e.g ., PCR primers) to amplify a region of the ⁇ - ⁇ spectrin gene (SPTBN2) as described herein .
  • sequences e.g ., PCR primers
  • the invention there is provided a method of treating cerebellar cortical degeneration in a canine mammal, which method comprises assessing the cerebellar cortical degeneration status of a canine mammal by use of a method as defined herein and if the canine mammal is identified as affected by cerebellar cortical degeneration, treating said canine mammal to prevent or reduce the onset of cerebellar cortical degeneration .
  • a method of treating cerebellar cortical degeneration in a canine mammal comprises increasing the level of non-mutant, wild-type ⁇ - ⁇ spectrin gene (SPTBN2) expression and/or ⁇ - ⁇ spectrin gene (SPTBN2) product activity in the canine mammal.
  • SPTBN2 wild-type ⁇ - ⁇ spectrin gene
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • Normal (i.e. non-mutant) ⁇ - ⁇ spectrin gene (SPTBN2) nucleic acid sequences described above can, for example, be utilized for the treatment of cerebellar cortical degeneration. Such treatment can be administered, for example, in the form of gene replacement therapy.
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • one or more copies of a normal ⁇ - ⁇ spectrin gene (SPTBN2) or a portion of the ⁇ - ⁇ spectrin gene (SPTBN2) that directs the production of a ⁇ - ⁇ spectrin gene (SPTBN2) product exhibiting normal ⁇ - ⁇ spectrin gene (SPTBN2) function may be inserted into the appropriate cells within a canine mammal in need of the same, using vectors that include, but are not limited to adenovirus, adeno-associated virus, and retrovirus vectors, in addition to other particles that introduce DNA into cells, such as liposomes.
  • ⁇ - ⁇ spectrin gene SPTBN2
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • liposomes either in vivo, ex vivo or in vitro wherein ⁇ - ⁇ spectrin gene (SPTBN2) DNA is delivered to the cytoplasm and nucleus of target cells.
  • techniques for delivery involve direct administration of such ⁇ - ⁇ spectrin gene (SPTBN2) sequences to the site of the cells in which the ⁇ - ⁇ spectrin gene (SPTBN2) sequences are to be expressed.
  • Additional methods that may be utilized to increase the overall level of ⁇ - ⁇ spectrin gene (SPTBN2) expression and/or ⁇ - ⁇ spectrin gene (SPTBN2) product activity include the introduction of appropriate ⁇ - ⁇ spectrin gene (S TB/V2)-expressing cells, preferably autologous cells, into the canine mammal at positions and in numbers that are sufficient to ameliorate the symptoms of cerebellar cortical degeneration . Such cells may be either recombinant or non-recombinant.
  • the expression of the ⁇ - ⁇ spectrin gene (SPTBN2) sequences is controlled by the appropriate gene regulatory sequences to allow such expression in the necessary cell types. Such gene regulatory sequences are well known to the skilled artisan .
  • Such cell-based gene therapy techniques are well known to those skilled in the art, see, e.g ., Anderson, U.S. Pat. No. 5,399,349.
  • the cells to be administered are non-autologous cells, they can be administered using well known techniques that prevent a host immune response against the introduced cells from developing.
  • the cells may be introduced in an encapsulated form which, while allowing for an exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognized by the host immune system .
  • the invention provides a method of gene therapy one or more copies of a nucleic acid sequence as described herein (e.g. non-mutant ⁇ - ⁇ spectrin gene (SPTBN2) or an active variant thereof) may be inserted into the appropriate cells within the canine mammal, using vectors that include, but are not limited to adenovirus, adeno-associated virus, and retrovirus vectors, in addition to other particles that introduce DNA into cells, such as liposomes.
  • a nucleic acid sequence as described herein e.g. non-mutant ⁇ - ⁇ spectrin gene (SPTBN2) or an active variant thereof
  • vectors that include, but are not limited to adenovirus, adeno-associated virus, and retrovirus vectors, in addition to other particles that introduce DNA into cells, such as liposomes.
  • Example gene therapy vectors for use in the method of this invention include retroviral or episomal vectors expressing particular desired genes under the control of the promoter and/or the supplemental control sequences disclosed herein (see, e.g ., Axel, et al ., U .S. Pat. No. 4,399,216, and Pastan, et al ., U .S . Pat. No. 5, 166,059, both incorporated herein by reference) .
  • Delivery systems as contemplated herein include both viral and liposomal delivery systems (see, e.g., Davis, et al ., U .S. Pat. No. 4,920,209, incorporated herein by reference).
  • Such gene therapy vectors may incorporate targeting signals to the appropriate membrane or organ .
  • cell or organelle specific promoters may be used.
  • the invention also provides such vectors and DNA molecules for use in a method of treatment of cerebellar cortical degeneration in a canine mammal.
  • the invention further provides use of such DNA molecules in the preparation of a medicament, for example for the treatment of a canine mammal .
  • the assessment of the genetic variation may be carried out on a DNA microchip, if appropriate.
  • a microchip-system may involve the synthesis of microarrays of oligonucleotides on a glass support. Fluorescently - labelled PCR products may then be hybridised to the oligonucleotide array and sequence specific hybridisation may be detected by scanning confocal microscopy and analysed automatically (see Marshall & Hodgson (1998) Nature Biotechnology 16 : 27-31 , for a review). Some preferred examples of such methods will now be discussed in more detail .
  • the method of detecting or assessing the genetic variation may comprise determining the binding of an oligonucleotide probe to the nucleic acid sample.
  • the detection step is performed by determining the binding of oligonucleotide probes to the nucleic acid sample, wherein the probes comprise all or part of the wild-type or mutant ⁇ - ⁇ spectrin gene (SPTBN2) .
  • the probe may comprise a nucleic acid sequence which binds specifically to a particular allele of a polymorphism and does not bind specifically to other alleles of the polymorphism .
  • hybridisation will generally be preceded by denaturation to produce single- stranded DNA.
  • a screening procedure chosen from the many available to those skilled in the art, is used to identify successful hybridisation events and isolated hybridised nucleic acid.
  • Probing may employ the standard Southern blotting technique. For instance DNA may be extracted from cells and digested with different restriction enzymes. Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the DNA fragments on the filter and binding determined .
  • Binding of a probe to target nucleic acid may be measured using any of a variety of techniques at the disposal of those skilled in the art.
  • probes may be radioactively, fluorescently or enzymatically labelled.
  • Polymorphisms may be detected by contacting the sample with one or more labelled nucleic acid reagents including recombinant DNA molecules, cloned genes or degenerate variants thereof under conditions favorable for the specific annealing of these reagents to their complementary sequences within the relevant gene.
  • a 'complement' or 'complementary' or 'reverse complement' sequence is one which is the same length as a reference sequence, but is 100% complementary thereto whereby by each nucleotide is base paired to its counterpart running in anti- parallel fashion i .e. G to C, and A to T or U .
  • the lengths of these nucleic acid reagents are at least 15 to 30 nucleotides. After incubation, all non-annealed nucleic acids are removed from the nucleic acid :gene hybrid. The presence of nucleic acids that have hybridized, if any such molecules exist, is then detected.
  • the nucleic acid from the cell type or tissue of interest can be immobilized, for example, to a solid support such as a membrane, or a plastic surface such as that on a microtitre plate or polystyrene beads.
  • a solid support such as a membrane, or a plastic surface such as that on a microtitre plate or polystyrene beads.
  • Detection of the remaining, annealed, labeled nucleic acid reagents is accomplished using standard techniques well-known to those in the art.
  • the gene sequences to which the nucleic acid reagents have annealed can be compared to the annealing pattern expected from a normal gene sequence in order to determine whether a gene mutation is present.
  • oligonucleotide probe will hybridise with a sequence which is not entirely complementary. The degree of base-pairing between the two molecules will be sufficient for them to anneal despite a mismatch.
  • Various approaches are well known in the art for detecting the presence of a mis-match between two annealing nucleic acid molecules. For instance, RN'ase A cleaves at the site of a mis-match. Cleavage can be detected by electrophoresing test nucleic acid to which the relevant probe or probe has annealed and looking for smaller molecules (i.e. molecules with higher electrophoretic mobility) than the full length probe/test hybrid.
  • Other approaches rely on the use of enzymes such as resolvases or endonucleases.
  • an oligonucleotide probe that has the sequence of a region of the normal gene (either sense or anti-sense strand) in which polymorphisms associated with the trait of interest are known to occur may be annealed to test nucleic acid and the presence or absence of a mis-match determined. Detection of the presence of a mis-match may indicate the presence in the test nucleic acid of a mutation associated with the trait.
  • an oligonucleotide probe that has the sequence of a region of the gene including a mutation associated with disease resistance may be annealed to test nucleic acid and the presence or absence of a mis-match determined.
  • a mismatch may indicate that the nucleic acid in the test sample has the normal sequence, or a different mutant or allele sequence.
  • a battery of probes to different regions of the gene may be employed.
  • suitable probes may comprise all or part of the ⁇ - ⁇ spectrin gene (SPTBN2) sequence (or reverse complement thereof), or all or part of a mutant form of the sequence (or reverse complement thereof ).
  • the mutant form may contain one or more of the genetic variations described herein.
  • suitable conditions of the desired stringency for selective hybridisation taking into account factors such as oligonucleotide length and base composition, temperature and so on.
  • Suitable selective hybridisation conditions for oligonucleotides of 17 to 30 bases include hybridization overnight at 42°C in 6X SSC and washing in 6X SSC at a series of increasing temperatures from 42°C to 65°C.
  • Amplification-based methods The hybridisation of such a probe may be part of a PCR or other amplification procedure. Accordingly, in one embodiment the detection step is performed by amplifying all or part of the ⁇ - ⁇ spectrin gene (SPTBN2) .
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • the assessment of the genetic variation in the amplification product may then be carried out by any suitable method, e.g., as described herein .
  • An example of such a method is a combination of PCR and low stringency hybridisation with a suitable probe.
  • the methods of assessing the genetic variation described herein may be performed on a genomic DNA sample, or on an amplification product thereof.
  • any suitable ⁇ - ⁇ spectrin gene SPTBN2
  • PCR primers flanking the marker of interest may be used .
  • the amplified region which the primers flank is less than 500 nucleotides, such as less than 300 nucleotides, in particular 50 to 300 (e.g. 268) nucleotides in length .
  • the detection step is performed by amplifying all or part of exon 29 of the ⁇ - ⁇ spectrin gene (SPTBN2), such as between nucleotides 53,691,704 and 53,691,711 on chromosome 18 (CanFam 2.0) .
  • SPTBN2 ⁇ - ⁇ spectrin gene
  • the detection step is performed by use of primers which flank or include part of the region defined between nucleotides 53,691,704 and 53,691,711 on chromosome 18 (CanFam 2.0) .
  • An oligonucleotide for use in nucleic acid amplification may be about 30 or fewer nucleotides.
  • Generally specific primers are upwards of 14 nucleotides in length, but are suitably 15-25 inclusive, more preferably 18-20.
  • Those skilled in the art are well versed in the design of primers for use processes such as PCR.
  • Various techniques for synthesizing oligonucleotide primers are well known in the art, including phosphotriester and phosphodiester synthesis methods. Suitable polymerase chain reaction (PCR) methods are reviewed, for instance, in "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, 1990, Academic Press, New York, Mullis et al, Cold Spring Harbor Symp. Quant.
  • PCR comprises steps of denaturation of template nucleic acid (if double- stranded), annealing of primer to target, and polymerisation.
  • An amplification method may be a method other than PCR. Such methods include strand displacement activation, the QB replicase system, the repair chain reaction, the ligase chain reaction, rolling circle amplification and ligation activated transcription.
  • PCR is used herein in contexts where other nucleic acid amplification techniques may be applied by those skilled in the art. Unless the context requires otherwise, reference to PCR should be taken to cover use of any suitable nucleic amplification reaction available in the art.
  • AFLP Aminified Fragment Length Polymorphism
  • the region of DNA that contains the mutation is amplified using PCR and the length of the resulting fragment of DNA is measured.
  • the genetic variation may be assessed or confirmed by nucleotide sequencing of a nucleic acid sample to determine the presence of the genetic variation.
  • the identity may be determined by comparison of the nucleotide sequence obtained with the native, non-mutant, wild-type sequence.
  • Nucleotide sequence analysis may be performed on a genomic DNA sample, or amplified part thereof, or RNA sample as appropriate, using methods which are standard in the art.
  • the genomic DNA sample may be subjected to a PCR amplification reaction using a pair of suitable primers. In this way the region containing a particular polymorphism or polymorphisms may be selectively amplified (PCR methods and primers are discussed in more detail above).
  • the nucleotide sequence of the amplification product may then be determined by standard techniques.
  • the assessment of the genetic variation may be performed by single strand conformation polymorphism analysis (SSCP).
  • SSCP single strand conformation polymorphism analysis
  • PCR products from the region to be tested are heat denatured and rapidly cooled to avoid the reassociation of complementary strands.
  • the single strands then form sequence dependent conformations that influence gel mobility.
  • the different mobilities can then be analysed by gel electrophoresis.
  • Assessment may be by heteroduplex analysis.
  • the DNA sequence to be tested is amplified, denatured and renatured to itself or to known wild-type DNA.
  • Heteroduplexes between different alleles contain DNA "bubbles" at mismatched basepairs that can affect mobility through a gel. Therefore, the mobility on a gel indicates the presence of sequence alterations. Restriction site based methods
  • the assessment may be made using RFLP analysis.
  • the DNA is mixed with the relevant restriction enzyme (i.e., the enzyme whose restriction site is created or abolished).
  • the resultant DNA is resolved by gel electrophoresis to distinguish between DNA samples having the restriction site, which will be cut at that site, and DNA without that restriction site, which will not be cut.
  • a mutant PCR primer may be designed which introduces a mutation into the amplification product, such that a restriction site is created when one of the polymorphic variants is present but not when another polymorphic variant is present.
  • the amplification product is admixed with the relevant restriction enzyme and the resultant DNA analysed by gel electrophoresis to test for digestion.
  • Tissues were processed routinely on the Shandon Excelsior ES. Paraffin- embedded tissues were sectioned at 4-6 ⁇ . Slides were stained on the Shandon Linistainer with Mayer's hematoxylin and 1 % alcoholic eosin. Previous slides, and their associated paraffin-embedded blocks, from the full-sibling clinically affected female puppy were retrieved for comparison and review.
  • Genomic DNA was extracted from whole blood samples preserved in EDTA using the Nucleon BACC2 kit (Tepnel Life Science), from buccal swabs using the QiaAmp Midi kit (Qiagen), and from formalin fixed paraffin embedded (FFPE) tissue using the Nucleospin FFPE DNA kit (Macherey Nagel).
  • RNA was extracted using the Qiagen RNeasy Midi kit (Qiagen), including the on column DNase treatment stage.
  • mRNA was isolated from 4.9 total RNA using Sera-Mag oligo(dt) particles (Thermo Fisher) and Sera-Mag mRNA isolation buffer kit (Thermo Fisher). mRNA-seq
  • RNA fragmentation was purified using the Qiagen RNeasy mini kit (Qiagen).
  • Reverse transcription of RNA fragments was performed using Superscript II Reverse Transcriptase (Life Technologies). Clean-up after the second strand synthesis, end repair, dA tailing, and PCR amplification modules was performed using the QIAquick PCR purification mini kit (Qiagen).
  • the adaptor ligated library was size selected by band excision after agarose gel electrophoresis, and purified using the QIAquick gel extraction kit (Qiagen) before PCR amplification, using primers for Illumina paired-end multiplexed sequencing.
  • the final mRNA-seq library was quantified by qPCR using the Kapa library quantification kit (Kapa Biosystems). Paired-end sequencing (51 bp reads) was carried out on a partial lane of an Illumina HiSeq2000, producing a 1.39 Gb dataset. Reads were aligned to the canine reference genome (CanFam 2.0) using BWA [21] . Quality scores were recalculated using GATK [22] . Aligned reads were viewed using The Integrative Genomics Viewer (IGV) [23] .
  • IGV Integrative Genomics Viewer
  • PCR Polymerase chain reaction
  • N EB 0.2 mM dNTPs
  • Qiagen 0.83 ⁇ forward primer
  • GGCAGAGACGTGAGTTAGCAC 0.83 ⁇ reverse primer
  • HotStarTaq Plus DNA polymerase Qiagen
  • 578 bp PCR products were Sanger sequenced using Big Dye v3.1 (Applied Biosystems) for capillary electrophoresis on an ABI3130xl genetic analyser. Sequencing data were analysed using Gap4 (Staden package) [24]. All primers were designed using Primer3 [25] and manufactured by IDT.
  • Quantitative PCR (qPCR) assays were carried out on an Illumina Eco machine in 10 ⁇ reactions containing 5 ⁇ Kapa Probe Fast qPCR mastermix (Kapa Biosystems), 1 x IDT PrimeTime qPCR assay mix and 2 ⁇ cDNA (primer sequences listed in Table 1) :
  • the probe was 5'6-FAM and 3' Iowa black labelled, with internal ZEN labelling Primerry
  • Reaction efficiencies were calculated using a seven point 2 x serial dilution to create a standard curve.
  • the efficiency for the SPTBN2 assay was estimated at 99.3 %, with a standard curve r 2 value of > 0.995.
  • Assays for ACTB and TBP genes were used as controls.
  • Canine cerebellum samples ( ⁇ 30 mg) were homogenised in 1 ml ice cold RIPA lysis buffer (Sigma-Aldrich), containing one complete protease inhibitor cocktail tablet per 10 ml (Roche). Protein concentrations were measured using a Qubit fluorometer (Invitrogen). Protein samples were separated by denaturing 6 % SDS-PAGE (National Diagnostics). Separated proteins were transferred to a nitrocellulose membrane, which was blocked for 16 hours with 5 % non-fat dried milk in phosphate-buffered saline/0.1% Tween 20 (PBS-T).
  • PBS-T phosphate-buffered saline/0.1% Tween 20
  • Blocked nitrocellulose membranes were incubated for one hour in 1 : 200 goat anti- SPTBN2 (Santa Cruz Biotechnology) or 1 : 1000 mouse ant ⁇ -ACTB (Camlab) primary antibody in blocking buffer. After washing in PBS-T, blots were incubated in 1 : 10,000 HRP-conjugated donkey anti-goat or 1 : 1000 HRP- conjugated goat anti-mouse secondary antibody in blocking buffer. Immunoreactive proteins were detected using HRP-conjugate substrate kit for enhanced chemiluminescence.
  • Physical examination did not reveal any gross abnormalities apart from the neurological signs.
  • Neurological examination revealed severe cerebellar ataxia, with tendency to lean and fall towards both sides, resulting in inability to walk without assistance.
  • Proprioceptive positioning was normal while hopping reactions were abnormal with delayed onset of protraction and exaggerated response, once initiated.
  • Spinal reflexes were normal in all four limbs.
  • Cranial nerve examination revealed an absent menace response bilaterally with normal vision. Occasionally when the head was positioned in extension spontaneous rotatory nystagmus was observed.
  • a lesion involving mainly the cerebellum and spinocerebellar tracts was suspected.
  • the main differential diagnoses included degenerative central nervous system disease, such as neonatal onset of cerebellar cortical degeneration and less likely inflammatory/infectious central nervous system disease, metabolic disease and neoplasia. Haematology and comprehensive biochemistry did not reveal any significant abnormalities for a four week old puppy.
  • Brainstem auditory evoked responses identified clear waves I to V. Based on the severity of the clinical signs, normal haematology and comprehensive biochemistry, a degenerative condition was considered the most likely underlying cause and the breeder elected euthanasia. Post-mortem examination was performed an hour after euthanasia, and failed to reveal gross pathology. The brain in toto weighed 42 g, whilst the cerebellum weighed 5 g (12 %, normal 10-12 %) [2] . Narrowing of folia was not noted.
  • the mutation is located in the 16 th of 17 spectrin repeat domains located in ⁇ - ⁇ spectrin ( Figure 5). Genotyping experiments were performed to establish whether the 8 bp SPTBN2 deletion could be potentially causal .
  • the sire and dam of the affected dogs were both heterozygous for the 8 bp deletion, and out of the ten clinically unaffected siblings tested, seven were heterozygous and three were homozygous for the wild-type allele.
  • An extended pedigree is shown in Figure 6.
  • An additional 145 Beagles which were collected for an unrelated project and clinically normal with respect to NCCD, were also genotyped.
  • Eight dogs were heterozygous for the deletion, and the remaining 137 dogs were homozygous wild-type, in full concordance with the mutation being causal.
  • 513 dogs from 37 other breeds were also genotyped; all were homozygous for the wild-type allele.
  • the 8 bp deletion in the dog is located at a tandem repeat sequence, suggesting homologous recombination as the deletion mechanism.
  • the position of a SNP (c.5580T>C) 18 bp downstream of the deleted sequence removes a possible termination site for the mutant protein and extends the sequence of potential aberrant amino acids from 6 to 27.
  • expression analysis was limited, due to the availability of only one case and one control, results are suggestive of a 68 x reduction in the relative levels of SPTBN2 in the NCCD case cerebellum, which may be due to nonsense mediated decay.
  • NCCD is likely to be heterogeneous in different canine breeds
  • screening for the SPTBN2 deletion in non-beagle cases has not been investigated to confirm this. It is possible that the mutation could exist at very low frequencies in other breed populations, especially those closely related to the beagle, but extensive screening of large numbers of individuals would be required to fully investigate this possibility.
  • Gao, Y., et al ., beta-Ill spectrin is critical for development of purkinje cell dendritic tree and spine morphogenesis. J Neurosci, 2011.31(46) : p. 16581-90.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne l'utilisation du gène de la spectrine β-III (SPTBN2) en tant que biomarqueur pour diagnostiquer in vitro la dégénérescence corticale cérébelleuse, des méthodes d'évaluation in vitro de l'état de la dégénérescence corticale cérébelleuse chez un mammifère canin, des amorces et des kits de diagnostic à utiliser dans la méthode.
PCT/GB2013/050988 2012-04-20 2013-04-19 Gène diagnostique WO2013156785A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1206946.4 2012-04-20
GB201206946A GB201206946D0 (en) 2012-04-20 2012-04-20 Diagnostic gene

Publications (1)

Publication Number Publication Date
WO2013156785A1 true WO2013156785A1 (fr) 2013-10-24

Family

ID=46261614

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2013/050988 WO2013156785A1 (fr) 2012-04-20 2013-04-19 Gène diagnostique

Country Status (2)

Country Link
GB (1) GB201206946D0 (fr)
WO (1) WO2013156785A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4294939A4 (fr) * 2021-02-22 2024-10-16 Univ Washington State Procédés pour l'identification et le traitement des hémorragies chez les animaux

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006091579A2 (fr) * 2005-02-22 2006-08-31 Regents Of The University Of Minnesota Identification d'un gene associe a l'ataxie spinocerebelleuse de type 5 et methodes d'utilisation
EP2141250A1 (fr) * 2008-07-02 2010-01-06 Institut National De La Recherche Agronomique (Inra) Procédé de diagnostic et de prédiction d'ataxie cérébelleuse
WO2012034532A1 (fr) * 2010-09-19 2012-03-22 中南大学 Gène associé à l'ataxie spinocérébelleuse héréditaire et utilisation de celui-ci

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006091579A2 (fr) * 2005-02-22 2006-08-31 Regents Of The University Of Minnesota Identification d'un gene associe a l'ataxie spinocerebelleuse de type 5 et methodes d'utilisation
EP2141250A1 (fr) * 2008-07-02 2010-01-06 Institut National De La Recherche Agronomique (Inra) Procédé de diagnostic et de prédiction d'ataxie cérébelleuse
WO2012034532A1 (fr) * 2010-09-19 2012-03-22 中南大学 Gène associé à l'ataxie spinocérébelleuse héréditaire et utilisation de celui-ci

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] 13 October 1997 (1997-10-13), "Homo sapiens beta III spectrin (SPTBN2) mRNA, partial cds.", retrieved from EBI accession no. EM_STD:AF026487 Database accession no. AF026487 *
G. URKASEMSIN ET AL: "Hereditary Cerebellar Degeneration in Scottish Terriers", JOURNAL OF VETERINARY INTERNAL MEDICINE, vol. 24, no. 3, 2 April 2010 (2010-04-02), pages 565 - 570, XP055067279, ISSN: 0891-6640, DOI: 10.1111/j.1939-1676.2010.0499.x *
LINDBLAD-TOH KERSTIN ET AL: "Genome sequence, comparative analysis and haplotype structure of the domestic dog", NATURE: INTERNATIONAL WEEKLY JOURNAL OF SCIENCE, NATURE PUBLISHING GROUP, UNITED KINGDOM, vol. 438, no. 7069, 8 December 2005 (2005-12-08), pages 803 - 819, XP002429578, ISSN: 0028-0836, DOI: 10.1038/NATURE04338 *
M. C. STANKEWICH ET AL: "A widely expressed III spectrin associated with Golgi and cytoplasmic vesicles", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 95, no. 24, 24 November 1998 (1998-11-24), pages 14158 - 14163, XP055067117, ISSN: 0027-8424, DOI: 10.1073/pnas.95.24.14158 *
OLIVER P FORMAN ET AL: "Genome-wide mRNA sequencing of a single canine cerebellar cortical degeneration case leads to the identification of a disease associated SPTBN2 mutation", BMC GENETICS, BIOMED CENTRAL, GB, vol. 13, no. 1, 10 July 2012 (2012-07-10), pages 55, XP021132399, ISSN: 1471-2156, DOI: 10.1186/1471-2156-13-55 *
ZÃ 1/4 HLKE C ET AL: "Screening of the SPTBN2 (SCA5) gene in German SCA patients", JOURNAL OF NEUROLOGY, STEINKOPFF-VERLAG, DA, vol. 254, no. 12, 25 October 2007 (2007-10-25), pages 1649 - 1652, XP019589670, ISSN: 1432-1459 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4294939A4 (fr) * 2021-02-22 2024-10-16 Univ Washington State Procédés pour l'identification et le traitement des hémorragies chez les animaux

Also Published As

Publication number Publication date
GB201206946D0 (en) 2012-06-06

Similar Documents

Publication Publication Date Title
Forman et al. Genome-wide mRNA sequencing of a single canine cerebellar cortical degeneration case leads to the identification of a disease associated SPTBN2 mutation
Downs et al. Late‐onset progressive retinal atrophy in the G ordon and I rish S etter breeds is associated with a frameshift mutation in C2orf71
Shearman et al. A canine model of Cohen syndrome: Trapped Neutrophil Syndrome
NZ590567A (en) A genetic marker test for brachyspina ( based on snp on bovine chromosome 21) and fertility in cattle
AU2021296270A1 (en) Treatment of obesity with G-protein coupled receptor 75 (GPR75) inhibitors
WO2013156785A1 (fr) Gène diagnostique
JP5897704B2 (ja) ブラキスパイナ突然変異の検出
US8124337B2 (en) Hereditary cataract status in canines based on HSF4 gene marker
EP2141250A1 (fr) Procédé de diagnostic et de prédiction d'ataxie cérébelleuse
US9752195B2 (en) TTC8 as prognostic gene for progressive retinal atrophy in dogs
EP2132337B1 (fr) Procede de detection d'un collapsus canin induit par l'exercice
EP3030676B1 (fr) Méthode destinée à prédire le risque de fracture osseuse chez le cheval
Song et al. Deleterious variants in RNF111 impair female fertility and induce premature ovarian insufficiency in humans and mice
US20200208218A1 (en) Methods of Diagnosing Intervertebral Disc Disease And Chondrodystrophy In Canines
EP4363586A2 (fr) Traitement de la baisse de densité minérale osseuse par des inhibiteurs de l'élément 5b de la famille wnt (wnt5b)
WO2023141577A2 (fr) Méthodes d'amélioration de la santé avec des inhibiteurs d'apolipoprotéine e (apoe)
WO2015033133A1 (fr) Gène pronostique
Takada Genetic approaches to neurodegenerative
JP2024524374A (ja) 溶質輸送体ファミリー９アイソフォームａ３調節因子２（ｓｌｃ９ａ３ｒ２）阻害剤による高血圧症の治療
EP2728016A1 (fr) Phénotype de cheveux longs chez les canidés
Agler et al. Canine Hereditary Ataxia in Old English Sheepdogs and Gordon Setters Is
Kay Cellular minigene models for the study of allelic expression of the tau gene and its role in progressive supranuclear palsy
Bell Genetics of x-linked and autosomal recessive hereditary nephropathy in the domestic dog

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13718051

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13718051

Country of ref document: EP

Kind code of ref document: A1