WO2013155085A1 - Methods and biomarkers for osteoporosis - Google Patents

Abstract

The present invention relates to methods of diagnosing and treating low bone mineral density in a subject. An exemplary method comprises isolating monocytes from a biological sample from the subject, processing the monocytes in vitro to determine the level of miR-133a in the monocytes, and diagnosing low bone mineral density in the subject by comparing the level of miR-133a in the monocytes from the subject with a reference level of miR-133a in monocytes.

Description

METHODS AND BIOMARKERS FOR OSTEOPOROSIS

GOVERNMENTAL RIGHTS

[0001] This invention was made with government support under Grant No. R01AR04054496-02S1 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.

FIELD OF THE INVENTION

[0002] The present invention relates to methods of diagnosing low bone mineral density in a subject, and methods of treating low bone mineral density.

BACKGROUND OF THE INVENTION

[0003] Osteoporosis is a major public health problem and is mainly characterized by low bone mineral density (BMD). About 10 million Americans have osteoporosis, and about 34 million are at risk for the disease. Individuals with osteoporosis have weak bones that can break from a minor fall or, in serious cases, even from simple actions, like sneezing or bumping into furniture. Fractures of the legs and pelvis due to falls are a significant public health problem, especially in elderly women, leading to high medical costs, inability to live independently, and even risk of death. Estimates suggest that about half of all women older than 50, and up to one in four men, will break a bone because of osteoporosis. Osteoporosis is responsible for two million broken bones and $19 billion in related costs every year. By 2025, experts predict that osteoporosis will be responsible for approximately three million fractures and $25.3 billion in costs each year. In addition, twenty percent of seniors who break a hip die within one year from problems related to the broken bone itself or surgery to repair it. Many of those who survive need long-term nursing home care. Osteoporosis can also affect posture, causing a person to become stooped or hunched.

[0004] As with all ailments, early detection of risk of the condition could lead to better prevention and treatment of the disease. Guidelines exist to identify high-risk older women by using bone mass density (BMD) screening. However, large and expensive equipment is required for accurately determining the risk of osteoporosis, and may not always be available.

[0005] Accordingly, a need exists for effective and simple clinical methods to diagnose low bone density in an aging population. Such a test would also be effective at diagnosing high-risk patients who should receive further testing, and patients for whom further testing can be avoided.

REFERENCE TO COLOR FIGURES

[0006] The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.

BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1 depicts flow cytometry analysis of isolated monocytes.

[0008] FIG. 2 graphically depicts expression levels (2^~ΔΔ0Τ) of significant miRNAs measured by array analysis in circulating monocytes in the low and high BMD groups (^**: P<0.01 ; ^*: P<0.05).

[0009] FIG. 3 graphically depicts expression levels (2^~ΔΔ0Τ) of miR-133a and miR-382 measured by qRT-PCR analysis in circulating monocytes in the low and high BMD groups (^*: P<0.05).

[0010] FIG. 4 graphically depicts expression levels (2^"ΔΔ0Τ) of CXCL1 1 , CXCR3, and SLC39A1 mRNAs measured by qRT-PCR analysis in circulating

monocytes in the low and high BMD groups.

[001 1 ] FIG. 5 graphically depicts principle component analysis (PCA) of the expression levels of the three potential target genes measured by qRT-PCR in the 10 high and 10 low BMD subjects.

[0012] FIG. 6 graphically depicts induction and inhibition of osteoclast differentiation in THP-1 cells using miR-133a agents. (A) Induction and inhibition of osteoclast differentiation in THP-1 cells three days after treatment. (B) Induction and inhibition of osteoclast differentiation in THP-1 cells six days after treatment. ^* P<0.05, ^** P<0.01 , ^*** P<0.001 . SUMMARY OF THE INVENTION

[0013] One aspect of the invention encompasses a method of diagnosing low bone mineral density in a subject. The method comprises isolating monocytes from a biological sample from the subject, processing the monocytes in vitro to determine the level of miR-133a in the monocytes, and diagnosing low bone mineral density in the subject by comparing the level of miR-133a in the monocytes from the subject with a reference level of miR-133a in monocytes.

[0014] Another aspect of the invention encompasses a method of determining the status of bone mineral density in a subject. The method comprises isolating monocytes from a biological sample from the subject, processing the monocytes in vitro to determine the level of miR-133a in the monocytes, and

determining the status of bone mineral density in the subject by comparing the level of miR-133a in the monocytes from the subject with a reference level of miR-133a in monocytes.

[0015] Yet another aspect of the invention encompasses a method of diagnosing osteoporosis in a subject. The method comprises isolating monocytes from a biological sample from the subject, processing the monocytes in vitro to determine the level of miR-133a in the monocytes, and diagnosing osteoporosis in the subject by comparing the level of miR-133a in the monocytes from the subject with a reference level of miR-133a in monocytes.

[0016] Another aspect of the invention encompasses a method of determining the risk of bone fracture in a subject. The method comprises isolating monocytes from a biological sample from the subject, processing the monocytes in vitro to determine the level of miR-133a in the monocytes, and determining the risk of bone fracture in the subject by comparing the level of miR-133a in the monocytes from the subject with a reference level of miR-133a in monocytes.

[0017] An additional aspect of the invention encompasses a method of treating or preventing loss of bone mineral density. The method comprises

administering to a subject having low bone mineral density, or at risk of developing low bone mineral density a therapeutically effective amount of a composition comprising a miR-133a agent that decreases the expression of miR-133a in monocytes in the subject.

[0018] Other features and aspects of the invention are described in more detail herein.

DETAILED DESCRIPTION

[0019] The present disclosure provides a method of diagnosing bone mineral density (BMD) in a subject. Bone mineral density generally decreases with age as a result of dysfunctional bone remodeling. Bone remodeling is a lifelong process where mature bone tissue is removed from the skeleton (bone resorption), and new bone tissue is formed (ossification or new bone formation). These processes also control the reshaping or replacement of bone following injuries like fractures, and micro- damage which occurs during normal activity. An imbalance in the regulation of bone resorption and bone formation results in bone mineral density disorders, including low bone density and osteoporosis.

[0020] The cells responsible for bone metabolism are osteoblasts and osteoclasts. Osteoblasts secrete new bone, and osteoclasts remove bone. Osteoblasts are specialized fibroblasts that in addition to fibroblastic products, express bone sialoprotein and osteocalcin. Osteoclasts are formed from the fusion of monocytes and are characterized by their large size, the presence of multiple nuclei, and positive staining for tartrate-resistant acid phosphatase (TRAP).

[0021 ] It was discovered that the level of miRNA biomarkers in monocytes of individuals with low bone density are significantly different from the levels of miRNA biomarkers in monocytes of individuals with high bone density. As such, the level of miRNA biomarkers in monocytes in an individual may be used to diagnose bone density in the individual. Diagnosis of bone mineral density in a subject using a method as described herein may improve patient outcome by identifying subjects who have low bone mineral density or individuals at risk of developing low bone mineral density.

Advantageously, such a method may allow a physician to determine the severity of a bone density disorder in a subject and to make appropriate, informed, and timely treatment decisions based on this information. [0022] The present disclosure also provides methods of prognosis of low bone mineral density in a subject, a method of diagnosing osteoporosis in a subject, determining the status of bone mineral density in a subject, determining the risk of bone fracture in a subject, and a method of treating a bone density disorder in a subject.

[0023] Other features and aspects of the invention are described in more detail herein.

I. Diagnosing low bone mineral density

[0024] One aspect of the present invention provides a method of diagnosing low bone mineral density in a subject. The method comprises determining the level of miRNA biomarkers in monocytes in the subject, and comparing the level of miRNA biomarkers in monocytes in the subject to a reference level of miRNA biomarkers in monocytes.

(a) miRNA biomarkers

[0025] The methods described herein comprise determining the expression levels of one or more miRNA biomarkers in monocytes. Diagnostic miRNAs may include any miRNA expressed in monocytes, which has been identified as having a level of expression correlated with altered bone density. In preferred embodiments, a diagnostic miRNA biomarker of the invention is miR133a.

[0026] As used herein, the term "miRNA" refers to a small non-coding RNA molecule which functions in transcriptional and post-transcriptional regulation of gene expression. A miRNA functions via base-pairing with complementary sequences within mRNA molecules, usually resulting in gene silencing via translational repression or target degradation. A mature miRNA is processed through a series of steps from a larger primary RNA transcript (pri-miRNA), or from an intron comprising a miRNA (mirtron), to generate a stem loop pre-miRNA structure comprising the miRNA sequence. A pre-miRNA is then cleaved to generate the mature miRNA. As such, a miRNA of the invention may be a pri-miRNA, a pre-miRNA, or a mature miRNA. A miRNA may also be a mirtron miRNA. [0027] As such, miR-133a may be a pri-miRNA comprising miR-133a, a mirtron comprising miR-133a, a pre-miRNA comprising miR-133a, or a mature miR- 133a. In some embodiments, miR-133a is a pri-miRNA comprising miR-133a. In other embodiments, miR-133a is a pre-miRNA comprising miR-133a. In yet other

embodiments, miR-133a is a mirtron comprising miR-133a. In other embodiments, miR- 133a is a mature miR-133a.

[0028] In humans, miR-133a is encoded by MIR133A1 , and MIR133A2. In some embodiments, miR-133a is encoded by MIR133A1 . In other embodiments, miR- 133a is encoded by MIR133A2.

(b) bone mineral density

[0029] As used herein, the terms "bone mineral density", "BMD", or "bone density" refer to the amount of mineral matter per square centimeter of bones. Bone density is used in clinical medicine as an indirect indicator of osteoporosis. In addition, there is a statistical association between poor bone density and higher probability of fracture (Cranney et al., 2007 CMAJ 177:575-580). Bone density measurements are used to screen individuals for osteoporosis risk and to identify those who might benefit from measures to improve bone strength.

[0030] Methods of measuring bone density are known in the art and may include densitometry techniques such as dual-energy X-ray absorptiometry (DXA or DEXA) using bone densitometers, quantitative computed tomography (QCT), qualitative ultrasound (QUS), single photon absorptiometry (SPA), dual photon absorptiometry (DPA), digital X-ray radiogrammetry (DXR), or single energy X-ray absorptiometry (SEXA).

[0031] Average bone mineral density may be measured across a bone section, and bone mineral density may be represented as bone mineral content (BMC) per width at the scanned line. Non limiting examples of bones that may be used to measure bone density include the spine, hip, and wrist. Measurements are most commonly made over the lumbar spine and over the upper part of the hip. The calculated density of these bones may then be compared with a reference BMD comprising an average BMD calculated based on age, sex, and size. The resulting comparison may be used to determine the stage of osteoporosis and the risk for fractures in an individual.

[0032] Comparison of the BMD of an individual with a reference BMD may generally be scored using a T-score, a Z-score, or a combination thereof. T- or Z-scores indicate the amount that the bone mineral density of an individual varies from the mean.

[0033] A T-score is the number of standard deviations above or below the mean for a healthy 30 year old adult of the same sex and ethnicity as the patient. A T- score of -1 .0 or higher, may indicate a normal bone density and a low risk of bone fracture. A T-score of -1 .0 to -2.5 may indicate osteopenia, a condition where bone mineral density is lower than normal. Osteopenia is considered by individuals in the art to be a precursor to osteoporosis. A T-score of -2.5 or lower may indicate osteoporosis. A Z-score is the number of standard deviations above or below the mean for the patient's age, sex and ethnicity. A Z-score may be used in cases of severe

osteoporosis. In general, a negative score indicates lower bone density, and positive scores indicate higher bone density.

[0034] A method of the invention comprises diagnosing low bone mineral density in a subject by comparing the level of miR-133a in the subject, with a reference level of miR-133a in monocytes in a population of individuals with high or low bone mineral density. Low bone density may be a T-score of about -1 .0, -1 .1 , -1 .2, -1 .3, -1 .4, -1 .5, -1 .6, -1 .7, -1 .8, -1 .9, -2.0, -2.1 , -2.2, -2.3, -2.4, -2.5, -2.6, -2.7, -2.8, -2.9, or -3.0 or lower. Conversely, high bone density may be a T-score of about 0, 1 .0, 1 .1 , 1 .2, 1 .3, 1 .4, 1 .5, 1 .6, 1 .7, 1 .8, 1 .9, 2.0, 2.1 , 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 or higher.

[0035] Low bone density may also be a Z-score of about -1 .0, -1 .1 , -1 .2, - 1 .3, -1 .4, -1 .5, -1 .6, -1 .7, -1 .8, -1 .9, -2.0, -2.1 , -2.2, -2.3, -2.4, -2.5, -2.6, -2.7, -2.8, -2.9, or -3.0 or lower. Conversely, high bone density may be a Z-score of about 0, 1 .0, 1 .1 , 1 .2, 1 .3, 1 .4, 1 .5, 1 .6, 1 .7, 1 .8, 1 .9, 2.0, 2.1 , 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 or higher.

[0036] In some embodiments, low bone density is a Z-score of about -0.1 or lower. In preferred embodiments, low bone density is a Z-score of about -0.5 or lower. In even more preferred embodiments, low bone density is a Z-score of about -0.8 or lower. In exemplary embodiments, low bone density is a Z-score of about -0.84 or lower. In a particularly exemplary embodiment, low bone density is a hip or spine Z- score of about -0.84 or lower.

[0037] In some embodiments, high bone density is a Z-score of about 0.1 or higher. In preferred embodiments, high bone density is a Z-score of about 0.5 or higher. In even more preferred embodiments, high bone density is a Z-score of about 0.8 or higher. In exemplary embodiments, high bone density is a Z-score of about 0.84 or higher. In a particularly exemplary embodiment, high bone density is a hip or spine Z- score of about 0.84 or higher.

(c) subject

[0038] A method of the disclosure comprises diagnosing low bone mineral density in a subject. As used herein, "subject" may refer to a living organism having a skeletal system. In particular, subjects may include, but are not limited to, human subjects or patients and companion animals. Exemplary companion animals may include domesticated mammals (e.g., dogs, cats, horses), mammals with significant commercial value (e.g., dairy cows, beef cattle, sporting animals), mammals with significant scientific value (e.g., captive or free specimens of endangered species), or mammals which otherwise have value. Suitable subjects may also include: mice, rats, dogs, cats, ungulates such as cattle, swine, sheep, horses, and goats, lagomorphs such as rabbits and hares, other rodents, and primates such as monkeys, chimps, and apes. In preferred embodiments, a subject is a human. A subject may be any human subject of any age including newborn, adolescent, adult, middle age, or elderly.

[0039] A subject may be a human subject that has low bone mineral density. Alternatively, a subject may be a human subject at risk for developing low bone mineral density. Guidelines for classifying human subjects as being at risk for low bone density are known in the art. For instance, a subject at risk for low bone density may be an elderly female, an elderly male, or people over age 50 with previous bone fracture from trauma, rheumatoid arthritis, low body weight, or a parent with a hip fracture, individuals with vertebral abnormalities, individuals receiving, or planning to receive, long-term glucocorticoid (steroid) therapy, individuals with primary hyperparathyroidism, individuals being monitored to assess the response or efficacy of an approved osteoporosis drug therapy, or individuals with a history of eating disorders. Other considerations related to risk of low bone density and the need for a test include smoking habits, drinking habits, the long-term use of corticosteroid drugs, and a vitamin D deficiency.

[0040] A human subject may be about 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59,

60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or about 99 years of age or older. In some embodiments, a human subject is about 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, or about 60 years of age. In other embodiments, a human subject is about 60,

61 , 62, 63, 64, 65, 66, 67, 68, 69, or about 70 years of age. In yet other embodiments, a human subject is about 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, or about 80 years of age. In other embodiments, a human subject is about 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, or about 90 years of age. In additional embodiments, a human subject is about 90, 91 , 92, 93, 94, 95, 96, 97, 98, or about 99 years of age or older. In some preferred embodiments, a human subject is about 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, or about 70 years of age. In some exemplary embodiments, a subject is a postmenopausal woman.

[0041] A subject may also be a population of cells expressing miR-133a and that can be differentiated into an osteoclast. Such cells may include those in a subject as well as those removed from a subject for therapeutic treatment, cultured cells, those used in gene therapy practices, and any other cell that expresses miR-133a and that can be differentiated into an osteoclast.

(d) isolating and processing monocytes

[0042] A method of the invention comprises isolating monocytes from a biological sample. A biological sample may be obtained by freshly collecting a sample, or may be obtained from a previously collected and stored sample. For instance, a sample may be obtained from a collection of stored and preserved blood samples. In some embodiments, a sample is obtained by freshly collecting a sample. In other embodiments, a sample is obtained from a previously collected and stored sample. [0043] Suitable samples comprise any biological sample comprising monocytes. Monocytes are produced by the bone marrow from hematopoietic stem cell precursors called monoblasts. Monocytes circulate in the bloodstream for about one to three days and then typically move into tissues throughout the body. As such, a biological sample of the invention may include any tissue sample comprising

monocytes. In preferred embodiments, a biological sample is a blood sample. As used herein, "blood" refers to whole blood, plasma, or serum.

[0044] Methods of collecting a blood sample are well known in the art. In an exemplary embodiment, venipuncture, with or without a catheter, may be used to collect a blood sample. In general a blood sample is large enough to supply sufficient amounts of circulating monocytes to be processed as described further below. For instance, a blood sample may be about 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85 90, or about 95ml or more. In some embodiments, a blood sample is about 30, 35, 40, 45, or about 50ml. In other embodiments, a blood sample is about 50, 55, 60, 65, or about 70ml. In yet other embodiments, a blood sample is about 70, 75, 80, 85 90, or about 95ml or more. In one embodiment, a blood sample is about 65, 70, or about 75ml.

[0045] According to the invention, monocytes are isolated. Methods for isolation, purification, or enrichment of certain cell types such as circulating monocytes from a sample are well known in the art and are discussed in Ausubel et al., (2003) Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, or

Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, NY. One skilled in the art will know which parameters may be manipulated to optimize purification or enrichment of cells of interest. Most commonly, cells are purified or enriched using immunoaffinity to antigens expressed on the surface of the cells. In short, the sample, consisting of a mixture of cells to be separated is incubated with a solid support, usually superparamagnetic beads that facilitate later steps. The solid support is coated with antibodies against a particular surface antigen, causing the cells expressing this antigen to attach to the solid support. If the solid support is superparamagnetic beads, the cells attached to the beads

(expressing the antigen) may be separated from the sample by attraction to a strong magnetic field. The procedure may be used for positively selecting the cells expressing the antigen(s) of interest. In negative selection the antibody used is against surface antigen(s), which are known to be present on cells that are not of interest, therefore enriching the sample with the cells of interest. In some embodiments, monocytes are isolated using negative isolation as described in the examples.

[0046] Isolated monocytes are processed in vitro to determine the level of miR-133a in the monocytes. The level of miR-133a may be determined as described in Section l(e). Methods of processing a cell sample to determine the level of a nucleic acid molecule such as miR-133a are known in the art, and may depend on the method used to determine the level of the nucleic acid molecule. For instance, these techniques may be as explained in, for example, Current Protocols in Molecular Biology, Volumes I, II, and III, 1997 (F.M. Ausubel ed.); Sambrook et al., 1989, Molecular Cloning: A

Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; DNA Cloning: A Practical Approach, Volumes I and II, 1985 (D. N. Glover ed.); Immobilized Cells and Enzymes, 1986 (IRL Press); Perbal, 1984, A Practical Guide to Molecular Cloning; the series, Methods in Enzymology (Academic Press, Inc.); and Methods in Enzymology, Vol. 154 and Vol. 155 (Wu and Grossman, and Wu, eds., respectively).

(e) determining the level of miR-133a

[0047] The level of miR-133a in the monocytes is determined. Methods of determining the level of a miRNA are known and commonly used in the art. Non limiting examples of methods that may be used to determine the levels of a miRNA include cloning, northern analysis, primer extension, an array, PCR, sequencing, and

combinations thereof. In some embodiments, the levels of miRNA biomarkers are determined using cloning. For instance, miRNAs may be cloned from a sample, and the cloned miRNAs sequenced to determine expression levels of miRNAs. In other embodiments, the levels of miRNA biomarkers are determined by northern analysis. Methods of determining levels of miRNAs using northern analysis are known in the art. In yet other embodiments, the levels of miRNA biomarkers are determined by primer extension. Methods of determining expression levels of miRNAs using primer extension are known in the art. In other embodiments, the levels of miRNA biomarkers are determined by an array. Methods of determining levels of miRNAs using an array are known in the art. In still other embodiments, the levels of miRNA biomarkers are determined by sequencing. For instance, high throughput sequencing methods modified for sequencing small RNAs may be used to determine the levels of miRNAs. High throughput sequencing of miRNAs generates millions of reads from a given sample, such that the levels of miRNAs in a sample may be determined. Non limiting examples of high throughput sequencing methods that may be used to determine the levels of miRNAs include pyrosequencing, polymerase-based sequence-by-synthesis, and sequencing by ligation.

[0048] In preferred embodiments, the expression level of miR-133a is determined by amplification techniques. Non-limiting examples of amplification techniques may include polymerase chain reaction, ligase chain reaction, nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA), transcription mediated amplification (TMA), loop-mediated isothermal amplification (LAMP), Q-beta replicase, rolling circle amplification, 3SR, ramification amplification (Zhang et al., (2001 ) Molecular Diagnosis 6 p141 -150), multiplex ligation-dependent probe amplification (Schouten et al. (2002) Nucl. Ac. Res. 30 e57). A summary of many of these techniques may be found in "DNA Amplification: Current technologies and applications" (Eds. Demidov & Broude (2004) Pub. Horizon Bioscience, ISBN:0- 9545232-9-6) and other current textbooks.

[0049] In a preferred embodiment, the level of miR-133a is determined by polymerase chain reaction (PCR). Methods of determining expression levels of miRNAs such as miR-133a using PCR are well and widely known in the art, and may include quantitative real time PCR, semi-quantitative PCR, multiplex PCR, or any combination thereof. In a particularly preferred embodiment, the levels of miRNA biomarkers are determined by quantitative real time PCR (qRT-PCR). Methods of determining the levels of miRNAs using qRT-PCR are known in the art, and are generally preceded by reverse transcription of a miRNA into a cDNA.

[0050] qRT-PCR methods may determine an absolute level of expression of a miRNA. Alternatively, qRT-PCR methods may determine the relative quantity of a miRNA. In preferred embodiments, the relative quantity of miR-133a is determined. [0051 ] The relative quantity of a miRNA such as miR-133a may be determined by normalizing the level of the miRNA to the level of one or more internal standard nucleic acid sequences. In general, such internal standard nucleic acid sequences should have a constant expression in a monocytes sample, regardless of the BMD outcome of the subject. For instance, internal standard nucleic acid sequences may be RNAs for housekeeping nucleic acid sequences such as mRNAs for the housekeeping genes glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), beta- actin, or 18S rRNA, or miRNAs that have constant and high expression in a sample such as RNU48 and RNU44. In one embodiment, the relative quantity of miR133a is determined by normalizing the level of miR-133a to the level of RNU48 and RNU44 in the sample. In an exemplary embodiment, the relative quantity of miR133a is

determined by qRT-PCR as described in the examples.

(f) diagnosing bone density

[0052] A method of the invention comprises diagnosing low bone mineral density by comparing the level of miR133a in monocytes in a subject with a reference level of miR-133a in monocytes.

[0053] A "reference level of miR-133a in circulating monocytes" is used herein to describe an average level of miR-133a in monocytes in a defined population of individuals. For instance, a reference level of miR-133a in monocytes may be the level of miR-133a in a population of subjects with low bone density. Alternatively, a reference level of miR-133a in monocytes may be the level of miR-133a in a population of individuals with high bone density. In some embodiments, a reference level of miR-133a in monocytes is the level of miR-133a in monocytes in a population of individuals with high bone mineral density. In other embodiments, a reference level of miR-133a in monocytes is the level of miR-133a in monocytes in a population of individuals with low bone mineral density.

[0054] In addition, a population of individuals may be a population matched for the patient's age, weight, sex, and ethnicity profile. For instance, if the subject is a postmenopausal woman of a certain age, weight and race, then the reference level of miR-133a in monocytes is an average of miR-133a levels in postmenopausal women with similar age, weight, sex and ethnicity characteristics.

[0055] In some embodiments, a reference level of miR-133a in circulating monocytes is an average level of miR-133a in monocytes in a population of individuals matched for the patient's age, sex and ethnicity with low bone density. In other embodiments, a reference level of miR-133a in circulating monocytes is an average level of miR-133a in monocytes in a population of individuals matched for the patient's age, sex and ethnicity with high bone density.

[0056] The reference level of miR-133a in circulating monocytes from an individual with high bone mineral density may be a relative quantity of miR-133a of about 0.1 , 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1 .0, 1 .1 , 1 .2, 1 .3, 1 .4 or about 1 .5. In some embodiments, the reference level of miR-133a in circulating monocytes from an individual with high bone mineral density is a relative quantity of miR-133a of about 0.1 , 0.2, 0.3, 0.4, or about 0.5. In other embodiments, the reference level of miR-133a in circulating monocytes from an individual with high bone mineral density is a relative quantity of miR-133a of about 0.5, 0.6, 0.7, 0.8, 0.9, or about 1 .0. In yet other embodiments, the reference level of miR-133a in circulating monocytes from an individual with high bone mineral density is a relative quantity of miR-133a of about 1 .0, 1 .1 , 1 .2, 1 .3, 1 .4 or about 1 .5. In preferred embodiments, the reference level of miR- 133a in circulating monocytes from an individual with high bone mineral density is a relative quantity of miR-133a of about 0.3 to about 1 .2. In a preferred embodiment, the reference level of miR-133a in circulating monocytes from an individual with high bone mineral density is a relative quantity of miR-133a of about 0.6, 0.61 , 0.62, 0.63, 0.64,

0.65, 0.66, 0.70, 0.71 , 0.72, 0.73, 0.74, 0.75, 0.76, 0.77, 0.78, 0.79, or about 0.80.

[0057] The reference level of miR-133a in circulating monocytes from an individual with low bone mineral density may be a relative quantity of miR-133a of about

1 , 1 .1 , 1 .2, 1 .3, 1 .4, 1 .5, 1 .6, 1 .7, 1 .8, 1 .9, 2.0, 2.1 , 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1 , 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1 , 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or about 5.0 or more. In some embodiments, the reference level of miR-133a in circulating monocytes from an individual with low bone mineral density may be a relative quantity of miR-133a of about 1 , 1 .1 , 1 .2, 1 .3, 1 .4, 1 .5, 1 .6, 1 .7, 1 .8, 1 .9, or about 2.0. In other embodiments, the reference level of miR-133a in circulating monocytes from an individual with low bone mineral density may be a relative quantity of miR-133a of about 2.0, 2.1 , 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or about 3.0. In yet other embodiments, the reference level of miR-133a in circulating monocytes from an individual with low bone mineral density may be a relative quantity of miR-133a of about 3.0, 3.1 , 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, or about 4.0. In other embodiments, the reference level of miR- 133a in circulating monocytes from an individual with low bone mineral density may be a relative quantity of miR-133a of about 4.0, 4.1 , 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, or about 5.0 or more. In preferred embodiments, the reference level of miR-133a in circulating monocytes from an individual with low bone mineral density may be a relative quantity of miR-133a of about 2.0, 2.1 1 , 2.12, 2.13, 2.14, 2.15, 2.16, 2.17, 2.18, 2.19, 2.2, 2.21 , 2.22, 2.23, 2.24, 2.25, 2.26, 2.27, 2.28, 2.29, 2.3, 2.31 , 2.32, 2.33, 2.34, 2.35, 2.36, 2.37, 2.38, 2.39, 2.4, 2.41 , 2.42, 2.43, 2.44, 2.45, 2.46, 2.47, 2.48, 2.49, or about 2.5 or more.

[0058] In some embodiments, a significantly higher level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with high bone mineral density indicates low bone mineral density. In other embodiments, a significantly similar level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with low bone mineral density indicates low bone mineral density.

[0059] A significant difference may be calculated using known statistical analysis techniques. Non-limiting examples of statistical analysis techniques that may be used to calculate the risk score include cross-correlation, Principal Components Analysis (PCA), factor rotation, Logistic Regression (LogReg), Linear Discriminant Analysis (LDA), Eigengene Linear Discriminant Analysis (ELDA), Support Vector Machines (SVM), Random Forest (RF), Recursive Partitioning Tree (RPART), related decision tree classification techniques, Shrunken Centroids (SC), StepAIC, Kth-Nearest Neighbor, Boosting, Decision Trees, Neural Networks, Bayesian Networks, Support Vector Machines, and Hidden Markov Models, Linear Regression or classification algorithms, Nonlinear Regression or classification algorithms, analysis of variants (ANOVA), hierarchical analysis or clustering algorithms; hierarchical algorithms using decision trees; kernel based machine algorithms such as kernel partial least squares algorithms, kernel matching pursuit algorithms, kernel Fisher's discriminate analysis algorithms, kernel principal components analysis algorithms, or Student's t-test statistical hypothesis test. In an exemplary embodiment, a Student's t-test statistical hypothesis test is used to calculate a P-value. In some embodiments, a P-value of less than about 0.1 , 0.09, 0.08, 0.07, 0.06, 0.07, 0.06, 0.05, 0.04, 0.03, 0.02 or 0.01 signifies a statistically significant difference.

II. Method of treating or preventing loss of bone mineral density

[0060] In other aspects, the present invention encompasses a method of treating or preventing the loss of bone mineral density in a subject. A method of the invention comprises administering to a subject having low bone mineral density, or at risk of developing low bone mineral density a therapeutically effective amount of a composition comprising a miR-133a agent that decreases the expression of miR-133a in monocytes in the subject.

[0061] Bone mineral density may be as described in Section l(b). A subject with low bone mineral density or at risk of developing low bone mineral density may be as described in Section l(c). miR-133a may be as described in Section l(a).

(a) miR-133a agents

[0062] As used herein, the term "miR-133a agent" refers to any molecule capable of modulating one or more activities of miR-133a. A miR-133a agent may modulate one or more activities of miR-133a by increasing or decreasing expression of miR-133a in a subject. In some embodiments, a miR-133a agent respectively modulates a miR-133a activity by increasing the respective expression of a miR-133a in a subject. In preferred embodiments, a miR-133a agent respectively modulates a miR- 133a activity by decreasing expression of a miR-133a in a subject.

[0063] Exemplary miR-133a agents may include, without limitation, a compound, a drug, a small molecule, a peptide, a nucleic acid molecule, a protein, an antibody, and combinations thereof. miR-133a agents may be synthetic or naturally occurring. [0064] In some embodiments, a miR-133a agent is a compound. In another embodiment, a miR-133a agent is a drug. In yet another embodiment, a miR-133a agent is a small molecule. In another embodiment, a miR-133a agent is a peptide. In another embodiment, a 133a agent is a protein. In still another embodiment, a miR- 133a agent is an antibody.

[0065] In preferred embodiments, a miR-133a agent is a nucleic acid molecule. For instance, a miR-133a nucleic acid agent may be an antisense

oligonucleotide, a miRNA mimic, a ribozyme, a small nuclear RNA (snRNA), a long noncoding RNA (LncRNA), or a nucleic acid molecule which forms triple helical structures.

[0066] In some embodiments, a miR-133a agent is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as miRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334:585-591 )) may be used to catalytically cleave miR-133a to thereby respectively inhibit activity of miR-133a. A ribozyme having specificity for a miR- 133a-encoding nucleic acid may be designed based upon the nucleotide sequence of a respective miR-133a cDNA. For example, miR-133a may be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel and Szostak (1993) Science 261 :141 1 -1418; Suryawanshi, Scaria, and Maiti (2010) Mol Biosyst. 6:1807-1809.

[0067] In other embodiments, a miR-133a agent is a snRNA. For instance, a miR-133a snRNA agent may be a snRNA capable of regulating transcription of a nucleic acid sequence respectively encoding miR-133a. Alternatively, a miR-133a snRNA agent may be a snRNA capable of regulating splicing of a mirtron encoding miR-133a.

[0068] In yet other embodiments, a miR-133a agent is a LncRNA. A miR- 133a LncRNA agent may be a LncRNA capable of regulating transcription of a nucleic acid sequence respectively encoding miR-133a.

[0069] In other embodiments, a miR-133a agent is a nucleic acid molecule which forms triple helical structures. For example, miR-133a expression may be modulated by targeting nucleotide sequences complementary to the regulatory region of miR-133a (e.g., the miR-133a coding sequence promoter and/or enhancers) to form triple helical structures that respectively prevent transcription of miR-133a in target cells. See generally, Helene (1991 ) Anticancer Drug Des. 6(6):569-84; Helene (1992) Ann. N.Y. Acad. Sci. 660:27-36; and Maher (1992) Bioassays 14(12):807-15.

[0070] In yet other embodiments, a miR-133a agent is a miRNA mimic of miR-133a. miRNA mimics are small RNA molecules, designed to mimic endogenous mature miRNA molecules when introduced into a cell. Methods of designing and generating miRNA mimics, such as miRNA mimics of miR-133a, are known in the art and may be purchased from commercially available sources or may be made in accordance with methods generally known in the art. Non limiting examples of miRNA mimics include MISSION^® human miRNA mimics from Sigma-Aldrich, meridian^® microRNA mimics from Thermo Scientific, miScript^® miRNA mimics from Qiagen, and mirVana™ mimics from Life Technologies.

[0071 ] In preferred embodiments, a miR-133a agent is an antisense oligonucleotide, also termed anti-miRNA oligonucleotides. Antisense molecules are oligonucleotides comprising nucleic acid sequences complementary to a sense nucleic acid sequence. A miR-133a antisense oligonucleotide agent comprises nucleic acid sequences complementary to a miRNA encoding miR-133a, and may modulate the expression of miR-133a by binding to a miRNA encoding miR-133a. The expression of miR-133a may be modulated by blocking the activity of miR-133a, and reducing the effective amount of miR-133a in a cell.

[0072] An antisense oligonucleotide may bind through hydrogen bonds to a sense nucleic acid. As used herein, the term "sense nucleic acid sequence" is a nucleic acid sequence corresponding to an RNA sequence expressed in a cell. For instance, a sense nucleic acid sequence may be an expressed mRNA nucleic acid sequence, or a DNA nucleic acid sequence corresponding to an expressed mRNA nucleic acid sequence. As such, an antisense molecule of the invention comprises a nucleic acid sequence complementary to an expressed miRNA encoding miR-133a.

[0073] A miRNA encoding miR-133a may be a mature miR-133a or a miRNA processing intermediate encoding a miR-133a miRNA. As such, an antisense nucleic acid may comprise nucleic acid sequences complementary to a mature miR- 133a or to a miRNA processing intermediate encoding a miR-133a miRNA. Non-limiting examples of miRNA processing intermediates encoding a miR-133a miRNA include a pre-miRNA encoding miR-133a, a pri-miRNA encoding miR-133a, or a mirtron encoding miR-133a. In some embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a pri-miRNA encoding miR-133a. In other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a mirtron encoding miR-133a. In some embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a pre-miRNA encoding miR-133a. In yet other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a mature miR-133a.

[0074] An antisense oligonucleotide may comprise nucleic acid sequences complementary to a noncoding region in a miRNA processing intermediate encoding a miR-133a miRNA. For instance, an antisense oligonucleotide may comprise nucleic acid sequences complementary to a noncoding region of a pri-miRNA, a pre-miRNA, or a mirtron encoding miR-133a. As used herein, the term "noncoding region" is used to describe nucleic acid sequences that flank a mature miR-133a sequence in a miRNA processing intermediate encoding a miR-133a miRNA.

[0075] In some embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a noncoding region of a pri-miRNA encoding miR-133a. In other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a noncoding region of a mirtron encoding miR-133a. In yet other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a noncoding region of a pre-miRNA encoding miR-133a.

[0076] In yet other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to coding and noncoding regions of a miRNA encoding miR-133a. In one alternative of the embodiments, an antisense

oligonucleotide comprises nucleic acid sequences complementary to the stem-loop of a pre-miRNA encoding miR-133a.

[0077] In some embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a coding region in a miR-133a miRNA. As used herein, the term "coding region" is used to describe a nucleic acid sequence present in a mature miR-133a miRNA. As will be recognized by those of skill in the art, a nucleic acid sequence present in a mature miR-133a is also present in a pri-miRNA encoding miR-133a, a pre-miRNA encoding miR-133a, and a mirtron encoding miR- 133a. As such, an antisense oligonucleotide comprising nucleic acid sequences complementary to a nucleic acid sequence present in a mature miR-133a, may be complementary to a mature miR-133a, as well as to a pri-miRNA encoding miR-133a, a pre-miRNA encoding miR-133a, and a mirtron encoding miR-133a. In some

embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a coding region of a pri-miRNA encoding miR-133a. In other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a coding region of a mirtron encoding miR-133a. In some

embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a coding region of a pre-miRNA encoding miR-133a. In yet other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to a mature miR-133a.

[0078] An antisense oligonucleotide molecule may comprise nucleic acid sequences complementary to the entire coding region of a miR-133a miRNA.

Alternatively, an antisense oligonucleotide molecule may comprise nucleic acid sequences complementary to only a portion of the coding or noncoding region of a miR- 133a miRNA. As such, an antisense oligonucleotide may comprise nucleic acid sequences complementary to 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 90, 100 or more nucleotides of the coding or noncoding region of miR-133a. In some embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to 4, 5, 6, 7, 8, 9, or 10 nucleotides of the coding or noncoding region of miR-133a. In other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides of the coding or noncoding region of miR-133a. In yet other embodiments, an antisense

oligonucleotide comprises nucleic acid sequences complementary to 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides of the coding or noncoding region of miR-133a. In yet other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to 30, 35, 40, 45, 50, 55, 60, 65, 70, 80, 90, 100 or more nucleotides of the coding or noncoding region of miR-133a. In other embodiments, an antisense oligonucleotide comprises nucleic acid sequences complementary to 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or 25 nucleotides of the coding or noncoding region of miR-133a.

[0079] In some embodiments, an antisense oligonucleotide of the invention comprises nucleic acid sequences complementary to a seed region of a miRNA encoding miR-133a. In other embodiments, an antisense oligonucleotide consists of nucleic acid sequences complementary to a seed region of a miRNA encoding miR- 133a. The seed region is a 7-8 nucleotide motif in the miRNA that determines specificity of binding of a miRNA to a target mRNA regulated by the miRNA. In most miRNAs, the seed region is within nucleotides 1 -9 of the mature miRNA sequence. Antisense oligonucleotides comprising nucleic acid sequences complementary to the seed sequence of a miRNA have been shown to inhibit activity of the miRNA. Such inhibitory activity is described in PCT Publication No. WO 2009/043353, which is herein incorporated by reference in its entirety for its description of modified oligonucleotides targeting miRNA seed sequences.

[0080] The size of a miR-133a antisense agent of the invention can and will vary depending on the target miRNA encoding a miR-133a, the size of the nucleic acid sequence complementary to a region of miR-133a, and whether the antisense oligonucleotide comprises nucleic acid sequences in addition to the sequences complementary to a miR-133a miRNA. An antisense oligonucleotide may be about 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45 or about 50 nucleotides in length. In some embodiments, an antisense oligonucleotide is about 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or about 15 nucleotides in length. In other embodiments, an antisense oligonucleotide is about 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, or about 25 nucleotides in length. In yet other embodiments, an antisense oligonucleotide is about 25, 26, 27, 28, 29, 30, 35, 40, 45, or about 50 nucleotides in length. [0081 ] In certain embodiments, a nucleic acid sequence of an antisense oligonucleotide comprising nucleic acid sequences complementary to a miR133a miRNA may have one or more mismatched base pairs with respect to its target miRNA or precursor sequence, and remains capable of hybridizing to its target sequence. For instance, a nucleic acid sequence of an antisense oligonucleotide comprising nucleic acid sequences complementary to a miR133a miRNA may have 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more mismatched base pairs with respect to its target miRNA or precursor sequence, and remains capable of hybridizing to its target sequence.

[0082] Anti-miR-133a antisense oligonucleotide may be purchased from commercially available sources. Non limiting examples of an anti-miR-133a antisense oligonucleotide include mirVana™ mimics from Life Technologies, miRCURY LNA™ microRNA inhibitors from Exigon, miArrest™ miRNA inhibitors from GeneCopoeia, miScript™ miRNA inhibitors from Qiagen, anti-miR™ miRNA inhibitors from Life

Technologies, and MISSION^® Synthetic miRNA Inhibitors.

[0083] Alternatively, an antisense oligonucleotide of the invention may be synthesized using chemical synthesis and enzymatic ligation reactions using

procedures known in the art. For example, an oligonucleotide (e.g., an antisense oligonucleotide) may be chemically synthesized using naturally occurring

ribonucleotides, deoxyribonucleotides, variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, or combinations thereof. For example, phosphorothioate derivatives and acridine substituted

nucleotides may be used. Other examples of modified nucleotides which may be used to generate an antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1 -methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine,

2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-aino-

3- N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the oligonucleotide may be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation.

[0084] Antisense oligonucleotides may include one or more modifications to a nucleobase, sugar, and/or internucleoside linkage, and as such is a modified oligonucleotide. A modified nucleobase, sugar, or internucleoside linkage may be selected over an unmodified form because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for other oligonucleotides or nucleic acid targets, and increased stability in the presence of nucleases. In certain embodiments, a modified nucleoside is a sugar-modified nucleoside. In certain such embodiments, sugar-modified nucleosides may further comprise a natural or modified heterocyclic base moiety or natural or modified internucleoside linkage and may include further modifications independent from the sugar modification. In certain embodiments, a sugar modified nucleoside is a 2'-modified nucleoside, wherein the sugar ring is modified at the 2' carbon from natural ribose or 2'-deoxy-ribose. In certain embodiments, a 2'- modified nucleoside comprises a 2'-substituent group selected from F, O-CH3, and OCH2CH2OCH3. In certain embodiments, a 2'-modified nucleoside has a bicyclic sugar moiety. In certain embodiments, a bicyclic sugar moiety comprises a bridge group between the 2' and the 4' carbon atoms.

[0085] In certain embodiments, a modified oligonucleotide comprises one or more internucleoside modifications. In certain such embodiments, each internucleoside linkage of an oligonucleotide is a modified internucleoside linkage. In certain

embodiments, a modified internucleoside linkage comprises a phosphorus atom.

[0086] In certain embodiments, a modified oligonucleotide comprises at least one phosphorothioate internucleoside linkage. In preferred embodiments, each internucleoside linkage of a modified oligonucleotide is a phosphorothioate

internucleoside linkage. [0087] In certain embodiments, a modified oligonucleotide comprises one or more modified nucleobases. In certain embodiments, a modified oligonucleotide comprises one or more 5-methylcytosines. In certain embodiments, each cytosine of a modified oligonucleotide comprises a 5-methylcytosine.

[0088] In certain embodiments, a modified nucleobase is selected from 5- hydroxymethyl cytosine, 7-deazaguanine and 7-deazaadenine. In certain embodiments, a modified nucleobase is selected from 7-deaza-adenine, 7-deazaguanosine, 2- aminopyridine and 2-pyridone.

[0089] In some embodiments, the antisense molecules of the invention may be modified at the base moiety, sugar moiety or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. By way of another example, the deoxyribose phosphate backbone of the nucleic acids may be modified to generate peptide nucleic acids (see Hyrup et al. (1996) Bioorganic & Medicinal Chemistry 4(l):5- 23). As used herein, the terms "peptide nucleic acids" or "PNAs" refer to nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of a PNA has been shown to allow for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers may be performed using standard solid phase peptide synthesis protocols as described in Hyrup et al. (1996) supra; Perry-O'Keefe et al. (1996) Proc. Natl. Acad. Sci. USA

93:14670-675.

[0090] In other embodiments, antisense oligonucleotides may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al. (1989) Proc. Natl. Acad. Sci. USA 86:6553-6556; Lemaitre et al. (1987) Proc. Natl. Acad. Sci. USA 84:648-652; PCT Publication No. W0 88/09810) or the blood-brain barrier (see, e.g., PCT Publication No. W0 89/10134). In addition, oligonucleotides may be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al. (1988)

Bio/Techniques 6:958-976) or intercalating agents (see, e.g., Zon (1988) Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.

[0091 ] Methods of designing and generating an antisense oligonucleotide, such as an anti-miR-133a antisense oligonucleotide, are known in the art.

(b) administration

[0092] Generally, methods of the present invention include administering to a subject a therapeutically effective amount of a composition comprising a miR-133a agent. For instance, 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miR-133a agents may be administered (e.g. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more miR-155 agents may be administered). In some embodiments, 1 , 2, 3, 4, or 5 miR-133a agents are

administered. In other embodiments, 5, 6, 7, 8, 9, 10 or more miR-133a agents are administered. In one embodiment, one miR-133a agent is administered. In another embodiment, two miR-133a agents are administered. In yet another embodiment, the miR-133a agent is delivered in combination with additional therapeutic agents known in the art. miR-133a agents may be as described in Section ll(a).

[0093] In certain embodiments, a miR-133a composition is administered in combination with at least one additional therapeutic agent. In certain embodiments, a miR-133a composition is administered sequential to an additional therapeutic agent. In other embodiments, a miR-133a composition is administered prior to the administration of an additional therapeutic agent. In certain embodiments, a miR-133a composition is administered prior to and after the administration of an additional therapeutic agent. In other embodiments, a miR-133a composition is administered at the same time as at least one therapeutic agent. In certain embodiments, a miR-133a composition may be administered without additional therapeutic agents.

[0094] Additional therapeutic agents may include those used in

immunotherapy, gene transfer therapy, stem cell and progenitor cell based cellular replacement therapy, antisense oligonucleotide therapy, antioxidant therapy, antidepressant therapy, antibody therapy, autophagy control therapy, drug therapy, and any therapeutic agent known in the art or yet to be discovered. [0095] A miR-133a composition of the invention may be administered to a subject by several different means. For instance, compositions may generally be administered in dosage unit formulations containing conventional nontoxic

pharmaceutically acceptable carriers, adjuvants, and vehicles as desired.

[0096] Methods of administration include any method known in the art or yet to be discovered. Exemplary administration methods include intravenous, intraocular, intratracheal, intratumoral, oral, rectal, topical, intramuscular, intraarterial, intrahepatic, intrathoracic, intrathecal, intracranial, intraperitoneal, intrapancreatic, intrapulmonary, or subcutaneously. A composition of the invention may also be administered directly by infusion into central nervous system fluid. One skilled in the art will appreciate that the route of administration and method of administration depend upon the intended use of the compositions, the location of the target area, and the condition being treated, in addition to other factors known in the art such as subject health, age, and physiological status.

[0097] In a preferred embodiment, the oligonucleotide may be administered parenterally. The term "parenteral" as used herein describes administration into the body via a route other than the mouth, especially via infusion, injection, or implantation, and includes intradermal, subcutaneous, transdermal implant, intracavernous, intravitreal, intra-articular or intrasynovial injection, transscleral, intracerebral,

intrathecal, epidural, intravenous, intracardiac, intramuscular, intraosseous,

intraperitoneal, intravenous, intrasternal injection, or nanocell injection. Formulation of pharmaceutical compositions is discussed in, for example, Hoover, John E.,

Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. (1975), and Liberman, H. A. and Lachman, L, Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y. (1980).

[0098] Compositions of the invention are typically administered to a subject in an amount sufficient to provide a benefit to the subject. This amount is defined as a "therapeutically effective amount." A therapeutically effective amount may be

determined by the efficacy or potency of the particular composition, the

neurodegenerative disorder being treated, the duration or frequency of administration, the method of administration, and the size and condition of the subject, including that subject's particular treatment response. A therapeutically effective amount may be determined using methods known in the art, and may be determined experimentally, derived from therapeutically effective amounts determined in model animals such as the mouse, or a combination thereof. Additionally, the route of administration may be considered when determining the therapeutically effective amount. In determining the therapeutically effective amounts, one skilled in the art may also consider the existence, nature, and extent of any adverse effects that accompany the administration of a particular compound in a particular subject.

[0099] When a miR-133a composition of the invention is an antisense oligonucleotide, molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to miR-133a or the coding sequence of miR-133a inhibiting the respective biological activity of miR-133a. The hybridization may be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. An antisense nucleic acid molecule of the invention may be administered by direct injection at a tissue site. Alternatively, antisense nucleic acid molecules may be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules may be modified such that they

specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies which bind to cell surface receptors or antigens. The antisense nucleic acid molecules may also be delivered by direct infusion into a subject. The antisense nucleic acid molecules may also be delivered to cells using gene therapy vectors known in the art. To achieve sufficient intracellular concentrations of the antisense molecules, vectors in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.

(c) treating a subject

[0100] A method of the invention comprises treating or preventing loss of bone mineral density in a subject by administering to the subject a therapeutically effective amount of a composition comprising a miR-133a agent that decreases the expression of miR-133a in monocytes in the subject.

[0101 ] In some embodiments, treating a subject increases bone mineral density of the subject. In other embodiments, treating a subject prevents the loss of bone mineral density of the subject. In yet other embodiments, treating a subject decreases the risk of bone fracture in the subject.

[0102] In some embodiments, a miR-133a agent is selected from the group consisting of nucleic acid molecule, protein, polypeptide, small molecule, and

combinations thereof.

III. Method of determining the status of bone mineral density

[0103] In yet other aspects, the invention encompasses methods of

determining the status of bone mineral density in a subject. The method comprises determining the level of miR-133a in monocytes in the subject, and comparing the level of miR-133a in monocytes in the subject to a reference level of miRNA biomarkers in monocytes to determine the status of bone mineral density in the subject. As used herein, the term "status of bone mineral density" is used to describe whether a subject has high or low bone mineral density.

[0104] In some embodiments, a significantly higher level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with high bone mineral density indicates low bone mineral density. In other embodiments, a significantly similar level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with high bone mineral density indicates high bone mineral density.

[0105] In some embodiments, a significantly similar level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with low bone mineral density indicates low bone mineral density. In other embodiments, a significantly lower level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with low bone mineral density indicates high bone mineral density. IV. Other methods

[0106] In other aspects, the invention encompasses methods of diagnosing osteoporosis in a subject. The method comprises determining the level of miR-133a in monocytes in the subject, and comparing the level of miR-133a in monocytes in the subject to a reference level of miRNA biomarkers in monocytes. In some embodiments, a significantly higher level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with high bone mineral density indicates osteoporosis. In other embodiments, a significantly similar level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with low bone mineral density indicates osteoporosis.

[0107] In yet other aspects, the invention encompasses methods of

determining the risk of bone fracture in a subject. The method comprises determining the level of miR-133a in monocytes in the subject, and comparing the level of miR-133a in monocytes in the subject to a reference level of miRNA biomarkers in monocytes. In some embodiments, a significantly higher level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with high bone mineral density indicates a high risk of bone fracture. In other embodiments, a significantly similar level of miR-133a in monocytes in a subject compared to the level of miR-133a in monocytes in a population of individuals with low bone mineral density indicates a high risk of bone fracture.

[0108] As described in Section l(), a diagnosis of osteopenia or osteoporosis may be used to determine the risk of bone fracture in a subject. In general, the risk of bone fracture increases with decreasing bone density diagnosis (Cranney et al., 2007 CMAJ 177:575-580).

[0109] In other aspects, the invention encompasses methods of identifying a subject with low bone mineral density. The method comprises determining the level of miR-133a in monocytes in the subject, and comparing the level of miR-133a in monocytes in the subject to a reference level of miRNA biomarkers in monocytes. DEFINITIONS

[01 10] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art. All patents, applications, published applications and other publications are incorporated by reference in their entirety. In the event that there is a plurality of definitions for a term herein, those in this section prevail unless stated otherwise.

[01 1 1 ] As used herein, "administering" is used in its broadest sense to mean contacting a subject with a composition of the invention.

[01 12] As used herein, a "pharmaceutical composition" includes a

pharmacologically effective amount of a therapeutic agent of the invention and a pharmaceutically acceptable carrier. As used herein, "pharmacologically effective amount," "therapeutically effective amount" or simply "effective amount" refers to that amount of an agent effective to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 15% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of an agent for the treatment of that disorder or disease is the amount necessary to effect at least a 15% reduction in that parameter.

[01 13] The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent. Such carriers may include, but are not limited to , saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers may include, but are not limited to,

pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents may include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, may generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate to delay absorption in the gastrointestinal tract. [01 14] In practicing the present invention, many conventional techniques in molecular biology, microbiology, and recombinant DNA may be used. These techniques are well known and are explained in, for example, Current Protocols in Molecular Biology, Volumes I, II, and III, 1997 (F.M. Ausubel ed.); Sambrook et al., 1989,

Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, N.Y.; DNA Cloning: A Practical Approach, Volumes I and II, 1985 (D. N. Glover ed.); Oligonucleotide Synthesis, 1984 (M.L. Gait ed.); Nucleic Acid Hybridization, 1985, (Hames and Higgins eds.); Transcription and Translation, 1984 (Hames and Higgins eds.); Animal Cell Culture, 1986 (R.I. Freshney ed.); Immobilized Cells and Enzymes, 1986 (IRL Press); Perbal, 1984, A Practical Guide to Molecular Cloning; the series, Methods in Enzymology (Academic Press, Inc.); Gene Transfer Vectors for Mammalian cells, 1987 (J.H. Miller and M.P. Calos eds., Cold Spring Harbor Laboratory); and Methods in Enzymology, Vol. 154 and Vol. 155 (Wu and Grossman, and Wu, eds., respectively).

[01 15] The terms "isolated," "purified," or "biologically pure" refer to material that is substantially or essentially free from components that normally accompany it as found in its native state. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein that is the predominant species present in a preparation is substantially purified. The term "purified" in some embodiments denotes that a protein gives rise to essentially one band in an electrophoretic gel.

Preferably, it means that the protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure. "Purify" or "purification" in other

embodiments means removing at least one contaminant from the composition to be purified. In this sense, purification does not require that the purified compound be 100% pure.

[01 16] The term "sample" or "biological sample" is used in its broadest sense. Depending upon the embodiment of the invention, for example, a sample may comprise a bodily fluid; an extract from a cell, chromosome, organelle, or membrane isolated from a cell; a cell; genomic DNA, RNA, or cDNA, in solution or bound to a substrate; a tissue; a tissue print or any other material isolated in whole or in part from a living subject. Biological samples may also include sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histologic purposes such as blood, plasma, serum, sputum, stool, tears, mucus, hair, skin, and the like. Biological samples also include explants and primary and/or transformed cell cultures derived from patient tissues.

EXAMPLES

[01 17] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Introduction for Examples 1 -3.

[01 18] Tissue-specific expressed microRNAs (miRNAs) are short noncoding RNA molecules that regulate gene expression, generally by destabilizing mRNAs or suppressing translation. miRNAs have been identified as important biomarkers and regulators in various human diseases such as cancer, diabetes and myocardial disease. In the bone area, many miRNAs regulate osteoblastogenesis. However, very few miRNAs have been related to osteoclastogenesis. miR-223 plays an essential role in osteoclastogenesis in a mouse osteoclast precursor cell line. MiR-146a inhibits osteoclastogenesis from human circulating mononuclear cells.

[01 19] Circulating monocytes are important cells that participate in

osteoclatogenesis by acting as osteoclast precursors and secreting osteoclastogenesis- related factors, such as IL-1 (interleukin-1 ), IL-6 and TNF-a (tumor necrosis factor- alpha). In addition, human studies have found associations of gene expression levels in circulating monocytes and osteoporosis, such as ANXA2 (annexin A2), STAT1 (signal transducer and activator of transcription 1 ), CCR3 [chemokine (C-C motif) receptor 3], HDC (histidine decarboxylase), and GCR (glucocorticoid receptor).

[0120] However, no study has been conducted to identify miRNA biomarkers in circulating monocytes associated with human osteoporosis in vivo. The Examples presented herein below identify differentially expressed miRNAs in circulating monocytes isolated from postmenopausal Caucasian women with discordant bone mineral density (BMD) using ABI miRNA array technology followed by qRT-PCR (quantitative RT-PCR). We found the significance of miR-133a in human circulating monocytes associated with postmenopausal osteoporosis. Further bioinformatic analysis of miR-133a identified its potential target genes that may be important in osteoclastogenesis.

Materials and Methods for Examples 1 -3.

Human subjects and characteristics

[0121 ] All the subjects were Caucasians of European origin recruited from the vicinity of Creighton University in Omaha, NE. The exclusion criteria were detailed in a an mRNA expression profiling study on B cells isolated from postmenopausal

Caucasians for different BMD status (Xiao et al., 2008 J Bone Miner Res 23:644-654). The information such as age, ethnicity, menstrual status, medication history, and disease history was obtained via questionnaire. Twenty unrelated postmenopausal Caucasian women were recruited, 10 with high BMD (spine or hip Z-score >0.84) and 10 with low BMD (spine or hip Z-score <-0.84). The high and low BMD groups are the top and bottom 20% BMD distributions of the age-, sex- and ethnicity-matched population. BMD (g/cm²) for the lumbar spine (L1 -4) and total hip (femoral neck, trochanter, and intertrochanteric region) were measured by Hologic 4500A dual energy X-ray absorptiometry (DXA) scanners (Hologic Inc., Bedford, MA). The machine was calibrated daily. The measurement precision as reflected by the coefficient of variation (CV) was 0.9% and 1 .4% for spine and hip BMD, respectively. Postmenopausal status was defined as the date of the last menses followed by at least 12 months of no menses. All the study subjects were aged 57-68. The detailed characteristics of the study subjects are summarized in Table 1. Table 1. Characteristics of the study subjects.

High BMD Low BMD

Traits (n = 10) (n = 10) P Value

Age (yrs) 63.6±3.2 61 .6±2.6 0.15

Height (cm) 159.2±3.2 163.6±4.7 0.03

Weight (kg) 76.7±7.9 72.9±17.6 0.55

Spine BMD (g/cm²) 1 .128±0.058 0.826±0.069 <0.001

Spine Z-Score 2.24±0.59 -0.63±0.64 <0.001

Hip BMD (g/cm²) 1 .057±0.101 0.725±0.045 <0.001

Hip Z-Score 1 .94±0.99 -1 .04±0.45 <0.001

Note: The data are mean ± SD.

[0122] As shown in Table 1 , both hip and spine BMD were significantly different between the high and low BMD groups. For age, weight and height traits, only height showed marginal difference between the two BMD groups. However, height only demonstrated a very small effect on quantitative BMD variations. Moreover, in the Examples presented herein below, BMD was classified as a quality trait into two categories, the low and the high BMD. Therefore, the effect of height on BMD can be ignored in this study.

Monocyte isolation

[0123] Blood mononuclear cells (MNCs) from 70 ml peripheral blood from each study subject were separated by density gradients with UNI-SEP tubes containing a solution of 5.6% polysucrose and 9.6% sodium metrizoate with a density of 1 .077 g/ml (Novamed, Jerusalem, Israel). Monocytes were isolated by a negative isolation kit, Dynabeads® Untouched™ Human Monocytes (Dynal Biotech, Lake Success, NY, USA), which contains a cocktail of CD2, CD7, CD16, CD19, CD56 and CD235a antibodies to deplete T cells, B cells, natural killer cells, erythrocytes and granulocytes, leaving monocytes naive and free of the surface-bound antibody and beads. The purity of isolated monocytes was assessed by flow cytometry with fluorescence labeled antibodies CD19-PE and CD45-FITC (BD Biosciences, San Jose, CA USA), and the average purity is about 85% with 3% deviation (FIG. 1 ).

Total RNA extraction

[0124] The m/^'A/ana miRNA Isolation Kit (Ambion, Austin, Texas, USA) was used to extract total RNA including miRNAs from each cell sample following the manufacturer's protocol. Total RNA concentration and integrity were evaluated by an Agilent 2100 Bioanalyzer (Agilent, Palo Alto, CA, USA). Each RNA sample has a high quality with an excellent integrity number >9.0. miRNA array procedures

[0125] TaqMan® Human MicroRNA Array v1 .0 (Applied Biosystems, Foster City, CA, USA) was used to perform miRNA expression profiling for each RNA sample. Each array covers 365 human miRNAs and endogenous controls RNU48 and RNU44. First, TaqMan miRNA Multiplex Reverse Transcription Kit (Applied Biosystems) was used for the RT reaction. For each RNA sample, the RT reaction was performed in a 63 μΙ reaction system including 1 .8 μΙ 100 mM dNTPs, 18 ml Reverse Transcriptase (50 U/ml), 9 μΙ 10X RT Buffer, 1 .13 μΙ RNase Inhibitor (20 U/ml), 16 μΙ sample RNA, and 17.08 μΙ nuclease-free water. The reaction conditions were as follows: 30 min at 16°C, 30 min at 42°C, and 5 min at 85°C. After that, 450 μΙ diluted RT reaction product (diluted 62.5-fold) with 450 μΙ TaqMan Universal PCR Master Mix (ABI) were mixed, and 100 μΙ real-time PCR reaction mix was loaded into each port of the array card (8 ports/card). The real-time qRT-PCR for each array was carried out on an Applied BioSystems 7900HT Fast Real-time PCR System with the following reaction conditions: 2 min at 50°C, 10 min at 95°C, 40 cycles of 15 sec at 95°C plus 1 min at 60uC. For each array card, there was only one probe for each target miRNA.

[0126] In the miRNA array data analysis, the raw expression level was determined by the cycle number at which the reaction crossed a predetermined cycle threshold (CT) as identified for each miRNA probe. The relative quantity (RQ) of each miRNA for each sample is determined by 2^~ΔΔ0Τ, where ACT= (CT_Target miRNA - CTendogenous control RNU48) and AACT=(ACT - average ACT of all the samples). The RQ data were used for student's ί test to identify differentially expressed miRNAs between the high and the low BMD groups. qRT-PCR for miRNAs

[0127] To correct for the multiple-testing comparison and eliminate false positive results in the miRNA array analysis, we conducted qRT-PCR among the same 20 RNA samples to further validate the identified significant miRNAs in the array analysis. Two-step qRT-PCR was used to confirm the differentially expressed miRNAs. The first step is RT of cDNA and the second step is real-time quantitative PCR. All the reagents are provided by Applied Biosystems. The RT reaction was performed in a 15 ml volume, containing 1 .5 μΙ Taqman RT Buffer (106), 0.15 μΙ 100 mM dNTPs (100 mM), 1 .0 μΙ Reverse Transcriptase, 0.19 μΙ RNase inhibitor (20 ΙΙ/μΙ), 3.0 μΙ specific miRNA primer, 100 ng total RNA, and nuclease-free water to make the final volume 15 μΙ. The real-time quantitative PCR was performed in a 20 μΙ reaction volume using standard protocols on the Applied Biosystems 7900HT System. Briefly, 2.5 μΙ cDNA was mixed with 10.0 μΙ TaqMan universal PCR master mix (2X), 1 .0 μΙ TaqMan miRNA assay and 6.5 μΙ nuclease-free water. The reaction conditions were the same as the above real-time PCR in the array experiments. For each RNA sample, the target miRNA and RNU48 reactions were run as triplicates in the same plate. The RQ of each miRNA for each sample is determined by 2^~ΔΔ0Τ, where ACT= (average of triplicate CT_Target miRNA - average of triplicate CTendogenous control RNU48) and AACT=(ACT - average ACT of all the samples). The RQ data were used for student's ί test between the two groups.

Target gene prediction and verification

[0128] Bioinformatic sequence analysis of each significant miRNA was conducted to identify potential target genes. miRNAs normally repress gene expression by base pairing at complementarity sites mainly but not exclusively in the 3'-untraslated region (3'-UTR) of the target mRNAs. The currently available miRNA target gene databases are all limited in the 3'-UTR analyses. Both miRDB (http://www.miRDB.org/) and TargetScan (http://www.targetscan.org/) databases were used to predict target genes by searching for the presence of conserved 8-mer and 7-mer sites in their 39- UTRs that match the seed region of each significant miRNA. In addition, qRT-PCR was also conducted for the potential target genes of the significant miRNA among the same 20 RNA samples. Similar to miRNA qRT-PCR, the mRNA qRT-PCR was also composed of RT and real-time qPCR. The first step is RT of cDNA and the second step is real-time quantitative PCR. The RT and qPCR were in 100 μΙ and 25 μΙ volumes, respectively, following the company's standard protocols (Applied Biosystems). For each RNA sample, the target mRNA and internal control β-actin were run as triplicates in the same plate. The same calculation for RQ 2^~ΔΔ0Τ for miRNA qRT-PCR was used, and student's ί test was performed between the two groups.

Example 1. miRNA array analyses.

[0129] Among the 365 miRNAs in the array, the expression of many miRNAs were missing among the 20 study samples, probably due to tissue-specific expression or extremely low expression. To obtain enough power, miRNAs that were expressed in at least 5 samples in each BMD group were selected for the analyses. According to this criterion, 156 qualified miRNAs (Table 2) were subject to the statistical analyses and two miRNAs, miR-133a and miR-382, showed significant upregulation in the low BMD group compared with the high BMD group (FIG. 2). Specifically, miR-133a displayed a fold change of 6.48 between the low and high BMD groups as mean ± SD (4.21 ±2.15 vs. 0.65±0.75, P = 0.007), and miR-382 showed a fold change of 3.65 between the low and high BMD groups (2.74±2.18 vs. 0.75±0.63, P = 0.027).

Table 2

miR-152 1.44 0.076 miR-133b 1.58 0.083 miR-1 10.29 0.085 miR-126-4373269 2.12 0.092 let-7a 2.31 0.095 miR-24 1.46 0.098 miR-221 2.47 0.108 miR-137 2.17 0.1 13 let-7b 2.28 0.120 miR-222 1.35 0.124 miR-210 1.75 0.141 miR-132 1.57 0.154 miR-186 1.41 0.160 miR-335 2.57 0.166 miR-425 1.35 0.170 miR-148b 1.63 0.177 miR-26a 1.51 0.182 miR-425-5p 1.66 0.192 miR-224 2.26 0.203 miR-330 1.50 0.205 miR-485-3p 2.07 0.207 miR-103 1.83 0.207 miR-345 1.45 0.217 miR-296 1.83 0.218 miR-31 2.74 0.220 miR-200c 1.98 0.226 miR-25 1.55 0.234 miR-502 1.43 0.234 miR-532 1.55 0.245 miR-486 1.54 0.246 miR-660 1.55 0.248 miR-30a-5p 1.53 0.254 miR-134 2.30 0.256 miR-199a 1.67 0.261 miR-361 1.83 0.261 miR-30b 1.47 0.268 miR-30d 1.54 0.271 miR-182 1.88 0.278 miR-423 1.82 0.282 miR-142-5p 1.51 0.283 miR-30a-3p 1.50 0.283 miR-340 1.49 0.294 miR-146b 1.94 0.295 miR-491 1.37 0.300 miR-125a 2.30 0.301 miR-432 1.78 0.306 miR-92 1.46 0.306 miR-26b 1.49 0.308 miR-127 1.86 0.310 miR-99a 1.41 0.310 miR-429 0.66 0.312 let-7f 1 .57 0.314 miR-126-4378064 2.05 0.324 miR-324-5p 1.47 0.328 miR-155 6.51 0.334 miR-650 0.65 0.348 miR-223 1.28 0.349 miR-191 1.80 0.353 miR-17-5p 1.40 0.353 miR-487b 2.03 0.358 miR-28 1.55 0.360 miR-422b 1.50 0.360 miR-200b 1.54 0.362 miR-19b 1.19 0.370 miR-629 1.29 0.378 miR-365 1.40 0.378 miR-98 1.84 0.382 miR-545 1.95 0.382 miR-148a 1.40 0.385 miR-550 1.30 0.386 miR-181 c 1.36 0.397 miR-192 1.72 0.399 miR-30e-3p 1.41 0.401 miR-21 1.27 0.401 miR-130a 1.76 0.404 miR-23b 0.67 0.408 miR-146a 1.42 0.408 miR-125b 1.48 0.409 miR-30c 1.27 0.409 miR-107 2.42 0.417 miR-181 b 1.24 0.429 miR-181 d 1.36 0.434 miR-9-4378074 1.34 0.438 miR-101 1.50 0.438 miR-196b 1.24 0.439 miR-501 1.35 0.443 miR-410 1.38 0.449 miR-193a 1.33 0.450 miR-500 1.37 0.453 miR-27a 1.33 0.457 miR-213 0.74 0.458 miR-374 1.33 0.459 miR-93 1.27 0.462 miR-339 1.45 0.463 miR-199b 1.43 0.467 miR-320 1.43 0.474 let-7d 1 .33 0.475 miR-19a 1.18 0.477 miR-20a 1.21 0.482 miR-301 1.55 0.498 miR-99b 1.33 0.502 miR-100 1.25 0.513 miR-362 1.21 0.516 miR-618 0.68 0.525 miR-484 1.10 0.527 miR-378 1.23 0.545 miR-376a 1.21 0.568 miR-328 1.23 0.607 miR-195 1.20 0.608 miR-149 1.29 0.613 miR-145 1.35 0.615 miR-7 0.78 0.618 miR-18a 0.72 0.622 miR-449 1.43 0.623 miR-15a 0.84 0.624 miR-197 1.14 0.628 miR-15b 1.25 0.632 miR-218 0.66 0.634 miR-331 1.14 0.647 miR-142-3p 1.26 0.649 miR-342 1.1 1 0.650 let-7c 1 .23 0.666 miR-338 0.84 0.684 miR-326 1.31 0.707 miR-141 0.79 0.71 1 miR-32 1.16 0.717 miR-22 1.18 0.729

miR-424 0.83 0.742

miR-20b 1.09 0.750

miR-130b 1.15 0.754

miR-95 1.25 0.761

miR-659 0.72 0.762

miR-9-4373285 1.12 0.766

miR-324-3p 1.08 0.776

miR-194 1.15 0.779

miR-200a 1.12 0.800

miR-594 0.79 0.810

miR-16 1.05 0.815

miR-30e-5p 1.10 0.821

miR-565 1.15 0.825

miR-196a 1.12 0.830

miR-140 1.06 0.832

miR-29a 1.09 0.852

miR-23a 1.06 0.868

miR-29c 1.07 0.869

miR-433 0.92 0.880

miR-106b 1.04 0.921

miR-10a 1.07 0.932

miR-17-3p 1.04 0.937

let-7g 1 .02 0.968

miR-41 1 1.01 0.993

Example 2. qRT-PCR for miRNAs.

[0130] qRT-PCR was further performed to validate the differential expression of miR-133a and miR-382. However, only the upregulation of miR-133a in monocytes in the low vs. the high BMD group (2.21 ±2.08 vs. 0.76±0.37) was validated by qRTPCR (P= 0.044). The difference in expression of miR-382 in monocytes in the low vs. the high BMD group (6.56±2.84 vs. 7.93±9.73) was not significant (P =0.67) (FIG. 3).

Example 3. Target gene prediction and verification.

[0131 ] The bioinformatic sequence analyses identified 226 potential target genes that are overlapped in both miRDB and TargetScan databases. By searching relevant references for all the 226 genes, it was found that three of them are related to osteodastogenesis, CXCL1 1 [chemokine (C-X-C motif) ligand 1 1 ], CXCR3 [chemokine (C-X-C motif) receptor 3], and SLC39A1 [solute carrier family (zinc transporter), member 1 ]. Table 3 demonstrates the specific putative binding sites of miR-133a in the 3' UTRs of the three genes. qRT-PCR analyses were conducted for all three genes among the same 20 study samples and did not find significant differential expression. In addition, correlation analysis of the expression levels of miR-133a and each gene was performed. All three genes did demonstrate negative correlation with miR-133a, although they were not significant (P.0.05) (Table 4, FIG. 4).

Table 3. Putative binding sites of miR-133a in predicted target genes in humans.

3' UTR Consequential Pairing

Target Gene Position Target gene binding region (top) and miR-133a

sequence (bottom)

5 ' AAAGGUGGGUGAAAGGACCAAA (SEQ ID NO: 2)

CXCL1 1 171 -177

3 ' GUCGACCAACUUCCCCUGGUUU (SEQ ID NO: 1 )

5 ' AAACAAGAUCGUCAGGACCAAA (SEQ ID NO: 3)

CXCR3 444-450

3 ' GUCGACCAACUUCCCCUGGUUU (SEQ ID NO: 1 )

5 ' AAGGGAAAUACUGAGGACCAAA (SEQ ID NO: 4)

SLC39A1 107-1 13

3 ' GUCGACCAACUUCCCCUGGUUU (SEQ ID NO: 1 )

Table 4. Correlation of expression levels (2 : ) of miR-133a with those of three potential target genes and the ratio of expression levels of each gene in the high and low BMD rou s, as measured b RT-PCR.

Note: H/L: high/low BMD groups. Discussion for Examples 1 -3

[0132] The aim of this study was to identify important miRNAs in human circulating monocytes associated with discordant BMD status in postmenopausal Caucasian women. Significant upregulation of miR-133a in the low BMD group in both the array and the qRT-PCR analyses was found.

[0133] Human mature miR-133a is encoded by two genes: MIR133A1 for miR- 133a1 at 18q1 1 .2 (194,036,59-194,077,46 bp) and MIR133A2 for miR-133a2 at 20q13.33 (61 1 ,601 ,19- 61 1 ,642,20 bp). Both genes encode different pre-mature miRNAs but generate the same mature miR-133a sequence. Interestingly, human genetic studies also found the association of 18q1 1 .2 to osteoporosis-related traits (Hsu et al. 2010 PLoS Genet 6:e1000977) and linkage of 20q13 to bone phenotypes (Ralston et al. 2005 Hum Mol Genet 14:943-951 ; Deng et al. 2007 J Bone Miner Res 22:808- 816; Mitchell et al. 2000 J Clin Endocrinol Metab 85:1362-1366). In humans, there are two types of miR-133 miRNA isoforms, miR-133a and miR-133b, with one base difference (g-a) in the last nucleotide at the 3' end (miRBase: www.mirbase.org). The ABI miRNA array used in this study includes both miR-133a and miR-133b probes. Interestingly, miR-133b is marginally unregulated in the low vs. the high BMD groups (1 .51 ±0.67 vs. 0.95±0.63, P= 0.08). In addition, we detected miR-133a expression levels in circulating B cells from the same 20 high or low BMD postmenopausal women. Circulating B cells were isolated by Dynabeads® CD19 (Pan B) (Dynal Biotech).

However, miR-133a was not differentially expressed in B cells between the high and the low BMD groups (P= 0.49). Therefore, miR-133a is most likely to be a monocyte specific biomarker underlying postmenopausal osteoporosis.

[0134] Many studies demonstrated that miR-133 and 133a are important in the development of muscle, such as skeletal muscle, and heart/cardiovascular muscle. In bone, particularly, miR-133 and 133a have been found to regulate osteoblastogenesis by targeting and regulating Runx2 expression. A recent study also demonstrated that miR-133a was upregulated in osteoblast-like periodontal ligament stem cells treated with ibandronate, a nitrogen-containing bisphosphonate that inhibits bone resorption, and is widely used to treat osteoporosis. However, the present study shows the association of miR-133a expression levels in circulating monocytes, the osteoclast precursors, with postmenopausal osteoporosis.

[0135] To further predict what genes are targeted and regulated by miR-133a in monocytes in bone metabolism, two miRNA target gene predicting databases

(miRDB and TargetScan) were used. Bioinformatic sequence analyses and reference searching identified three potential target genes of miR-133a related to the inhibition of osteoclastogenesis, which are CXCL1 1 , CXCR3, and SLC39A1 (Table 3). CXCL1 1 is a small cytokine of the CXC chemokine family. CXCL1 1 has been shown to inhibit osteoclast differentiation of CD14+ monocytes. CXCR3 is a Gai protein-coupled receptor in the CXC chemokine receptor family. CXCR3 expression significantly decreased during osteoclast differentiation. The SLC39A1 gene encodes zinc

transporter 1 (ZIP1 ). Zinc deficiency has been correlated with reduction of bone growth and development of osteoporosis. SLC39A1 has been detected in osteoclasts and inhibited osteoclastogenesis and osteoclast function through zinc uptake.

[0136] All three genes did show negative correlation with miR-133a, though not significant (Table 3). Since one single miRNA normally regulates the expression of hundreds of genes, the regulatory effect of each gene may be small. Osteoporosis is a complex disease and regulated by multiple genes. To investigate the combined effects, a principle component analysis (PCA) was also utilized to analyze the qRT-PCR observations from all three potential target genes. The PCA was performed using the correlation matrix. The analysis reduced the original data into two principle components (PC) that account for 58.17% and 32.78% of the total variance, respectively. A plot of the second PC against the first PC in the 10 high and 10 low BMD subjects is shown in FIG. 5. It can be seen that both PCs are above the average levels in 6 out of 10 high BMD subjects and below the average levels in 7 out of 10 low BMD subjects, which means that the three genes are systematically upregulated in the high vs. low BMD groups. This result is consistently correlated with the downregulation of miR-133a in the high vs. low BMD groups.

[0137] In the miRNA array data, the statistical tests for the 156 miRNAs were performed according to expression data available in at least five samples in each group, and raw P values but not adjusted P values were used for multiple tests. No significant miRNAs were found after multiple testing adjustments by Bonferroni. However, the significant qRT-PCR P value confirmed the differential expression of miR-133a in the array analyses. The qRT-PCR validation largely solved the multiple testing problem.

Example 4. miR133a induces osteoclast differentiation.

[0138] To determine if miR-133a induces osteoclast differentiation, miR-133a were increased or decreased in THP-1 , a human acute monocytic leukemia cell line that can be differentiated into osteoclasts upon exposure to calcitriol. In short, THP-1 cells were cultured in RPMI with 10% FBS, and calcitriol (40 ng/ml) was added to the media for differentiation. The THP-1 cells were treated with a miR-133a mimic, or with a miR- 133a inhibitor, capable of increasing or decreasing miR-133a activity in THP-1 cells, respectively. THP-1 cells treated with calcitriol alone were used as a control for miR- 133a agents. THP-1 differentiation into osteoclast was assessed by TRAP (tartrate- resistant acid phosphatase) staining at various time points.

[0139] As shown in FIG. 6A, on day 3 after treatment, a higher percentage of the THP-1 cells treated with calcitriol and miR-133a mimic differentiated into osteoclasts than THP-1 cells treated with calcitriol alone. As such, increasing miR-133a activity enhances differentiation of THP-1 cells into osteoclasts. Conversely, a lower percentage of the THP-1 cells treated with calcitriol and miR-133a inhibitor differentiated into osteoclasts than THP-1 cells treated with calcitriol alone. As such, decreasing miR-133a activity inhibits differentiation of THP-1 cells into osteoclasts. A similar result was obtained when cells were stained 6 days after treatment (FIG. 6B).

Claims

CLAIMS What is claimed is:

1 . A method of diagnosing low bone mineral density in a subject, the method

comprising:

(a) isolating monocytes from a biological sample from the subject,

(b) processing the monocytes in (a), in vitro, to determine the level of miR- 133a in the monocytes,

(c) diagnosing low bone mineral density in the subject by comparing the level of miR-133a from (b) with a reference level of miR-133a in monocytes.

2. The method of claim 1 , wherein the reference level of miR-133a in monocytes is the level of miR-133a in monocytes in a population of individuals with high bone mineral density.

3. The method of claim 2, wherein a significantly higher level of miR-133a in

monocytes in the subject compared to the level of miR-133a in monocytes in a population of individuals with high bone mineral density indicates low bone mineral density.

4. The method of claim 1 , wherein the reference level of miR-133a in monocytes is the level of miR-133a in monocytes in a population of individuals with low bone mineral density.

5. The method of claim 4, wherein a significantly similar level of miR-133a in

monocytes in the subject compared to the level of miR-133a in monocytes in a population of individuals with low bone mineral density indicates low bone mineral density.

6. The method of claim 1 , wherein the biological sample is blood.

7. The method of claim 1 , wherein the level of miR-133a is the relative quantity of miR-133a.

8. The method of claim 1 , wherein the relative quantity of miR-133a is determined by qRT-PCR.

9. The method of claim 1 , wherein the reference level of miR-133a in monocytes from an individual with high bone mineral density is a relative quantity of miR-133a of about 0.3 to about 1 .2.

10. The method of claim 1 , wherein the reference level of miR-133a in monocytes from an individual with low bone mineral density is a relative quantity of miR-133a of about to 1 about 4.5.

1 1 . The method of claim 1 , wherein low bone mineral density is a spine or hip Z-score of less than about -0.84.

12. The method of claim 1 , wherein high bone mineral density is a spine or hip Z-score of less than about 0.84.

13. A method of determining the status of bone mineral density in a subject, the

method comprising:

(a) isolating monocytes from a biological sample from the subject,

(b) processing the monocytes in (a), in vitro, to determine the level of miR- 133a in the monocytes,

(c) determining the status of bone mineral density in the subject by comparing the level of miR-133a from (b) with a reference level of miR-133a in monocytes.

14. The method of claim 13, wherein the reference level of miR-133a in monocytes is the level of miR-133a in monocytes from an individual with high bone mineral density.

15. The method of claim 14, wherein (i) a significantly higher level of miR-133a in monocytes in the subject compared to the level of miR-133a in monocytes from the individual with high bone mineral density indicates low bone mineral density, and (ii) a significantly similar level of miR-133a in monocytes in the subject compared to the level of miR-133a in monocytes from the individual with high bone mineral density indicates high bone mineral density.

16. The method of claim 13, wherein the reference level of miR-133a in monocytes is the level of miR-133a in monocytes from an individual with low bone mineral density.

17. The method of claim 16, wherein (i) a significantly similar level of miR-133a in

monocytes in the subject compared to the level of miR-133a in monocytes from the individual with low bone mineral density indicates low bone mineral density, and (ii) a significantly lower level of miR-133a in monocytes in the subject compared to the level of miR-133a in monocytes from the individual with low bone mineral density indicates high bone mineral density.

18. A method of diagnosing osteoporosis in a subject, the method comprising:

(a) isolating monocytes from a biological sample from the subject,

(b) processing the monocytes in (a), in vitro, to determine the level of miR- 133a in the monocytes,

(c) diagnosing osteoporosis in the subject by comparing the level of miR-133a from (b) with a reference level of miR-133a in monocytes.

19. The method of claim 18, wherein the reference level of miR-133a in monocytes is the level of miR-133a in monocytes in a population of individuals with high bone mineral density.

20. The method of claim 19, wherein a significantly higher level of miR-133a in monocytes in the subject compared to the level of miR-133a in monocytes in a population of individuals with high bone mineral density indicates osteoporosis.

21 . The method of claim 18, wherein the reference level of miR-133a in monocytes is the level of miR-133a in monocytes in a population of individuals with low bone mineral density.

22. The method of claim 21 , wherein a significantly similar level of miR-133a in

monocytes in the subject compared to the level of miR-133a in monocytes in a population of individuals with low bone mineral density indicates osteoporosis.

23. A method of determining the risk of bone fracture in a subject, the method

comprising:

(a) isolating monocytes from a biological sample from the subject,

(b) processing the monocytes in (a), in vitro, to determine the level of miR- 133a in the monocytes,

(c) determining the risk of bone fracture in the subject by comparing the level of miR-133a from (b) with a reference level of miR-133a in monocytes.

24. The method of claim 23, wherein the reference level of miR-133a in monocytes is the level of miR-133a in monocytes in a population of individuals with high bone mineral density.

25. The method of claim 24, wherein a significantly higher level of miR-133a in

monocytes in the subject compared to the level of miR-133a in monocytes in a population of individuals with high bone mineral density indicates increased risk of bone fracture.

26. The method of claim 23, wherein the reference level of miR-133a in monocytes is the level of miR-133a in monocytes in a population of individuals with low bone mineral density.

27. The method of claim 26, wherein a significantly similar level of miR-133a in

monocytes in the subject compared to the level of miR-133a in monocytes in a population of individuals with low bone mineral density indicates increased risk of bone fracture.

28. A method of treating or preventing loss of bone mineral density, the method

comprising administering to a subject having low bone mineral density, or at risk of developing low bone mineral density a therapeutically effective amount of a composition comprising a miR-133a agent that decreases the expression of miR- 133a in monocytes in the subject.

29. The method of claim 28, wherein treating the subject increases bone mineral

density of the subject.

30. The method of claim 28, wherein treating the subject prevents the loss of bone mineral density of the subject.

31 . The method of claim 28, wherein treating the subject decreases the risk of bone fracture in the subject.

32. The method of claim 28, wherein the miR-133a agent is selected from the group consisting of nucleic acid molecule, protein, polypeptide, small molecule, and combinations thereof.