WO2013153250A1 - Glycosaminoglycan-binding of proteins with secret domain encoded by poxvirus - Google Patents

Abstract

The present invention relates to a fusion polypeptide that comprises (1) a SECRET chemokine-binding domain of a viral protein selected from CrmB, CrmD, SCP-1, SCP-2 and SCP-3, a functional homologue, derivative or fragment thereof, covalently bonded to (2) a polypeptide sequence thereof or of different origin from the SECRET domain, in which the SECRET chemokine-binding domain of said fusion polypeptide binds to the cell surface via a glycosaminoglycan (GAG) present on said cell surface. The invention furthermore also relates to the use of said polypeptide in the treatment of autoimmune and inflammatory diseases and in the production of antibodies for treating adverse effects arising from vaccination with vaccinia virus or the pathological condition caused by the poxvirus and monkeypox virus.

Description

 UNION TO GLYCOSAMINOGLYCANS OF PROTEINS WITH SECRET DOMAIN CODED BY POXVIRUS

This invention relates to the ability to bind glycosaminoglycans (GAGs) of the SECRET chemokine-binding domain (smallpox virus-encoded chemokine receptor) present in tumor necrotizing factor (TNFRs) receptors called cytokine response modifier B and D (CrmB and CrmD) and in the proteins called SECRET-containing proteins 1, 2 and 3 (SCP-1, SCP-2 and SCP-3) encoded by poxvirus, and by homologues, derivatives or fragments thereof, to increase the immunomodulatory properties of proteins with SECRET domain. It also refers to fusion polypeptides, pharmacological compositions and assays using the proteins of the invention. STATE OF THE TECHNIQUE

Cytokines, as an important part in the regulation of an effective antiviral response, constitute the form of communication between the cellular components responsible for ending the infection. Living with the host over years of evolution has allowed poxviruses to capture genes from their hosts to adapt them for their own benefit. Thus, these viruses are capable of expressing soluble viral versions of receptors (viroceptors) or cytokines (viroquines) in order to manipulate the regulation of the anti-viral response to guarantee its expansion in the organism. At the same time, poxviruses express proteins without sequence similarity with any known cellular component but with specific cytokine binding and inhibition functions (Alcami, 2003).

The tumor necrosis factor α (TNF) is activated shortly after a virus infects its host to start the response by inducing chemokines (CKs), adhesion molecules and other cytokines and regulating or taking part in the mechanisms effectors of the cells of the Immune system to remove infected cells as soon as possible. It is an essential molecule for the establishment of a cellular response, or Th1, effective against a viral infection and, therefore, poxviruses have adopted elegant strategies to block this cytokine (Cunnion, 1999).

The expression of soluble homologs of TNF cell receptors (vTNFRs) is one of these viral strategies. To date, four different vTNFRs have been described, the modifiers of the cytokine response B (CrmB), CrmC, CrmD and CrmE. Different species of poxvirus differentially express these vTNFRs. CrmB and CrmD, unlike CrmC and CrmE, contain a C-terminal domain that inhibits the in vitro activity of some CKs. This domain was first described in our laboratory and was named SECRET by smallpox virus encoded chemokine receptor. Thus, CrmB and CrmD have a double activity, anti-TNF and anti-CKs. In addition, the SECRET domain is also part of 3 secreted proteins encoded by poxvirus, called SECRET domain-containing proteins 1, 2 and 3 (SCP-1, SCP-2 and SCP-3) (Alejo and cois. 2006). The genes encoding SECRET domains are found in vaccinia virus (VACV), ectromelia virus (ECTV), cowpox virus (CPXV) or smallpox virus (VARV).

In the clinic there are soluble tumor necrotizing factor (TNF) receptors and humanized anti-TNF monoclonal antibodies for the treatment of inflammatory disorders. Patent ES 2315037 describes the use of the C-terminal domain (CTD) of tumor necrotizing factor (TNFR) receptors encoded by poxvirus and called "cytokine response modifier B and D" (CrmB and CrmD), and by homologues, derivatives or fragments thereof to modulate chemokine activity and to increase the immunomodulatory properties of TNFRs. It also refers to fusion polypeptides, pharmacological compositions and assays using the proteins of the invention. This invention protects the use of a new chemokine binding domain (called SECRET), present in poxvirus, to increase the anti-inflammatory capacity of TNFRs used in the clinic as an anti-inflammatory medication. Glycosaminoglycans (GAGs) are polysaccharides attached to a protein nucleus with a high degree of sulfation and charge. They are found on the cell surface and in the extracellular matrix and participate in important biological processes such as cell proliferation, morphogenesis, migration, viral pathogenesis and union of growth factors and cytokines (Handel et al., 2005). For example, the binding of CKs to GAGs is essential in the formation of chemotactic gradients that guide lymphocyte migration (Proudfoot et al., 2003).

Some immune modulation proteins of poxvirus, such as the soluble VACV interferon receptor, B18 (Montanuy et al., 201 1), or the ortholog of A41 in ECTV, E163 (Ruiz-Arguello et al., 2008), are capable of joining the cell surface by interacting with GAGs. In this way, they manage to increase their local concentration around the cytokine receptors with which they interact. As it is an extended strategy among poxvirus immune modulation proteins, the possible binding of CrmD to these surface polysaccharides has been studied. In this regard, it has been discovered that CrmD, through its SECRET domain, is able to interact with GAGs with high affinity and block the effect of TNF on cell surfaces.

TNFa is behind the pathogenesis of numerous inflammatory disorders suffered by millions of people worldwide. Diseases such as rheumatoid arthritis, psoriasis, vasculitis, juvenile chronic arthritis, ankylosing spondylitis or Crohn's disease are being treated by TNFa inhibitors with some degree of success (Wong et al., 2008). Today there are five drugs approved for the clinic: Etanercept, adalimumab, infliximab, certolizumab and golimumab (Tak and Kalden, 201 1). All, except etanercept, consist of the application of anti-TNF antibodies of different nature. Etanercept is a soluble version of a TNFR2 dimer fused to a Fe portion of a human IgG. Etanercept, adalimumab and infliximab are the most widespread treatments among the world population with 500,000, 370,000 and 1,136,000 patients respectively (Tak and Kalden, 201 1). BRIEF DESCRIPTION OF THE INVENTION

The present invention demonstrates that the SECRET domain, in addition to inhibiting chemokines, binds to the cell surface through glycosaminoglycans (GAGs). In this way, thanks to this SECRET domain, viral TNFRs can increase their local concentration around the cellular receptors of their ligands and thus carry out their inhibitory functions more efficiently.

The soluble TNFRs used in clinical practice, to improve their stability, are fused to a Fe portion of human immunoglobulins, from which however adverse side effects can be derived as a result of complement system activation. This fusion to the Fe portion allows the transport of TNFRs through the bloodstream bound to the cellular receptors of Fe regions. The fusion of the SECRET domain to these TNFRs, would lead these TNF inhibitors to the cell surface, where their concentration would be increased local and stability, being able to be transported together to the surface GAGs but without activating the complement system.

The present invention identifies a new property of the SECRET domain not described in other related patents, for the development of more effective anti-TNF therapies and with less adverse effects. This property of joining surface GAGs could be incorporated into the human TNFRs used in the clinic.

This new property of the SECRET domain, makes this domain of viral TNF receptors can be fused to soluble receptors used for the treatment of autoimmune or inflammatory diseases, as is the case of anti-TNF drugs, to take these inhibitors to the cell surface In this way, a medicine with greater stability and action at the local level is achieved. The present invention relates to the ability to bind to GAGs of the SECRET domain of the CrmB or CrmD vTNFRs and SCPs (SCP-1, SCP-2 and SCP-3), including functional homologues, derivatives and fragments thereof to increase stability and immunomodulatory properties of these proteins.

The present invention also relates to the ability to bind to GAGs of the SECRET domain of CrmB or CrmD vTNFRs and SCPs (SCP-1, SCP-2 and SCP-3), including functional homologues, derivatives and fragments thereof to increase the stability and immunomodulatory properties of vTNFRs fused to them.

The present invention also has as a protection object a fusion polypeptide comprising a SECRET domain or homologue of the SECRET domain described in the present invention, wherein said SECRET domain or homologue is fused to a polypeptide sequence of the same or different origin.

The present invention also has as a protection object a polynucleotide comprising a sequence encoding the SECRET domain or a homologue of the SECRET domain, described in the present invention, or for a fusion polypeptide described in the present invention. Another object of the present invention is a viral vector or expression plasmid comprising a polynucleotide described in the present invention.

The present invention also refers to a pharmaceutical composition comprising the SECRET domain and / or a homologue of the SECRET domain described in the present invention and / or a fusion polypeptide described in the present invention and / or an expression cassette and / or a viral vector described in the present invention for use in increasing immunomodulatory activity by binding to GAGs in vivo.

Finally, the present invention has as an object of protection the use of the GAG binding capacity of the SECRET domain and / or a homologue of the SECRET domain as described in the present invention and / or a fusion polypeptide as It is described in the present invention and / or an expression cassette and / or a viral vector as described in the present invention in the preparation of a medicament for the treatment of anti-inflammatory diseases.

DETAILED DESCRIPTION OF THE INVENTION

Poxviruses encode soluble receptors that inhibit the proinflammatory functions of tumor necrotizing factor (vTNFRs). Some of these vTNFRs, such as CrmB or CrmD, also have a domain called SECRET capable of inhibiting the chemotactic function of some chemokines. The ability of the SECRET domain to increase the anti-inflammatory capacity of human TNFRs is protected by a previous patent of our laboratory, an aspect that we are exploring through a TRACE project of MICINN and whose patent is being funded by the Genetrix company.

In the present invention, by means of heparin binding experiments and binding cytometry assays to different cell types we have observed that CrmB and CrmD are capable of interacting with surface glycosaminoglycans (GAGs) through their SECRET domain since other vTNFRs such as CrmE and CrmC, lacking this domain, do not. However, when we fuse the SECRET domain to CrmC we get a protein that effectively binds to the surface of the cells. We have also verified, through cytotoxicity assays, that CrmD is capable of binding and blocking TNF while remaining attached to the cell surface. On the other hand, although in the sequence of the SECRET domain, there is no obvious reason for binding to GAGs, we have experimentally defined some of the amino acids involved in the interaction.

This ability to bind to GAGs is not unique to these vTNFRs among molecules with immune modulation functions of poxvirus. In fact, the soluble viral interferon B18 receptor or the A41 L chemokine inhibitor are also able to bind to these molecules, which can be an important feature in blocking proinflammatory agents.

Significantly, because in the amino acid sequence of the SECRET domain, GAGs binding sites cannot be predicted using available computer tools, this property cannot be predicted.

One aspect of the invention relates to a fusion polypeptide comprising:

 - a SECRET chemokine binding domain of a viral protein selected from CrmB, CrmD, SCP-1, SCP-2 and SCP-3, a functional homologue, derivative or fragment thereof, covalently linked to - a polypeptide sequence thereof or different origin than the SECRET domain,

wherein the SECRET chemokine binding domain of said fusion polypeptide binds to the cell surface through a glycosaminoglycan (GAG) present on said cell surface. In the context of the present invention the terms chemokines and chemokines are equivalent and can be used interchangeably to refer to the same molecule.

Within the context of the present invention, a functional homologue, derivative or fragment of the same SECRET chemokine binding domain (also referred to as' SECRET domain in the present description) of a viral protein selected from CrmB, CrmD, SCP-1, SCP is contemplated -2 and SCP-3. As the person skilled in the art understands, said homologs, derivatives or fragments will possess the same functional capacity as SECRET chemokine binding domain, that is, the ability to bind to the cell surface through a glycosaminoglycan (GAG) present on said surface. mobile. Tests to verify the GAG binding capacity of homologs, derivatives or fragments of the SECRET chemokine binding domain are described in the examples of the present patent application.

In a particular embodiment, the SECRET chemokine binding domain has an amino acid sequence with at least 80% homology with an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20. In the present invention It is understood that the terms homology and sequence identity have the same meaning and are used interchangeably throughout this description. Thus, "identity" or "sequence identity" is understood as the degree of similarity between two nucleotide or amino acid sequences obtained by aligning the two sequences. Depending on the number of common residues between the aligned sequences, a degree of identity expressed as a percentage will be obtained. The degree of identity between two amino acid sequences can be determined by conventional methods, for example, by standard sequence alignment algorithms known in the state of the art, such as BLAST [Altschul SF et al. Basic local alignment search tool. J Mol Biol. 1990 Oct 5; 215 (3): 403-10]. The BLAST programs, for example, BLASTN, BLASTX, and TBLASTX, BLASTP and TBLASTN, are in the public domain on the website of The National Center for Biotechonology Information (NCBI).

The person skilled in the art understands that changes in the nucleotide sequence of genes that give rise to conservative amino acid substitutions at positions not critical to protein functionality, are evolutionarily neutral changes that do not affect their overall structure or functionality. . In a particular embodiment, the percent identity or homology corresponds to the percent of common amino acids or nucleotides between the two sequences with respect to the overall alignment of the protein, that is, with respect to the alignment of the full length of both sequences. .

In a more particular embodiment, the amino acid sequence has at least 85, 90, 95, 99 or 100% homology with the sequences selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20.

In another preferred embodiment, the SECRET chemokine binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO : 6, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20. A preferred embodiment of the present invention relates to the GAG binding capacity of the SECRET domain of CrmB described above, where the SECRET domain of CrmB comprises SEQ ID No. 26 or SEQ ID No. 28. Another embodiment of the present invention refers to the GAG binding capacity of the SECRET domain of CrmD described above, where the SECRET domain of CrmD comprises SEQ ID No. 22 or SEQ ID No. 24.

Another particular embodiment of the present invention refers to the ability to GAGs of the SECRET domain of SCPs: SCP-1, SCP-2 or SCP-3 described above, where the SECRET domains comprise any of the sequences: SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 14, SEQ ID No. 16, SEQ ID No. 18 or SEQ ID No. 20.

In a particular embodiment of the fusion polypeptide described above, the SECRET domain is covalently bound or fused to a polypeptide sequence, wherein said polypeptide sequence is the recipient of the viral tumor necrotizing factor (vTNFRs). In another even more particular embodiment, the polypeptide sequence is the N-terminal domain of tumor necrotizing factor (TNF) binding of vTNFRs. In another particular embodiment, the polypeptide sequence is the human tumor necrotizing factor receptor (hTNFRs).

In another aspect, the present invention relates to a polynucleotide encoding a fusion polypeptide as defined in the present description. In another aspect, it relates to a viral vector or expression plasmid comprising a polynucleotide encoding a fusion polypeptide as defined herein.

Another preferred object of the present invention is a pharmaceutical composition comprising a fusion polypeptide, a polynucleotide or a viral vector or expression plasmid as defined in the present description. Preferably, the present invention also refers to said pharmaceutical composition, further comprising an immunosuppressant or an additional anti-inflammatory substance.

In another aspect, the invention relates to the use of the pharmaceutical composition as defined in the present description for use as an anti-inflammatory.

In another aspect, the invention relates to the use of the fusion polypeptide, the polynucleotide encoding said fusion polypeptide or the viral vector or expression plasmid comprising said polynucleotide, in the preparation of a medicament for the treatment of autoimmune diseases or inflammatory

Another preferred object of the present invention is the use of the SECRET domain and / or a homologue of the SECRET domain or an amino acid sequence with at least 80% homology with an amino acid sequence selected from the group consisting of SEQ ID NO: 26 , SEQ ID NO: 28, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20, to obtain specific antibodies inhibiting the ability to bind to GAGs of the SECRET domain.

In another aspect, the invention relates to an antibody obtained according to the present invention. Preferably, the present invention also refers to the use of the antibodies described above in the manufacture of a medicament for the treatment of adverse effects caused by vaccination with vaccinia virus or of the pathology caused in man by smallpox virus. or related viruses (monkeypox virus). Vaccination with the vaccinia virus can cause adverse effects and complications in the vaccinated person, such as eczema, myocarditis, progressive or generalized vaccinia, or encephalitis, which can result in the death of the individual. The classic vaccination with the vaccinia virus is contraindicated in individuals with immunodeficiencies, such as those infected with the human immunodeficiency virus, because of the high risk of progressive or generalized vaccinia. The pathology caused by infection with virulent viruses (smallpox virus or monkeypox virus) is due to a generalized infection with high levels of viral replication in internal organs and in the skin that can lead to the death of the individual. The use of antibodies specific to the SECRET domain neutralizes the biological activity of these viral proteins and their interaction with GAGs, reducing the ability of the virus to block the immune system and allowing the immune system to control virus replication more effectively in the infected individual. Treatment with these neutralizing antibodies would limit the replication of the vaccinia virus used in vaccinations, reducing the adverse effects of vaccination, and virulent viruses (smallpox virus and monkeypox virus), reducing the pathology and mortality caused by these virulent viruses.

In another aspect, the invention relates to the use of a SECRET chemokine binding domain of a viral protein selected from CrmB, CrmD, SCP-1, SCP-2 and SCP-3, a functional homologue, derivative or fragment thereof. , in the manufacture of a medicament for the treatment of autoimmune or inflammatory diseases, characterized in that said SECRET domain is capable of binding to a glycosaminoglycan (GAG).

In a particular embodiment, the SECRET chemokine binding domain has an amino acid sequence with 80% homology with an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20.

In another particular embodiment, the amino acid sequence of a SECRET chemokine binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20.

In another particular embodiment, the amino acid sequence of the SECRET domain of CrmB is SEQ ID NO: 26 or SEQ ID NO: 28.

In another particular embodiment, the amino acid sequence of the SECRET domain of CrmD is SEQ ID NO: 22 or SEQ ID NO: 24. In another particular embodiment, the amino acid sequence of the SECRET domain of SPC-1 is SEQ ID NO: 6 or SEQ ID NO: 8, of SPC-2 is SEQ ID NO: 18 or SEQ ID NO: 20, and of SPC-3 is SEQ ID NO: 14 or SEQ ID NO: 16.

In a particular embodiment, said medicament increases the stability and / or immunomodulatory properties of at least one protein selected from CrmB, CrmD, SCP-1, SCP-2 and SCP-3. The interaction with GAGs allows the protein to stick to the cell surface and be less exposed to circulating proteases in the tissues and bloodstream, increasing its stability. The retention of proteins in the inflamed tissue allows it to act for longer periods and more effectively inhibit the inflammatory response, enhancing its immunomodulatory properties.

In another particular embodiment, the SECRET domain, its functional counterpart, derivative or fragment is fused to at least one vTNFR, or to a humanized anti-TNF antibody.

In another particular embodiment, the SECRET domain, its functional counterpart, derivative or fragment is fused to the TNF-binding N-terminal domain of vTNFR.

In another particular embodiment, the vTNFR is CrmB or CrmD. In another particular embodiment, the SECRET domain, its functional counterpart, derivative or fragment is fused to at least one hTNFR.

In another particular embodiment, the medicament comprises an immunosuppressant or an additional anti-inflammatory substance.

In another particular embodiment, the medicament comprises at least one specific antibody inhibiting the GAG binding capacity of the SECRET domain.

Throughout the description and the claims the word "comprises" and its variants are not intended to exclude other technical characteristics, additives, components or steps. For those skilled in the art, other objects, advantages and features of the invention will be derived partly from the description and partly from the practice of the invention. The following figures and examples are provided by way of illustration, and are not intended to be limiting of the present invention.

DESCRIPTION OF THE FIGURES

FIGURE 1. CrmD binds to GAGs with high affinity. A) Kinetics by SPR of the binding of CrmD to a chip coupled with 50 RUs of heparin. Different concentrations of purified CrmD (0-300nM) were injected onto a chip coupled with 50 RUs of heparin at 30 μΙ / min. The sensorgrams were aligned and adjusted to a global Langmuir 1: 1 model. The association (Ka), dissociation (Kd) and affinity (KD) constants are presented, along with the standard errors (EE). B) Competition of CrmD binding to heparin by soluble GAGs. Increasing concentrations of different soluble GAGs (0-1,000 Mg / ml), heparin (·), CSA (■), CSB () and HS (X) were incubated with 50nM CrmD for 15 min at 4 ° C, before passing the mixtures on the heparin chip. The maximum response in the equilibrium was collected and the percentage data was represented in relation to the response detected in absence of soluble GAGs.

FIGURE 2. CrmD binds to heparin and to the cell surface through the SECRET domain. A) Heparin binding assay by SPR. 300 nM of the purified proteins CrmD, CrmD163 and CRD-CrmD, were injected at 10 μΙ / min on heparin chips. The sensorgrams obtained for each construction are shown. The inverted arrows indicate the start and end of the injection. B) Surface binding assay of MOLT4 and L929 cells by cytometry. 200 nM of the purified proteins, vCCI of CPXV, E163 of ECTV, B18 of VACV, and CrmD, CrmD163 and CRD-CrmD of ECTV were incubated with 300,000 cells on ice for 30 min. After successive washing, the protein retained on the surface was detected by an anti-His mouse antibody (1: 400) followed by an appropriate secundane conjugated to Alexa488 (1: 500). The fluorescent signal (FL1: anti-mouseAlexa488) is shown with respect to the total of events analyzed in percentage in samples incubated without (gray) or with (white) recombinant protein.

FIGURE 3. CrmD and CrmD163 bind to the cell surface thanks to their interaction with GAGs. 300,000 CHO-K1 cells (normal GAG expression), CHO-745 (reduced GAG expression) and CHO-618 (without GAGs) were incubated with 200 nM of the CrmD, CrmD163 and CRD-CrmD proteins for 30 min at 4 ° C. After several washes, the cells were incubated with a 1: 400 dilution of the anti-His mouse antibody to label the retained protein and was detected by a secondary anti-mouse antibody conjugated to Alexa488 (1: 500). 20,000 events were collected from each sample that were analyzed by the FlowJo software. The area under the curve indicates the fluorescence with respect to the total analyzed events, in percentage, of cells incubated without (gray) or with (white) recombinant protein. FIGURE 4. The vTNFRs with SECRET domain are capable of binding to the cell surface. A L929 cell surface binding assay of purified proteins, CrmB_VARV, CrmE_CPXV, CrmC_CPXV and a CrmC-secret construction. This assay was analyzed both by cytometry and flow (A) and by immunofluorescence (B). A) The fluorescence (60x), with respect to the total events in percentage, is shown in samples incubated with the different recombinant proteins indicated (white) or without protein (gray). B) The coverslips on which the L929 cells were seeded were incubated with 100 nM of each protein for 1 hour at 4 ° C before fixation with 4% PFA for 30 minutes at RT. The same antibodies were used as for flow cytometry but with a 1: 500 dilution of the anti-His antibody and 1: 900 for the secondary conjugated with Alexa 488. The coverslips were assembled and the samples were analyzed by means of an Axioskop 2 Plus microscope. (Zeiss)

FIGURE 5. CrmD bound to GAGs can interact and inhibit mTNFa. TO)

SPR test in which 100 nM of mTNFa was injected at Ι ΟμΙ / min on a heparin chip before or after passing on the 500 nM CrmD (blue) or B18 VACV (green) chip, without regenerating the surface . Inverted triangles indicate the start and end of recombinant protein injection and the start of mTNFa injection. B) Precipitation experiment with agarose-heparin resin (HepAg). 400 nM of CrmD, CRD-CrmD and B18 of VACV were incubated with a heparin resin for 1 h. After washing, the resins were incubated with 400nM mTNFa for an additional 30 min and the presence of recombinant protein and mTNFa was analyzed by westem blot C) Cytotoxicity test of mTNFa on L929 cells. For cell binding, proteins, hTNFR2, CRD-CrmD, CrmC CrmC-SECRET and CrmD (10 Mg / ml), were incubated on 30,000 L929 cells for 30 minutes at 37 ° C. These same conditions were repeated for incubation in solution of the proteins with the mTNFa. The mixtures were subsequently added on L929 cells. The samples were analyzed in triplicate and the means and standard deviations of survival in percentage are shown in relation to the values collected in the absence of mTNFa. FIGURE 6. Expression of GAG1 -4 mutants and cell binding assays.

A) Coomasie blue stained gel showing ~ 500 ng of each of the GAG1-4 mutants expressed by recombinant baculovirus and purified by Ni-NTA affinity chromatography. B) Surface binding assay of CHO-K1 cells by flow cytometry. 200 nM of each of the mutants (GAG1: red, GAG2: purple, GAG3: blue, GAG4: green) and CrmD (black) were incubated with 300,000 cells. 10,000 events were collected using a Cantoll FACS cytometer and analyzed with the FlowJo software. The fluorescence of each sample is shown with respect to the total events analyzed in percentage. The gray curve marks the fluorescence signal of cells incubated in the absence of protein.

FIGURE 7. GAG1 -4 mutants inhibit migration efficiently.

Chemotaxis experiment in transwell with MOLT4 cells. Increasing amounts of the GAG1 -4 and CrmD mutants were pre-incubated with 70 nM of mCCL25. The average migration is shown, together with its standard deviation, of each of the samples analyzed in triplicate, in percentage of the migration in the absence of recombinant protein. To normalize the data taken in the absence of CK were used.

FIGURE 8. Sequence Alignments - CLUSTAL W (1 .82) "multiple sequence alignment"

FIGURE 9. Sequence Alignments - CLUSTAL W (1 .82) "multiple sequence alignment (CrmB / CrmD)"

FIGURE 10. Sequence Alignments - CLUSTAL W (1 .82) "multiple sequence alignment (CTDs)"

EXAMPLES The following specific examples provided in this patent document serve to illustrate the nature of the present invention. These examples are included for illustrative purposes only and should not be construed as limitations on the invention claimed herein. Therefore, the examples described below illustrate the invention without limiting its scope.

EXAMPLE 1: Materials and methods

 Cell lines

 The generation, amplification and titration of the recombinant baculovirus stocks were carried out in adherent Spodoptera frugiperda Sf9 insect cells maintained in culture in TC100 medium (Gibco) supplemented with 10% bovine fetal serum (FCS, Sigma), 2 mM of L- glutamine (Sigma) and antibiotics, 100 g / ml of a mixture of penicillin-streptomycin antibiotics (Sigma) and 25 g / ml of gentamicin (Sigma). Recombinant protein expression was done in H5 insect cells in suspension, maintained in Express Five medium (Gibco) with 8 mM L-glutamine and antibiotics. Both cell lines were cultured at 27 ° C.

The cell lines, L929 (mouse fibroblasts) were maintained in culture at 37 ° C, 95% RH and 5% C02 in DMEM medium (Gibco) supplemented with 10% FCS, 2 mM L-glutamine and antibiotics. These cells were used for the cytotoxicity experiments of TNF.

The MOLT4 cells used in the chemotaxis assays were grown in RPMI 1640 medium (MP Biomedicals) supplemented with 10% FCS, 2 mM L-glutamine and antibiotics, at 37 ° C, 95% RH and 5% C02.

For assays related to the analysis of protein binding to cell surfaces, lines derived from hamster ovary were used, CHO-K1 and its mutants for the expression of surface GAGs, CHO-618 (mutation in the enzyme galactosyltransferase) and CHO-745 (mutation in the enzyme xylosyltransferase). These lines were grown in DMEM medium: F12-HAM (Gibco), 1: 1 (v / v), duly supplemented with 10% FCS, 2 mM L-glutamine and antibiotics, at 37 ° C, 95% RH and 5% C02.

Cloning

The E6 Naval ECTV gene encoding the CrmD protein (1-320) was amplified by polymerase chain reaction (PCR) of the pMS1 vector using the 5 ^' CrmD34 and 3 ^' CrmD33 oligonucleotides incorporating the BamHI and Xhol in 5 ^' and 3 ^' , respectively. Thus, it was subcloned without its signal peptide (21-320) in the pFastBad vector, previously digested with BamHI and Xhol, so that the gene was in reading phase with the 5 ^' melitin signal peptide and with V5 tags and 6xHis in 3 ^' to facilitate its purification by affinity chromatography. The plasmid resulting from ligation was named pSP3. The same strategy was followed for cloning in this vector of the SECRET domain of CrmD, CrmD163 (CrmD163-320) using oligonucleotides 5 ^' CrmD36 and 3 ^' CrmD33, thus generating plasmid pSP4. Likewise, for cloning the short form of the N-terminal domain of CrmD, CRD-CrmD (CrmD21-151), in the vector pFastBad, oligonucleotides CrmD34 and CrmD87 were used to extract the PCR gene from the pMS1 template. After ligation of the PCR product in the vector digested with BamHI and Xhol, plasmid pSP6 was obtained.

A similar procedure was followed to clone in the pFastBad vector the other vTNFRs, CrmE of CPXV strain Elephantpox, CrmC of CPXV strain Brighton Red and CrmB of VARV strain Bangladesh 1975. The corresponding genes were amplified by PCR from pre-existing constructs in the laboratory. , by a pair of oligonucleotides (Table 1) that added the BamHI target in 5 ^' and Xhol in 3 ^' and then cloned into the pFastBad of the same way as explained above. The resulting constructs were called pSP8, pSP9 and pSP12, respectively.

The pSP24 construct, for baculovirus expression of a CrmC protein fused to the SECRET domain of CrmD, was generated by PCR extracting the corresponding plasmid pSP22 gene, which contained this fusion cloned into the pMS30 vector. For this, the 5 ^' CrmC-Sp BamHI and CrmD33 and pSP22 oligonucleotides were used as a template. Next, the PCR product was subcloned into the pFastBad vector on the BamHI and Xhol targets. All oligonucleotides used for the above constructs are listed in Table 1.

Table 1. List of oligonucleotides used for the generation of the different constructions. The name and sequence (5 'to 3') of the different oligonucleotides used are indicated. The final construction and the protein expressed in each plasmid are also noted. The sequence underlines the Xhol restriction sites (CTCGAG) or BamHI (GGATCC) that were incorporated for cloning.

 Oligonucleotide Sequence ConstrucProteína tion

 CrmD33 GCGCTCGAGGCATCTCTTTCA pSP3 CrmD ECTV

 CAATCATTTGG

 CrmD34 GCGGGATCCGATGTTCCGTAT pSP3 CrmD

 ACACCCATTAATGGG

 CrmD36 GCGGGATCCTTTAACAGCATA pSP4 CrmD 163

 GATGTAGAAATTAATATGTATC C

 CrmD87 G C G CTC G AG G C AC ATATTAC A pSP6 CRD-CrmD

 TCTC CTTTAG ATG

 5'CrmE- GGCGGATCCATGAAATGTGAA pSP8 CrmE CPXV SP BamHI CAAGGTGTCTC

 3'CrmE- GGCCTCGAGGTCCTTGTCATT pSP8 CrmE CPXV SP Xhol GGTTTACATTGATCAG

 5'CrmC-Sp C C C G G ATC C G ATATAC CTACT pSP9 CrmC CPXV BamHI TCGTCACTGCC

 3'CrmC-Sp GCGCTCGAGGCATTACATTTA pSP9 CrmC CPXV Xhol GATAGTTTGCATGG

5'CrmB VARV- GCGGGATCCGCACCGTATACA pSP12 CrmB VARV Sp BamHI CCACCCAATGG 3'CrmB VARV- GCGCTCGAGGCTAAAAAGCG pSP12 CrmB VARV

Sp Xhol GGTGGGTTTGG

Point CrmD mutants were made using the Quik Change Lightning Site-Directed Mutagenesis Kit (Agilent Technologies). This kit allows to carry out targeted mutations following a simple protocol. Briefly, based on the pSP3 vector (CrmD in pFastBad) in which the target gene is cloned, a PCR was performed with two complementary oligonucleotides containing the desired mutation. In this way the entire vector was copied incorporating the mutation. Next, the original DNA was digested with the Dpnl enzyme which, being methylated, is susceptible to digestion and transformed XLI Gold ultracompetent bacteria. Finally, the incorporation of the mutation was verified by sequencing the DNA extracted from individual colonies. Table 2 shows the list of oligonucleotides used for the generation of specific CrmD mutants for binding to GAGs.

TABLE 2. Oligonucleotides used for CrmD mutagenesis. The name of the mutant protein, the incorporated mutation, the name of the oligonucleotide and the sequence (5 'to 3') are indicated with residues that differ from the original sequence highlighted in red.

protein mutation Oligonsequence

 cleotide

 GAG1 K245A CrmD97 GCAGTGCAAGATTAATCTAGAATCGCAT

 GTAATTCTGGAAGAGAATCTAGA

GAG1 K245A CrmD98 TCTAGATTCTCTTCCAGAATTACATGCGA

 TTCTAGATTAATCTTGCACTGC

GAG2 R250A / R CrmD99 AGATTAATCTAGAAATCAAATGTAATTCT

 253A G G AG C AG AATCTG C AC AACTAAC AC C C A

 CGACGAAG

GAG2 R250A / R CrmD 100 CTTCGTCGTGGGTGTTAGTTGTGCAGAT

 253A TCTGCTCCAGAATTACATTTGATTTCTAG

 ATTAATCT

GAG3 K177A CrmD101 GTAGAAATTAATATGTATCCTGTTAACGC

 GACCTCTTGTAATTCGAGTATAGGAAG

GAG3 K177A CrmD 102 CTTCCTATACTCGAATTACAAGAGGTCGC

 GTTAACAGGATACATATTAA I I I CTAC

GAG4 K218A CrmD 103 TCTTTATTCGAGATTACTATTCAGTCGTT G ATG C ACTAG C AACTTC AG GTTT

 GAG4 K218A CrmD104 AAACCTGAAGTTGCTAGTGCATCAACGA

 CTGAATAGTAATCTCCAATAAAGA

Generation of recombinant baculovirus

 Recombinant baculoviruses were generated using the Bac-to-Bac expression system (Invitrogen) following the manufacturer's instructions. Briefly, the genes cloned into the pFastBad vector can be integrated into bacilli of the baculovirus genome under the activity of the polyhedrin promoter by transforming competent Obac DHI cells after a transposition process. The DNA of the recombinant bacmids thus obtained was purified and transfected with cellfectine (Invitrogen) in Sf9 insect cells following the manufacturer's instructions. Recombinant baculoviruses were collected at 72 h post-transfection of the supernatants of the transfected cells. These viruses were called PO (pass 0) and were stored at 4 ° C and in the dark. Subsequently, these POs were titrated and amplified in one step by infection of Sf9 cells at a very low multiplicity of infection (moi = 0.01-0.05 plaque forming unit (pfu) / cel) in order to generate a stock of high-titre recombinant baculovirus (greater than 5 x 10 7 pfu / ml) for recombinant protein expression.

Expression and purification of recombinant proteins

H5 insect cells were infected at high moi (moi = 2-5 pfu / cel) with the corresponding recombinant baculoviruses. At 72 h post-infection the supernatants of the infection (100 ml) were collected and clarified by two successive centrifugations for 5 min at 1,200 rpm and 40 min at 6000 rpm, respectively. Subsequently, they were concentrated using the Stirred Ultrafiltration Cell 8200 (Amicon) system to obtain a final volume of 2.5 ml using YM membranes (Millipore) of a pore diameter size for a molecular weight limit (MWCO) of 10,000 Da. The supernatants thus concentrated were filtered with 0.22 μηι filters and dialyzed in "binding buffer" (50 mM sodium phosphate (pH 7.4), 300 mM NaCI, 10 mM imidazole) using PD10 filtration gel columns ( Amersham Biosciences). The protein was purified by nickel affinity chromatography (Nickel-NTA resin, Qiagen). For this, the concentrated and dialyzed supernatants were incubated in "binding buffer" for 1 h at 4 ° C with 0.5 ml of resin per 100 ml of initial supernatant. Then, the resin was mounted on a column (Poly-Prep, Bio-Rad) and washed with 40 ml of "wash buffer" (50 mM sodium phosphate (pH 7.4), 300 mM NaCI, 20 mM imidazole) to remove bound proteins specifically. After that, the protein of interest was eluted by "elution buffer" with increasing concentrations of imidazole (60, 100 and 250 mM) in 50 mM sodium phosphate (pH 7.4), 300 mM NaCI. The protein was collected in fractions of 0.5 ml each and analyzed by polyacrylamide gel electrophoresis with sodium dodecyl sulfate (SDS-PAGE) and Coomassie blue staining. Subsequently, the fractions with the highest degree of purity and amount of protein were pooled, concentrated and dialyzed in PBS using Vivaspin 500 (Sartorius) micro columns with a MWCO of 10,000 Da. Finally, the exact concentration of the protein stocks obtained was determined by BCA (BCA protein assay kit, Pierce) and densitometry with respect to both calibrations with BSA (Sigma).

Resonance of surface plasmons

A chip coupled with biotinylated heparin (Calbiochem) was generated. 2,000 RUs of streptavidin (Sigma), diluted in acetate pH 4.0 to 0.2 mg / ml, were coupled into a CM4 chip by the covalent immobilization system by amines in the two cells of the chip. The active sites of the matrix were blocked with 1 M ethanolamine pH 8.5 and then 5 g / ml of biotinylated heparin diluted in HBS-EP with 300 mM NaCI was passed through one of the two cells. The other cell, in which only streptavidin was coupled, was used as a control for nonspecific junctions. In this way, 50 RUs of heparin were captured almost irreversibly due to the high affinity of the streptavidin-biotin interaction (KD ~ 10-14 M). To analyze the affinity for heparin, different concentrations of purified recombinant protein in HBS-EP buffer were passed, subsequently regenerating the chip with injections of 1 min with 2M MgCl2. The sensorgrams were standardized and adjusted to a Langmuir 1: 1 model to determine the affinity constants using the Bioevaluation 3.2 software package.

The specificity of the CrmD-heparin interaction was evaluated by a competition assay with soluble GAGs, heparin, heparan sulfate (HS) and chondroitin sulfate A (CSA) and B (CSB) (Sigma). For this, the CrmD protein (30 nM), diluted in HBS-EP, with increasing amounts of the various soluble GAGs, was pre-incubated on ice for 15 min. The mixture was passed through the heparin chip and the equilibrium response was collected for each sample. The percentage of the signal increase in each sample was analyzed with respect to the value obtained for the CrmD protein in the absence of soluble GAGs.

Flow cytometry

The binding of recombinant protein to the surface of the cell lines, L929, MOLT4 and CHO cell mutants for the expression of surface GAGs, CHO-K1, CHO-618 and CHO-745 was analyzed. CHO-K1 cells have a normal expression of surface GAGs, however, CHO-745 cells do not synthesize HS or CS and CHO-618 absolutely lack any type of surface GAGs (Zhang et al., 2006). 300,000 cells were incubated with 200 nM protein in 50 μΙ of PBS-staining (PBS supplemented with 1% FCS and 1% BSA) for 30 min on ice. To detect surface proteins, it was incubated for 20 min with a 1: 400 dilution in PBS-staining of the anti-PentaHis monoclonal mouse antibody (Qiagen) followed by the marking with a secondary anti-mouse antibody conjugated to Alexa488 (Invitrogen) at 1: 500 in PBS-staining in darkness for 20 min. 10,000 events were collected on a FACSCantoll cytometer (BD Bioscience) and analyzed in the FlowJo 7.2.2 software (Treestar). Immunofluorescence

 L929 cells seeded at confluence were used on coverslips previously washed with ethanol and exposed to UV light. The cells were incubated with 150 μΙ of 200 nM of the recombinant protein in PBS-staining for 30 min at 4 ° C and then fixed with 4% PFA in PBS at room temperature (RT). The covers were washed three times and the nonspecific sites were blocked by incubating with PBS supplemented with 5% FCS for 15 min at RT. To detect the surface protein, a 1: 600 dilution in PBS supplemented with 1% FCS of the anti-V5 mouse monoclonal antibody (Invitrogen) was used followed by marking with a secondary anti-mouse antibody conjugated to Alexa488 (Invitrogen) diluted 1: 900 in PBS supplemented with 1% FCS. For assembly, the covers were passed sequentially through PBS, water and ethanol and placed on the slides with a drop of Prolong mounting medium (Invitrogen). The samples were observed and analyzed by means of an Axioskop2 plus (Zeiss) fluorescence microscope coupled to a Coolsnap FX camera (Roper Scientific) controlled by MetaVue 5.07 software (Molecular Devices).

Precipitation with heparin resin

The recombinant proteins used for this assay were incubated in the presence or absence of TNFa, for 1 h at RT under rotational agitation with 20 μΙ of an agarose-coupled heparin resin (50%, v / v) in 400 μΙ of binding buffer ( PBS supplemented with 0.2% FCS). After that time the agarose spheres were recovered by centrifuging 1 min at 13,000 rpm. The supernatants were decanted and the spheres were washed with binding buffer three times. The bound protein was eluted from the resin by adding 25 μΙ of loading buffer for SDS-PAGE and boiling the sample for 5 min. Proteins were detected by immunoblotting (Western blot) with anti-PentaHis (1: 2,000) (Qiagen) and anti-TNF (1: 1,000) (R&D Systems) antibodies and secondary anti-mouse peroxidase conjugates (1 : 5,000) (GE Healthcare) and anti-goat (1: 1, 000) (R&D Systems), respectively. Cytotoxicity assays with TNFa

 To assess the in vitro activity of the different CrmD constructs, cytotoxicity experiments were carried out on L929 cells, a line of mouse fibroblasts, following a protocol set up in the laboratory (Alejo et al., 2006). For this, 6 pM of mouse TNFa was incubated in the absence or presence of 10ug / ml of recombinant protein. After 1 h of incubation at 37 ° C in DMEM supplemented with 2% FBS, the mixture was added on L929 cells seeded the day before in M96 plates at 10,000 cells / well. To accelerate the cytotoxic effect of the cytokine used in each case, the transcription inhibitor, actinomycin D (Sigma), was added to the cells at a final concentration of 4 g / ml. To assess whether the proteins retained on the cell surface could effectively inhibit the action of TNFa, the experiment was repeated by previously incubating the proteins with the cells. After 30 minutes of incubation and those from washed with fresh medium, TNFa was added under the same conditions as explained above.

After 18 h of incubation, cell viability was measured by adding 20 μΙ per well of Cell Titter AQueous One Solution (Promega) and determining the absorbance at 492 nm in a Sunrise plate reader (Tecan).

Chemotaxis Assays

 With the objective of evaluating the anti-CK capacity of CrmD and other recombinant proteins, CKs-induced migration inhibition experiments were performed in transwell (Zaballos et al., 1999).

On the test day MOLT4 cells were harvested in exponential growth, and after washing with PBS, resuspended at 10 x 10 ⁶ cells / ml in RPMI supplemented with 0.1% FCS. For these tests, M96 plates were used in transwell (Neuroprobe). In the lower wells the CK CCL25 was incubated in the absence or presence of increasing amounts of purified protein in RPMI supplemented with 0.1% FCS, at 37 ° C for 30 min. The membrane was placed on the plate and 25μΙ of the cell suspension was distributed in each of the upper compartments. After 3-4 h of migration at 37 ° C, the remaining cells of the upper compartments were washed with PBS and the plates were centrifuged two min at 1000 rpm before removing the membrane. The number of cells that crossed the membrane into the lower wells where the CK was located was quantified by adding 5 μΙ / well of Cell Titter AQueous One Solution (Promega) and measuring the absorbance at 492 nm. The results were represented as the percentage in relation to migration in the absence of recombinant protein. Data were previously normalized with absorbance in the absence of CK.

Results

SECRET domains encoded by poxviruses that interact with GAGs Viral genes and proteins that include a SECRET chemokine-binding domain with the ability to bind to GAGs consist of the following sequences (see Sequence Listing):

 - CPXV CrmD: V221 gene (SEQ ID No 1) and protein (SEQ ID No 2)

 - ECTV CrmD: E3 gene (SEQ ID No 3) and protein (SEQ ID No 4)

- ECTV SCP-1 SECRET domain: E12 gene (SEQ ID No 5) and protein (SEQ ID No 6)

 - SECRET domain of SCP-1 of CPXV: gene V014 (SEQ ID No 7) and protein (SEQ ID No 8)

 - VARV CrmB: G2R gene (SEQ ID No 9) and protein (SEQ ID No 10)

- CPXV CrmB: V005 gene (SEQ ID No. 1 1) and protein (SEQ ID No. 12)

- SECRET domain of SCP-3 of CPXV: gene V218 (SEQ ID No 13) and protein (SEQ ID No 14)

 - VACV SCP-3 SECRET domain: VACWR206 gene (SEQ ID No 15) and protein (SEQ ID No 16)

- VACV SCP-2 SECRET domain: VACWR189 gene (SEQ ID No 17) and protein (SEQ ID No 18) - ECTV SCP-2 SECRET domain: E184 gene (SEQ ID No 19) and protein (SEQ ID No 20)

 - SECRET domain of CPXV CrmD: gene (SEQ ID No 21) and protein (SEQ ID No 22)

- SECRET domain of ECTV CrmD: gene (SEQ ID No 23) and protein (SEQ ID No 24)

 - CPXV CrmB SECRET domain: gene (SEQ ID No 25) and protein (SEQ ID No 26)

 - VARV CrmB SECRET domain: gene (SEQ ID No 27) and protein (SEQ ID No 28)

 Different sequence alignments showing the homology of

Amino acids are shown in Sequence Alignments.

CrmD joins GAGs with high affinity

First, the possible interaction of CrmD to GAGs was analyzed by SPR studies with hepanna chips. 50 RUs of biotinylated hepanna were coupled to CM4 chips in which 2,000 RUs of streptavidin had previously been immobilized. Then, 300 nM of recombinant CrmD in HBS-EP buffer was injected onto the chip, observing a very significant response and indicative of a strong bond between CrmD and hepanna. In fact, the affinity of this CrmD-heparin interaction was calculated, injecting different concentrations of CrmD on the chip, obtaining an affinity constant KD = 3.30 nM (Figure 1A) which places it in the same order as the interactions of B18 (Montanuy et al., 201 1) and E163 (Ruiz-Arguello et al., 2008) with hepanna.

The specificity of the interaction of CrmD with GAGs was also studied by performing competition experiments in which the binding of CrmD to the heparin chip was competed with increasing concentrations of different soluble GAGs. Soluble heparin was the one that presented the best efficacy in inhibiting the binding of CrmD to the surface. However, both HS and CSA and CSB, with a lower degree of sulfation, also blocked the interaction CrmD-heparin in a dose-dependent manner although with worse efficiency than heparin. While with less than Ιμς / ηιΙ of heparin it was possible to inhibit 50% of the CrmD binding to the surface, at least 10Mg / ml of CSA, CSB or HS was needed to block 50% of the interaction (Figure 1 B). No significant differences were found between HS, CSA and CSB. These data suggest that CrmD is able to interact with different types of GAGs but has a greater affinity for heparin.

CrmD interacts with GAGs through the SECRET domain

CrmD has been shown to be able to interact with GAGs, which would potentially attribute the ability to bind to cell surfaces or the extracellular matrix. In order to know if this interaction with GAGs was mediated by one domain or another or if it was a property of the complete protein, 300 nM of the CRD-CrmD and CrmD163 recombinant proteins were injected onto the heparin chip. The CrmD163 protein, which contains the SECRET domain, was able to interact with heparin, however, for CRD-CrmD no binding was detected (Figure 2A).

Cellular surfaces are rich in GAGs. To confirm that the binding to GAGs of CrmD and CrmD163, allowed these proteins to be retained on cell surfaces, a flow cytometry assay was used in which 200 nM of the different recombinant proteins were incubated with L929 and MOLT4 cells. As can be seen in Figure 2B, only CrmD and CrmD163 were retained on the surface of these two cell lines, while the presence of CRD-CrmD was not detected. The E163 and B18 proteins are shown as positive controls of the interaction with the surface and vCCI as a negative control.

In order to confirm that the interaction of CrmD with the cell surface was mediated by GAGs, a flow cytometry experiment similar to the previous one was performed in which three cell lines with different surface pattern of GAGs expression were used (Figure 3 ): i) CHO-K1 cells that they have 40-70% of HS and 30-55% of CS, i) CHO-745 cells with reduced GAG expression and iii) the CHO-618 line that completely lacks GAGs. As shown in Figure 43, while CrmD and CrmD163, but not CRD-CrmD, bound to the surface of CHO-K1 cells, none of the proteins were retained on the surface of CHO-745 or CHO-618 cells. These results corroborated that CrmD is capable of binding to the GAGs present in cell membranes and that it does so through the SECRET domain.

A similar experiment was performed for binding to L929 cells using the four different purified vTNFRs, CrmD_ECTV, CrmB_VARV, CrmC_CPXV and CrmE_CPXV. As seen in Figure 4, only CrmB_VARV and CrmD_ECTV joined CHO-K1 cells while CrmC_CPXV and CrmE_CPXV, lacking SECRET domain, as expected, were not retained (Figure 4A). However, a baculovirus-generated construct expressing CrmC fused to the CrmD SECRET (CrmC-SECRET) did interact with the surface of these cells (Figure 4A). This same result was confirmed by performing an immunofluorescence of L929 cells incubated with 200 nM of each vTNFR. Fluorescent label was observed only in those cells that were incubated with CrmD_ECTV, CrmB_VARV or CrmC-SECRET (Figure 4B). In this way, it could be concluded that the vTNFRs, CrmD and CrmB, join GAGs thanks to their binding domain to CKs SECRET.

By binding to GAGs, CrmD can interact with TNFoc on the cell surface

To know if CrmD linked to GAGs is capable of interacting with TNF, two different approaches were used, a SPR test and a precipitation with heparin coupled to an agarose resin. Through SPR, it was found that mTNFa was able to interact with CrmD previously bound to the heparin surface. 300 nM CrmD was injected onto the heparin chip and without regenerating the surface 100 were passed nM of mTNFa. An increase in the signal was observed when injecting the mTNFa that was not detected when the cytokine was passed after the binding of 300 nM of VACV B18, a protein not relevant for the binding of mTNFa but which does bind GAGs (Figure 5A) . Therefore, CrmD can interact simultaneously with mTNFa and with GAGs.

These results were confirmed by precipitation with an agarose-heparin resin. This resin was incubated for 1 h with 200 nM B18 of VACV, CRD-CrmD and CrmD. After this incubation and the corresponding washes 200 mM of mTNFa was added to the resin and the samples were analyzed by western blot to detect the presence of mTNFa and the recombinant protein. As shown in Figure 5B, CrmD (line 4) and B18 of VACV (line 9), but not CRD-CrmD (line 6), were bound to the resin and also the mTNFa was retained only in the resin previously incubated with CrmD (line 4) (Figure 5B).

In order to also know if this interaction of CrmD with mTNFa on the surface was also effective in blocking the effects of cytokine, a cytotoxicity experiment was performed with L929 cells with a variation. The proteins to be studied, CrmD, CRD-CrmD, CrmC, CrmC-SECRET and hTNFR2 were previously incubated on the cells at 10 g / ml. After a series of washes an active amount of mTNFa (6 pM) was added and at 16 h the cell viability was checked. As a control, the conditions of this experiment were repeated but pre-incubating the recombinant proteins with mTNFa and adding the mixture on L929 cells after 1 h. It was observed that, effectively, in solution, all proteins inhibited cell death. However, only CrmD and the CrmC-SECRET protein were retained after washing on the surface of the cells and could subsequently interact with the mTNFa inhibiting its effect (Figure 5C). These results suggest that the binding of CrmD with GAGs does not interfere with the binding of TNFa and that, in this way, CrmD can inhibit TNF on the surface of cells. In addition, adding a SECRET domain to CrmC achieved a protein. (CrmC-SECRET) capable of retaining on the cell membrane and protecting against the subsequent cytotoxic effect of mTNFa.

Identification of residues involved in binding to GAGs present in the SECRET domain

 Two consensus sequences have been defined for binding to GAGs, -XBBBXXBX- and -XBBXBX-, where B is a basic residue and X is a hydropathic residue (Hileman et al., 1998). However, there is great diversity in the motifs in GAG binding proteins. These types of motifs can be found in the sequence of some GAG-binding proteins such as B18 from VACV (Montanuy et al., 201 1) or E163 from ECTV (Ruiz-Arguello et al., 2008).

On the other hand, in the sequence of the SECRET domain, similar motifs that could be mediating the interaction of GAGs cannot be identified. To know the molecular basis of the interaction of CrmD with GAGs, four point mutants were constructed in which one or several basic residues were changed to alanines. These four mutants were named GAG1 (K245A), GAG2 (R250A / R253A), GAG3 (K177A) and GAG4 (K177A / K218A) and were expressed by the baculovirus system (Figure 6A).

With these purified mutants, cell binding experiments were performed with the CHO-K1 cell line. 200 nM of each mutant and CrmD as a control, were incubated with CHO-K1 cells at 4 ° C for 30 min. As shown in Figure 6B, the GAG3 and GAG4 mutants bound to the cell surface with a degree similar to CrmD, while retention of the GAG1 protein was clearly affected and the GAG2 mutant barely interacted with the cell surface. CHO-K1. This result suggests that residues K245, R250 and R253, are involved in the swelling of the contacts with the negative charges of the surface GAGs. It was found that the amino acid changes generated in the GAG1, GAG2, GAG3 and GAG4 mutants did not affect the anti-CK activity of the SECRET domain. For this, an in vitro chemotaxis experiment was performed in which increasing concentrations of these mutants (GAG1-4) were pre-incubated with 70 nM of mCCL25. The ability to inhibit the migration of MOLT4 cells under these conditions of each mutant with respect to the CrmD protein was compared. Both GAG1, GAG2, GAG3 and GAG4 inhibited mCCL25-induced migration in a manner comparable to CrmD protein, reducing it to 50% or less when incubated with 140 nM (1: 2 molar ratio) of recombinant proteins with CK (Figure 7). In this way, it was shown that mutagenized residues in the GAG1-4 mutants are not involved in the interaction with CKs. Therefore, a mutant, GAG2, has been generated, unable to bind to cell surfaces but not inerting with the anivity of CrmD.

Thus, by means of the R250A / R253A (GAG2) mutation, a CrmD version has been generated that has the same ability to block TNF and CKs in suspension as the parental protein, but lacks the residues involved for interaction with GAGs and consequent retention on the cell surface.

Discussion

Previous data from the laboratory, provide the SECRET domain with great importance in the evasion of the immune system carried out by CrmD. Always in a context of infection in which TNFa is inhibited. The elimination of this anti-CK domain, results in an ECTV RevCRDs with an attenuation of five orders of magnitude with respect to ECTV RevCrmD. Since ECTV expresses other proteins with anti-CKs capabilities (E163, vCCI, SCP2 and SCP3), it is surprising that the removal of a domain that only blocks a small group of CKs has such a dramatic effect on the virulence of ECTV. Therefore, one might expect the addition of this Anti-CKs domain to a protein with anti-TNF activity could be a substantial advantage for the virus. The action of the SECRET domain seems to have to do with the anti-TNFa function of CrmD but no positive cooperativity was observed in the binding of the different ligands and both domains are structurally and functionally independent.

However, we have discovered that the SECRET domain is capable of interacting with surface GAGs with great affinity. In addition, thanks to this new function of the SECRET domain, CrmD can inhibit the action of TNFa on the cell membrane, close to the cytokine receptors. By interacting with GAGs, CrmD could not only increase its stability in vivo, but also allow it to increase its concentration around cellular TNFRs. At the same time, its great affinity for GAGs could allow CrmD to displace CKs from surfaces preventing the formation of chemotactic gradients, a strategy used, for example, by the E163 protein to interfere with the functions of CKs ( Ruiz- Arguello et al., 2008).

Although there is no reason for binding to GAGs in the amino acid sequence of CrmD, we have defined some residues in the sequence of the SECRET domain important for binding to GAGs, K245, R250 and R253.

From another point of view, TNFa is a molecule involved in some chronic inflammatory disorders such as rheumatoid arthritis or Crohn's disease. The new clinical treatments are based on the use of biological drugs consisting of recombinant antibodies (infliximab, adalimumab) or, more recently, less immunogenic molecules, such as etanercept consisting of a dimer of the TNFR2 extracellular domain fused to a human Fe fragment. In line with what was observed in the pathogenesis of ECTV, it is likely that in addition to TNFa, CKs play an important role in the development of the disease, therefore, predictably, the addition of a SECRET domain to etanercept could enhance the anti-inflammatory effect of this molecule, thanks to the anti-CK effect. On the other hand, one of the functions of the Fe fragment is to guarantee the stability and transport of the drug, thanks to its interaction with the Fe cell receptors, in the body. A SECRET domain could successfully replace these two functions of the Fe portion, providing stability and transport of the molecule thanks to its interaction with GAGs on cell surfaces. In addition, in this way, some side effects due to activation of the complement system produced by the Feet of etanercept (Horiuchi et al., 2010) would be avoided.

BIBLIOGRAPHY

Alcami, A. 2003. Viral mimicry of cytokines, chemokines and their receptors. Nat Rev Immunol 3: 36-50.

Alejo, A., M.B. Ruiz-Arguello, Y. Ho, V.P. Smith, M. Saraiva, and A. Alcami. 2006. A chemokine-binding domain in the tumor necrosis receptor factor from variola (smallpox) virus. Proc Nati Acad Sci U S 103: 5995-6000.

Cunnion, K.M. 1999. Tumor necrosis factor receptors encoded by poxviruses. Mol Genet Metab 67: 278-282.

Handel, T.M., Z. Johnson, S.E. Crown, E.K. Lau, and A.E. Proudfoot 2005. Regulation of protein function by glycosaminoglycans-as exemplified by chemokines. Annu Rev Biochem 74: 385-410.

Hileman, R.E., J.R. Fromm, J.M. Weiler, and R.J. Linhardt 1998. Glycosaminoglycan-protein interactions: definition of consensus sites in glycosaminoglycan binding proteins. Bioessays 20: 156-167.

Ho uchi, T., H. Mitoma, S. Harashima, H. Tsukamoto, and T. Shimoda. 2010. Transmembrane TNF-alpha: structure, function and interaction with anti-TNF agents. Rheumatology (Oxford) 49: 1215-1228.

Montanuy, I., A. Alejo, and A. Alcami. 201 1. Glycosaminoglycans mediate retention of the poxvirus type I inferred binding protein at the cell surface to locally block inferred antiviral responses. Phase J 25: 1960-1971. Proudfoot, AE, TM Handel, Z. Johnson, EK Lau, P. LiWang, I. Clark-Lewis, F. Borlat, TN Wells, and MH Kosco-Vilbois. 2003. Glycosaminoglycan binding and oligomerization are essential for the in vivo activity of certain chemokines. Proc Nati Acad Sci USA 100: 1885-1890.

Ruiz-Arguello, M.B., V.P. Smith, G.S. Campanella, F. Baleux, F. Arenzana- Seisdedos, A.D. Luster, and A. Alcami. 2008. An ectromelia virus protein that interacts with chemokines through their glycosaminoglycan binding domain. J Virol 82: 917-926.

Tak, P.P., and J.R. Kalden 201 1. Advances in rheumatology: new targeted therapeutics. Arthritis Res Ther 13 Suppl 1: S5.

Wong, M., D. Ziring, Y. Korin, S. Desai, S. Kim, J. Lin, D. Gjertson, J. Braun, E. Reed, and R.R. Singh. 2008. TNFalpha blockade in human diseases: mechanisms and future directions. Clin Immunol 126: 121-136.

Zaballos, A., J. Gutiérrez, R. Varona, C. Ardavin, and G. Márquez. 1999. Cutting edge: identification of the orphan chemokine receiver GPR-9-6 as CCR9, the receiver for the chemokine TECK. J Immunol 162: 5671-5675. Zhang, L, R. Lawrence, B.A. Frazier, and J.D. Esko 2006. CHO glycosylation mutants: proteoglycans. Methods Enzymol 416: 205-221.

Claims

one . Fusion polypeptide comprising:

 - a SECRET chemokine binding domain of a viral protein selected from CrmB, CrmD, SCP-1, SCP-2 and SCP-3, a functional homologue, derivative or fragment thereof, covalently linked to

- a polypeptide sequence of the same or different origin as the SECRET domain,

 wherein the SECRET chemokine binding domain of said fusion polypeptide binds to the cell surface through a glycosaminoglycan (GAG) present on said cell surface.

2. A polypeptide according to claim 1, wherein the SECRET chemokine binding domain has an amino acid sequence with at least 80% homology with an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: twenty.

3. Polypeptide according to claim 2, wherein the SECRET chemokine binding domain has an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 22, SEQ ID NO : 24, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20.

4. Polypeptide according to claim 1, wherein the SECRET domain of CrmB is SEQ ID NO: 26 or SEQ ID NO: 28.

5. Polypeptide according to claim 1, wherein the amino acid sequence of the SECRET domain of CrmD is SEQ ID NO: 22 or SEQ ID NO: 24.

6. Polypeptide according to claim 1, wherein the amino acid sequence of the SECRET domain of SPC-1 is SEQ ID NO: 6 or SEQ ID NO: 8, of SPC-2 is SEQ ID NO: 18 or SEQ ID NO: 20, and of SPC-3 is SEQ ID NO: 14 or SEQ ID NO: 16.

7. Fusion polypeptide according to any one of claims 1 to 6, wherein the polypeptide sequence is the recipient of the viral tumor necrotizing factor (vTNFRs).

8. Fusion polypeptide according to claim 7, wherein the polypeptide sequence is the N-terminal domain of tumor necrotizing factor (TNF) binding of viral tumor necrotizing factor receptors (vTNFRs).

9. Fusion polypeptide according to any one of claims 1 to 6, wherein the polypeptide sequence is the human tumor necrotizing factor receptor (hTNFRs).

10. A polynucleotide encoding a fusion polypeptide according to any one of claims 1 to 9.

eleven . A viral vector or expression plasmid comprising a polynucleotide according to claim 10.

12. Use of a fusion polypeptide according to any one of claims 1 to 9, a polynucleotide according to claim 10 or a viral vector or expression plasmid according to claim 1, in the preparation of a medicament for the treatment of autoimmune diseases or inflammatory

13. Pharmaceutical composition comprising a fusion polypeptide according to any one of claims 1 to 9, a polynucleotide according to the claim 10, or a viral vector or expression plasmid according to claim 1 1.

14. Composition according to claim 13, further comprising an immunosuppressant or an anti-inflammatory compound.

15. Use of a SECRET chemokine binding domain or an amino acid sequence with at least 80% homology with an amino acid sequence selected from the group consisting of SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO : 22, SEQ ID NO: 24, SEQ ID NO: 6, SEQ ID NO: 8,

SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18 and SEQ ID NO: 20, to obtain specific antibodies that inhibit GAGs binding capacity of the SECRET domain.

16. An antibody obtained according to claim 15.

17. Use of the antibodies described in claim 16, in the manufacture of a medicament for the treatment of adverse effects caused by vaccination with vaccinia virus or the pathology caused by smallpox virus and monkeypox virus.