WO2013156771A1

WO2013156771A1 - Anti-atherogenic peptides

Info

Publication number: WO2013156771A1
Application number: PCT/GB2013/050972
Authority: WO
Inventors: Xinjie Lu; Vijay Kakkar
Original assignee: Thrombosis Research Institute
Priority date: 2012-04-17
Filing date: 2013-04-16
Publication date: 2013-10-24
Also published as: GB201206761D0

Abstract

Theinvention relates to novel nucleic acids and peptides having anti atherogenic and/or anti-inflammatory activity. In particular, the invention relates to a combination therapy of two or more peptides for treating autoimmune disease and/or inflammatory disease. It also relates to methods of making and using such peptides, intermediates useful in the manufacture of such peptides, formulations comprising such peptides, and to other subject matter.

Description

Anti-atherogenic peptides

[0001] This invention relates to novel nucleic acids and peptides having anti atherogenic and/or anti-inflammatory activity. In particular, the invention relates to a combination therapy of two or more peptides of the invention for treating autoimmune disease and/or

inflammatory disease. It also relates to methods of making and using such peptides, intermediates useful in the manufacture of such peptides, formulations comprising such peptides, and to other subject matter.

BACKGROUND

[0002] The anaphylatoxin C5a, generated by activation of the innate immunity complement component C5, is a potent protein fragment. Binding of C5a to the guanine nucleotide- binding protein (G-protein)-coupled receptor C5a receptor (C5aR) present in immune- inflammatory cells, including monocytes, macrophages, neutrophils and T-cells, leads to proinflammatory activation. C5a exerts its effect by activating the C5aR [1]. The C5aR, also known as complement component 5aR-1 (C5AR1) or CD88 (cluster of differentiation 88), belongs to the rhodopsin-like receptor superfamily, characterized by seven hydrophobic, transmembrane helical regions connected by three extracellular and three intracellular loops [2-6]. Among the innate immune components, C5, C5a, and C5aR are abundant and suggested to play critical roles in atherogenesis [7,8]. Monocyte-to-macrophage

differentiation and low-density-lipoprotein (LDL) oxidation play a pivotal role in early atherogenesis. Macrophages are key players in many aspects of human physiology and disease, including atherosclerosis. By taking up modified LDL (oxidized or acetylated), monocyte-derived macrophages are turned into fat-loaded macrophages residing in the vessel wall, furthering the local inflammatory response and leading to progression of the atherosclerotic plaque. Atherosclerosis is a chronic disease characterized by the

accumulation of lipids and inflammatory cells within the walls of the arteries; it is recognized as an active process, with immune cells and mediators accumulating in the developing plaques from the earliest stages, and inflammation central to disease progression [9]. Both innate and adaptive immunities play roles in various stages of atherosclerosis.

[0003] Atherosclerosis is a major cause of cerebrocardiac vascular disorders such as brain infarction, heart infarction, and angina pectoris. Such cerebrocardiac vascular disorders account for around 40% of all adult deaths. Despite the key role of atherosclerosis in these disorders no fundamental method of treating or, in particular, of preventing it has yet been developed. Accordingly, there is a need in the art for novel treatments for atherosclerosis. „

2

BRIEF SUMMARY OF THE DISCLOSURE

[0004] This specification contains data showing that a peptide having the sequence of C5aR-P1 (SEQ ID NO:2) or a peptide having the sequence of C5aR-P2 (SEQ ID NO:4) and having characteristics described next has anti-atherogenic and/or anti-inflammatory activity. Furthermore, a combination of the peptides C5aR-P1 and C5aR-P2 results in a synergistic effect of their activity.

[0005] The teaching of each of the following paragraphs of this section is applicable across the entire ambit of the disclosure, including to the teaching of every other paragraph of the disclosure.

[0006] Accordingly, the invention provides in one aspect a nucleic acid selected from a group consisting of:

(a) a nucleic acid with at least 75% sequence identity to SEQ ID NO 1 ;

(b) a nucleic acid comprising a sequence as set forth in SEQ ID NO 1 ;

(c) a nucleic acid which hybridises to SEQ ID NO 1 under conditions of high stringency;

(d) a nucleic acid which differs from (a) and (b) by virtue of degeneracy of the genetic code;

(e) nucleic acid encoding a first fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR), wherein the fragment is less than 40 amino acids long; and

(f) a fragment of (a), (b), (c), (d) or (e), wherein the fragment encodes a peptide which has anti-atherogenic and/or anti-inflammatory activity.

[0007] The nucleic acids mentioned in clauses (a) to (c) of this aspect of the invention may have a percentage identity to SEQ ID NO:1 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

[0008] The encoded first fragment may be less than 40 amino acids, for example it may be less than 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 amino acids in length.

[0009] A second aspect of the invention resides in a nucleic acid selected from a group consisting of:

(a) a nucleic acid with at least 75% sequence identity to SEQ ID NO 3;

(b) a nucleic acid comprising a sequence as set forth in SEQ ID NO 3;

(c) a nucleic acid which hybridises to SEQ ID NO 3 (under conditions of high stringency); (d) a nucleic acid which differs from (a) and (b) by virtue of degeneracy of the genetic code

(e) a nucleic acid encoding a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR), wherein the fragment is less than 40 amino acids long; and

[0010] The nucleic acids mentioned in clauses (a) to (c) of this aspect of the invention may have a percentage identity to SEQ ID NO:3 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

[0011] The encoded second fragment may be less than 40 amino acids, for example it may be less than 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 or 10 amino acids in length.

[0012] The following paragraphs [013] to [029] apply to all nucleic acids of the disclosure.

[0013] A nucleic acid of the disclosure may be less than 120 amino acids in length, for example it may be less than 117, 114, 11 1 , 108, 105, 102, 99, 96, 93, 90, 87, 84, 81 , 78, 75, 72, 69, 66, 63, 60, 57, 54, 51 , 48, 45, 42, 39, 36, 33 or 30 nucleic acids in length.

[0014] A nucleic acid of the disclosure may be more than 18 amino acids in length, for example, it may be more than 21 , 24, 27, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 11 1 , 114 or 1 17 nucleic acids in length.

[0015] A nucleic acid of the disclosure may be between 24 and 120 nucleic acids in length, e.g. between 27 and 1 17 nucleic acids in length, between 30 and 114 nucleic acids in length, between 33 and 11 1 nucleic acids in length, between 36 and 108 nucleic acids in length, between 36 and 105 nucleic acids in length, between 36 and 102 nucleic acids in length, between 36 and 99 nucleic acids in length, between 36 and 96 nucleic acids in length, between 36 and 93 nucleic acids in length, between 36 and 90 nucleic acids in length, between 36 and 87 nucleic acids in length, between 36 and 84 nucleic acids in length, between 36 and 81 nucleic acids in length, between 36 and 78 nucleic acids in length, between 36 and 75 nucleic acids in length, between 36 and 72 nucleic acids in length, between 36 and 69 nucleic acids in length, between 36 and 66 nucleic acids in length, between 36 and 63 nucleic acids in length, inclusive. Ideally the nucleic acid is between 36 and 60 nucleic acids in length, inclusive.

[0016] The extracellular N-terminal region of C5aR consists of 40 amino acids which lie outside of the cell membrane in the extracellular space when C5aR is embedded in the cell membrane, i.e. when C5aR is exists in its naturally occurring conformation within the cell membrane. Preferably, C5aR is human C5aR.

[0017] The second fragment of the second aspect of the invention may be of a different sequence as compared to the first fragment of the first aspect of the invention.

[0018] A nucleic acid of the first aspect of the invention may be for use in a combination therapy with a peptide of the second aspect of the invention. For example, a nucleic acid of the first aspect of the invention may be used simultaneously, sequentially or separately in a combined therapy with a peptide of the second aspect of the invention.

[0019] In one embodiment, C5aR is selected from a human C5aR, a mouse C5aR, a rat C5aR, a rabbit C5aR, a dog C5aR, a horse C5aR, a cat C5aR and a monkey C5aR. In certain embodiments the N-terminal region of C5aRconsists of nucleotides 1-120 of human C5aR.

[0020] A nucleic acid of the disclosure may be for use in therapy.

[0021] A nucleic acid of the disclosure may be for use in treating and/or preventing diseases selected from autoimmune disease and inflammatory disease.

[0022] A nucleic acid of the disclosure may be for use in treating and/or preventing a disease selected from: rheumatoid arthritis; atherosclerosis; diabetes; and lupus.

[0023] A third aspect of the invention resides in a nucleic acid selected from (i) and (ii):

(i) (a) a nucleic acid with at least 75% sequence identity to SEQ ID NO 1 ;

(b) a nucleic acid comprising a sequence as set forth in SEQ ID NO 1 ;

(d) a nucleic acid which differs from (a), (b) and (c) by virtue of degeneracy of the genetic code;

(e) a nucleic acid encoding a first fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR), the first fragment being less than 40 amino acids in length; and

(f) a fragment of (a), (b), (c), (d) or (e), wherein the fragment encodes a peptide which has anti-atherogenic and/or anti-inflammatory activity,

(ii) (a) a nucleic acid with at least 75% sequence identity to SEQ ID NO 3;

(b) a nucleic acid comprising a sequence as set forth in SEQ ID NO 3;

(c) a nucleic acid which hybridises to SEQ ID NO 3 (under conditions of high stringency); (d) a nucleic acid which differs from (a), (b) and (c) by virtue of degeneracy of the genetic code,

(e) a nucleic acid encoding a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR), the second fragment being less than 40 amino acids in length and wherein the second fragment is of a different sequence as compared to the first fragment; and

(f) a fragment of (a), (b), (c), (d) or (e), wherein the fragment encodes a peptide which has anti-atherogenic and/or anti-inflammatory activity, wherein the nucleic acid is for use in combination therapy with the other of (i) and (ii).

[0024] The nucleic acids of clause (i) of this aspect of the invention may have a percentage identity to SEQ ID NO: 1 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

[0025] The nucleic acids of clause (ii) of this aspect of the invention may have a percentage identity to SEQ ID NO:3 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

[0026] The encoded first fragment and/or the encoded second fragment may be less than 40 amino acids, for example it may be less than 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 or 10 amino acids in length.

[0027] In one embodiment, C5aR is selected from a human C5aR, a mouse C5aR, a rat C5aR, a rabbit C5aR, a dog C5aR, a horse C5aR, a cat C5aR and a monkey C5aR. In certain embodiments the N-terminal region of C5aRconsists of nucleotides 1-120 of human C5aR.

[0028] A nucleic acid selected from clauses (i) and (ii) may be used simultaneously, sequentially or separately in combination therapy with a nucleic acid selected from the other of clauses (i) and (ii).

[0029] A nucleic acid of the disclosure may be for use in a combination therapy for use in in treating and/or preventing diseases selected from autoimmune diseases and inflammatory diseases. For example, the combination therapy may be for use in treating and/or preventing a disease selected from: rheumatoid arthritis; atherosclerosis; diabetes; and lupus.

[0030] A fourth aspect of the invention resides in a peptide selected from:

(a) a peptide with at least 75% sequence identity to SEQ ID. NO. 2;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO.

2; „

6

(c) a peptide encoded by the nucleic acid of the first aspect of the invention;

(d) a first fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) for use in therapy, wherein the first fragment is less than 40 amino acids in length;

(e) a fragment of (a), (b), (c) or (d), wherein the fragment has anti-atherogenic and/or anti-inflammatory activity.

[0031] The peptide mentioned in clauses (a) to (b) of this aspect of the invention may have a percentage identity to SEQ ID NO:2 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

[0032] The first fragment may be less than 40 amino acids, for example it may be less than 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 amino acids in length.

[0033] A fifth aspect of the invention resides in a peptide selected from:

(a) a peptide with at least 75% sequence identity to SEQ ID. NO. 4;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO.

4;

(c) a peptide encoded by the nucleic acid of the second aspect of the invention;

(d) a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) for use in therapy, wherein the second fragment is less than 40 amino acids in length;

[0034] The peptide mentioned in clauses (a) to (b) of this aspect of the invention may have a percentage identity to SEQ ID NO:4 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

[0035] The following paragraphs [036] to [051] apply to all peptides of the disclosure

[0036] A second fragment of the fifth aspect of the invention may be of a different sequence as compared to a first fragment of the fourth aspect of the invention.

[0037] A peptide of the fourth aspect of the invention may be for use in a combination therapy with a peptide of the fifth aspect of the invention. For example, a peptide of the fourth aspect of the invention may be used simultaneously, sequentially or separately in a combined therapy with a peptide of the fifth aspect of the invention. [0038] The second fragment may be less than 40 amino acids, for example it may be less than 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 or 10 amino acids in length.

[0039] The N-terminal region may consist of residues 1-40 of human C5aR. Optionally, the C5aR is a human C5aR, a mouse C5aR, a rat C5aR, a rabbit C5aR, a dog C5aR or a monkey C5aR

[0040] A peptide of the disclosure may be less than 40 amino acids in length, for example it may be less than 39, 38, 37, 36, 35, 34, 33, 32, 31 , 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 or 10 amino acids in length.

[0041] A peptide of the disclosure may be more than 6 amino acids in length, for example, it may be more than 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38 or 39 amino acids in length.

[0042] A peptide of the disclosure may be between 8 and 40 amino acids in length, e.g. between 9 and 39 amino acids in length, between 10 and 38 amino acids in length, between 1 1 and 37 amino acids in length, between 12 and 36 amino acids in length, between 12 and 35 amino acids in length, between 12 and 34 amino acids in length, between 12 and 33 amino acids in length, between 12 and 32 amino acids in length, between 12 and 31 amino acids in length, between 12 and 30 amino acids in length, between 12 and 29 amino acids in length, between 12 and 28 amino acids in length, between 12 and 27 amino acids in length, between 12 and 26 amino acids in length, between 12 and 25 amino acids in length, between 12 and 24 amino acids in length, between 12 and 23 amino acids in length, between 12 and 22 amino acids in length, between 12 and 21 amino acids in length, inclusive. Ideally the peptide is between 12 and 20 amino acids in length, inclusive.

[0043] A peptide of the disclosure may be for use in therapy. For example, a peptide of the disclosure may be for use in therapy treating and/or preventing diseases selected from autoimmune diseases and inflammatory diseases, such as a disease selected from the group consisting of rheumatoid arthritis, atherosclerosis, diabetes and lupus.

[0044] A sixth aspect of the invention resides in a peptide consisting of any contiguous sub-sequence of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34,35, 36, 37, 38, 39 or 40 amino acids of a peptide of the disclosure.

[0045] A seventh aspect of the invention resides in peptides selected from peptides whose amino acids sequence consists of the sequence:

J¹-YDDKDTLD (SEQ ID NO: 5)

wherein: J¹ is any contiguous sequence of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12 or 13 amino acids comprised in sequence MNSFNYTTPDYGH (SEQ ID NO:6), said contiguous sequence including the C-terminal H residue of SEQ ID NO:6.

The peptide may have anti-atherogenic and/or anti-inflammatory activity. The peptides may be used in peptide synthesis, e.g. liquid phase synthesis and accordingly, the N-terminal group may be protected and/or the C-terminal carboxy group may be protected, activated or coupled to a solid phase.

[0046] J¹ may comprise at least 2 amino acids, e.g. J¹ may comprise at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12 or 13 amino acids. J¹ may comprise less than 13 amino acids, e.g. J¹ may comprise less than 12, 11 , 10, 9, 8, 7, 6, 5, 4, 3 or 2 amino acids.

[0047] An eighth aspect of the invention resides in peptides selected from peptides whose amino acids sequence consists of the sequence:

J²-TPVDKTSN (SEQ ID NO:7)

wherein:

J² is any contiguous sequence of 1 , 2, 3, 4 or 5 amino acids comprised in sequence TLDLN (SEQ ID NO:8) said contiguous sequence including the C-terminal N residue of SEQ ID NO:8;

The peptide may have anti-atherogenic and/or anti-inflammatory activity. The peptides may be used in peptide synthesis of a peptide of the fourth, fifth or ninth aspects of the invention. E.g. liquid phase synthesis and accordingly, the N-terminal group may be protected and/or the C-terminal carboxy group may be protected, activated or coupled to a solid phase.

[0048] J² may comprise at least 2 amino acids, e.g. J² may comprise at least 2, 3, 4 or 5 amino acids. J² may comprise less than 5 amino acids, e.g. J² may comprise less than 4, 3 or 2 amino acids.

[0049] A ninth aspect of the invention resides in a peptide selected from (i) and (ii):

(i) (a) a peptide with at least 75% sequence identity to SEQ ID. NO. 2;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO. 2;

(c) a peptide encoded by the nucleic acid of the first aspect of the invention;

(e) a fragment of (a), (b), (c) or (d), wherein the fragment has anti-atherogenic and/or anti-inflammatory activity,

(ii) (a) a peptide with at least 75% sequence identity to SEQ ID. NO. 4; (b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO. 4;

(d) a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) for use in therapy, wherein the second fragment is less than 40 amino acids in length and wherein the second fragment is of a different sequence as compared to the first fragment;

wherein the peptide is for use in combination therapy with the other of (i) and (ii).

[0050] A peptide selected from clauses (i) and (ii) may be used simultaneously,

sequentially or separately in combination therapy with a peptide selected from the other of clauses (i) and (ii).

[0051] A peptide of the disclosure may be for use in a combination therapy for use in in treating and/or preventing diseases selected from autoimmune diseases and inflammatory diseases. For example, the combination therapy may be for use in treating and/or preventing a disease selected from: rheumatoid arthritis; atherosclerosis; diabetes; and lupus.

[0052] A tenth aspect of the invention resides in a pharmaceutical composition comprising a peptide selected from:

(a) a peptide of the disclosure; and

(b) a peptide clause (i) of the ninth aspect of the invention in combination with a peptide from clause (ii) of the ninth aspect of the invention.

[0053] A pharmaceutical composition of the disclosure may be for use in therapy.

Optionally, a pharmaceutical composition of the disclosure may be for use in treating and/or preventing diseases selected from autoimmune diseases and inflammatory diseases. For example, the autoimmune disease and inflammatory disease may be selected from the group consisting of rheumatoid arthritis, atherosclerosis, diabetes and lupus.

[0054] An eleventh aspect of the invention resides in a fusion protein comprising (i) and (ii):

(i) a peptide of the disclosure; and

(ii) a peptide selected from:

(a) an antibody;

(b) an antibody fragment;

(c) a soluble-peptide;

(d) a cell-permeable peptide;

(e) a hapten. [0055] A twelfth aspect of the invention resides a method of treating and/or preventing a disease selected from autoimmune diseases and/or an inflammatory diseases comprising administering a peptide selected from:

(i) (a) a peptide with at least 75% sequence identity to SEQ ID. NO. 2;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO.

2;

(c) a peptide encoded by the nucleic acid of the first aspect of the invention;

(d) a first fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR), wherein the fragment is less than 40 amino acids in length;

(ii) (f) a peptide with at least 75% sequence identity to SEQ ID. NO. 4;

(g) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO.

4;

(h) a peptide encoded by the nucleic acid of the second aspect of the invention;

(i) a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR), wherein the second fragment is less than 40 amino acids in length and wherein the second fragment is of a different sequence as compared to the first fragment;

(j) a fragment of (f), (g), (h) or (i), wherein the fragment has anti-atherogenic and/or anti-inflammatory activity, and

(iii) (k) a peptide selected from clause (i) with a peptide selected from clause (ii).

[0056] In certain embodiments, a peptide of clause (i) is co-administered with a peptide of clause (ii). In certain embodiments, a peptide of clause (i) is administered separately, sequentially or simultaneously to a peptide of clause (ii).

[0057] The method may be for treating and/or preventing a disease is selected from:

rheumatoid arthritis; atherosclerosis; diabetes; and lupus.

[0058] A thirteenth aspect of the invention resides a product comprising of a peptide of the fourth aspect of the invention and a peptide of the fifth aspect of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

[0059] Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which: _ _

1 1

[0060] Figure 1. Titers of peptide-induced lgG1 and lgG2c antibodies in the sera of Apob^tm2S9yLdlr^{tm1 Her J} mice at 2 and 12 weeks after the first immunization and in controls (immunization with either KLH+alum or alum alone). A-E, lgG1 titers; F-J, lgG2c titers.

Figure 1 K Levels of peptide-specific lgG1 antibodies in the sera of Ld\ ^1Her Apob^tm2S9YJ mice at 2 and 12 weeks after the first immunization and in controls (Alum alone and KLH+Alum- immunized mice). The mean optical densities (ODs) ±SEMs from 6 mice (*P<0.05, **P<0.01 , and ***P<0.001), compared to above 2 corresponding controls, that were considered statistically significant are shown. Dilution ratio: 1 : 1250. (Figure 1 L) Levels of peptide- specific lgG2c antibodies in the sera of Ldli^{t 1Her} Apob^{t 2Say} mice mice at 2 and 12 weeks after the first immunization and in controls. The mean optical densities (ODs) from 6 mice (*P<0.05), compared with 2 corresponding controls, that were considered statistically significant are shown. Dilution ratio: 1 :50.

[0061] Figure 2. Detection and quantitation of lesion areas in the aorta and descending aorta of Apob^tm2S9yLdlr^{tm1 Her J} mice fed a high-fat diet after immunization with C5aR peptides versus controls (KLH). A: Representative photomicrograph of lesions observed in

atherosclerotic aortas as analyzed with elastin/van Gieson staining. B: Lesion area in μιτι². C: Percentage of luminal surface occupied by lesions in the aortic sinus (percentage of ratio of lesion areas in μιτι² vs. total areas in μιτι²) (n=18 sections). D: Representative

photomicrographs and quantitative analysis of collagen (Sirius Red coloration under polarized light) in atherosclerotic aortas in individual mice (n=6). E: Quantitative analysis of collagen in atherosclerotic aortas in individual mice (n=6). F: Percentage reduction in lesion size in aortic sinus. G: Representative photomicrograph of lesions observed in

atherosclerotic aortas as analyzed with ORO staining. H: Lesion-occupied area vs. total area. I: percentage reduction in descending aortas (n=6).

[0062] Figure 3. Assessment of inflammation-associated cells in lesions of

A_pobtm2sgy_Ld|_rtmi Her/^j _{mice fed g h}j_gh._{fat djet after} immunization with C5aR-P1 , C5aR-P2, or

C5aR-P1 +C5aR-P2. A: Photomicrographs showing immunohistochemical staining of CD68 (green) and CD1 1c (red) markers. B: Percent of occupied lesion area (vs. total area) for CD68. C: Percent of occupied lesion area (vs. total area) for CD11 c. D: Photomicrographs showing immunohistochemical staining of CD4⁺ T-cells (green) and Foxp3⁺ Treg cells (red). E: Assessment of Treg cells as percentage of Foxp3⁺ areas co-localized with CD4⁺ area (n=18 sections). F: Assessment of Treg cells as fold increase for percentage of Foxp3⁺ area compared with controls. G and H: Representative flow cytometric plots for

CD4⁺CD25⁺Foxp3⁺ (Treg) cell population in spleen cells. Spleen cells from mice immunized with either C5aR peptides or KLH (control) were performed using a Treg detection kit (Miltenyi Biotec, Surrey, UK) according to manufacturer's protocols. (I and J) Bar chart presentation of flow cytometric analysis. Data represent mean±SEM of data from 3 independent samples. *P<0.05, **P<0.01 and ***P<0.001.

[0063] Figure 4. Cytokine concentrations in lesion sites, plasma, and supernatant of spleen cells. A, B: Concentrations of atheroprotective cytokines IL-10 and TGF-β were increased significantly in mice immunized with these two peptide antigens. Immunization with the two peptides in combination had significantly more effect than with either peptide alone. C, D: Plasma concentrations of the atherogenic cytokines TNF-a and IFN-γ were reduced significantly by immunization with these two peptides. Supernatants of splenocytes from mice immunized with these peptides individually showed significantly increased secretion of (E) IL-10 and (F) TGF-β, stimulated with 10 or 100 μg/mL of ConA, respectively. In contrast, significantly decreased secretion of (G) TNF-a and (H) IFN-γ was found in supernatants of splenocytes in mice immunized with these two peptides antigens. G. A significantly greater decrease in the secretion of IFN-y was observed in mice immunized with peptides in combination vs. singly (P<0.05). (M and N) Concentration of Cytokine for IL-10 and IFN-y in the supernatant of splenocytes stimulated with C5aR-P1 +C5aR-P2 (10 μg/ml for each peptide) from Ld/ ^miHe \po ^m2Ss,yJ mice fed a high-fat diet after immunization with C5aR-P1+C5aR-P2 (5 analyses±SEM and differences between experimental groups are shown). Data represent mean±SEM of data from 6 mice of each groups. *P<0.05, **P<0.01 and ***P<0.001.

[0064] Figure 5. Analysis of T-cell specificity in vitro. A: CD4⁺ T-cells from KLH-immunized mice were stimulated with C5aR-P1 or C5aR-P2. B: CD4⁺ T-cells from C5aR-P1 -immunized mice were stimulated with C5aR-P1 peptide, showing a significant response to C5aR-P1 and no response to C5aR-P2. C: CD4⁺ T-cells from C5aR-P2-immunized mice were stimulated with C5aR-P2 peptide, showing a significant response to C5aR-P2 and no response to C5aR-P1. D: CD4⁺ T-cells from a combination of C5aR-P1 and C5aR-P2-immunized mice were stimulated with either C5aR-P1 or C5aR-P2, showing a significant response to both peptides.

[0065] Figure 6. Measurement of monocyte differentiation into macrophages by flow cytometry. A: Monocytes isolated from C57/B6 background mice were cultured for 3 days and their differentiations determined by expression of CD206 and F4/80 using flow cytometry, which showed expressions in fresh cells (control), unstimulated cells (control), Den-stimulated (10 ng/mL) cells, C5a-stimulated (10 ng/mL) cells, C5a/C5aR antiserum (C5a stimulation after C5aR antiserum-pretreated) treated cells and C5a/C5a antiserum (C5a stimulation after C5a-pretreated) treated cells and granulocyte-macrophage colony- stimulating factor-stimulated cells (shown in red) compared with that of isotype control (shown in black). C: Spleen cells from immunized mice were analisized using a flow cytometer, which showed expression levels of CD206. MFI denotes mean fluorescence intensity. Histogram presentations for CD206 and F4/80 expression in monocytes and CD206 expression in immunized mice spleen cells were shown in Figure B and D, respectively. Data represent mean ± SEM. ***P<0.001.

[0066] Figure 7. Assessment of C5aR distribution in the lesions of Apob^tm2S9yLdlr^{tm1 Her J} mice fed a high-fat diet after immunization with an ApoB peptide, human heat-shock protein (HSP)60 peptide, and a combination of ApoB and human HSP60 peptides, compared with KLH control. (A) Representative photomicrographs showing immunohistochemical staining of C5aR (in red), C5a (in green), and merged C5a/C5aR. (B) C5aR-positive area in lesion. (C) Percent of occupied lesion C5aR. (D) C5a/C5aR ratio. (E) C5a concentrations in plasma.

[0067] Figure 8. (A) Representative photomicrographs showing immunohistochemical staining of the aortic root showed C5aR⁺ cells (red) and C5a⁺ area (green) in the lesion, and C5aR⁺ cells co-localized within C5a⁺ (yellow) in lesions from C5aR-peptide-immunized mice and KLH-immunized mice. (B) and (C) Quantitative analysis of either C5aR or C5a expression in lesions. (D) The number of C5aR⁺C5a⁺ cells and C5aR⁺C5a^" cells. (E) The percentage of C5aR⁺C5a⁺ cells and C5aR⁺C5a^" cells. (F-H) Assessment of C5a and C5aR distribution in the lesions of Ld\ ^1Her Apob^tm2S9YJ mice fed a high-fat diet after immunization with an ApoB peptide, human heat-shock protein (HHSP)60 peptide, and a combination of ApoB and HHSP60 peptides in KLH-conjugated form, compared with KLH control (reference 2). (F) Representative photomicrographs showing immunohistochemical staining of C5aR (in red), C5a (in green), and merged C5a/C5aR. (G) C5aR-positive area in lesion. (H) Percent of C5aR-occupied lesion. (n=6 mice). (I) Percent of C5aR-occupied lesion.

[0068] Figure 9. Assessment of antigen-specific regulatory function. T-effector cells, the CD4⁺CD25^" cells, were isolated from CD4⁺ T-cells (unbound to CD4⁺CD25⁺ cell beads, 99.5% of CD4⁺CD25^" cells) from spleen of mice that had received oral immunization with C5aR-P1 , C5aR-P2 and C5aR-P1+P2, respectively. Proliferation of effector cells alone is indicated in the leftmost bar of each group. Addition of isolated CD4⁺CD25⁺ Treg cells from animals immunized with C5aR-P1 (A); with C5aR-P2 (B); with C5aR-P1 + P2 (C) and with KLH-control (D) is indicated at different ratios to affect cells. Data are expressed as mean of 6 analyses±SEM. Differences between groups are shown; *P<0.05 **P<0.01 and

***P<0.001.

[0069] Figure 10. Measurement of cross-reaction using C5aR-P1- or C5aR-P2-immunized serum to react with oxLDL and native LDL. The immunized mice used were fed with normal chow for 5 weeks. (B) Measurement of cross- reaction using pooled ApoB-peptide- immunized mice serum to react with C5aR peptides. Blood samples were taken from the immunized mice at 4 weeks after the first injection of the antigens to test cross-reaction. (C) C5a concentrations in plasma observed by ELISA analysis (n=6 mice). (D) OxLDL concentrations in plasma observed by ELISA analysis (n=5 mice). (E) C5aR expression in lymph nodes analyzed by flow cytometer.

[0070] Figure 11. Cytokine mRNA expression in aorta arch and Foxp3 mRNA expression in lymph nodes, respectively; Real-time reverse-transcription PCR normalized to GAPDH in aorta arches and lymph nodes of peptide-immunized mice. (A) Showing fold of increase in expression levels considering the expression in control as 1-fold; (B) IL-10, (C) TGF-β, (D) TNF-y and (E) IFN-γ expression (relative to GAPDH) in aorta arches of mice treated with C5aR-P1 and C5aR-P2 either singly or in combination. (F) Showing fold of increasing or decreasing expression levels considering the expression in control as 1-fold. Values are means ± SEM from 5 mice per group. *P<0.05.

[0071] Figure 12. Analysis of peptide antigen epitope-induced specific CD4⁺ T-cell proliferation CD4⁺ T cells isolated from the splenocytes of mice were incubated with the peptide at the dose of 0.01-10 μΜ/L in the presence of irradiated stimulator spleen cells. (A) CD4⁺ T-cells from C5aR-P1-immunized mice stimulated with C5aR-P1 peptide and with C5aR-P2 peptide. (B) CD4⁺ T-cells from C5aR-P2-immunized mice stimulated with C5aR-P2 peptide and with C5aR-P1 peptide. (C) CD4⁺ T-cells from a combination of C5aR-P1 and C5aR-P2-immunized mice stimulated with either C5aR-P1 or C5aR-P2 peptides. (D) CD4⁺ T-cells from KLH-treated mice stimulated with C5aR-P1 or C5aR-P2.

DETAILED DESCRIPTION

[0072] Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed. _

15

[0073] The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

[0074] For the avoidance of doubt, it is hereby stated that the information disclosed earlier in this specification under the heading "Background" is relevant to the invention and is to be read as part of the disclosure of the invention.

[0075] The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure.

[0076] The present invention relates to peptides having anti-atherogenic and antiinflammatory activity. Two peptides, named C5aR-P1 and C5aR-P2, have been shown to reduce atherosclerotic lesion size and promote a major shift away from pro-inflammatory cytokines (i.e. TNF-a and IFN-γ) towards anti-inflammatory cytokines (IL-10 and TGF-β).

[0077] Unexpectedly, a combination of C5aR-P1 and C5aR-P2 resulted in an unpredictable synergistic effect on atherosclerotic lesion reduction and the inflammatory response. This was surprising because it would be expected that a combination of the two peptides would give a similar result as compared to either peptide alone since the same total dose of peptide used in each experiment was unchanged.

[0078] The peptides of the present invention are based on an N-terminal sequence of human C5aR.

Table 1 displays the preferred peptides of the invention.

The nucleic acid sequence encoding the peptide C5aR-P1 is:

5'atgaactctttcaactacactactccggattacggtcattacgacgacaaagacactcttgac

(SEQ ID NO: 1)

The nucleic acid sequence encoding the peptide C5aR-P2 is:

5'Actcttgaccttaacactccggtcgacaaaacttctaac (SEQ ID NO: 3)

[0079] As used herein, by "peptide" and "protein" can be used interchangeably and mean at least two covalently attached amino acids linked by a peptidyl bond. The term peptide encompasses purified natural products, or products which may be produced partially or wholly using recombinant or synthetic techniques. The terms peptide and protein may refer to an aggregate of a protein such as a dimer or other multimer, a fusion protein, a protein variant, or derivative thereof. The term also includes modifications of the protein, for example, protein modified by glycosylation, acetylation, phosphorylation, pegylation, ubiquitination, and so forth. A protein may comprise amino acids not encoded by a nucleic acid codon.

[0080] In certain embodiments one or more peptides of the invention are conjugated to the carrier protein, Keyhole limpet hemocyanin (KLH).

[0081] In certain embodiments one or more peptides of the invention are conjugated to an adjuvant to form an adjuvant peptide conjugate.

[0082] In certain embodiments one or more peptides of the invention are conjugated to an antibody to form an antibody peptide conjugate.

[0083] In certain embodiments one or more peptides of the invention are conjugated to an antibody fragment to form an antibody fragment peptide conjugate.

[0084] In certain embodiments one or more peptides of the invention are conjugated to a soluble peptide to form a soluble peptide conjugate.

[0085] In certain embodiments one or more peptides of the invention are conjugated to a soluble peptide to form a cell permeable peptide conjugate.

[0086] By "peptide modification" or "protein mutation" is meant an amino acid substitution, insertion, and/or deletion in a polypeptide sequence or an alteration to a moiety chemically linked to a protein. For example, a modification may be an altered carbohydrate or PEG structure attached to a protein.

[0087] The term "modified peptide" or "mutated protein" encompasses peptides having at least one substitution, insertion, and/or deletion of an amino acid. A modified or mutated peptide may have 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more amino acid modifications (selected from substitutions, insertions, deletions and combinations thereof). Optionally a modified or mutated peptide has 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more conservative amino acid substitutions.

[0088] The term "conservative substitution" means an amino acid substitution for an amino acid residue having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting peptide. _ _

17

[0089] A peptide can be produced to contain one or more conservative substitutions by manipulating the nucleotide sequence that encodes that peptide using, for example, standard procedures such as site-directed mutagenesis or PCR. Alternatively, a peptide can be produced to contain one or more conservative substitutions by using standard peptide synthesis methods.

[0090] Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Examples of amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include: Ser for Ala; Lys for Arg; Gin or His for Asn; Glu for Asp; Ser for Cys; Asn for Gin; Asp for Glu; Pro for Gly; Asn or Gin for His; Leu or Val for lie; lie or Val for Leu; Arg or Gin for Lys; Leu or lie for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr; Tyr for Trp; Trp or Phe for Tyr; and lie or Leu for Val.

[0091] The term "nucleic acid" includes oligonucleotides, oligomers of nucleosides or analogs thereof, including deoxynbonucleosides, ribonucleosides, and the like. Nucleic acids of the present invention range in size from a few monomeric units, e.g. 2-4, to hundreds of monomeric units. For example, a nucleic acid of the invention may be at least 12, 15, 18, 21 , 14, 17, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 11 1 , 114, 117, 120 nucleotides in length or any integer therebetween. For example, a nucleic acid of the invention may be less than 12, 15, 18, 21 , 14, 17, 30, 33, 36, 39, 42, 45, 48, 51 , 54, 57, 60, 63, 66, 69, 72, 75, 78, 81 , 84, 87, 90, 93, 96, 99, 102, 105, 108, 1 11 , 1 14, 1 17, 120 nucleotides in length or any integer therebetween. Nucleic acids can be obtained from existing nucleic acid sources, including genomic or cDNA, or can be produced by synthetic methods. The term nucleic acid encompasses modified nucleic acid.

[0092] The term "isolated" refers to a naturally-occurring nucleic acid that is not

immediately contiguous with both of the sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally-occurring genome of the organism from which it is derived. For example, an isolated nucleic acid can be, without limitation, a recombinant DNA molecule of any length, provided one of the nucleic acid sequences normally found immediately flanking that recombinant DNA molecule in a naturally-occurring genome is removed or absent. Thus, an isolated nucleic acid includes, without limitation, a recombinant DNA that exists as a separate molecule (e.g., a cDNA or a genomic DNA fragment produced by PCR or restriction endonuclease treatment) independent of other sequences as well as recombinant DNA that is incorporated into a vector, an autonomously replicating plasmid, a virus (e.g., a retrovirus, adenovirus, or herpes virus), or into the genomic DNA of a prokaryote or eukaryote. In addition, an isolated nucleic acid can include a recombinant DNA molecule that is part of a hybrid or fusion nucleic acid sequence. _„

18

[0093] The term "modified nucleic acid" or encompasses nucleic acids having at least one substitution, insertion, and/or deletion of a base. For example, the modified nucleic acid can have up to 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45 or up to 50 substitutions, insertions, and/or deletions of a base.

[0094] The term "sequence identity" means the identity between two or more nucleic acid sequences, or two or more amino acid sequences. It is expressed in terms of the identity or % similarity between the sequences. Sequence identity is taken over the entire length of at least one of the nucleic acid sequences being compared or over the entire length of at least one of the amino acid sequences being compared. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity when aligned using standard methods. This homology is more significant when the orthologous proteins or cDNAs are derived from species which are more closely related (e.g., human and mouse sequences), compared to species more distantly related (e.g., human and C. elegans sequences).

[0095] Methods of alignment of sequences for comparison are well known in the art.

Various programs and alignment algorithms are described in: Smith & Waterman, Adv. AppI. Math. 2:482, 1981 ; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Nat. Acad Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:23744, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth Mol. Bio. 24:307-31 , 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

[0096] The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, Md. 20894, US) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.

[0097] One indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence-dependent and are different under different environmental parameters.

[0098] Nucleic acid sequences that do not show a high degree of identity may

nevertheless encode identical or similar (conserved) amino acid sequences, due to the degeneracy of the genetic code. Changes in a nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein. Such homologous nucleic acid sequences can, for example, possess at least 60%, 70%, 80%, 90%, 95%, 98%, or 99% sequence identity determined by this method.

[0099] One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only; it is possible that strongly significant homologs could be obtained that fall outside the ranges provided. An alternative (and not necessarily cumulative) indication that two nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.

[00100] The term "isolated" means a biological component (such as a nucleic acid molecule or protein) that has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, i.e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids and proteins that have been "isolated" include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids, proteins and peptides.

[00101] The term "derivative" can mean a biological molecule that has been altered chemically or genetically in a way which does not affects its biological activity. A derivative may be a functional derivative or a biologically effective analogue of the parent biomolecule. Nucleic acids of the present invention, including nucleic acid fragments, have anti atherogenic and/or anti-inflammatory activity. Peptides of the present invention, including peptide fragments, have anti atherogenic and/or anti-inflammatory activity.

[00102] Nucleic acids of the present invention include those coding for peptides

homologous to, and having essentially the same biological properties as, the proteins disclosed herein. In particular, the nucleic acid disclosed herein as SEQ ID NO: 1 encodes the protein given herein SEQ ID NO:2 and the nucleic acid disclosed herein as SEQ ID NO:3 encodes the protein given herein SEQ ID NO:4. This definition is intended to encompass natural allelic variations therein. Thus, nucleic acids which hybridise to nucleic acids disclosed herein as SEQ ID NO: 1 or which hybridise to nucleic acids disclosed herein as nucleic acids disclosed herein as SEQ ID NO:3 (or fragments or derivatives thereof which serve as hybridisation probes as discussed below) and which code expression for a protein associated with a protein according to SEQ ID NO:2 or which code expression for a protein associated with a protein according to SEQ ID NO:4 are included in the present invention. [00103] Conditions which will permit other nucleic acids to hybridize to the nucleic acids of SEQ ID NO: 1 or to the nucleic acids of SEQ ID NO:3 disclosed herein can be determined in accordance with known techniques. For example, hybridization of such sequences may be carried out under conditions of reduced stringency, medium stringency or even stringent conditions (e.g., conditions represented by a wash stringency of 35-40% Formamide with 5x Denhardt's solution, 0.5% SDS and 1x SSPE at 37°C; conditions represented by a wash stringency of 40-45% Formamide with 5x Denhardt's solution, 0.5% SDS, and 1x SSPE at 42°C; and conditions represented by a wash stringency of 50% Formamide with 5x

Denhardt's solution, 0.5% SDS and 1x SSPE at 42°C, respectively) to DNA disclosed herein in a standard hybridization assay. See, e.g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual (2d Ed. 1989) (Cold Spring Harbor Laboratory).

[00104] In general, nucleic acids sequences which code for proteins of the present invention and which hybridize to the nucleic acids of SEQ ID NO:1 or SEQ ID NO:3 disclosed herein will be preferably at least 75% homologous, 85% homologous, and even 95% homologous or more with SEQ ID NO: 1 or at least 75% homologous, 85% homologous, and even 95% homologous or more with SEQ ID NO:3. Furthermore, nucleic acids of which code for proteins of the present invention, or nucleic acids which hybridize to that of SEQ ID NO:1 or SEQ ID NO:3 but which differ in codon sequence from SEQ ID NO: 1 or from SEQ ID NO:3 due to the degeneracy of the genetic code, are also part of this invention. The degeneracy of the genetic code, which allows different nucleic acid sequences to code for the same protein or peptide, is well known in the literature.

[00105] The term "nucleic acid fragment" is intended to mean a nucleic acid of at least 12, 15, 18, 21 , 24, 27, 30, 33, 36, 39 or 41 contiguous nucleotides of the reference sequence or any integer therebetween; preferred fragments are those which are capable of hybridizing selectively, under stringent conditions, with said reference sequence. Preferably, the nucleic acid fragment is at least 36 contiguous nucleotides in length. Optionally, the peptide fragment is at least 63 contiguous nucleotides in length. The nucleic acid fragment of the invention encodes a peptide having anti-atherogenic and/or anti-atherosclerotic activity.

[00106] The term "nucleic acid fragment" is also intended to mean a nucleic acid of less than 120, 90, 75, 66 or 54 contiguous nucleotides of the reference sequence or any integer therebetween; preferred fragments are those which are capable of hybridizing selectively, under stringent conditions, with said reference sequence. Preferably, the nucleic acid fragment is less than 37 contiguous nucleotides in length. Optionally, the peptide fragment is less than 64 contiguous nucleotides in length The nucleic acid fragment of the invention encodes a peptide having anti-atherogenic and/or anti-atherosclerotic activity. [00107] The term "peptide fragment" is intended to mean a peptide of at least 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 or 30 contiguous amino acids in length. Preferably, the peptide fragment is at least 12 contiguous amino acids in length. Optionally, the peptide fragment is at least 21 contiguous amino acids in length. The peptide fragment has an anti-atherogenic and/or anti-atherosclerotic activity.

[00108] The term "peptide fragment" is intended to mean a peptide of less than 40, 30, 25, 22, 18 or 14 contiguous amino acids in length. Preferably, the peptide fragment is less than 13 contiguous amino acids in length. Optionally, the peptide fragment is less than 22 contiguous amino acids in length. The peptide fragment has an anti-atherogenic and/or anti- atherosclerotic activity.

[00109] Protein homology is defined as biological homology between proteins. Homologous proteins in different species are derived from a common ancestral protein. Evolutionary constraints can retain the amino acid sequence of a protein and/or the protein's tertiary structure. In human genetic research, homologous proteins are identified in model organisms and research is carried out on the homologous protein in the model organism. The results are then extrapolated to humans.

[00110] Homologous proteins do not necessarily share similar amino acid sequences.

Structural similarity is often found in divergently related proteins where there is little similarity in the primary amino acid sequence. During evolution, protein structures are often better conserved than their sequences (Voet. (1999). Proteins: three-dimensional structure. In: Fundamentals of Biochemistry. USA: Wiley. Page 138).

[00111] Peptides of the present invention can be produced by, for example, solid phase synthesis or liquid-phase synthesis. These techniques are well known in the art and described in WO 90/05738 and US4797469.

[00112] Solid-phase synthesis is the most common technique for peptide synthesis. Usually, peptides are synthesized from the carbonyl group side (C-terminus) to amino group side (N- terminus) of the amino acid chain in this method, although peptides are synthesised in the opposite direction in cells. In peptide synthesis, an amino-protected amino acid is bound to a solid phase material (most commonly, low cross-linked polystyrene beads), forming a covalent bond between the carbonyl group and the resin, most often an amido or an ester bond. Then the amino group is deprotected and reacted with the carbonyl group of the next amino-protected amino acid. The solid phase now bears a dipeptide. This cycle is repeated to form the desired peptide chain. After all reactions are complete, the synthesized peptide is cleaved from the bead. The protecting groups for the amino groups mostly used in the peptide synthesis are 9-fluorenylmethyloxycarbonyl group (Fmoc) and t-butyloxycarbonyl _

22

(Boc). The Fmoc group is removed from the amino terminus with base while the Boc group is removed with acid.

[00113] During liquid-phase synthesis the peptide has to be manually removed from the reaction solution after each cycle. Additionally, this approach requires another chemical group to protect the C-terminus of the first amino acid.

[00114] Chemical synthesis of a peptide of the invention is from the C-terminal end to the N- terminal end. The skilled person will appreciate that a number of intermediate peptides are formed during the production of a peptide of the invention. These intermediate peptides are encompassed by the present invention.

[00115] The intermediate peptides and final peptides have the same essential structural element, i.e. the intermediate sequence is incorporated in to the final peptide sequence. Thus, the intermediate peptide incorporates an essential sequence element into the final peptide.

[00116] The intermediate peptides and final peptides are technically inter-related, i.e. the final peptide is manufactured directly from the intermediate peptide or is separated from it by a small number of intermediate peptides all containing the same essential sequence element.

[00117] Accordingly, in one embodiment there is provided an intermediate peptide,

Intermediate P1 , having the sequence J¹-YDDKDTLD (SEQ ID NO: 5).

[00118] J¹ is any contiguous sequence of 1 , 2, 3, 4, 5 or 6 amino acids comprised in sequence MNSFNYTTPDYGH (SEQ ID NO:6), said contiguous sequence including the C- terminal H residue of SEQ ID NO:6.

[00119] In another embodiment, there is provided an intermediate peptide, Intermediate P2, having the sequence J²-TPVDKTSN (SEQ ID NO: 7). J² is any contiguous sequence of 1 , 2, 3, 4 or 5 amino acids comprised in sequence TLDLN (SEQ ID NO:8) said contiguous sequence including the C-terminal N residue of SEQ ID NO:8.

[00120] In one embodiment J¹ comprises at least two amino acids.

[00121] In one embodiment J¹ comprises at least four amino acids.

[00122] In one embodiment J² comprises at least two amino acids.

[00123] In one embodiment J² comprises at least four amino acids.

[00124] The sequences of the intermediate peptides of the invention are set out in Table 2 below.

Intermediate P2 J^-TPVDKTSN SEQ ID NO: 7

J¹ represents the amino acid sequence of MNSFNYTTPDYGH (SEQ I D NO: 6).

J² represents the amino acid sequence of TLDLN (SEQ I D NO: 8).

[00125] The term "treating" includes: (1) inhibiting, e.g. delaying, initiation and/or

progression of a disorder or condition; (2) preventing or delaying the appearance of clinical symptoms of the state, disorder or condition developing in a human or an animal that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; (3) inhibiting the state, disorder or condition (e.g. , arresting, reducing or delaying the development of the disease, or a relapse thereof in case of maintenance treatment, of at least one clinical or subclinical symptom thereof); and/or (1) relieving the condition (i.e. , causing regression of the state, disorder or condition or at least one of its clinical or subclinical symptoms). The benefit to a patient to be treated may be either statistically significant or at least perceptible to the patient or to the physician. The term "therapeutic or prophylactic" encompasses the same subject matter.

[00126] A person skilled in the art would appreciate that the following drug delivery methods could be used in conjunction with the peptides, peptide fragments, nucleic acids and nucleic acid fragments of the present invention:

• Lipid vesicles such as liposomes

• Antibody-agent conjugates

• Soluble peptide-agent conjugates

• Gene therapy, such as retroviral or adenoviral vectors used to express an agent.

• Nanovectors, for example, polymerosomes

• Cell permeable peptides. [00127] A pharmaceutical composition of the invention is a composition comprising one or more agents, e.g. peptides or nucleic acids of the invention, and a pharmaceutically acceptable diluent, carrier and/or excipient. Such formulations may further routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, supplementary immune potentiating agents such as adjuvants and cytokines and optionally other therapeutic agents.

[00128] Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of them mean "including but not limited to", and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

EXAMPLES

[00129] Objective: The goal of this study was to assess whether immunization of

A_pobtm2sgy_Ld|_rtmi Her/^j _{m jce wjtn} ^_Q p_eptj_des |_0Cated at the N-terminus of C5aR, either singly or in combination, is effective in reducing atherosclerotic lesions.

[00130] Methods and results: Eight-to-ten-week-old female Apob^tm2S9yLdlr^{tm1 Her J} mice were immunized using a repetitive immunization multiple-sites strategy with keyhole limpet hemocyanin-conjugated peptides derived from the C5a receptor (C5aR), either singly (designated as C5aR-P1 [aa 1-21] and C5aR-P2 [aa 19-31]) or in combination (designated as C5aR-P1+C5aR-P2). Mice were fed a high-fat diet for 10 weeks. Lesions were evaluated histologically; local and systemic immune responses were analyzed by

immunohistochemistry of aorta samples and cytokine measurements in plasma samples and splenocyte supernatants. Immunization of Apob^tm2S9yLdlr^{tm1 Her J} mice with these peptides elicited high concentrations of antibodies against each peptide. Immunization with the single peptide inhibited plaque development. Combined inoculation with C5aR-P1+C5aR-P2 had a synergistic effect on reducing the lesion in the aorta sinus and descending aortas when compared with controls (see, for example, Figure 2G, Figure 3F and Figure 4B). This effect correlated with cellular infiltration and cytokine/chemokine secretion in the serum or in stimulated spleen cells as well as specific cellular immune responses when compared with controls.

[00131] Conclusions: The results obtained from the tissues of mice immunized with C5aR peptides either singly or in combination showed that C5a protein or C5aR is expressed in the lesion sites of aorta sinus (Figure 8) in mice immunized with different peptides or with KLH only as controls. Although both C5aR⁺ cells per mm² lesion and the C5a percentage of area in the lesion showed somewhat similar profiles between the sampling groups and the control (Figure 8B and C), most of C5a were not co-localized with C5aR or the numbers of

C5aR_C5a⁺ cells were decreased significantly in mice immunized with C5aR peptides compared with those in KLH-immunized control mice showing almost all of C5aR⁺ cells combined with C5a (Figures 8A Magnified, 8D and 8E). Interestingly, additional tissues of mice immunized with ApoB peptide, human HSP60 peptide either singly or in combination showed that not only C5a or C5aR expressed in the lesions of aorta sinus but C5a co- localized with C5aR (Figures 8 F-H, Table 1).

Table 1. Measurement of C5aR and C5a areas occupied in lesions in recombinant antigen-immunized mice and controls

[00132] Immunization of mice with C5aR-P1 and C5aR-P2, either singly or in combination, was effective in reducing early atherosclerotic lesion development. The combined peptide has more potential than either epitope alone in reducing atherosclerotic lesion formation through increasing atheroprotective cytokines and Foxp3 Treg expression and blocking monocyte differentiation into macrophages.

[00133] Materials and Methods

[00134] Peripheral Blood Mononuclear Cell (PBMC) Isolation From C57BL/6

Background Mice

[00135] Blood was diluted with PBS (1 :4 dilution) and slowly added into pre-prepared histopaque solution (1 :1 v/v) in a centrifuge tube, followed by centrifuged (2000rpm) at room temperature for 20 minutes to collect monocytes.

[00136] Animal Experiments

[00137] Apob^tm2S9yLdlr^{tm1 Her J} mice on a C57BL/6 background were used in our study, with a total of 4 groups, each comprising 8-10 females (5-6-weeks' old). The immunizing antigens KLH-C5aR-P1 and KLH-C5aR-P2 were injected either singly at a dose of 20 μg per inoculation, or the 2 antigens were combined, with 10 μg per inoculation each mixed with alum adjuvant. Control groups received KLH with alum or alum alone. The repetitive immunization multiple sites strategy was adopted and mice were sacrificed at the end of week 12 after being fed a high-fat diet for 10 weeks (the diet was started at week 2 and was continued for 10 weeks after the last immunization).

[00138] Tissue Preparation and Antibody Response Measurement

[00139] Twelve weeks after the first immunization, heart segments with the aortic root were harvested and mounted in optimal cutting temperature (OCT) for immunohistochemical analyses and in paraffin for lesion measurement. Atherosclerosis in aortic roots was examined by Image-Pro Plus TM software, version 4.0 (Media Cybernetics, Bethesda, MD, USA). Longitudinally opened descending aortas were evaluated for the extent of

atherosclerosis after Oil Red O (ORO) staining. Peptide-specific antibody titers were measured by ELISA following the manufacturer's instructions.

[00140] Immunohistochemical Analyses, Morphometric Analyses, and Quantitative Measurements of Atherosclerosis

[00141] Sections from OCT-embedded samples were stained with CD68-, CD1 1 c-, CD4-, and forkhead box protein3 (Foxp3)-specific antibodies. Sections of paraffin-embedded tissues were stained with hematoxylin and eosin and elastin/van Gieson (Sigma) for histological examination and were evaluated using an Olympus U-ULH Optical microscope (Olympus Optical Co. Ltd, Tokyo, Japan). The extent of atherosclerosis in the aortic roots and descending aortas was measured and analyzed quantitatively using Image-Pro Plus TM software, version 4.0 (Media Cybernetics, Bethesda, MD, USA).

[00142] Measurement of Cytokines

[00143] Plasma concentrations of interleukin (IL)-10, transforming growth factor (ΤΘΡ)-β, tumor necrosis factor (TNF)-a, and interferon (IFN)-y were measured by ELISA following the manufacturer's instructions (R&D systems, Abingdon, UK). IL-10 and TNF-a concentrations in the lesions were quantified by immunohistochemical analyses (rat anti-mouse TNF-a and IL-10 were purchased from BioLegend, CA, USA). Concentrations of ConA-induced IL-10, TGF-β, TNF-a, and IFN-γ in splenocyte cultures were also measured.

[00144] CD4⁺ T-cell Proliferation Assay

[00145] Peptide-antigen-specific CD4⁺ T-cell response was measured as proliferation of the CD4⁺ T cells obtained from the immunized mice with the recombinant constructs in response to in vitro stimulation with peptides.

[00146] Fluorescence Activated Cell Sorting Analysis

[00147] At indicated time points, cells were processed for staining (30 minutes at 4°C) using allophycocyanin-anti-mouse CD206 antibody (BioLegend, Cambridge, UK) and fluorescein isothiocyanate (FITC)-anti-mouse F4/80 antibody (eBioscience, Hatfield, UK). Cells were analyzed with a Beckman-Coulter FC-500 Analyzer (Bachman Coulter, High Wycombe, UK).

[00148] Statistical Analyses

[00149] Data are reported as meanistandard error of the mean (±SEM) unless stated otherwise. The analysis was performed using graph-pad Prism 5.01 and Sigma plot 9.0 (Systat Software Inc, Hounslow, UK). Differences between the 2 groups of mice were analyzed using Student's t test and are expressed as meaniSEM or using the Mann-Whitney test (for nonparametric data). For experiments involving≥3 groups, analysis of variance (ANOVA) with the Tukey multiple comparison post-test was used. A P value of <0.05 was considered statistically significant. An extended description of the methods is available online.

[00150] Results; C5a and c5aR are Involved in Lesion Sites

[00151] The results obtained from the tissues of mice immunized with an apolipoprotein B (ApoB) peptide (amino acids 661 and 680), a human heat shock protein (HHSP)60 peptide, and a combination of both (unpublished data) showed that C5a protein or C5aR are expressed in the lesion sites of aorta sinus (Figure 7A) in mice immunized with different peptides or with KLH only as controls (Figure 7B). The percentage of C5aR occupied area in lesion is shown in Figure 7C. Co-localization of C5a with C5aR showed same levels between C5a and C5aR (Figure 7D). In addition C5a level in plasma from C5aR peptide-immunized mice are same as that from KLH-immunized mice (Figure 7E)

[00152] Peptide-Specific Immunoglobulin G in the Sera of Immunized Mice

[00153] After immunization of Apob^tm2S9yLdlr^{tm1 Her J} mice with KLH-conjugated peptide antigens C5aR-P1 or C5aR-P2, or both (C5aR-P1+C5aR-P2), a peptide-induced specific immunoglobulin (lg)G1 response was observed (Figure 1A-C), when compared with either KLH+alum or an alum-only control (Figure 1 D, 1 E). Little or no lgG2c immune response (Figure 1 F-H) was detected in pooled antiserum when compared with that in controls (Figure 11, 1J). However, the titers of lgG2c detected were much lower than those of lgG1 based on the optical densities measured in different dilutions of samples.

[00154] Reduction of Atherosclerotic Lesion Size in Aortic Sinus and in Descending Aorta

[00155] Representative sections of aortic sinuses from experimental groups are shown in Figure 2A. Lesion size was significantly smaller in mice immunized with either C5aR-P1 or C5aR-P2 (both P<0.00^) compared with the KLH-alum-immunized control group, either by regarding the mean lesion area (384 710±24 186 μηι²) or percentage of lesion versus total area (45±1.9%). The smallest lesion area was observed in mice immunized with the combination of the two peptides (171 480±9276 μηι² based on lesion area, P<0.051 to P<0.001) compared with the single-peptide-immunized mice). In respect of the percentage of the lesion area versus total area in the aorta sinus (Figure 2C), the difference was significant between the combined peptide and C5aR-P2, showing 25.3±1.2% (P<0.001). Reduction in lesion size, expressed as a percentage of the decrease in the lesion size in the aortic sinus of peptide-immunized mice compared with lesions in the KLH-alum-immunized control mice, was significant (P<0.001), showing a 39.3% reduction following immunization with C5aR-P1 and a 32.7% reduction with C5aR-P2 (Figure 2C and 2D). Mice immunized with the combined peptides showed a significant reduction in lesion size (43.7%, P<0.001), which was also significant when compared with the mice immunized with C5aR-P2 (P<0.001) (Figure 2C and 2D).

[00156] Longitudinally opened descending aortas were stained en face with ORO and positively stained plaques areas were measured. Representative en face stained descending aortas from experimental groups are shown in Figure 2E. Lesion size was significantly smaller in mice immunized with a single peptide (C5aR-P1 : 4.7±0.2%, P=0.015; and C5aR- P2: 6.1 ±0.2%, P=0.045) or with the combined peptides (C5aR-P1 +P2: 2.7±0.4%, P=0.008) compared with that in control mice (9.9±1.5%) (Figure 2F). Reduction in lesion size was expressed as a percentage of the decrease in the lesion size versus total size in the descending aorta of peptide-immunized mice compared with that in control mice (set as zero percent of reduction) showing 52.5% following immunization with C5aR-P1 , 38.4% with C5aR-P2, and 72.8% with the combined peptide (Figure 2G). It was surprising that the combined peptides resulted in a greater reduction in lesion size since it would be expected that the % reduction in lesion size would fall in between that of each peptide individually. This results shows that there is a synergistic effect between the peptides. The increased reduction in lesion size in the descending aorta from the mice immunized with the combined peptide was significant compared with that in mice immunized with either C5aR-P1 (P<0.01) or C5aR-P2 (PO.01).

[00157] Amount of Inflammatory Cells and CD4⁺ Cells Expressing Foxp3 in the

Lesions, Foxp 3 mRNA Expression in Lymph Nodes

[00158] The percentage of macrophage-occupied area in the lesions decreased significantly, showing 68.7% (10.6% vs. 33.9%, P<0.001) in mice immunized with C5aR-P1 , 63.7%

(12.3% vs. 33.9%, PO.001) in mice immunized with C5aR-P2, and 82.1 % (6.1 % vs. 33.9%, PO.001) in mice immunized with C5aR-P1+C5aR-P2 (Figures 3TTI-1612A and 3B); total macrophage-occupied area in lesions in control mice (33.9%) was set as at 100% (0% reduction).

[00159] Measurement of the CD1 1c⁺-stained lesion area showed a significant reduction in mice, with 74.1 % (6.9% vs. 26.6%, P<0.001) in mice immunized with C5aR-P1 , 70.0% (8.0% vs. 26.6%, PO.001) in mice immunized with C5aR-P2, and 81.6% (4.9% vs. 26.6%, _

29

P<0.001) in mice immunized with C5aR-P1+C5aR-P2, compared with the CD1 1c⁺ content of the lesions in control group (Figure 3C).

[00160] The proportion of CD4⁺ cells expressing Foxp3 was approximately 3-4-fold higher (4.6%, P<0.001 ; 4.4%, P<0.001) in mice immunized with C5aR-P1 , C5aR-P2 respectively compared with 1.0% in control mice. The proportion of CD4⁺ cells expressing Foxp3 was approximately 8 fold higher (7.9%, P<0.001) in mice immunized with a combination of C5aR- P1+C5aR-P2 (Figures 3D-3F). The improved proportion of CD4⁺ cells expressing Foxp3 following immunization with a combination of the peptides was surprising. It would be expected that the % proportion of the combined immunization would fall in between the % proportions resulting from each peptide individually. Consistently, mRNA expression of Foxp3 in lymph nodes showed 1.8-fold, 1.7 fold and 2.2 fold increases (Figure 11A-F) in mice immunized with C5aR-P1 , C5aR-P2 and C5aR-P1+P2, respectively when compared with controls.

[00161] Expression of Anti-Inflammatory and Pro-Inflammatory Cytokines in Lesion Sites, and Cytokine Concentrations in Plasma and in Supernatants of Stimulated Splenocytes

[00162] Anti-inflammatory cytokine IL-10 expression detected by immunohistochemistry in the aortic lesions of mice immunized with these peptides is shown in Figure 4A. The proportion of CD4⁺ cells expressing IL-10 was >18-fold higher in mice immunized with the combined peptides compared with peptides used singly (92.4±6.1 % vs. 50.4±4.2% for C5aR- P1 ; and 38.7±2.1 % for C5aR-P2; P<0.001). This data also points to a synergistic effect. The higher IL-10 was also found for peptides used singly versus that in controls (5.1±0.2%). A significant difference in IL-10 expression was found between the two single peptides

(P=0.041) (Figure 4B).

[00163] Immunohistochemical analyses showed significantly smaller TNF-a occupied areas in the lesions of mice immunized with the combination peptides compared with peptides used singly (6.7±0.47% for C5aR-P1 +C5aR-P2 vs. 17.2±1.0% for C5aR-P1 and 14.0±1.5% for C5aR-P2). In addition, smaller TNF-a-occupied lesion areas were also found in mice receiving peptides singly compared with controls (44.5±2.4%) (Figures 4C and 4D).

Consistently, mRNA expression of cytokines in the aorta arch showed 3.8-fold, 1.3-fold and 5.1 -fold increases in the expression of IL-10 (Figures 1 1A and 11 F) for C5aR-P1 , C5aR-P2 and C5aR-P1+P2, respectively, while 6.6-fold, 2.3-fold and 16.3-fold increases in the expression of -TGF-ββ (Figure 11) for C5aR-P1 , C5aR-P2 and C5aR-P1+P2, respectively. By contrast, 2.6-fold, 4.5-fold and 4.7-fold decreases were observed in the expression of TNF-a (Figures 1 1 D and 1 1 F) and 1.1-fold, 1.4-fold and 3.0-fold deceases in the expression of IFN-Y (Figures 11 E and 11 F) for C5aR-P1 , C5aR-P2 and C5aR-P1+P2, respectively. „„

30

These results were consistent with cytokine levels measured in the plasma and in the supernatants of splenocytes.

[00164] Plasma concentrations of IL-10 (P<0.05) and TGF-β (PO.01) were increased significantly in mice immunized with either the C5aR-P1 or C5aR-P2 peptide antigens compared with controls (Figures 4E and 4F); even higher concentrations were observed in mice immunized with the combined peptides than with either alone. The difference is significant for IL-10 (P<0.05, C5aR-P1+C5aR-P2 vs. C5aR-P1) and TGF-β (P<0.05, C5aR- P1+C5aR-P2 vs. either C5aR-P1 or C5aR-P2). In contrast, plasma concentrations of the atherogenic cytokine TNF-a were reduced (P<0.05) by immunization with the two peptide antigens individually compared with that in controls, whereas a significant reduction of TNF-a was observed in mice immunized with C5aR-P1+C5aR-P2 versus controls (P<0.001) (Figure 4G). A significant difference was also shown in mice immunized with the peptides given in combination versus individually. A similar trend for the plasma concentrations of TNF-a was obtained for peptides used singly or in combination in respect of the plasma levels of IFN-γ (Figure 4H). Although no statistically significant difference was found between mice immunized with C5aR-P2 and C5aR-P1+C5aR-P2 (P=0.156) in plasma levels of IFN-γ, a significant difference was found between mice immunized with C5aR-P1 and C5aR- P1+C5aR-P2 (P=0.039)(Figure 4H).

[00165] Supernatants of splenocytes from mice immunized with these peptide antigens used either alone or in combination showed significantly increased secretions of IL-10 (Figure 4I) and TGF-β (Figure 4J), when stimulated with 10 or 100 μg/mL of ConA (P<0.05-0.001). The secretion of IL-10 in C5aR-P1+C5aR-P2-immunized mice was significantly higher than for C5aR-P2 used alone. In contrast, decreased secretion of TNF-a (Figure 4K) and IFN-γ (Figure 4L) was found in supernatants of splenocytes in mice immunized with these two peptide used either singly or in combination (P<0.01-0.001) when compared with controls. Again, a significantly greater decrease in the secretion of IFN-γ was observed in mice immunized with peptides used in combination versus singly (Figure 4K; P<0.05-0.01), but this was not the case in the secretion of TNF-a, which showed no difference between peptides used either alone or in combination.

[00166] Evaluation of Specific Cellular Immune Response

[00167] CD4⁺ T-cells from mice immunized with the peptide antigens were incubated with the corresponding immunizing antigens at 0-10 μΜ/L and a dose-dependent significant increase in proliferative response was shown between 0.1 and 1 μΜ/L (Figure 5). CD4⁺ T-cell proliferative responses were observed from antigen-immunized mice incubated with the corresponding immunizing antigen and the response was specific (Figures 5C-5D) compared with those incubated with PBS in which the responses were smaller and nonspecific (Figures 5A-5B).

[00168] Evaluation of Monocyte Differentiation into Macrophages

[00169] Differentiation of monocytes into macrophages is an important part of plaque development. Mouse (C57BL/6) PBMCs were stimulated with granulocyte-macrophage colony-stimulating factor in the presence or absence of C5a or C5a antisera/C5aR peptide antisera. After 3 days, the expression of cell-surface markers CD206 (macrophage marker) and F4/80 (monocyte/macrophage marker) was assessed. C5a induced monocyte differentiation into macrophages when compared with fresh cells or non-stimulated cells or dendroaspin (unrelated protein), in which little differentiation was observed. In addition, fewer macrophages were observed in mice immunized with C5aR-P1 compared to mice immunized with KLH only (control). These results indicate that monocyte differentiation into macrophages was inhibited by immunization with C5aR-P1 , as assessed in vitro where PBMC differentiation induced by C5a was abolished by incubation with the antisera of either C5a or C5aR-peptide (Figure 6A and 6B). Similarly, spleen cells from peptide-immunized mice resulted in a considerable decrease in CD206 (macrophage marker) expression when compared with that from control mice (Figure 6C and 6D).

[00170] In this invention, we investigated whether immunizing Apob^tm2S9yLdlr^{tm1 Her J} mice with two peptides derived from C5aR had an effect on atherosclerotic lesions when the mice were fed a high-fat diet. Their combination showed a synergistic effect on atherosclerotic lesion reduction, indicating that the N-terminus of C5aR aa sequence (1-35) is immunogenic and is involved in lesion reduction through immunization in this mouse model.

[00171] The first investigation was to whether C5a or C5aR are present in the

atherosclerotic lesion sites. Both were found to be involved at the lesion site, with

approximately the same levels in both experimental and control groups. These findings suggest that C5a and C5aR are associated with lesion development through a different mechanism in ApoB or human HSP60 peptide-immunizaion towards lesion reduction. In addition, co-localization of C5a with C5aR showed an almost equal amount of C5a and C5aR, suggesting their interaction may play a role in lesion formation.

[00172] Experiments were conducted to characterize the effect of immunization with two peptides, either individually or in combination, on the development of atherosclerotic lesions. The results from our study show that immunization induced an lgG1-isotype specific to each antigen peptide, alone or in combination, when an individual peptide was used as an ELISA antigen. Interestingly, the peptide-induced immune response was associated with an antiatherogenic effect, detected as a significant reduction in the size of the atheromatous lesion area. [00173] The study data demonstrate that immunization influences cellular infiltration into atherosclerotic lesions, as increased concentrations of macrophages, activated CD4⁺ T cells, and dendritic cells (markers of early lesion formation) were observed. Low numbers of macrophages, CD4⁺ T-cells, and CD1 1 c⁺ cells, and high numbers of Treg cells were observed in mice immunized with these peptides.

[00174] TNF-a and I FN-γ activate other cells in the vasculature, thus orchestrating an inflammatory response to atherogenesis. Based on the cytokine profiles from either plasma or spleen cells in immunized mice, TN F-a and IFN-γ secretion may well be linked to the ability of the immune animals to release these cytokines from pre-primed cells, leading to a decrease in the need to synthesize significant amounts of new TNF-a and IFN-γ. Our results show that vaccination with peptides promoted a major shift away from pro-inflammatory cytokines (i.e. TN F-a and IFN-γ) towards anti-inflammatory cytokines (I L-10 and TGF-β), which is evident not only in the plaque but also systemically. These results strongly suggest that an anti-inflammatory response is responsible for the observed reduction in plaque size.

[00175] The CD4⁺ T-cell-specific proliferative response in the C5aR peptide-immunized mice indicated that a cellular immune response was involved in the reduction of atherosclerotic lesion size. The mechanism of this reduction may be due to C5aR-peptide immunization blocking monocyte differentiation into macrophages through regulation of the C5aR/C5a interaction. This suppressing monocyte differentiation does not affect C5a expression.

[00176] Our present study highlights the effect of immunization of C5aR peptide epitopes on reduction of atherosclerotic lesion through blocking monocyte differentiation into

macrophages as well as strong cellular responses showing increased atheroprotective cytokines and Foxp3 Treg content.

[00177] Materials and Methods

[00178] Animal experiments

[00179] Female Apob^tm2S9yLdlr^{tm1 Her J} mice (The Jackson Laboratory, Maine, USA) were used, with a total of 4 groups (3 sample groups and 1 control group), each comprising 8-10 mice (5-6-weeks' old) with similar body weights. For antigen injection, the repetitive immunization multiple sites strategy (RIMMS) was adopted [1 ,2]. Mice were inoculated 5 times at 2-3-day intervals. At each immunization mice received 20- g of KLH-conjugated peptide. Group 1 received KLH-C5aR-P1 (peptide 1), group 2 received KLH-C5aR-P2 (peptide 2), group 3 received a combination of KLH-C5aR-P1 and KLH-C5aR-P2, and group 4 (control) was injected with KLH (20 g). Peptides were synthesized and conjugated to KLH by Severn Biotech Ltd, UK. Two weeks after the first antigen injection (RIMMS), sera were collected for ELISA test.

[00180] Antibody Response Measurement [00181] Blood samples were collected in heparinized capillaries by retro-orbital bleeding at week 2, and 12 weeks after the first injection of the antigens to test antibody production. The free C5aR-P1 and C5aR-P1 containing an N-terminal cysteine (synthesized by Severn Biotech Ltd, Worcestershire, UK) were used in ELISA as antigens. Maleimide-activated 96- well plates (Pierce, Thermo Fisher Scientific Inc., Hampshire, UK) were coated with these peptides individually and peptide-specific IgG was measured in the plasma of immunized mice according to the manufacturer's instructions. Horseradish peroxidase-conjugated a- mouse IgG (Jackson ImmunoResearch Laboratories, Inc. West Grove, PA, USA) was used as a secondary antibody. A 1 : 1250 and 1 :6250 dilution of plasma samples was made before assaying for peptide-specific lgG1. Similarly, HRP-conjugated mouse lgG2c was also measured at 1 :50 and 1 :250 dilution of plasma samples.

[00182] Tissue Preparation

[00183] Comprehensive quantification of atherosclerosis was performed in

Apob^tm2S9yLdlr^{tm1 Her J} mice as follows: 12 weeks after the first immunization, tissues were harvested and mounted in optimal cutting temperature (OCT) for immunohistochemical analyses or paraffin for lesion measurement. The OCT-embedded samples were frozen in the mounting medium (OCT compound, Tissue-Tek, Sakura Finetek, Europe) from which 5- μηι thick sequential sections were taken using a Reichert-Jung Cryocut 1800 (Leica). The paraffin-embedded sections were prepared using a Leica Jung RM2055 microtome.

[00184] Morphometric analyses and quantitative measurements of atherosclerosis.

[00185] Slides were stained with hematoxylin and eosin and elastin/van Gieson (Sigma) for histological evaluation using an Olympus U-ULH optical microscope (Olympus Optical Co. Ltd, Tokyo, Japan). Image-Pro Plus TM software version 4.0 (Media Cybernetics, Silver Spring, USA) was used to trace the external elastic lamina, internal elastic lamina, and lumen in the aortic root area to ascertain the area of atherosclerotic lesions. The total aortic root area and lesion area were measured following which the ratio of total lesion area/total aortic root area was calculated and expressed as percentage of lesion in the aortic root area.

[00186] Immunohistochemical Analyses

[00187] Hearts with proximal aortas embedded in OCT were sectioned and fixed in methanol. Consecutive tissue sections were incubated in 0.2% TritonX-100/phosphate- buffered saline (PBS) for 1 hour then blocked with 1 % bovine serum albumin (BSA) for 1 hour. The samples were stained with either purified hamster anti-mouse CD11 c

(eBioscience, Ltd., Hatfield, UK) or rat anti-mouse CD4 (BD Biosciences, Oxford, UK), CD68, Foxp3, or TNF-a (BioLegend, San Diego, CA, USA) at 4°C overnight, washed in PBS and incubated with rabbit anti-rat IgG-fluorescein isothiocyanate (FITC) or goat anti-mouse IgG- tetramethylrhodamine-5-(and-6)-isothiocyanate (TRITC) (Sigma-Aldrich Company Ltd.

Dorset, UK). For IL-10 and for Foxp3 (BD Biosciences, UK), FITC-conjugated rat anti-mouse CD4 mAb and phycoerythrin PE)-labelled anti-mouse IL-10 and Foxp3 (BioLegend, San Diego, CA, USA) were used. All slides were counterstained with mounting medium containing 4, 6-diamino-2-phenylindole (DAPI) (Vector Laboratories Inc., Peterborough, UK). Bright-field images were captured, scanned, and overlaid using an Axiovert S100 TV immunofluorescence microscope (Zeiss, Welwyn Garden City, UK) equipped with Plan- NEOFLUAR objectives and a KTL/CCD-1300/Y/HS camera (Princeton Instruments,

Buckinghamshire, UK). Image-Pro Plus TM software version 4.0 was used to determine lesion area. The content of CD4⁺ T-lymphocytes, CD68⁺ macrophages, CD11 c⁺, and foxp3⁺ cells within the lesion were measured with a microscope using a magnification of 800X and averaged in m². Six sections from each animal (six animals from each group) were investigated.

[00188] Measurement of Pro- and Anti-Inflammatory Cytokines

[00189] Concentrations of murine cytokines IL-10, TGF-β, TNF-a, and IFN-y were measured in plasma using ELISA kits following the manufacturer's instructions (R&D systems,

Abingdon, UK). IL-10 and TNF-a levels in the lesions were quantified by

immunohistochemical analyses and the ratio of IL-10 and TNF-a positive area/total lesion area, respectively, was measured and calculated by using Image-Pro Plus TM, version 4.0.

[00190] Cytokine Production by Splenocytes After In Vitro Stimulation with ConA

[00191] Spleens were homogenized and the cells recovered suspended in RPMI (denotes: Roswell Park Memorial Institute) 1640 complete medium supplemented with 10% foetal calf serum (FCS)|[SR1 ], 100 U/mL penicillin, and 100 μg/mL streptomycin. The cells were cultured for 48 h at 37°C in a humidified 5% C0₂ incubator at a density of 1 * 10⁶ cells/0.1 mL medium/well of the 96-well plate with a serial dilution of ConA (Sigma, Dorset, UK). Cytokine (IL-10, TGF-β, TNF-a, and IFN-γ) concentrations in the supernatant of stimulated spleen cells were tested using ELISA kits (R&D systems, Abingdon, UK) according to the manufacturer's instructions.

[00192] CD4⁺ T-Cell Proliferation Assay

[00193] CD4⁺ T cells were purified from spleen cells of Apob^tm2S9yLdlr^{tm1 Her J} mice immunized with peptide antigens by using the magnetic-activated cell sorting CD4⁺ T Cell Isolation Kit (Miltenyi Biotec, Surrey, UK) and were used as responder cells. Constructs as antigens and γ-irradiated (30 Gy) spleen cells from PBS-treated Apob^tm2S9yLdlr^{tm1 Her J} mice were used for stimulation. CD4⁺ T cells (3x10⁵/well) were stimulated with γ-irradiated spleen cells

(2x10⁵/well) in the presence or absence of antigens (0.5 M) for 72 h at 37°C in a 10% C0₂, 90% air-humidified incubator. Control cultures included responder cells alone in medium and responder cells with 5 μg/ml of ConA (Sigma). Eighteen hours before harvesting, 0.5 μθϊ of methyl-[³H]-thymidine (Amersham Biosciences, Amersham, UK)/well were added to the cultures for the final 6 h. The cells were harvested and incorporated radioactivity was measured using a Micro 96 harvester (Skatron Instruments, Lier, Norway) and liquid scintillation counter (1205 BetaplateTM, Turku, Finland).

[00194] Peripheral Blood Mononuclear Cell (PBMC) Isolation From C57BL/6

Background Mice

[00195] Blood taken from C57/B6 background mice was diluted with PBS (1 :4 dilution) and slowly added into pre-prepared histopaque solution (1 :1 v/v) in a centrifuge tube, followed by centrifuged (2000rpm) at room temperature for 20 minutes to collect monocytes.

[00196] Fluorescence Activated Cell Sorting (FACS) Analysis

[00197] Spleen cells from the mice (C57/B6 back ground) were determined by FACS analysis. Briefly, 3* 10⁵ cells were incubated at 4°C for 30 min with appropriate dilutions of directly labeled monoclonal antibodies (allophycocyanin-anti-mouse CD206 antibody;

BioLegend, Cambridge, UK) and FITC-anti-mouse F4/80 antibody (eBioscience, Hatfield, UK). After 2 washing steps with 0.02% BSA/PBS (pH 7.3), fluorescence was analyzed on a FACS (Cytomics FC500; Bachman coulter, High Wycombe, UK). Six mice were used in each experimental group. These experiments were repeated 3 times.

[00198] Statistical Analyses

[00199] Data are reported as meanistandard error of the mean (±SEM), unless stated otherwise. Analysis was performed using graph-pad Prism 5.01 and Sigma plot 9.0.

Differences between 2 groups of mice were analyzed by Student's f-test and are expressed as meaniSEM or by the Mann-Whitney test (for non-parametric data). For experiments with ≥3 groups, analysis of variance (ANOVA) with the Tukey multiple comparison post-test was used. A value of P<0.05 was considered statistically significant. Statistical analyses were conducted using one-way ANOVA for multiple comparisons. Comparisons between groups were performed using used Student's f-test (2-tailed analyses); *P<0.05; **P <0.01 ; ***P <0.001 were considered statistically significant.

[00200] References

1. Ippel JH, de Haas CJ, Bunschoten A, van Strijp JA, Kruijtzer JA, Liskamp RM, Kemmink J. Structure of the tyrosine-sulfated C5a receptor N terminus in complex with chemotaxis inhibitory protein of Staphylococcus aureus. J Biol Chem. 2009;284:12363-12372.

2. Heller T, Hennecke M, Baumann U, Gessner JE, zu Vilsendorf AM, Baensch M, Boulay F, Kola A, Klos A, Bautsch W, Kohl J. Selection of a C5a receptor antagonist from phage _

36 libraries attenuating the inflammatory response in immune complex disease and

ischemia/reperfusion injury. J Immunol. 1999; 163:985-994.

3. Gerard NP, Gerard C. The chemotactic receptor for human C5a anaphylatoxin. Nature. 1991 ;349:614-617.

4. Boulay F, Mery L, Tardif M, Brouchon L, Vignais P. Expression cloning of a receptor for C5a anaphylatoxin on differentiated HL-60 cells. Biochemistry. 1991 ;30:2993-2999.

5. Wright AJ, Higginbottom A, Philippe D, Upadhyay A, Bagby S, Read RC, Monk PN, Partridge LJ. Characterisation of receptor binding by the chemotaxis inhibitory protein of Staphylococcus aureus and the effects of the host immune response. Mol Immunol.

2007;44:2507-2517.

6. Nikiforovich GV, Marshall GR, Baranski TJ. Simplified modeling approach suggests structural mechanisms for constitutive activation of the C5a receptor. Proteins. 2010;79:787- 802.

7. Haskard DO, Boyle JJ, Mason JC. The role of complement in atherosclerosis. Curr Opin Lipidol. 2008; 19:478^182.

8. Meuwissen M, van der Wal AC, Niessen HW, Koch KT, de Winter RJ, van der Loos CM, Rittersma SZ, Chamuleau SA, Tijssen JG, Becker AE, Piek JJ. M. Meuwissen, A. van der Wal, H. Niessen, K. Koch, R. de Winter, C. van der Loos, S. Rittersma, S. Chamuleau, J. Tijssen, A. Becker and J. Piek. Colocalisation of intraplaque C reactive protein, complement, oxidised low density lipoprotein, and macrophages in stable and unstable angina and acute myocardial infarction. J Clin Pathol. 2006;59:196-201.

9. Glass CK, Witztum JL. Atherosclerosis, the road ahead. Cell. 2001 ; 104:503-516.

Claims

1. A nucleic acid selected from (i) and (ii):

(i) (a) a nucleic acid with at least 75% sequence identity to SEQ ID NO 1 ;

(b) a nucleic acid comprising a sequence as set forth in SEQ ID NO 1 ;

(e) a nucleic acid encoding a first fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) wherein the encoded fragment is less than 40 amino acids in length; and

(f) a fragment of (a), (b), (c), (d) or (e), wherein the fragment encodes a peptide having anti-atherogenic and/or anti-inflammatory activity,

(ii) (a) a nucleic acid with at least 75% sequence identity to SEQ ID NO 3;

(b) a nucleic acid comprising a sequence as set forth in SEQ ID NO 3;

(c) a nucleic acid which hybridises to SEQ ID NO 3 (under conditions of high stringency);

(d) a nucleic acid which differs from (a), (b) and (c) by virtue of degeneracy of the genetic code,

(e) a nucleic acid encoding a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) wherein the encoded fragment is less than 40 amino acids in length, wherein the second fragment is of a different sequence as compared to the first fragment; and

(f) a fragment of (a), (b), (c), (d) or (e), wherein the fragment encodes a peptide having anti-atherogenic and/or anti-inflammatory activity, wherein the nucleic acid is for use in combination therapy with the other of (i) and (ii).

2. A nucleic acid of claim 1 , wherein the nucleic acid of clause (i) has a percentage identity to SEQ ID NO: 1 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

3. A nucleic acid of claim 1 , wherein the nucleic acid of clause (ii) has a percentage identity to SEQ ID NO:3 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

4. A nucleic acid any one of claims 1 to 3, wherein the nucleic acid selected from clauses (i) and (ii) is for simultaneous, sequential or separate use in combination therapy with a nucleic acid selected from the other of clauses (i) and (ii).

5. The nucleic acid of claim 4, wherein the combination therapy is for use in treating and/or preventing diseases selected from autoimmune diseases and inflammatory diseases.

6. The nucleic acid of claim 4 or claim 5, wherein the combination therapy is for use in treating and/or preventing a disease selected from: rheumatoid arthritis;

atherosclerosis; diabetes; and lupus.

7. A peptide selected from (i) and (ii):

(i) (a) a peptide with at least 75% sequence identity to SEQ ID. NO. 2;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO. 2;

(c) a peptide encoded by the nucleic acid of claim 1 or claim 2;

(ii) (a) a peptide with at least 75% sequence identity to SEQ ID. NO. 4;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO. 4;

(c) a peptide encoded by the nucleic acid of claim 3 or claim 4;

(d) a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) for use in therapy, wherein the second fragment is less than 40 amino acids in length, and wherein the second fragment is of a different amino acid sequence as compared to the first fragment;

8. The peptide of claim 7, wherein the peptide selected from clauses (i) and (ii) may be used simultaneously, sequentially or separately in combination therapy with the peptide selected from the other of clauses (i) and (ii).

9. The peptide of claim 8, wherein the combination therapy is for use in treating and/or preventing diseases selected from autoimmune diseases and inflammatory diseases.

10. The peptide of claim 9, wherein the disease is selected from the group consisting of rheumatoid arthritis, atherosclerosis, diabetes and lupus.

11. A pharmaceutical composition comprising a peptide selected from:

a peptide from claim 7, clause (i) in combination with a peptide from claim 7, clause (ii).

12. The composition of claim 1 1 for use in therapy.

13. The composition of claim 1 1 or claim 12, for use in treating and/or preventing

diseases selected from autoimmune diseases and inflammatory diseases.

14. The composition of claim 13, wherein the disease is selected from the group

consisting of rheumatoid arthritis, atherosclerosis, diabetes and lupus.

15. A fusion protein comprising (i) and (ii):

(i) a peptide encoded by the nucleic acid of anyone of claims 1 to 6 or the peptide of any one of claims 7 to 14; and

(ii) a peptide selected from:

(a) an antibody;

(b) an antibody fragment;

(c) a soluble-peptide;

(d) a cell-permeable peptide;

(e) a hapten.

16. A method of treating and/or preventing a disease selected from autoimmune

diseases and/or an inflammatory diseases comprising administering to a subject a peptide selected from:

(i) (a) a peptide with at least 75% sequence identity to SEQ ID. NO. 2;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO.

2;

(c) a peptide encoded by the nucleic acid of claim 1 or claim 2; (d) a first fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) for use in therapy, wherein the fragment is less than 40 amino acids in length;

(ii) (f) a peptide with at least 75% sequence identity to SEQ ID. NO. 4;

(g) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO.

4;

(h) a peptide encoded by the nucleic acid of claim 3 or claim 4;

(i) a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) for use in therapy, wherein the second fragment is less than 40 amino acids in length and wherein the second fragment is of a different sequence to the first fragment;

(iii) (k) a peptide selected from clauses (i) and (ii) either sequentially,

simultaneously or separately with another peptide selected from the other of clauses (i) and (ii).

17. The method of claim 16 where in the disease is selected from: rheumatoid arthritis; atherosclerosis; diabetes; and lupus.

18. A product comprising a protein selected from clause (i) of claim 16 in combination with a peptide selected from clause (ii) of claim 16.

19. A nucleic acid selected from a group consisting of:

(a) a nucleic acid with at least 75% sequence identity to SEQ ID NO 1 ;

(b) a nucleic acid comprising a sequence as set forth in SEQ ID NO 1 ;

(e) a nucleic acid encoding a first fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) wherein the encoded fragment is less than 40 amino acids in length; and (f) a fragment of (a), (b), (c), (d) or (e), wherein the fragment encodes a peptide which has anti-atherogenic and/or anti-inflammatory activity.

20. A nucleic acid of claim 19, wherein the nucleic acid has a percentage identity to SEQ ID NO: 1 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

21. A nucleic acid selected from a group consisting of:

(a) a nucleic acid with at least 75% sequence identity to SEQ ID NO 3;

(b) a nucleic acid comprising a sequence as set forth in SEQ ID NO 3;

(d) a nucleic acid which differs from (a) and (b) by virtue of degeneracy of the genetic code

(e) a nucleic acid encoding a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR), wherein the encoded fragment is less than 40 amino acids in length; and

22. A nucleic acid of claim 21 , wherein the nucleic acid has a percentage identity to SEQ ID NO:3 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

23. The nucleic acid of any one of claims 19 to 22, wherein the N-terminal region of C5aR consists of nucleotides 1-120 of human C5aR.

24. The nucleic acid of any one of claims 19 to 23, for use in therapy.

25. The nucleic acid of any one of claims 19 to 24 for use in treating and/or preventing diseases selected from autoimmune disease and inflammatory disease.

26. The nucleic acid of any one of claims 19 to 25 for use in treating and/or preventing a disease selected from: rheumatoid arthritis; atherosclerosis; diabetes; and lupus.

27. A peptide selected from: (a) a peptide with at least 75% sequence identity to SEQ ID. NO. 2;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO. 2;

(c) a peptide encoded by the nucleic acid of claim 1 or claim 2;

(d) a first fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) for use in therapy, wherein the N-terminal region is less than 40 amino acids in length;

28. The peptide of claim 27, wherein the peptide has a percentage identity to SEQ ID NO:2 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

29. A peptide selected from:

(a) a peptide with at least 75% sequence identity to SEQ ID. NO. 4;

(b) a peptide comprising an amino acid sequence as set forth in SEQ ID. NO. 4;

(c) a peptide encoded by the nucleic acid of claim 3 or claim 4;

(d) a second fragment of an extracellular N-terminal region of a complement component 5 receptor (C5aR) for use in therapy, wherein the N-terminal region is less than 40 amino acids in length;

30. The peptide of claim 29, wherein the peptide has a percentage identity to SEQ ID NO:4 of at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94% or at least 95%.

31. The peptide of any one of claims 27 to 30, wherein the N-terminal region of C5aR consists of residues 1-40 of human C5aR.

32. The peptide of any one of claims 27 to 30, wherein the C5aR is a human C5aR, a mouse C5aR, a rat C5aR, a rabbit C5aR, a dog C5aR, a horse C5aR, a cat C5aR or a monkey C5aR.

33. The peptide of any one of claims 27 to 32, wherein the peptide is less than 40 amino acids in length, e.g. wherein the peptide is less than 30, 25, 22, 18 or 14 amino acids in length.

34. The peptide of any one of claims 27 to 32, wherein the peptide is more than 6 amino acids in length, e.g. wherein the peptide is more than 8, 10, 16 or 20 amino acids in length.

35. The peptide of any one of claims 27 to 32, wherein the peptide is between 8 and 40 amino acids in length, e.g. between 12 and 20 amino acids in length inclusive.

36. The peptide of any one of claims 27 to 35, for use in therapy.

37. The peptide of any one of claims 27 to 35, for use in treating and/or preventing

diseases selected from autoimmune diseases and inflammatory diseases.

38. The peptide of any one of claims 15 to 23, for use in treating and/or preventing a disease selected from: rheumatoid arthritis; atherosclerosis; diabetes; and lupus.

39. A peptide consisting of any contiguous sub-sequence of 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34,35, 36, 37, 38, 39 or 40 amino acids of a peptide of any one of claims 15 to 26.

40. A peptide of the sequence: J¹-YDDKDTLD (SEQ ID NO: 5) wherein:

J¹ is any contiguous sequence of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12 or 13 amino acids comprised in sequence MNSFNYTTPDYGH (SEQ ID NO:6), said contiguous sequence including the C-terminal H residue of SEQ ID NO:6.

41. A peptide of claim 40 wherein J¹ comprises at least 2 amino acids.

42. A peptide of claim 40 wherein J¹ comprises at least 4 amino acids

43. A peptide of the sequence:

J²-TPVDKTSN (SEQ ID NO:7) wherein: J² is any contiguous sequence of 1 , 2, 3, 4 or 5 amino acids comprised in sequence TLDLN (SEQ ID NO:8) said contiguous sequence including the C-terminal N residue of SEQ ID NO:9;

44. A peptide of claim 43 wherein J² comprises at least 2 amino acids.

45. A peptide of claim 43 wherein J² comprises at least 3 amino acids.

46. The peptide of any one of claims 40 to 45, wherein the peptide has anti-atherogenic or anti-inflammatory activity.

47. The peptide of any one of claims 40 to 46, wherein the N-terminal group is protected and/or the C-terminal carboxy group is protected, activated or coupled to a solid phase

48. The use of a peptide of any one of claims 40 to 47 in the synthesis of a peptide of any one of claims 27 to 38.