WO2013153189A1 - Anti-adamts-5 antibody, derivatives and uses thereof - Google Patents

Anti-adamts-5 antibody, derivatives and uses thereof Download PDF

Info

Publication number
WO2013153189A1
WO2013153189A1 PCT/EP2013/057649 EP2013057649W WO2013153189A1 WO 2013153189 A1 WO2013153189 A1 WO 2013153189A1 EP 2013057649 W EP2013057649 W EP 2013057649W WO 2013153189 A1 WO2013153189 A1 WO 2013153189A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
antibody
amino acid
acid sequence
identity
Prior art date
Application number
PCT/EP2013/057649
Other languages
French (fr)
Inventor
Riccardo Chiusaroli
Michela Visintin
Gianfranco Caselli
Lucio Claudio Rovati
Original Assignee
Rottapharm Biotech S.R.L.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to IN1868MUN2014 priority Critical patent/IN2014MN01868A/en
Priority to MX2014012295A priority patent/MX2014012295A/en
Priority to CN201380019819.6A priority patent/CN104245737B/en
Priority to US14/390,466 priority patent/US9631029B2/en
Priority to RU2014145536A priority patent/RU2014145536A/en
Priority to KR1020147031200A priority patent/KR20150003278A/en
Application filed by Rottapharm Biotech S.R.L. filed Critical Rottapharm Biotech S.R.L.
Priority to CA2869031A priority patent/CA2869031A1/en
Priority to JP2015504963A priority patent/JP2015518476A/en
Priority to AU2013246880A priority patent/AU2013246880B2/en
Priority to EP13715240.1A priority patent/EP2836516B1/en
Publication of WO2013153189A1 publication Critical patent/WO2013153189A1/en
Priority to HK15102792.9A priority patent/HK1202296A1/en

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against enzymes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/16Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46Hydrolases (3)
    • A61K38/48Hydrolases (3) acting on peptide bonds (3.4)
    • A61K38/4886Metalloendopeptidases (3.4.24), e.g. collagenase
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • A61K39/39533Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
    • A61K39/39558Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/02Drugs for skeletal disorders for joint disorders, e.g. arthritis, arthrosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/04Drugs for skeletal disorders for non-specific disorders of the connective tissue
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P19/00Drugs for skeletal disorders
    • A61P19/08Drugs for skeletal disorders for bone diseases, e.g. rachitism, Paget's disease
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/38Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against protease inhibitors of peptide structure
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/64Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
    • C12N9/6402Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals
    • C12N9/6405Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from non-mammals not being snakes
    • C12N9/6416Metalloendopeptidases (3.4.24)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/21Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/20Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/50Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/565Complementarity determining region [CDR]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/60Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622Single chain antibody (scFv)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • This invention relates to anti-ADAMTS-5 antibodies useful in the treatment of a condition associated with cartilage degradation.
  • Osteoarthritis is a group of overlapping distinct diseases, which may have different etiologies but similar biologic, morphologic, and clinical outcomes.
  • the disease process not only affects the articular cartilage, but involves the entire joint, including the subchondral bone, ligaments, capsule, synovial membrane, and periarticular muscles.
  • the articular cartilage degenerates with fibrillation, fissures, ulceration, and full thickness loss of the joint surface.
  • This condition is characterised by focal areas of loss of articular cartilage within synovial joints, associated with hypertrophy of bone (osteophytes and subchondral bone sclerosis) and thickening of the capsule. It may be interpreted as the reaction of synovial joints to injury.
  • This phenomenon can occur in any joint, but is most common in selected joints of the hand, spine, knee, foot and hip.
  • This pathological change when severe, results in radiological changes (loss of joint space and osteophytes), which have been used in epidemiological studies to estimate the prevalence of OA at different joint sites.
  • the molecular and cellular mechanisms at the basis of the onset of OA are, at present, unknown; it is hypothesised that abnormal load as well as trauma may have a role, but it seems certain that genetics and heritable factors are also involved. Inflammation, when present, is only secondary to a primary event.
  • OA is the most common form of arthritis.
  • the World Health Organization (WHO) estimates that, worldwide, 9.6% of men and 18% of women aged over 60 years have symptomatic OA, classifying OA as the 4th cause of disability in women and the 8th cause in men. It is considered that the risk of disability is the same for knee OA as for cardiac disease.
  • RA Rheumatoid arthritis
  • RA Rheumatoid arthritis
  • OA and RA can be triggered by different causes and progress according to different pathways, they share the underlying process which consists of an imbalance in cartilage matrix synthesis and breakdown, leading to the destruction of the articular cartilage which in turn results in restricted joint movement, joint instability, pain and chronic disability.
  • DMARD disease-modifying agents antirheumatic drugs
  • OA in the absence of a cure, treatment can only be palliative, being limited to the use of COX-2 selective inhibitors, such as celecoxib, and traditional non-steroidal anti-inflammatory drugs (NSAIDs), such as naproxen and diclofenac, or even older drugs for pain control, such as acetaminophen.
  • COX-2 selective inhibitors such as celecoxib
  • NSAIDs non-steroidal anti-inflammatory drugs
  • naproxen and diclofenac or even older drugs for pain control, such as acetaminophen.
  • An additional class of drugs which includes compounds such as chondroitin and glucosamine sulfate, also exists as a treatment option for OA, but many physicians remain unconvinced about their efficacy.
  • DMARDs in particular methotrexate and the availability of new biologic agents, typically supported by NSAIDs and/or corticosteroids to provide pain relief, as well as to control inflammation to some degree have dramatically enhanced the success of its management.
  • traditional DMARDs have a slow onset of action and toxicity that mandates frequent monitoring.
  • NSAIDs use has been overshadowed by gastrointestinal side-effects, when considering classical NSAIDs drugs, and by cardiovascular and renal side-effects when considering selective COX-2 inhibitors.
  • Cartilage is mainly constituted by chondrocytes and an extracellular matrix (ECM) that consists of proteoglycans (mainly aggrecan), collagens and water.
  • ECM extracellular matrix
  • proteoglycans mainly aggrecan
  • HA hyaluronic acid
  • Type II collagen provides the cartilage with unique compressibility and elasticity, biomechanical properties for weight bearing and joint motion functions.
  • Aggrecan consists of three globular regions: Gl and G2 near the N-terminus of the protein and G3 at the C-terminus.
  • the Gl and G2 regions are separated by a short interglobular domain (IGD) while the G2 and G3 regions are separated by a long glycosaminoglycan (GAG) attachment region.
  • the Gl domain constitutes, through an ancillary protein, the binding region of aggrecan to HA.
  • the GAG attachment region of aggrecan provides the high anionic charge density needed to bind water and conferring to cartilage its unique osmotic properties necessary to guarantee its functionality. Therefore, understanding the biochemical mechanisms leading to aggrecan cleavage might help in the development of therapeutics suitable to block or control the OA disease. Loss of cartilage integrity in arthritis is associated with impaired aggrecan integrity due to proteolytic cleavage of the protein.
  • Aggrecanases (mainly aggrecanase-2, also named ADAMTS-5 and aggrecanase-1, also named ADAMTS-4), were recently identified as being among the key enzymes for cartilage degradation.
  • ADAMTS-5 mainly aggrecanase-2, also named ADAMTS-5 and aggrecanase-1, also named ADAMTS-4
  • ADAMTS-5 were recently identified as being among the key enzymes for cartilage degradation.
  • ADAMTS-5 plays a fundamental role in the pathological joint changes associated with two models of OA and of RA in the mouse.
  • Both ADAMTS-4 and -5 are glutamyl endopeptidases and cleave aggrecan at five specific sites: Glu373-Ala374 (interglobular domain-IGD), Glul545-Glyl546, Glul714-Glyl715, Glul819-Alal820, and Glul919- Leul920 bonds (human sequence), resulting in cartilage destruction.
  • ADAMTS-4 Fig. l, SEQ. ID NO: 1
  • ADAMTS-5 Fig. l, SEQ. ID NO: 2
  • Both enzymes have a similar domain arrangement consisting of a signal sequence (SS), a prodomain (Pro), a catalytic metalloproteinase domain (Cat), a disintegrin (Dis) domain, a thrombospondin type I (TS) domain, a cysteine- rich (CysR) domain, and a spacer (Sp) domain.
  • SS signal sequence
  • Pro prodomain
  • Cat catalytic metalloproteinase domain
  • Dis disintegrin
  • TS thrombospondin type I
  • cysteine- rich (CysR) domain cysteine- rich domain
  • Sp spacer
  • the application WO 2011/002968 discloses an antibody capable of binding to both the catalytic domain and desintegrin domain of human ADAMTS-5.
  • the documents WO 01/11074 and WO 00/53774 disclose an ADAMTS-5 protein and generally refer to antibody against such protein.
  • the authors isolated antibodies recognizing and binding to an epitope comprised in the spacer domain of ADAMTS-5 (named antibodies anti-Sp_ADAMTS-5).
  • the antibodies are useful for therapeutic applications in humans.
  • the antibodies are fully human or chimeric or humanized to minimize the risk for immune responses against the antibodies when administered to a patient.
  • other antigen-binding molecules such as, e.g., antigen- binding antibody fragments, antibody derivatives, and multi- specific molecules, can be designed or derived from such antibodies.
  • the antibodies of the present invention display inhibitory action against cartilage matrix degeneration, they control cartilage matrix degrading enzyme production and they improve cartilage matrix synthesis, thus treat and/or prevent cartilage degradation.
  • the antibody may be used in the treatment and/or prevention of a condition associated with cartilage degradation.
  • a condition associated with cartilage degradation includes osteoarthritis (OA), rheumatoid arthritis (RA), gout, psoriatic arthritis, systemic lupus erythematosus, septic arthritis, polymyalgia rheumatica, ankylosing spondylitis, pseudogout, polymyositis, fibromyalgia or lyme disease.
  • the antibodies of the present invention may be used for treating and/or preventing the disease classified into the early stage to the advanced stage of OA and RA.
  • Each stage from the initial stage to the advanced stage of OA is classified according to the OARSI and Mankin classification.
  • the diseases classified into any of the above-mentioned grades or scores are accompanied with cartilage degeneration as condition of disease.
  • the antibodies of the present invention can be used effectively to treat or prevent the diseases classified into the initial stage to the advanced stage of OA and RA.
  • Antibody-binding fragments of such antibodies, as well as molecules comprising such antigen-binding fragments, including engineered antibody fragments, antibody derivatives, bispecific antibodies and other multispecific molecules, are also object of the invention.
  • compositions and kits or other articles that comprise the antibodies of the invention are also part of the invention.
  • an antibody, recombinant or synthetic antigen- binding fragments thereof able to recognise and bind an epitope comprised in the aa. 732 to aa. 874 region of SEQ ID No. 2 of ADAMTS-5.
  • the epitope is comprised in aa. 732 to aa 745 of SEQ ID No. 2, preferably in aa 746 to aa 763 of SEQ ID No. 2, preferably in aa 764 to aa 779 of SEQ ID No. 2, preferably in aa 780 to aa 795 of SEQ ID No. 2, preferably in aa 796 to aa 811 of SEQ ID No.
  • the epitope is comprised in the aa. 757 to aa 771 region of SEQ ID No. 2.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof as described above comprises at least one heavy chain complementary determining region (CDRH3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 62, 65, 68, 71, 74, 77, 80, 83, 86, 89 and 92.
  • CDRH3 heavy chain complementary determining region
  • the antibody, recombinant or synthetic antigen-binding fragments thereof further as described above comprises a heavy chain complementary determining region (CDRH2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ ID No. 61, 64, 67, 70, 73, 76, 79, 82, 85, 88 and 91.
  • CDRH2 heavy chain complementary determining region
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention further comprises a heavy chain complementary determining region (CDRH1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ ID No. 60, 63, 66, 69, 72, 75, 78, 81, 84, 87 and 90.
  • CDRH1 heavy chain complementary determining region
  • the antibody, recombinant or synthetic antigen-binding fragments thereof as described above further comprises at least one light chain complementary determining region (CDRL3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 29, 32, 35, 38, 41 , 44, 47, 50, 53, 56 and 59.
  • CDRL3 light chain complementary determining region
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention further comprises one light chain complementary determining region (CDRL2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: 28, 31, 34, 37, 40, 43, 46, 49, 52, 55 and 58.
  • CDRL2 light chain complementary determining region
  • the antibody, recombinant or synthetic antigen-binding fragments thereof as described above further comprises one light chain complementary determining region (CDRL1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: 27, 30, 33, 36, 39, 42, 45, 48, 51, 54 and 57.
  • CDRL1 light chain complementary determining region
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention comprises a heavy chain complementary determining regions (CDRHl) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 60, 63, 66, 69, 72, 75, 78, 81, 84, 87 and 90 and a heavy chain complementary determining regions (CDRH2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ.
  • CDRHl heavy chain complementary determining regions
  • CDRH3 heavy chain complementary determining regions
  • the antibody, recombinant or synthetic antigen-binding fragments thereof as described above further comprises a light chain complementary determining regions (CDRL1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 27, 30, 33, 36, 39, 42, 45, 48, 51, 54 and 57 and a light chain complementary determining regions (CDRL2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 28, 31, 34, 37, 40, 43, 46, 49, 52, 55 and 58 and a light chain complementary determining regions (CDRL3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 29, 32, 35, 38, 41, 44, 47, 50, 53, 56 and 59.
  • CDRL1 light chain complementary determining regions
  • CDRL2 amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO
  • the antibody, recombinant or synthetic antigen-binding fragments thereof as described above comprises a CDRHl amino acid sequence having at least 80 % identity to SEQ ID No. 60, a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 61, a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 62.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention further comprises a CDRL1 amino acid sequence having at least 80 % identity to SEQ ID No. 27, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 28 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 29.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof as described above comprises a CDRH1 amino acid sequence having at least 80 % identity to SEQ ID No. 81 , a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 82 and a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 83.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention further comprises a CDRLl amino acid sequence having at least 80 % identity to SEQ ID No. 48, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 49 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 50.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention comprises a CDRH1 amino acid sequence having at least 80 % identity to SEQ ID No. 87, a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 88 and a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 89.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof further comprises a CDRLl amino acid sequence having at least 80 % identity to SEQ ID No. 54, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 55 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 56.
  • At least 80 % identity means that the identity may be at least 80 % or at least 85 % or 90% or 95% or 100% sequence identity to referred sequences.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof as described above is a monoclonal antibody or a chimeric or a humanized, or a deimmunized or a fully human antibody.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof as described above for medical use.
  • a condition associated with cartilage degradation such as osteoarthritis and/or rheumatoid arthritis.
  • the antibody, recombinant or synthetic antigen- binding fragments thereof as described above may be used for the treatment of pathological responses mediated by Syndecan-4, in particular pathological responses of chondrocytes mediated by Syndecan-4.
  • nucleic acid molecule encoding the antibody, recombinant or synthetic antigen-binding fragments thereof as defined above.
  • the nucleic acid molecule encoding the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID No.99 to SEQ ID No. 120.
  • the nucleic acid comprises at least one of the following sequences: SEQ ID NO.: 99, 100, 113, 114, 117 and 118.
  • a host cell comprising the nucleic acid as described above.
  • the host cell produces the antibody, recombinant or synthetic antigen- binding fragments thereof of the invention.
  • It is a further object of the invention a method of producing the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention comprising culturing the cell that produces the antibody as described above and recovering the antibody from the cell culture.
  • a pharmaceutical composition comprising at least one antibody, recombinant or synthetic antigen-binding fragments thereof as described above and pharmaceutically acceptable excipients.
  • the composition comprises an effective amount of the antibody, recombinant or synthetic antigen-binding fragments thereof.
  • Pharmaceutical compositions are conventional in this field and can be made by the person skilled in the art just based on the common general knowledge. Pharmaceutical compositions comprising the antibody and/or a fragment and/or a recombinant derivative and/or a conjugate thereof in admixture with at least one pharmaceutically acceptable excipient and/or vehicle are included in the scope of the present invention.
  • composition according to the invention is for use in intraarticular administration.
  • mutants of the disclosed CDRs may be generated by mutating one or more amino acids in the sequence of the CDRs. It is known that a single amino acid substitution appropriately positioned in a CDR can be sufficient to improve the affinity.
  • researchers have used site directed mutagenesis to increase affinity of some immunoglobulin products by about 10 fold. This method of increasing or decreasing (i.e modulating) affinity of antibodies by mutating CDRs is common knowledge (see, e.g., Paul, W. E., 1993).
  • substitution, deletion, or addition of amino acids to the CDRs of the invention to increase or decrease (i.e, modulate) binding affinity or specificity is also within the scope of this invention.
  • the preferred antibody according to the present invention shall be identified with the name CRB0017 (comprising SEQ ID No. 3 and SEQ ID No. 4), CRB0102 (comprising SEQ ID No. 17 and SEQ ID No. 18) and CRB0123 (comprising SEQ ID No. 21 and SEQ ID No. 22) as indicated in Table III. While the present invention focuses on such antibodies, as an exemplification of the present invention, one of ordinary skill in the art will appreciate that, once given the present disclosure, other similar antibodies, and antibody fragments thereof, as well as antibody fragments of these similar antibodies may be produced and used within the scope of the present invention. Such similar antibodies may be produced by a reasonable amount of experimentation by those skilled in the art.
  • the antibody is a scFv, Fv fragment, a Fab fragment, a F(ab)2 fragment, a multimeric antibody, a peptide or a proteolytic fragment containing the epitope binding region.
  • the scFv fragment comprises a sequence selected from the group of SEQ ID No. 125 to 132 and SEQ ID no. 135, 136, 137.
  • nucleic acid encoding the antibody or functional derivatives thereof of the invention, or hybridizing with the above nucleic acid, or consisting of a degenerated sequence thereof.
  • the process for the preparation of the monoclonal antibody is within the skills of the man skilled in the art and comprises cultivating host cell and isolating the antibody according to standard procedures.
  • the antibody herein disclosed shall be suitably formulated in pharmaceutical compositions as normally done in this technical field.
  • the antibodies of the present invention may comprises at least one CDRH as defined above that contains one or more amino acid substitutions, deletions or insertions of no more than 4 amino acids, preferably of no more than 2 amino acids.
  • the antibodies of the present invention may further comprises at least one CDRL as defined above that contains one or more amino acid substitutions, deletions or insertions of no more than 4 amino acids, preferably of no more than 2 amino acids.
  • the antibodies of the invention compete for binding to ADAMTS-5.
  • the method for treating or preventing a condition associated with cartilage degradation comprises administering to a patient in need thereof an effective amount of at least one antibody, recombinant or synthetic antigen-binding fragments thereof as described above.
  • the invention comprises a method of inhibiting binding of ADAMTS-5 to aggrecan in a subject comprising administering an effective amount of at least one antibody, recombinant or synthetic antigen- binding fragments thereof as described above.
  • the antibodies, recombinant or synthetic antigen-binding fragments thereof of the invention selectively bind to Spacer domain of ADAMTS-5, preferably with a Kd that is ⁇ 2nM.
  • the invention comprises a method for treating or preventing a condition associated with cartilage degradation in a subject, the method comprising administering to a subject in need thereof an effective amount of at least one antibody, recombinant or synthetic antigen-binding fragments thereof of the invention simultaneously or sequentially with an agent that specifically blocks pain.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention are neutralizing antibody (i.e an antibody that reduces or abolishes the biological activity of the related antigen) that binds to ADAMTS-5 and reduces the likelihood that ADAMTS-5 binds to aggrecan.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention bind to ADAMTS-5 at a location within residues 732-874 of SEQ. ID NO: 2.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention when bound to ADAMTS-5, is positioned 8 angstroms or less from at least one of the following residues of ADAMTS-5: T732, K733, 1734, V735, G736, T737, F738, N739, K740, K741, S742, K743, G744, Y745, T746, D747, V748, V749, R750, 1751, P752, E753, G754, A755, T756, H757, 1758, K759, V760, R761, Q762, F763, K764, A765, K766, D767, Q768, T769, R770, F771, T772, A773, Y774, L77
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention blocks an antibody to ADAMTS-5 from binding within 8 angstroms of a residue of ADAMTS-5.
  • the residue of ADAMTS-5 is selected from at least one of the following ADAMTS-5 residues: T732, K733, 1734, V735, G736, T737, F738, N739, K740, K741, S742, K743, G744, Y745, T746, D747, V748, V749, R750, 1751, P752, E753, G754, A755, T756, H757, 1758, K759, V760, R761, Q762, F763, K764, A765, K766, D767, Q768, T769, R770, F771, T772, A773, Y774, L775, A776, L777, K778, K779, K780, N781, G782, E783, Y784,
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention binds to ADAMTS-5 at a location that overlaps with a location at which aggrecan binds to ADAMTS-5.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention reduces the likelihood that aggrecan will bind to ADAMTS-5 within 8 angstroms of at least one of the following residues on ADAMTS-5: T732, K733, 1734, V735, G736, T737, F738, N739, K740, K741, S742, K743, G744, Y745, T746, D747, V748, V749, R750, 1751, P752, E753, G754, A755, T756, H757, 1758, K759, V760, R761, Q762, F763, K764, A765, K766, D767, Q768, T769, R770, F771 , T772, A773, Y774, L775, A776, L777, K778, K779, K780, N781, G782, E783, Y784, L785, 1786, N787, G788, K789,
  • the formulations are typically for an antibody as disclosed herein, recombinant or synthetic antigen-binding fragments thereof of the inventionas active principle concentration from about 0.1 mg/ml to about 100 mg/ml.
  • the antibody, recombinant or synthetic antigen-binding fragments thereof concentration is from about 0.1 mg/ml to 1 mg/ml; preferably from 1 mg/ml to 10 mg/ml, preferably from 10 to 100 mg/ml.
  • a "pharmaceutical composition” is one that is adapted and suitable for administration to a mammal, especially a human.
  • the composition can be used to treat a disease or disorder in the mammal.
  • the antibody in the composition has been subjected to one or more purification or isolation steps, such that contaminant(s) that might interfere with its therapeutic use have been separated therefrom.
  • the pharmaceutical composition comprises the therapeutic protein and a pharmaceutically acceptable carrier or diluent.
  • the composition is usually sterile and may be lyophilized. Pharmaceutical preparations are described in more detail below.
  • Therapeutic formulations of the antibody/antibodies can be prepared by mixing the antibody having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed., 1980), in the form of lyophilized formulations or aqueous solutions.
  • Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and may include buffers, antioxidants, preservatives, peptides, proteins, hydrophilic polymers, chelating agents such as EDTA, sugars, salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN®, PLURONICS® or polyethylene glycol (PEG).
  • buffers such as EDTA, sugars, salt-forming counter-ions such as sodium
  • metal complexes e.g., Zn-protein complexes
  • non-ionic surfactants such as TWEEN®, PLURONICS® or polyethylene glycol (PEG).
  • the active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions.
  • colloidal drug delivery systems for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • macroemulsions for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules
  • the formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.
  • the appropriate dosage of anti-Sp-ADAMTS-5 antibody/antibodies of the present invention will depend on the type of disease to be treated, the severity and course of the disease, whether the antibody is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the antibody, and the discretion of the attending physician.
  • the antibody is suitably administered to the patient at one time or over a series of treatments.
  • about 1 ⁇ g/kg to 15 mg/kg of antibody or fragment thereof is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion.
  • the treatment is sustained until a desired suppression of disease symptoms occurs.
  • other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.
  • the antibody composition should be formulated, dosed, and administered in a fashion consistent with good medical practice.
  • the antibodies/derivatives of the present invention can be administered by any appropriate route. This includes (but is not limited to) intraperitoneal, intramuscular, intravenous, subcutaneous, intraarticular, intratracheal, oral, enteral, parenteral, intranasal or dermal administration.
  • a preferred mode of administration is the intraarticular route.
  • Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners.
  • the "therapeutically effective amount" of the antibody to be administered will be governed by such considerations, and is the minimum amount necessary to prevent, ameliorate, or treat a disease or disorder.
  • the antibody need not be, but is optionally formulated with one or more agents currently used to prevent or treat the disorder in question.
  • the effective amount of such other agents depends on the amount of antibody present in the formulation, the type of disorder or treatment, and other factors discussed above.
  • antibody herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.
  • antibody fragment refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds.
  • antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g. scFv); and multispecific antibodies formed from antibody fragments.
  • an "antibody that binds to the same epitope” as a reference antibody refers to an antibody that blocks binding of the reference antibody to its antigen in a competition assay by 50% or more, and conversely, the reference antibody blocks binding of the antibody to its antigen in a competition assay by 50% or more.
  • An exemplary competition assay is provided herein.
  • chimeric antibody refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species.
  • the "class” of an antibody refers to the type of constant domain or constant region possessed by its heavy chain.
  • the heavy chain constant domains that correspond to the different classes of immunoglobulins are called [alpha], [delta], [epsilon], [gamma], and [mu], respectively.
  • Fc region herein is used to define a C-terminal region of an immunoglobulin heavy chain that contains at least a portion of the constant region.
  • the term includes native sequence Fc regions and variant Fc regions. Unless otherwise specified herein, numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system, also called the EU index, as described in Kabat et al, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.
  • FR Framework or “FR” refers to variable domain residues other than hypervariable region (HVR) residues.
  • the FR of a variable domain generally consists of four FR domains: FR1 , FR2, FR3, and FR4. Accordingly, the HVR and FR sequences generally appear in the following sequence in VH (or VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4.
  • VH or VL
  • full length antibody “intact antibody”
  • whole antibody are used herein interchangeably to refer to an antibody having a structure substantially similar to a native antibody structure or having heavy chains that contain an Fc region as defined herein.
  • host cell refers to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells.
  • Host cells include “transformants” and “transformed cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
  • a "human antibody” is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non- human antigen-binding residues.
  • a "human consensus framework” is a framework which represents the most commonly occurring amino acid residues in a selection of human immunoglobulin VL or VH framework sequences.
  • the selection of human immunoglobulin VL or VH sequences is from a subgroup of variable domain sequences.
  • the subgroup of sequences is a subgroup as in Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91- 3242, Bethesda MD (1991), vols. 1-3.
  • a “humanized” antibody refers to a chimeric antibody comprising amino acid residues from non- human HVRs and amino acid residues from human FRs.
  • a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non- human antibody, and all or substantially all of the FRs correspond to those of a human antibody.
  • a humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody.
  • a "humanized form" of an antibody, e.g., a non-human antibody refers to an antibody that has undergone humanization.
  • a “deimmunized” antibody is an antibody with reduced immunogenicity based on disruption of HLA binding, an underlying requirement for T cell stimulation.
  • hypervariable region refers to each of the regions of an antibody variable domain which are hypervariable in sequence and/or form structurally defined loops ("hypervariable loops").
  • native four-chain antibodies comprise six HVRs; three in the VH (HI , H2, H3), and three in the VL (LI , L2, L3).
  • HVRs generally comprise amino acid residues from the hypervariable loops and/or from the "complementarity determining regions" (CDRs), the latter being of highest sequence variability and/or involved in antigen recognition.
  • CDRs complementarity determining regions
  • Exemplary hypervariable loops occur at amino acid residues 26-32 (LI), 50-52 (L2), 91-96 (L3), 26-32 (HI), 53-55 (H2), and 96-101 (H3) (Chothia and Lesk, J. Mol. Biol. 196:901- 917, 1987).
  • CDRs (CDR-L1 , CDR-L2, CDR-L3, CDR-H1 , CDR-H2, and CDR-H3) occur at amino acid residues 24-34 of LI , 50-56 of L2, 89-97 of L3, 31-35B of HI , 50-65 of H2, and 95-102 of H3 (Kabat et al, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991). With the exception of CDR1 in VH, CDRs generally comprise the amino acid residues that form the hypervariable loops. CDRs also comprise "specificity determining residues," or "SDRs,” which are residues that contact antigen.
  • SDRs are contained within regions of the CDRs called abbreviated-CDRs, or a-CDRs.
  • exemplary a- CDRs (a-CDR-Ll , a-CDR-L2, a-CDR-L3, a-CDR-Hl , a-CDR-H2, and a-CDR-H3) occur at amino acid residues 31-34 of LI , 50-55 of L2, 89-96 of L3, 31-35B of HI , 50-58 of H2, and 95-102 of H3 (See Almagro and Fransson, Front. Biosci. 13: 1619-1633, 2008).
  • HVR residues and other residues in the variable domain (e.g., FR residues) are numbered herein according to Kabat et al.
  • monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts.
  • polyclonal antibody preparations typically include different antibodies directed against different determinants (epitopes)
  • each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen.
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present invention may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.
  • package insert is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, combination therapy, contraindications and/or warnings concerning the use of such therapeutic products.
  • Percent (%) amino acid sequence identity with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • pharmaceutical formulation refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
  • a “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
  • treatment refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis.
  • antibodies of the invention are used to delay development of a disease or to slow the progression of a disease.
  • variable region refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen.
  • the variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs, See, e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91, 2007).
  • FRs conserved framework regions
  • HVRs hypervariable regions
  • antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively (See, e.g., Portolano et al, J. Immunol. 150:880- 887, 1993; Clarkson et al, Nature 352:624-628, 1991).
  • vector refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked.
  • the term includes the vector as a self- replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced.
  • Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors”.
  • the antibody or derivatives thereof comprises a heavy chain variable domain (VH) sequence having at least 80 %, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%), 99%), or 100% sequence identity to an amino acid sequence selected from the group of: SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24.
  • VH heavy chain variable domain
  • the antibody or derivatives thereof comprises a light chain variable domain (VK or VL) sequence having at least 80 %, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%), 99%), or 100% sequence identity to an amino acid sequence selected from the group of: SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23.
  • VK or VL light chain variable domain
  • the VH sequence or VK/VL sequence having at least 80 %>, 85 %>, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to said SEQ ID No. contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-Sp-ADAMTS-5 antibody comprising that sequence retains the ability to bind to the spacer domain of ADAMTS-5.
  • a total of 1 to 4 amino acids have been substituted, inserted and/or deleted in the sequence of the CDRH3 such as in SEQ ID No. 62.
  • substitutions, insertions, or deletions occur in regions outside the HVRs (i.e. , in the FRs).
  • the antibody of the invention is antibody CRB0017, CRB0093, CRB0094, CRB0102, CRB0123, CRB0124, as defined in Table III.
  • the antibody or fragment thereof of the invention has a dissociation constant (Kd) of ⁇ 100 nM, ⁇ 10 nM, ⁇ 1 nM, ⁇ 0.1 nM, ⁇ 0.01 nM, or ⁇ 0.001 nM or less, e.g. from 10-8 M to 10 "13 M, e.g. , from 10 "9 M to 10 "13 M.
  • Kd dissociation constant
  • Kd is measured by a radiolabeled antigen binding assay (RIA) performed with the Fab version of an antibody of interest and its antigen as described by the following assay.
  • Solution binding affinity of Fabs for antigen is measured by equilibrating Fab with a minimal concentration of ( I)-labeled antigen in the presence of a titration series of unlabeled antigen, then capturing bound antigen with an anti-Fab antibody-coated plate (see, e.g. , Chen et al, J. Mol. Biol. 293:865-881(1999)).
  • ADAMTS-4 and ADAMTS-5 schematic representation. Both enzymes are multidomain metalloproteinases secreted from the cell into the extracellular space. Both enzymes have a similar domain arrangement consisting of a signal sequence (SS), a prodomain (Pro), a catalytic metalloproteinase domain (Cat), a disintegrin (Dis) domain, a thrombospondin type I (TS) domain, a cysteine- rich (CysR) domain, and a spacer (Sp) domain. In addition, ADAMTS-5 contains an extra TS domain after the spacer domain.
  • SS signal sequence
  • Pro prodomain
  • Cat catalytic metalloproteinase domain
  • Dis disintegrin
  • TS thrombospondin type I
  • CysR cysteine- rich domain
  • Sp spacer
  • ADAMTS-5 contains an extra TS domain after the spacer domain.
  • FIG. 4 Sandwich ELISA. Dilution curves of coated CRB0017_IgG4 binding to Spacer- GST and/or GST in solution at 30 ⁇ g/mL. As secondary antibody an anti-GST (1 : 1000) was used following an anti-rabbit IgG HRP (1 :2000) for final detection. The mean absorbance at 450nm of the experiments performed in duplicate wells is shown with SD indicated by the bars.
  • FIG. 5 Kinetic analysis of CRB0017_IgG4 binding Spacer-GST in solution using Biacore X-100. 5610 RU of CRB0017_IgG4 were immobilized on CM5 chip. The association and dissociation were performed for 180s and 800s respectively. Kinetic rate constants and affinity determined for CRB0017_IgG4/Spacer-GST interaction are shown in the table below. Figure 6. Immunoprecipitation (IP) of ADAMTS-5 full length (TS5-FL) by CRB0017_IgG4.
  • IP Immunoprecipitation
  • TS5-FL 0.1 ⁇ g of dialyzed/affinity purified TS5-FL were immunoprecipitated (IP) with anti- Sp_ADAMTS-5 CRB0017_IgG4 antibody (11, 22 and 25 ⁇ g in lane 1, 2 and 3, respectively) or with 11 ⁇ of unrelated antibody as a negative control (lane 4). Immunoprecipitates were analysed by immunoblotting with anti-FLAG antibody (1 : 1000). CRB0017_IgG4- immunoprecipitated ⁇ 81kDa TS5-FL band was observed corresponding to TS5-FL p75 protein. The molecular mass of immunoprecipitated TS5-FL protein is slightly higher than predicted from its amino acid composition. This difference is due to N-glycosylation in the Dis, CysR, Sp domains and to O-glycosylation at the C-term domain. Molecular mass markers are indicated to the left-hand side of the Figure.
  • FIG. 7 IP of ADAMTS-4 full length (TS4-FL) by CRB0017_IgG4.
  • 0.2 ⁇ g of dialyzed/affinity purified TS4-FL were immunoprecipitated (IP) with anti- Sp_ADAMTS-5 CRB0017_IgG4 antibody (30 and 60 ⁇ g in lane 1 and 2, respectively) or with an unrelated antibody (30 ⁇ g) as a negative control (lane 3).
  • dialyzed/affinity purified TS4-FL was loaded as a positive control. Immunoprecipitates were analysed by immunoblotting with anti-FLAG antibody (1 : 1000).
  • CRB0017_IgG4-immunoprecipitated ⁇ 75kDa TS5-FL band was observed corresponding to TS4-FL p68 protein.
  • the molecular mass of immunoprecipitated TS4-FL protein is slightly higher than predicted from its amino acid composition and this is mainly due to N- and O- glycosylation in the protein. Molecular mass markers are indicated to the left-hand side of the Figure.
  • Figure 8 Effect of anti-Sp_ADAMTS-5 IgG4 in in vitro proteolysis of bovine cartilage induced by IL-la.
  • Figure represents IL-la 5ng/ml activity in the absence or presence of CRB0017 IgG4 after 48h of incubation (three different independent experiments).
  • a human native IgG4 (Serotec) was used.
  • a synthetic ADAMTS-5 inhibitor (Cpd 23) and a natural ADAMTS-5 inhibitor (TIMP-3) were used.
  • the results are expressed as % GAG release, i.e. the quantitation of glycosaminoglycans (GAGs) in the form of aggrecan fragments released from the cartilage in culture; this method measures cytokine efficiency in simulating cartilage metabolism.
  • GAGs glycosaminoglycans
  • FIG. 9 Evaluation of the effect of the HelixB- ADAMTS-5 binding protein CRB0016_IgG4 in the STR/ort mouse model of osteoarthritis.
  • CRB0016_IgG4 was administered intraarticularly in both knees of each animal, once at the start of the experiment and again after 6 weeks, at doses of 1,2 and 12 ⁇ g/knee.
  • Three months after first administration, CRB0016_IgG4 did not modify the course of OA in the STR/ort mouse strain, as assessed histo-pathologically.
  • Grade is defined as the depth of the lesion through the articular cartilage.
  • Stage is defined as the horizontal extent of cartilage involvement within one side of a joint compartment irrespective of the underlying grade.
  • OARSI score is defined as grade x stage.
  • Cell loss is defined as the fraction of articular chondrocytes that have undergone cell death, within the articular compartment considered.
  • GAG (glycosaminoglycan) loss is defined as and assessed by the loss of a cation stain that presents metachromasy towards GAGs, such as for instance Toluidine blue or Safranin O.
  • Mankin has defined his score as the sum of grade, cell loss and GAG loss, while the total score is defined as the sum of the OARSI score and cell loss and GAG loss. All of the above parameters constitute features of OA, and their scoring gives a measure of the severity and progression of the pathology.
  • FIG. 10 Evaluation of the effect of CRB0017_IgG4 in the STR/ort mouse model of osteoarthritis.
  • CRB0017_IgG4 was administered intraarticularly in both knees of each animal, once at the beginning of the experiment and again after 6 weeks, at doses of 1,2 and 12 ⁇ g/knee.
  • Three months after first administration, CRB017_IgG4 showed a dose-dependent activity in reducing OA severity in the STR ort mouse model. All parameters are defined as in Fig. 9.
  • CRB0017_IgG4 is able to recognize ADAMTS-5 secreted from permeabilized or non permeabilized cells in a dose dependent manner. As controls, anti-catalytic and two anti-cys domain of ADAMTS-5 commercial antibodies were used. B) CRB0017_IgG4 does not cross-reacted with any protein on the cell surface of HEK293 cells.
  • MMT Unilateral medial meniscal tear model
  • CRB0017_IgG4 35 ⁇ g/knee
  • CRB0017 70 ⁇ g/knee or vehicle.
  • All histological scores were dose-dependently decreased by treatment with CRB0017_IgG4 compared to vehicle.
  • FIG. 14 Competitive inhibition of mAb ADAMTS-5 binding to mAb CRB0017-coated plates by free Syndecan-4.
  • mAb CRB0017 (2 ⁇ g/ml in coating buffer) were adsorbed to immunoplates before blocking.
  • ADAMTS-5 (4 ⁇ g/ml) in presence of Syndecan-4 (O. ⁇ g/ml) were incubated before adding to the immobilized mAb CRB0017.
  • ADAMTS-5 binding to mAb CRB0017-coated plates were revealed using anti-FLAG commercial antibody.
  • mAbs anti-spacer CRB0017_IgG4, CRB0093_IgG4, CRB094_IgG4 and CRB0124_IgG4 are able to recognize specifically full length ADAMTS-5 in sandwich ELISA with comparable specificity.
  • mAb CRB0123_IgG4 display a higher binding capacity for ADAMTS-5 than the other anti-spacer mAbs in this assay.
  • SEQ. ID NO:l A S4_HUMAN A disintegrin and metalloproteinase with thrombospondin motifs 4 (UniProtKB/Swiss-Prot : 075173.3)
  • SEQ. ID NO 2 ATS5_HUMAN A disintegrin and metalloproteinase with thrombospondin motifs 5 (UniProtKB/Swiss-Prot : Q9UNA0.2)
  • VK light chain
  • VH heavy chain
  • CDRL light chain
  • SEQ ID NO: 3 to SEQ ID NO: 94, SEQ ID NO: 125 to 132 and SEQ ID NO: 135 to SEQ ID NO: 137 are amino acid sequences, SEQ ID NO: 95 to 120 are nucleotide sequences.
  • SPLINT libraries Single Pot Library of Intracellular Antibodies constructed from human lymphocytes.
  • SPLINT technology expresses human scFv (single chain antibody fragment) libraries cloned in pMVl vector, a vector derived from pLinker220 vector (Visintin et al, 2004. J Immunol Methods. 290: 135-153), as fusion to the VP16 activation domain.
  • the variable regions are linked with a small peptide linker (SGGSTSGSGKPGSGEGSSGT, SEQ ID No. 138).
  • pMVl contains LEU2 gene that permits maintenance of the plasmid and selection on media lacking leucine in yeast strain L40 and the bla gene that permits the selection of plasmid in E.coli.
  • RNA was prepared from the B lymphocytes and pooled together before being used for the isolation of mRNA.
  • mRNA was prepared using Oligotex mRNA mini kit (Qiagen) according to manufacturer's instruction. ThermoScriptTM RT-PCR System (Invitrogen) was used for cDNA synthesis reactions according to manufacturer's instruction. Oligo (dT)20 were used to synthesize cDNA of V- genes repertoire.
  • the primer sequences which in theory encompass the entire repertoire of human antibody genes, were obtained from IMGT/GENE-DB (Giudicelli et al, 2005. Stud Health Technol Inform. 116:3-8), and modified according to previously published protocols (Sblattero and Bradbury, 1998. Immunotechnology. 3 :271-278); (Marks et al, 1991. Eur J Immunol. 21 :985- 991);(Orlandi et al, 1992. Biotechnology. 24:527-531).
  • the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlapping polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning (Visintin et al, 2004. J Immunol Methods . 290: 135-153).
  • the PCR reactions for huSPLINT_9 included seven VH forward primers paired with four VH reverse primers which generated a total of twenty-eight reactions; whereas four VK forward primers paired with four reverse primers generated a total of sixteen reactions; and nine ⁇ forward primers paired with two ⁇ reverse primers generated a total of eighteen reactions.
  • TTATCCTCGAGCGGTACCCAGGTCCAGCTKGTRCAGTCTGG SEQ I D No . 143 TTATCCTCGAGCGGTACCCAGRTCACCTTGAAGGAGTCTG SEQ I D No . 144 TTATCCTCGAGCGGTACCCAGGTGCAGCTGGTGSARTCTGG SEQ I D No . 145 o GATTGGTTTGCCGCTAGCTGAGGAGACRGTGACCAGGGTG SEQ I D No . 14 6
  • VL_PTfw CGCTGGATTGTTATTACTCGCAGCAAGCGGCGCGCATGCC SEQ ID No. 169
  • VH_PTrv CCAGGCCCAGCAGTGGGTTTGGGATTGGTTTGCCGCTA SEQ ID No. 172
  • the PCR reactions for huSPLINT IO included six VH forward primers paired with four VH reverse primers which generated a total of twenty-four reactions; whereas six VK forward primers paired with five VK reverse primers generated a total of thirty reactions; and seven ⁇ forward primers paired with three ⁇ reverse primers generated a total of twenty- one reactions.
  • VH PTfw CGCTGGATTGTTATTACTCGCAGCAAGCGGCGCGCATGCC SEQ ID No. 205
  • VL PTrv CCAGGCCCAGCAGTGGGTTTGGGATTGGTTTGCCGCTA SEQ ID No.208
  • the PCRs led to the representation in the repertoire of variable regions derived from all conceivable framework assemblies. All primers contained either BssHII or Nhel restriction sites or linker sequence. The final pull-through PCR could be done with two primers (PTfw&PTrv). After the final scFv gene repertoires had been sequentially digested with BssHII and Nhel, they were ligated directly into pre-digested and dephosphorylated pMVl vector.
  • the EcoRI-BamHI digested cDNA was cloned into pMICBDl vector (Visintin et al, 2004. J Immunol Methods. 290: 135-153) designed to contain bacterial cloramphenicol resistance, TRP1 gene (which allows yeast containing this plasmid to grow in minimal medium lacking tryptophan) and the 2 ⁇ origin of replication.
  • This plasmid contains the entire region of the Escherichia coli lexA protein, expressed from the yeast alcohol dehydrogenase I (ADH1) promoter, followed by a polylinker for cDNA insertion, to generate in- frame fusions to lexA. Bait was sequenced to confirm in-frame fusion of the insert with lexA binding domain in the vector.
  • L40 yeast cells were transfected with bait Sp_ADAMTS-5/MICBDl vector by using lithium acetate transformation protocol. The transformants were assayed for histidine prototropy on YC-Lys/- Ura/-His/-Trp plates (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790; Visintin et al, 2004. J Immunol Methods. 290:135-153.; Visintin et al, 2004. Methods. 34:200-214; Visintin et al, 2002. J Mol Biol. 317:73-83.; Visintin et al, 1999. Proc Natl Acad Sci U S A.
  • cDNA encoding an a-helix (helixB, SEQ. ID No. 124) at the surface position of the human catalytic domain of ADAMTS-5 was assembled using primers:
  • the EcoRI-PstI digested cDNA was cloned into pMICBDl vector (Visintin et al, 2004. J Immunol Methods. 290: 135-153).
  • L40 yeast cells were transfected with bait helixB/MICBDl vector by using lithium acetate transformation protocol. The transformants were assayed for histidine prototropy on YC-Lys/- Ura/-His/-Trp plates (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790). Yeast colonies were assayed for ⁇ -galactosidase activity using colony lift filters, as previously described (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790). The transfection of the bait did not result in activation of the lacZ gene (data not shown).
  • SPLINT libraries were transformed into L40 yeast strain expressing the bait (Sp ADAMTS- 5/MICBD1 or HelixB-ADAMTS-5/MICBDl) using the lithium acetate method and the selection as described (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790; Visintin et al, 2004. J Immunol Methods. 290:135-153.; Visintin et al, 2004. Methods. 34:200-214; Visintin et al, 2002. JMol Biol. 317:73-83.; Visintin et al, 1999. Proc Natl Acad Sci U S A. 96: 11723-11728).
  • Transformed yeast cells were plated on solid medium lacking Trp (W), Leu (L), Uracil (U), Lys (K) and His (H) (YC-WHULK).
  • Trp (W) is provided by pMICBDl plasmid
  • Leu (L) by pMVl plasmid
  • Uracil (U) Lys (K) and His (H) are prototroph markers of the yeast strain.
  • Positive clones were grown on selective medium YC-WHULK.
  • ⁇ -Galactosidase assays were performed as described (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790; Visintin et al, 2004. J Immunol Methods.
  • ADAMTS-5 Human Spacer domain of ADAMTS-5 (SEQ. ID NO: 121 and 123) was cloned into Nco- Xhol restriction sites of pET41b (Novagen). The cDNA encoding the Spacer domain was amplified from ADAMTS-5 pSecTag2A using primers:
  • Sp_ADAMTS-5-GST/pET41b plasmid was transformed into Rosetta 2 (DE3) E.coli (Novagen) by heat shock transformation system (Hanahan, 1983. J Mol Biol. 166:557-580.) and plate onto LB Kan/Cam plates.
  • Anti-catalytic_ADAMTS-5 CRB0016 scFv and anti-Sp_ADAMTS-5 CRB0017 scFv were reformatted to entire chimeric IgG antibodies by coupling the murine antigen-binding variable domains to human constant domains.
  • the cDNAs encoding the light and heavy chain were generated by GENEART (Germany) with suitable restriction sites for subcloning. Sequences were optimized for mammalian expression (CHO- S cell line) (SEQ.ID. NO: 95 and 96; 97 and 98).
  • the cDNAs were sub-cloned in expression plasmids (pcDNA3.1 derivates containing an extended CMV promoter for expression of the gene of interest) using Hindlll and Xhol as cloning sites.
  • expression plasmids pcDNA3.1 derivates containing an extended CMV promoter for expression of the gene of interest
  • Hindlll and Xhol as cloning sites.
  • two expression plasmids were generated: one plasmid containing the cDNA encoding the light chain, one containing the cDNA encoding the heavy chain.
  • the expression plasmid containing the correct inserts was verified by restriction analysis and DNA sequence analysis of the insert.
  • Anti-Sp_ADAMTS-5 CRB0093, CRB0094, CRB0102, CRB0123 and CRB0124 scFvs were also reformatted to entire fully human IgG 4 antibodies following the cloning procedure adopted for CRB0016 and CRB0017 described above.
  • Anti-ADAMTS-5 antibodies were produced from transfected cells.
  • CHO-S cells were transfected with plasmids encoding CRB0016 and CRB0017 heavy and light chains.
  • Conditioned media from transfected cells were recovered by removing cells and debris. Clarified conditioned media were loaded onto protein A-sepharose column. Non-specific bindings were removed by extensively binding buffer washes (20 mM sodium phosphate pH 7.0 ).
  • Anti- Sp_AD AMT S -5 scFv fragments (SEQ, ID 125, 126, 127, 128, 129, 130, 131, 132, 135, 136, 137) were subcloned into Ncol/Notl restriction sites of pETM-13 bacterial expression vector.
  • a triple dialysis against IBD buffer (6M guanidine HC1 at pH 4) was performed.
  • the solubilised and quantified proteins were diluted 35mg/L, as quickly as possible, into cold REF buffer (lOOmMTris/HCl; 0.5M arginine; 375 ⁇ oxidized 1-gluthatione; 5mM EDTA at pH 8.5).
  • the protein solution was dispensed every 50 minutes with a pipette directly into the REF buffer while vortexing.
  • the sample was first concentrated and the remaining guanidinium was removed by dialysis into IEXA buffer (according to pi of scFv and thus to ionic exchange protocol subsequently employed).
  • the refolded scFvs were purified by a ion exchange chromatography stored aliquoted at -80°C.
  • Nunc Maxi-Sorp Immunoplate was coated with lOOmL Sp_ADAMTS-5-GST and GST at ⁇ g/mL in coating buffer (lOOmM Na 2 C0 3 pH 9.6). Plate was incubated overnight at 4°C. next day, the unbound antigens were discarded and plate was washed 3x with PBS. Nonspecific binding was blocked by adding 200mL of 3% MPBS (3% fat free milk in PBS). Plate was incubated for lh at RT. Plate was washed 3xTPBS (0.1% Tween20 in PBS) and 3xPBS.
  • Nunc Maxi-Sorp Immunoplate was coated with serial dilution of lOOmL of anti- Sp_ADAMTS-5 immunoglobulin in coating buffer (lOOmM Na 2 C0 3 pH 9.6). Plate was incubated overnight at 4°C. The next day, the unbound antibodies were discarded and plate was washed 3x with PBS. Non-specific binding was blocked by adding 200 ⁇ of 3% MPBS (3% fat free milk in PBS). Plate was incubated for lh at RT. Plate was washed 3xTPBS (0.1% Tween20 in PBS) and 3xPBS. 100 ⁇ of Sp_ADAMTS-5-GST and GST (30 ⁇ g/mL) in 3% MPBS was added to appropriate wells.
  • coating buffer lOOmM Na 2 C0 3 pH 9.6
  • Immobilization level of 5000 RU for the immunoglobulin and 1000 RU for scFv was set to get a low density immobilization of the ligand.
  • Mild regeneration condition of the chip contact time of 30 seconds at lOmM glycine pH2 was used.
  • Sp_ADAMTS-5-GST was diluted into PBS+0.005% Tween20 running buffer at 5 serial dilution (starting in the micromolar range and diluting 1 :2) and applied at a flow rate of 30 ⁇ /min.
  • Sample condition Step was set initially with contact time of 60 seconds and dissociation time of 400 seconds. On the basis of the resulting sensograms, in the kinetic/affinity step, the analyte concentrations, contact time, dissociation time and regeneration solution were adjusted.
  • mAbs anti-spacer CRB0017_IgG4, CRB0093_IgG4, CRB0094_IgG4, CRB0123_IgG4 and CRB0124_IgG4 were coated at 2 ⁇ g/mL in lOOmM Na 2 C0 3 pH 9.6 and incubated at 4° C overnight. Next day the unbound immunoglobulin was discarded off the plate and wash 3X with TBS. Plate was blocked by adding 200 ⁇ of protein free blocking buffer (Pierce- undiluted) and incubated for lhour at 37°C. Plate was washed as above. Then ⁇ , per well of purified ADAMTS-5 (4 ⁇ / ⁇ 1) in Blocking buffer (dil.
  • cDNA encoding human ADAMTS-5 (SEQ. ID NO: 133) and human ADAMTS-4 (SEQ. ID NO: 134) sequences were amplified to introduce restriction site for Kpn I (5' termini) and for Xho I (3' termini) and to remove the region coding for propeptide. After digestion with Kpnl and Xhol, the inserts were subcloned into pSecTag2A vector (Invitrogen).
  • ADAMTS-5 3XFLAG/pSecTag2A and ADAMTS-4 3XFLAG/pSecTag2A were transfected in FreeStyleTM 293-F cell line.
  • Cells were adapted to suspension culture in FreeStyleTM 293 Expression Medium.
  • Anti-clumping agent (Invitrogen) was added to the medium, before or post-transfection.
  • Cells were transfected with FreeStyleTM MAX Reagent complex in animal- origin free OptiMEMTM SFM.
  • Transfected cells were incubated at 37°C, 8% C02 on a stirring platform set at 75 rpm. 100 ⁇ g/ml heparin was added into the culture 24 hour post- transfection.
  • ADAMTS-5 3XFLAG and ADAMTS-4 3XFLAG expressions reached a significant protein activity 48-72 hours post-transfection. After 2-3 days, supernatants were harvested and stored at -80°C until purification.
  • ADAMTS-5 3X FLAG and ADAMTS-5 3X FLAG purified samples were resuspended in Sample buffer (Invitrogen), heated for 10 min and loaded onto a 10% SDS-polyacrylamide gel electrophoresis system (Invitrogen, NuPage System) and then subjected to Western blotting.
  • the separated proteins were transferred to PVDF membrane (GE Healthcare).
  • the membranes were blocked 30' with Starting Block Solution (Pierce) and incubated lh with primary monoclonal antibody anti 3XFLAG (Sigma) 1 : 1000 at °RT.
  • the purified full length enzymes ADAMTS-4 3X FLAG and ADAMTS-5 3X FLAG were tested for activity by an enzymatic assay.
  • Aggrecan purified from bovine nasal cartilage entrapped in polyacrylamide was used as a substrate to determine aggrecan-degrading activity.
  • Aggrecan/polyacrylamide particles samples (5,0 ⁇ 0.2 mg dry weight) were placed in 1,5 mL tubes with 400 ⁇ of TNC (0,1 M Tris-HCl, 0,1 M NaCl, 10 mM CaC12, 0,1% CHAPS; pH 7,5) and 100 ⁇ of recombinant ADAMTS-4 (p68, FL) and ADAMTS-5 (p75, FL) preparations, expressed in transiently transfected FreeStyle-293 cells and incubated at 37°C for 6 or 24 h.
  • TNC 1,1 M Tris-HCl, 0,1 M NaCl, 10 mM CaC12, 0,1% CHAPS; pH 7,5
  • ADAMTS-4 p68, FL
  • ADAMTS-5 p75, FL
  • the amount of sulphated glycosaminoglycans (GAGs) in the supernatant was determined by a colorimetric assay (1,9 dimethyl methylene blue, DMB). Standard curve (Chondroitin Sulphate extracted from bovine trachea) and samples were diluted in PBS-BSA 1%. After a 5-20 min of reaction, samples were read at 590 nm. The GAGs concentration of each sample was calculated from absorbance measurements (blank subtracted) and compared to the reference standard curve.
  • Bovine nasal cartilage disks were obtained from eight month male bovine nasal septum.
  • 2-mm-diameter punches of cartilage were obtained from the nasal cartilage.
  • the punches were first washed three times with PBS-AASS buffer (lxPBS, 100 U/ml penicillin G, 100 ⁇ g/ml streptomycin and 2.5 ⁇ g/ml amphotericin B).
  • the punches were subsequently incubated at 37°C in an atmosphere of 5% C02, in microplate wells containing DMEM 10%, 100 U/ml penicillin G, 100 ⁇ g/ml streptomycin and 2.5 ⁇ g/ml amphotericin B (DMEM-AASS media).
  • the punches of cartilages were first incubated with 500 ⁇ g/mL papain at 65°C for 2h for the measurement of the percentage of total GAG remaining in the tissue.
  • the sulphated glycosaminoglicans (GAGs) determination is done by a colorimetric assay with 1,9 dimethylmethylene blue (DMB).
  • Standard curve Chodroitin Sulphate extracted from bovine trachea
  • medium samples and and digested cartilage samples were diluted in PBS-BSA 1%. After a 5-20 min of reaction samples were read at 590 nm. Immunoprecipitation of ADAMTS-5 and ADAMTS-4 3xFLAG full length proteins.
  • Immunoprecipitation was performed using Protein G Immunoprecipitation Kit (SIGMA). To reduce background caused by non-specific adsorption of irrelevant cellular proteins to the Protein G Agarose, a pre-clearing step was perfomed. 50 ⁇ of the Protein G Agarose suspension was added to the sample (ADAMTS-5 or ADAMTS-4 purified proteins) in a microcentrifuge tube and incubate for 2 hours at 4 °C with rocking. Beads was pelleted by centrifugation at 12,000g for 30 seconds in a microcentrifuge and the collected supernatant (precleared sample) was transferred to a fresh tube. This sample was used for immunoprecipitation.
  • SIGMA Protein G Immunoprecipitation Kit
  • the Cell-Based ELISA format allows target cellular proteins, to be analyzed in the same well, thus minimizing well-to-well variability.
  • FreeStyleTM 293-F cell line stably expressing ADAMTS-5 3XFLAG were used. Cells were coltured as suspension culture in FreeStyleTM 293 Expression Medium. FreeStyleTM 293-F cells expressing ADAMTS-5 3XFLAG and FreeStyleTM 293-F cells
  • pAb Anti- ADAMTS-5 Cys 636-649 (Abcam#abl 11918) and pAb Anti- ADAMTS-5 Cys 600-700 (Abeam # ab41037) were used to detect the effective retention and/or secretion of ADAMTS-5. Evaluation of binding capacity of present invention antibodies to ADAMTS-5.
  • mAb CRB0017_IgG4 was coated at 2 ⁇ g/mL in lOOmM Na 2 C0 3 pH 9.6 and incubated at 4° C overnight. Next day the unbound immunoglobulin was discarded off the plate and wash 3X with TBS. Plate was blocked by adding 200 ⁇ of protein free blocking buffer (Pierce- undiluted) and incubated for lhour at 37°C. Plate was washed as above. Then ⁇ per well of either HEK-293-ADAMTS-5-3XFLAG or HEK-293 (negative control) conditioned medium supplemented with Heparin 100 ⁇ g/ml was added. Plate was incubated for lhour at 37°C. Plate was subsequently washed 3X with TTBS.
  • Hind limbs were embedded in paraffin, 5 -micron thick sections were produced and stained with toluidine blue and then scored in a blind fashion according to both Mankin's (Mankin et al, 1971. J Bone Joint Surg Am. 53:523-537) and the OARSI methods (Pritzker et al, 2006. Osteoarthritis Cartilage. 14: 13-29). This method produces an OA score with a range 0-24 based on the most advanced grade (6) and the more extending stage (4). Statistical analysis was performed with Student's t test comparing vehicle vs. basal, and with ANOVA followed by Dunn's or Dunnett's tests comparing all treatment groups vs. vehicle.
  • Unilateral medial meniscal tear (MMT) in rats results in rapidly progressive cartilage degenerative changes characterized by chondrocyte and proteoglycan loss, fibrillation, osteophyte formation and chondrocyte cloning. Progressive degenerative changes occur 3-6 weeks post-surgery: tibial cartilage degeneration may be focally severe with degenerative changes of lesser severity in the surrounding matrix and prominent osteophytes.
  • mice Male Lewis rats weighing 200 g were used. Right knees underwent surgery or sham-surgery. The medial collateral ligament was transected and the medial meniscus was grasped with a hemostat and reflected proximally toward the femur. The meniscus was transected with a scalpel or small surgical scissors. Sham operation consisted in only opening skin and capsula.
  • One week after surgery rats were treated intraarticularly in the operated knee with present invention antibodies such as either CRB0017_IgG4 34 ⁇ g, CRB0017_IgG4 72 ⁇ g, or vehicle. Four weeks after surgery the animals were sacrificed by cervical dislocation and the operated knees explanted and fixed in formalin o/n.
  • the spacer domain of ADAMTS-5 was cloned to the 3 Of LexA (LexA-Sp_ADAMTS-5; SEQ. ID NO: 93) and used to challenge a mouse SPLINT (mSPLINT) and two-different human SPLINT (huSPLINT_09 and huSPLINT IO) libraries (Visintin et al, 2004. J Immunol Methods. 290: 135-153).
  • amino acid sequences of V regions of the isolated anti-Sp_ADAMTS-5scFvs are in the group of sequences consist ing of SEQ.ID NO: 3 and 4; 5 and 6; 7 and 8; 9 and 1 0: 1 1 and 12; 13 and 14; 1 5 and 16; 1 7 and 18; 19 and 20; 21 and 22; 23 and 24.
  • cDNAs expressing anti-Sp_ADAMTS-5 scFv were cloned into E.coli pET41b expression vector.
  • the proteins were well expressed in the cytoplasm and mostly retained in inclusion bodies (IB).
  • scFv fragments can be refolded by dialysis after solubilization of IB (Umetsu et al, 2003. J Biol Chem. 278:8979-8987. Epub 2003 Jan 8977).
  • the authors performed the technique of refolding by dilution (Patil et al, 2008. JBiotechnol. 134:218-221. Epub 2008 Jan 2018).
  • the refolding condition of scFv was optimized for each sample. Refolded scFv were subsequently quantified by Bioanalyzer 2100 (Agilent) and tested by ELISA and Biacore analysis.
  • Reformatted chimeric immunoglobulin CRB0017_IgG4 displays the same immunoreactivity pattern in ELISA assay in a dose dependent fashion (Fig.4). Similar results were obtained with the monoclonal antibodies CRB0102 and CRB0123 (data not shown). Moreover, the chimeric anti-Sp_ADAMTS-5 CRB0017_IgG4 (comprising mouse variable regions) was able to immunoprecipitate the recombinant ADAMTS-5 FL protein as well as recombinant human ADAMTS-4 FL (Fig. 6 and 7). In addition, the authors carried out surface plasmon resonance (SPR) analyses to determine the binding kinetics of CRB0017_IgG4.
  • SPR surface plasmon resonance
  • the chimeric monoclonal antibody was either immobilized on a CM5 chip followed by injections at various concentration of Sp_ADAMTS-5-GST or used as ligand in combination with Sp_ADAMTS-5-GST-immobilized sensor chip.
  • KD 2 steady state binding constants
  • the authors measured a binding strengths by SPR around subnanomolar- 7 nM of KD 2 (data not shown).
  • CRB0017_IgG4 displayed also a strong affinity (KDi of ⁇ 2 nM) when immobilized on sensor chip (Fig. 5) that correlated better with the binding values as determined by antigen-specific ELISA (Fig. 4).
  • mAbs CRB0017_IgG4, CRB0093_IgG4, CRB094_IgG4, CRB0123_IgG4 and CRB0124_IgG4 in coating were challenged in ELISA using mAbs CRB0017_IgG4, CRB0093_IgG4, CRB094_IgG4, CRB0123_IgG4 and CRB0124_IgG4 in coating.
  • mAbs CRB0017, CRB0093, CRB0094 and CRB00124 showed comparable specificity to ADAMTS-5 while mAb CRB0123_IgG4 display a higher binding capacity for ADAMTS-5 than mAb CRB0017_IgG4 in this assay (Fig. 15).
  • In-Cell ELISA use quantitative immunocytochemistry to measure protein expression or post- translational modifications in cultured cells.
  • Cells are fixed in a 96-well plate and targets of interest are detected with highly specific, well-characterized monoclonal antibodies and levels are quantified with enzyme-labeled secondary antibodies.
  • the enzyme is both efficiently secreted by this cell line and is also retained into the extracellular matrix (ECM).
  • ECM extracellular matrix
  • Supematants harvested from FreeStyleTM 293-F cell line stably expressing ADAMTS-5 3XFLAG were challenged in a sandwich ELISA assay using mAb CRB0017_IgG4 in coating.
  • the supematants were used immediately after collection, in order to preserve the function of ADAMTS-5 and to avoid as much as possible the autocatalysis of the enzyme.
  • the antibody was able to recognize the enzyme ADAMTS-5 present in the conditioned medium with high specificity. Evaluation of the capacity of Syndecan-4 to interfere in CRB0017_IgG 4 anti-spacer ADAMTS-5 binding to ADAMTS-5 antigen.
  • syndecan-4 is functionally involved in cartilage degradation by hypertrophic OA chondrocytes through inhibiting the activation of ADAMTS-5 mediated aggrecan cleavage (Echtermeyer, F. et al. 2009. Nat Med. 15(9): 1072-6).
  • ADAMTS-5 activation depends on direct interaction with syndecan-4 on the surface of osteoarthritic chondrocytes; the mechanisms involved in cartilage degradation seem to involve both direct binding of ADAMTS-5 to Syndecan-4 and the regulation of ADAMTS-5 activation by MMP-3, which is regulated by Syndecan-4 in an ER -dependent manner.
  • the authors also evaluated the inhibition of IL- la-induced aggrecan degradation in the bovine cartilage tissue. 48h after the treatments, the proportion of total GAG remaining in the tissue was measured. This analysis revealed that CRB0017_IgG4 inhibited GAG release (50% inhibition) from tissue at 20nM concentration (Fig. 8). In this experiment, the control antibody (nhIgG4) was not able to interfere with the enzyme at the same concentration. Moreover, the natural inhibitor TIMP-3 did not show markedly to inhibit the IL-la-mediated conversion and release process when tested at the concentration of 20nM (data not shown).
  • the HelixB- ADAMTS-5 binding protein CRB0016_IgG4 was administered intraarticularly in both knees of each animal, once at the start of the experiment and again after 6 weeks, at doses of 1,2 and 12 ⁇ g/knee.
  • CRB0017_IgG4 Evaluation of the effect of CRB0017_IgG4 in the STR/ort mouse model of osteoarthritis.
  • CRB0017_IgG4 was administered intraarticularly in both knees of each animal, once at the start of the experiment and again after 6 weeks, at doses of 1,2 and 12 ⁇ g/knee. After three months, the authors observed that the knees from vehicle treated animals displayed severe OA with clefting and erosion of the articular cartilage to the subchondral bone, with prominent chondro-osseous metaplasias and often inflammation and pannus. OA Mankin's score was significantly decreased in the CRB0017_IgG4 12 ⁇ g group compared to vehicle.
  • the OA grade x stage takes into account not only the depth of the damage (grade), but also its extension on the articular surface (stage).
  • the OA grade x stage was significantly lower in the CRB0017_IgG4 12 ⁇ g group compared to vehicle.
  • Administration of CRB0017_IgG4 1.2 ⁇ g was associated with a trend to a decrease with both scoring methods.
  • CRB0017_IgG4 can modify the course of OA in the STR/ort mouse strain, by delaying cartilage breakdown as assessed histologically.
  • the procedure of blind scoring of the histological samples clearly showed a dose dependent effect of the compound in decreasing cartilage damage.
  • CRB0017_IgG4 was associated with a dose-related decrease in all histo-patho logical severity scores (Fig. 13). The procedure of blind scoring of the histological samples showed a dose dependent decrease in OA severity following intra-articular treatment with CRB0017_IgG4.
  • proteolytic enzymes in addition to their catalytic domains, have also non-catalytic ancillary domains that are important modulators of the interaction between the enzyme and substrate or inhibitors.
  • ADAMTS family of enzymes degrade proteoglycans and thereby have the potential to alter tissue architecture and regulate cellular function.
  • ADAMTS-4 and ADAMTS-5 can cleave the aggrecan at various sites, releasing the chondroitin and keratansulfate-bearing regions of the molecule from the tissue. This was demonstrated to be an early and crucial step in the development of osteoarthritis.
  • These enzymes can also be proteolyzed to smaller isoforms, which have altered proteolytic activity.
  • the 3D domain architecture of the full-length aggrecanases is not known, because it is very difficult to obtain the X-ray structures of these enzymes, due to their complex production and purification.
  • the invention provides the evidence that antibodies directed against an ancillary non catalytic domain, such as the spacer domain of ADAMTS-5, strongly inhibit the enzymatic activity of this protein.
  • the results obtained with the anti-spacer domain antibody CRB0017_IgG4 illustrate the concept that the inhibition of the aggrecanase-2 within the spacer domain is more effective than the inhibition of the enzyme within the catalytic domain.
  • an anti-catalytic antibody such as CRB0016_IgG4 is not able to produce such an effect.
  • Syndecan-4 Apart from induction of enzymes by activated chondrocytes, the function of Syndecan-4 is further regulated by interaction with matrix molecules and cell surface proteoglycans. Syndecan-4 is a transmembrane heparan sulfate proteoglycan that seems crucial for the activity of ADAMTS-5.
  • Syndecan-4 activity markedly reduced OA cartilage pathology in the murine DMM OA model. This was demonstrated both in Syndecan-4 knockouts as well as in WT mice, locally treated by intraarticular injections with Syndecan-4 specific antibodies. In vitro studies identified direct interaction of Syndecan-4 with ADAMTS-5. In addition, it was demonstrated that ADAMTS-5 activity is dependent on MMP-3 and the latter activity is controlled by Syndecan-4.
  • Syndecans undergo regulated proteolytic cleavage at ectodomain sites near the membrane by matrix metalloproteinases and metzincins family of endoproteases, a process called shedding, both as part of normal turnover as well as in response to external stimuli and is regulated by multiple pathways. Besides disrupting syndecan signaling, the released soluble ectodomain acts as an antagonist to compete with intact syndecans for its ligands. While syndecan ectodomain shedding is known to be activated by physiological stimulants and the ectodomains are being ascribed pathophysiological roles, in particular in tumorigenesis and inflammation, little is known about how their release from the cell surface is regulated. Thus it could be of interest to see if the anti-ADAMTS-5 CRB0017_lgG4 could help a further understanding of this process.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biophysics (AREA)
  • Physical Education & Sports Medicine (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Microbiology (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Rheumatology (AREA)
  • Orthopedic Medicine & Surgery (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Oncology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to an antibody,recombinant or synthetic antigen-binding fragments thereof able to recognise and bind an epitope comprised in the spacer domain of ADAMTS-5, nucleic acid and expression vector encoding the same, method of production and uses thereof.

Description

ANTI-AD AMTS-5 ANTIBODY, DERIVATIVES AND USES THEREOF
FIELD OF THE INVENTION
This invention relates to anti-ADAMTS-5 antibodies useful in the treatment of a condition associated with cartilage degradation.
In particular, such degradation is observed in osteoarthritis and in other forms of arthritides.
BACKGROUND ART
Osteoarthritis (OA) is a group of overlapping distinct diseases, which may have different etiologies but similar biologic, morphologic, and clinical outcomes. The disease process not only affects the articular cartilage, but involves the entire joint, including the subchondral bone, ligaments, capsule, synovial membrane, and periarticular muscles. Ultimately, the articular cartilage degenerates with fibrillation, fissures, ulceration, and full thickness loss of the joint surface. This condition is characterised by focal areas of loss of articular cartilage within synovial joints, associated with hypertrophy of bone (osteophytes and subchondral bone sclerosis) and thickening of the capsule. It may be interpreted as the reaction of synovial joints to injury. This phenomenon can occur in any joint, but is most common in selected joints of the hand, spine, knee, foot and hip. This pathological change, when severe, results in radiological changes (loss of joint space and osteophytes), which have been used in epidemiological studies to estimate the prevalence of OA at different joint sites. The molecular and cellular mechanisms at the basis of the onset of OA are, at present, unknown; it is hypothesised that abnormal load as well as trauma may have a role, but it seems certain that genetics and heritable factors are also involved. Inflammation, when present, is only secondary to a primary event.
OA is the most common form of arthritis. The World Health Organization (WHO) estimates that, worldwide, 9.6% of men and 18% of women aged over 60 years have symptomatic OA, classifying OA as the 4th cause of disability in women and the 8th cause in men. It is considered that the risk of disability is the same for knee OA as for cardiac disease.
Rheumatoid arthritis (RA), another common form of arthritis, is a chronic inflammatory disease characterized by articular synovitis leading to cartilage degradation, bone erosion and pain, leading to severe disability and premature mortality.
Though OA and RA can be triggered by different causes and progress according to different pathways, they share the underlying process which consists of an imbalance in cartilage matrix synthesis and breakdown, leading to the destruction of the articular cartilage which in turn results in restricted joint movement, joint instability, pain and chronic disability. Moreover, in spite of the impressive number of patients affected by OA and RA, relatively little is known regarding their aetiology, pathogenesis, and progression. Even more impressively, very few, disease-modifying agents antirheumatic drugs (DMARD) exist for their treatment, and they are mainly limited to RA.
For OA, in the absence of a cure, treatment can only be palliative, being limited to the use of COX-2 selective inhibitors, such as celecoxib, and traditional non-steroidal anti-inflammatory drugs (NSAIDs), such as naproxen and diclofenac, or even older drugs for pain control, such as acetaminophen. An additional class of drugs, which includes compounds such as chondroitin and glucosamine sulfate, also exists as a treatment option for OA, but many physicians remain unconvinced about their efficacy.
Concerning RA, over the last decade, the optimal use of DMARDs, in particular methotrexate and the availability of new biologic agents, typically supported by NSAIDs and/or corticosteroids to provide pain relief, as well as to control inflammation to some degree have dramatically enhanced the success of its management. However, traditional DMARDs have a slow onset of action and toxicity that mandates frequent monitoring. Moreover, NSAIDs use has been overshadowed by gastrointestinal side-effects, when considering classical NSAIDs drugs, and by cardiovascular and renal side-effects when considering selective COX-2 inhibitors.
Therefore, the research for new therapeutic agents preventing cartilage degradation is of great interest, since OA and RA affect millions of people all over the world with an expected incidence rising with the increase of the average population age.
The degradation of cartilage occurring in OA and RA is the result of enzymatic cleavage of its structural components. Cartilage is mainly constituted by chondrocytes and an extracellular matrix (ECM) that consists of proteoglycans (mainly aggrecan), collagens and water. Within the matrix, the interaction between aggrecan, hyaluronic acid (HA) and Type II collagen provides the cartilage with unique compressibility and elasticity, biomechanical properties for weight bearing and joint motion functions. Aggrecan consists of three globular regions: Gl and G2 near the N-terminus of the protein and G3 at the C-terminus. The Gl and G2 regions are separated by a short interglobular domain (IGD) while the G2 and G3 regions are separated by a long glycosaminoglycan (GAG) attachment region. The Gl domain constitutes, through an ancillary protein, the binding region of aggrecan to HA. The GAG attachment region of aggrecan provides the high anionic charge density needed to bind water and conferring to cartilage its unique osmotic properties necessary to guarantee its functionality. Therefore, understanding the biochemical mechanisms leading to aggrecan cleavage might help in the development of therapeutics suitable to block or control the OA disease. Loss of cartilage integrity in arthritis is associated with impaired aggrecan integrity due to proteolytic cleavage of the protein. Aggrecanases (mainly aggrecanase-2, also named ADAMTS-5 and aggrecanase-1, also named ADAMTS-4), were recently identified as being among the key enzymes for cartilage degradation. In particular, the publications Glasson et al, 2005. Nature. 434:644-648) and Stanton et al, 2005. Nature. 434:648-652), demonstrated that ADAMTS-5 plays a fundamental role in the pathological joint changes associated with two models of OA and of RA in the mouse. Both ADAMTS-4 and -5 are glutamyl endopeptidases and cleave aggrecan at five specific sites: Glu373-Ala374 (interglobular domain-IGD), Glul545-Glyl546, Glul714-Glyl715, Glul819-Alal820, and Glul919- Leul920 bonds (human sequence), resulting in cartilage destruction.
Human ADAMTS-4 (Fig. l, SEQ. ID NO: 1) and ADAMTS-5 (Fig. l, SEQ. ID NO: 2) are multidomain metalloproteinases secreted from the cell into the extracellular space. Both enzymes have a similar domain arrangement consisting of a signal sequence (SS), a prodomain (Pro), a catalytic metalloproteinase domain (Cat), a disintegrin (Dis) domain, a thrombospondin type I (TS) domain, a cysteine- rich (CysR) domain, and a spacer (Sp) domain. In addition, ADAMTS-5 contains an extra TS domain after the spacer domain. All the above mentioned domain regions outside the catalytic domain, play significant roles in recognition and processing of natural protein substrates, are termed "exosites".
It was demonstrated, for instance, that the Sp and CysR domains of aggrecanases contain GAG-binding motifs that modulate the affinity of the proteinases for their substrates (Kashiwagi et al, 2004. J Biol Chem. 279: 10109-10119); (Gendron et al, 2007. J Biol Chem. 282: 18294-18306); (Flannery, Curr. 11 :614-619); (Zeng et al, 2006. Biochim Biophys Acta. 1760:517-524).
Thus, interest has been growing in the development of inhibitors for ADAMTS-4 and -5 for the treatment of OA and/or RA. Numerous metalloproteinase inhibitors have been developed, and several were clinically tested in patients with cancer (Zucker et al, 2000. Oncogene. 19:6642-6650) and rheumatoid arthritis (Milner and Cawston, 2005. Curr Drug Targets Inflamm Allergy. 4:363-375), but they failed to show efficacy and exhibited side effects such as musculoskeletal pain and mild thrombocytopenia (Zucker et al, 2000. Oncogene. 19:6642- 6650). These failures are thought to be due to the lack of selectivity of the inhibitors and inhibition of biologically important off-target metalloproteinases and other effects. Selectivity is thus a prerequisite for nontoxic therapeutic inhibitors. One way to increase selectivity against specific metalloproteinases is to generate allosteric or exosite binding. Inhibitors that bind to an enzyme exosite could block interaction with natural ECM substrates and could be an attractive alternative to active site-directed inhibitors because they can be highly specific and effectively block hydrolysis only of the target substrate, thus minimizing in vivo side effects (Troeberg et al, 2008. Faseb J. 22:3515-3524).
The application WO 2011/002968 discloses an antibody capable of binding to both the catalytic domain and desintegrin domain of human ADAMTS-5. The documents WO 01/11074 and WO 00/53774 disclose an ADAMTS-5 protein and generally refer to antibody against such protein.
DESCRIPTION OF THE INVENTION
In the present invention, the authors isolated antibodies recognizing and binding to an epitope comprised in the spacer domain of ADAMTS-5 (named antibodies anti-Sp_ADAMTS-5). The antibodies are useful for therapeutic applications in humans. Typically, the antibodies are fully human or chimeric or humanized to minimize the risk for immune responses against the antibodies when administered to a patient. As described herein, other antigen-binding molecules such as, e.g., antigen- binding antibody fragments, antibody derivatives, and multi- specific molecules, can be designed or derived from such antibodies. The antibodies of the present invention display inhibitory action against cartilage matrix degeneration, they control cartilage matrix degrading enzyme production and they improve cartilage matrix synthesis, thus treat and/or prevent cartilage degradation. Therefore the antibody may be used in the treatment and/or prevention of a condition associated with cartilage degradation. Such condition includes osteoarthritis (OA), rheumatoid arthritis (RA), gout, psoriatic arthritis, systemic lupus erythematosus, septic arthritis, polymyalgia rheumatica, ankylosing spondylitis, pseudogout, polymyositis, fibromyalgia or lyme disease.
In particular, the antibodies of the present invention, may be used for treating and/or preventing the disease classified into the early stage to the advanced stage of OA and RA. Each stage from the initial stage to the advanced stage of OA is classified according to the OARSI and Mankin classification.
In both pathologies, the diseases classified into any of the above-mentioned grades or scores are accompanied with cartilage degeneration as condition of disease. The antibodies of the present invention can be used effectively to treat or prevent the diseases classified into the initial stage to the advanced stage of OA and RA. Antibody-binding fragments of such antibodies, as well as molecules comprising such antigen-binding fragments, including engineered antibody fragments, antibody derivatives, bispecific antibodies and other multispecific molecules, are also object of the invention.
Pharmaceutical compositions and kits or other articles that comprise the antibodies of the invention are also part of the invention.
It is therefore an object of the invention an antibody, recombinant or synthetic antigen- binding fragments thereof able to recognise and bind an epitope comprised in the aa. 732 to aa. 874 region of SEQ ID No. 2 of ADAMTS-5. Preferably the epitope is comprised in aa. 732 to aa 745 of SEQ ID No. 2, preferably in aa 746 to aa 763 of SEQ ID No. 2, preferably in aa 764 to aa 779 of SEQ ID No. 2, preferably in aa 780 to aa 795 of SEQ ID No. 2, preferably in aa 796 to aa 811 of SEQ ID No. 2, preferably in aa 812 to aa 827 of SEQ ID No. 2, preferably in aa 828 to aa 843 of SEQ ID No. 2, preferably in aa 844 to aa 859 of SEQ ID No. 2, preferably in aa 860 to aa 874 of SEQ ID No. 2. Still preferably, the epitope is comprised in the aa. 757 to aa 771 region of SEQ ID No. 2.
Preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof as described above comprises at least one heavy chain complementary determining region (CDRH3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 62, 65, 68, 71, 74, 77, 80, 83, 86, 89 and 92.
Preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof further as described above comprises a heavy chain complementary determining region (CDRH2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ ID No. 61, 64, 67, 70, 73, 76, 79, 82, 85, 88 and 91.
Preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention further comprises a heavy chain complementary determining region (CDRH1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ ID No. 60, 63, 66, 69, 72, 75, 78, 81, 84, 87 and 90.
In a preferred embodiment, the antibody, recombinant or synthetic antigen-binding fragments thereof as described above further comprises at least one light chain complementary determining region (CDRL3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 29, 32, 35, 38, 41 , 44, 47, 50, 53, 56 and 59.
In a preferred embodiment, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention further comprises one light chain complementary determining region (CDRL2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: 28, 31, 34, 37, 40, 43, 46, 49, 52, 55 and 58.
In a preferred embodiment, the antibody, recombinant or synthetic antigen-binding fragments thereof as described above further comprises one light chain complementary determining region (CDRL1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: 27, 30, 33, 36, 39, 42, 45, 48, 51, 54 and 57.
Preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention comprises a heavy chain complementary determining regions (CDRHl) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 60, 63, 66, 69, 72, 75, 78, 81, 84, 87 and 90 and a heavy chain complementary determining regions (CDRH2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 61, 64, 67, 70, 73, 76, 79, 82, 85, 88 and 91 and a heavy chain complementary determining regions (CDRH3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 62, 65, 68, 71, 74, 77, 80, 83, 86, 89 and 92.
In a preferred embodiment, the antibody, recombinant or synthetic antigen-binding fragments thereof as described above further comprises a light chain complementary determining regions (CDRL1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 27, 30, 33, 36, 39, 42, 45, 48, 51, 54 and 57 and a light chain complementary determining regions (CDRL2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 28, 31, 34, 37, 40, 43, 46, 49, 52, 55 and 58 and a light chain complementary determining regions (CDRL3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 29, 32, 35, 38, 41, 44, 47, 50, 53, 56 and 59.
In a yet preferred embodiment, the antibody, recombinant or synthetic antigen-binding fragments thereof as described above comprises a CDRHl amino acid sequence having at least 80 % identity to SEQ ID No. 60, a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 61, a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 62.
In a still preferred embodiment, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention further comprises a CDRL1 amino acid sequence having at least 80 % identity to SEQ ID No. 27, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 28 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 29.
In a still preferred embodiment, the antibody, recombinant or synthetic antigen-binding fragments thereof as described above comprises a CDRH1 amino acid sequence having at least 80 % identity to SEQ ID No. 81 , a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 82 and a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 83. In a still preferred embodiment, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention further comprises a CDRLl amino acid sequence having at least 80 % identity to SEQ ID No. 48, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 49 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 50.
Preferably the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention comprises a CDRH1 amino acid sequence having at least 80 % identity to SEQ ID No. 87, a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 88 and a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 89. Still preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof further comprises a CDRLl amino acid sequence having at least 80 % identity to SEQ ID No. 54, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 55 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 56.
In the present invention "at least 80 % identity" means that the identity may be at least 80 % or at least 85 % or 90% or 95% or 100% sequence identity to referred sequences.
Preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof as described above is a monoclonal antibody or a chimeric or a humanized, or a deimmunized or a fully human antibody.
It is a further object of the invention, the antibody, recombinant or synthetic antigen-binding fragments thereof as described above for medical use. Preferably, for use in the treatment and/or prevention of a condition associated with cartilage degradation, such as osteoarthritis and/or rheumatoid arthritis. Preferably the antibody, recombinant or synthetic antigen- binding fragments thereof as described above may be used for the treatment of pathological responses mediated by Syndecan-4, in particular pathological responses of chondrocytes mediated by Syndecan-4.
It is a further object of the invention a nucleic acid molecule encoding the antibody, recombinant or synthetic antigen-binding fragments thereof as defined above. Preferably, the nucleic acid molecule encoding the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention comprises at least one nucleic acid sequence selected from the group consisting of SEQ ID No.99 to SEQ ID No. 120. Preferably, the nucleic acid comprises at least one of the following sequences: SEQ ID NO.: 99, 100, 113, 114, 117 and 118.
It is a further object of the invention an expression vector encoding the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention.
It is a further object of the invention a host cell comprising the nucleic acid as described above. Preferably, the host cell produces the antibody, recombinant or synthetic antigen- binding fragments thereof of the invention.
It is a further object of the invention a method of producing the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention comprising culturing the cell that produces the antibody as described above and recovering the antibody from the cell culture. It is another object of the invention a pharmaceutical composition comprising at least one antibody, recombinant or synthetic antigen-binding fragments thereof as described above and pharmaceutically acceptable excipients. The composition comprises an effective amount of the antibody, recombinant or synthetic antigen-binding fragments thereof. Pharmaceutical compositions are conventional in this field and can be made by the person skilled in the art just based on the common general knowledge. Pharmaceutical compositions comprising the antibody and/or a fragment and/or a recombinant derivative and/or a conjugate thereof in admixture with at least one pharmaceutically acceptable excipient and/or vehicle are included in the scope of the present invention.
In a preferred embodiment, the composition according to the invention is for use in intraarticular administration.
It is also an object of the invention a method of treating and/or preventing a condition associated with cartilage degradation, such as osteoarthritis, rheumatoid arthritis and other forms of arthritides comprising administering a therapeutically effective amount the antibody, recombinant or synthetic antigen-binding fragments thereof as described above. It is also an object of the invention a method for treating and/or preventing joint destruction, for the treatment and/or prevention of autoimmune and/or inflammatory diseases comprising administering an therapeutic effective amount of the antibody, recombinant or synthetic antigen-binding fragments thereof as described above.
It is an object of the invention a method of reducing and/or inhibiting ADAMTS-5 comprising administering an effective amount of the antibody, recombinant or synthetic antigen-binding fragments thereof as described above. In the present invention mutants of the disclosed CDRs may be generated by mutating one or more amino acids in the sequence of the CDRs. It is known that a single amino acid substitution appropriately positioned in a CDR can be sufficient to improve the affinity. Researchers have used site directed mutagenesis to increase affinity of some immunoglobulin products by about 10 fold. This method of increasing or decreasing (i.e modulating) affinity of antibodies by mutating CDRs is common knowledge (see, e.g., Paul, W. E., 1993). Thus, the substitution, deletion, or addition of amino acids to the CDRs of the invention to increase or decrease (i.e, modulate) binding affinity or specificity is also within the scope of this invention.
For sake of brevity, the preferred antibody according to the present invention shall be identified with the name CRB0017 (comprising SEQ ID No. 3 and SEQ ID No. 4), CRB0102 (comprising SEQ ID No. 17 and SEQ ID No. 18) and CRB0123 (comprising SEQ ID No. 21 and SEQ ID No. 22) as indicated in Table III. While the present invention focuses on such antibodies, as an exemplification of the present invention, one of ordinary skill in the art will appreciate that, once given the present disclosure, other similar antibodies, and antibody fragments thereof, as well as antibody fragments of these similar antibodies may be produced and used within the scope of the present invention. Such similar antibodies may be produced by a reasonable amount of experimentation by those skilled in the art.
Still preferably, the antibody is a scFv, Fv fragment, a Fab fragment, a F(ab)2 fragment, a multimeric antibody, a peptide or a proteolytic fragment containing the epitope binding region. Preferably the scFv fragment comprises a sequence selected from the group of SEQ ID No. 125 to 132 and SEQ ID no. 135, 136, 137.
It is a further object of the present invention a nucleic acid encoding the antibody or functional derivatives thereof of the invention, or hybridizing with the above nucleic acid, or consisting of a degenerated sequence thereof.
The process for the preparation of the monoclonal antibody is within the skills of the man skilled in the art and comprises cultivating host cell and isolating the antibody according to standard procedures.
As far as the industrial aspects of the present invention are concerned, the antibody herein disclosed shall be suitably formulated in pharmaceutical compositions as normally done in this technical field.
The antibodies of the present invention may comprises at least one CDRH as defined above that contains one or more amino acid substitutions, deletions or insertions of no more than 4 amino acids, preferably of no more than 2 amino acids. The antibodies of the present invention may further comprises at least one CDRL as defined above that contains one or more amino acid substitutions, deletions or insertions of no more than 4 amino acids, preferably of no more than 2 amino acids.
The antibodies of the invention compete for binding to ADAMTS-5. The method for treating or preventing a condition associated with cartilage degradation, comprises administering to a patient in need thereof an effective amount of at least one antibody, recombinant or synthetic antigen-binding fragments thereof as described above. In some aspects, the invention comprises a method of inhibiting binding of ADAMTS-5 to aggrecan in a subject comprising administering an effective amount of at least one antibody, recombinant or synthetic antigen- binding fragments thereof as described above.
The antibodies, recombinant or synthetic antigen-binding fragments thereof of the invention selectively bind to Spacer domain of ADAMTS-5, preferably with a Kd that is < 2nM.
In some aspects, the invention comprises a method for treating or preventing a condition associated with cartilage degradation in a subject, the method comprising administering to a subject in need thereof an effective amount of at least one antibody, recombinant or synthetic antigen-binding fragments thereof of the invention simultaneously or sequentially with an agent that specifically blocks pain.
The antibody, recombinant or synthetic antigen-binding fragments thereof of the invention are neutralizing antibody (i.e an antibody that reduces or abolishes the biological activity of the related antigen) that binds to ADAMTS-5 and reduces the likelihood that ADAMTS-5 binds to aggrecan.
Preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention bind to ADAMTS-5 at a location within residues 732-874 of SEQ. ID NO: 2. In some embodiments, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention, when bound to ADAMTS-5, is positioned 8 angstroms or less from at least one of the following residues of ADAMTS-5: T732, K733, 1734, V735, G736, T737, F738, N739, K740, K741, S742, K743, G744, Y745, T746, D747, V748, V749, R750, 1751, P752, E753, G754, A755, T756, H757, 1758, K759, V760, R761, Q762, F763, K764, A765, K766, D767, Q768, T769, R770, F771, T772, A773, Y774, L775, A776, L777, K778, K779, K780, N781, G782, E783, Y784, L785, 1786, N787, G788, K789, Y790, M791, 1792, S793, T794, S795, E796, T797, 1798, 1799, D800, 1801, N802, G803, T804, V805, M806, N807, Y808, S809, G810, W811, S812, H813, R814, D815, D816, F817, L818, H819, G820, M821, G822, Y823, S824, A825, T826, K827, E828, 1829, L830, 1831, V832, Q833, 1834, L835, A836, T837, D838, P839, T840, K841, P842, L843, D844, V845, R846, Y847, S848, F849, F850, V851, P852, K853, K854, S855, T856, P857, K858, V859, N860, S861, V862, T863, S864, H865, G866, S867, N868, K869, V870, G871, S872, H873 or T874.
In some embodiments, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention blocks an antibody to ADAMTS-5 from binding within 8 angstroms of a residue of ADAMTS-5. In some embodiments the residue of ADAMTS-5 is selected from at least one of the following ADAMTS-5 residues: T732, K733, 1734, V735, G736, T737, F738, N739, K740, K741, S742, K743, G744, Y745, T746, D747, V748, V749, R750, 1751, P752, E753, G754, A755, T756, H757, 1758, K759, V760, R761, Q762, F763, K764, A765, K766, D767, Q768, T769, R770, F771, T772, A773, Y774, L775, A776, L777, K778, K779, K780, N781, G782, E783, Y784, L785, 1786, N787, G788, K789, Y790, M791, 1792, S793, T794, S795, E796, T797, 1798, 1799, D800, 1801, N802, G803, T804, V805, M806, N807, Y808, S809, G810, W81 1, S812, H813, R814, D815, D816, F817, L818, H819, G820, M821, G822, Y823, S824, A825, T826, K827, E828, 1829, L830, 1831, V832, Q833, 1834, L835, A836, T837, D838, P839, T840, K841, P842, L843, D844, V845, R846, Y847, S848, F849, F850, V851, P852, K853, K854, S855, T856, P857, K858, V859, N860, S861, V862, T863, S864, H865, G866, S867, N868, K869, V870, G871, S872, H873 or T874.
Preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention binds to ADAMTS-5 at a location that overlaps with a location at which aggrecan binds to ADAMTS-5.
Preferably, the antibody, recombinant or synthetic antigen-binding fragments thereof of the invention reduces the likelihood that aggrecan will bind to ADAMTS-5 within 8 angstroms of at least one of the following residues on ADAMTS-5: T732, K733, 1734, V735, G736, T737, F738, N739, K740, K741, S742, K743, G744, Y745, T746, D747, V748, V749, R750, 1751, P752, E753, G754, A755, T756, H757, 1758, K759, V760, R761, Q762, F763, K764, A765, K766, D767, Q768, T769, R770, F771 , T772, A773, Y774, L775, A776, L777, K778, K779, K780, N781, G782, E783, Y784, L785, 1786, N787, G788, K789, Y790, M791, 1792, S793, T794, S795, E796, T797, 1798, 1799, D800, 1801, N802, G803, T804, V805, M806, N807, Y808, S809, G810, W811, S812, H813, R814, D815, D816, F817, L818, H819, G820, M821, G822, Y823, S824, A825, T826, K827, E828, 1829, L830, 1831, V832, Q833, 1834, L835, A836, T837, D838, P839, T840, K841, P842, L843, D844, V845, R846, Y847, S848, F849, F850, V851, P852, K853, K854, S855, T856, P857, K858, V859, N860, S861, V862, T863, S864, H865, G866, S867, N868, K869, V870, G871, S872, H873 or T874. The invention provides formulations comprising a therapeutically effective amount of an antibody as disclosed herein, a buffer maintaining the pH in the range from about 4.5 to about 6.5, and, optionally, a surfactant.
The formulations are typically for an antibody as disclosed herein, recombinant or synthetic antigen-binding fragments thereof of the inventionas active principle concentration from about 0.1 mg/ml to about 100 mg/ml. In certain embodiments, the antibody, recombinant or synthetic antigen-binding fragments thereof concentration is from about 0.1 mg/ml to 1 mg/ml; preferably from 1 mg/ml to 10 mg/ml, preferably from 10 to 100 mg/ml.
For the purposes herein, a "pharmaceutical composition" is one that is adapted and suitable for administration to a mammal, especially a human. Thus, the composition can be used to treat a disease or disorder in the mammal. Moreover, the antibody in the composition has been subjected to one or more purification or isolation steps, such that contaminant(s) that might interfere with its therapeutic use have been separated therefrom. Generally, the pharmaceutical composition comprises the therapeutic protein and a pharmaceutically acceptable carrier or diluent. The composition is usually sterile and may be lyophilized. Pharmaceutical preparations are described in more detail below.
Therapeutic formulations of the antibody/antibodies can be prepared by mixing the antibody having the desired degree of purity with optional physiologically acceptable carriers, excipients or stabilizers (Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed., 1980), in the form of lyophilized formulations or aqueous solutions. Acceptable carriers, excipients, or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and may include buffers, antioxidants, preservatives, peptides, proteins, hydrophilic polymers, chelating agents such as EDTA, sugars, salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and/or non-ionic surfactants such as TWEEN®, PLURONICS® or polyethylene glycol (PEG).
The active ingredients may also be entrapped in microcapsule prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed., 1980). The formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes. In another embodiment, for the prevention or treatment of disease, the appropriate dosage of anti-Sp-ADAMTS-5 antibody/antibodies of the present invention, will depend on the type of disease to be treated, the severity and course of the disease, whether the antibody is administered for preventive or therapeutic purposes, previous therapy, the patient's clinical history and response to the antibody, and the discretion of the attending physician. The antibody is suitably administered to the patient at one time or over a series of treatments. Depending on the type and severity of the disease, about 1 μg/kg to 15 mg/kg of antibody or fragment thereof is an initial candidate dosage for administration to the patient, whether, for example, by one or more separate administrations, or by continuous infusion. For repeated administrations over several days or longer, depending on the condition, the treatment is sustained until a desired suppression of disease symptoms occurs. However, other dosage regimens may be useful. The progress of this therapy is easily monitored by conventional techniques and assays.
The antibody composition should be formulated, dosed, and administered in a fashion consistent with good medical practice. The antibodies/derivatives of the present invention can be administered by any appropriate route. This includes (but is not limited to) intraperitoneal, intramuscular, intravenous, subcutaneous, intraarticular, intratracheal, oral, enteral, parenteral, intranasal or dermal administration. A preferred mode of administration is the intraarticular route. Factors for consideration in this context include the particular disorder being treated, the particular mammal being treated, the clinical condition of the individual patient, the cause of the disorder, the site of delivery of the agent, the method of administration, the scheduling of administration, and other factors known to medical practitioners. The "therapeutically effective amount" of the antibody to be administered will be governed by such considerations, and is the minimum amount necessary to prevent, ameliorate, or treat a disease or disorder. The antibody need not be, but is optionally formulated with one or more agents currently used to prevent or treat the disorder in question. The effective amount of such other agents depends on the amount of antibody present in the formulation, the type of disorder or treatment, and other factors discussed above.
The term "antibody" herein is used in the broadest sense and encompasses various antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), and antibody fragments so long as they exhibit the desired antigen-binding activity.
An "antibody fragment" refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include but are not limited to Fv, Fab, Fab', Fab'-SH, F(ab')2; diabodies; linear antibodies; single-chain antibody molecules (e.g. scFv); and multispecific antibodies formed from antibody fragments.
An "antibody that binds to the same epitope" as a reference antibody refers to an antibody that blocks binding of the reference antibody to its antigen in a competition assay by 50% or more, and conversely, the reference antibody blocks binding of the antibody to its antigen in a competition assay by 50% or more. An exemplary competition assay is provided herein.
The term "chimeric" antibody refers to an antibody in which a portion of the heavy and/or light chain is derived from a particular source or species, while the remainder of the heavy and/or light chain is derived from a different source or species.
The "class" of an antibody refers to the type of constant domain or constant region possessed by its heavy chain. There are five major classes of antibodies: IgA, IgD, IgE, IgG, and IgM, and several of these may be further divided into subclasses (isotypes), e.g., IgGl, IgG2, IgG3, IgG4, IgAl, and IgA2. The heavy chain constant domains that correspond to the different classes of immunoglobulins are called [alpha], [delta], [epsilon], [gamma], and [mu], respectively.
The term "Fc region" herein is used to define a C-terminal region of an immunoglobulin heavy chain that contains at least a portion of the constant region. The term includes native sequence Fc regions and variant Fc regions. Unless otherwise specified herein, numbering of amino acid residues in the Fc region or constant region is according to the EU numbering system, also called the EU index, as described in Kabat et al, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991.
"Framework" or "FR" refers to variable domain residues other than hypervariable region (HVR) residues. The FR of a variable domain generally consists of four FR domains: FR1 , FR2, FR3, and FR4. Accordingly, the HVR and FR sequences generally appear in the following sequence in VH (or VL): FR1-H1(L1)-FR2-H2(L2)-FR3-H3(L3)-FR4. The terms "full length antibody," "intact antibody," and "whole antibody" are used herein interchangeably to refer to an antibody having a structure substantially similar to a native antibody structure or having heavy chains that contain an Fc region as defined herein.
The terms "host cell," "host cell line," and "host cell culture" are used interchangeably and refer to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells. Host cells include "transformants" and "transformed cells," which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein. A "human antibody" is one which possesses an amino acid sequence which corresponds to that of an antibody produced by a human or a human cell or derived from a non-human source that utilizes human antibody repertoires or other human antibody-encoding sequences. This definition of a human antibody specifically excludes a humanized antibody comprising non- human antigen-binding residues.
A "human consensus framework" is a framework which represents the most commonly occurring amino acid residues in a selection of human immunoglobulin VL or VH framework sequences. Generally, the selection of human immunoglobulin VL or VH sequences is from a subgroup of variable domain sequences. Generally, the subgroup of sequences is a subgroup as in Kabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition, NIH Publication 91- 3242, Bethesda MD (1991), vols. 1-3.
A "humanized" antibody refers to a chimeric antibody comprising amino acid residues from non- human HVRs and amino acid residues from human FRs. In certain embodiments, a humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the HVRs (e.g., CDRs) correspond to those of a non- human antibody, and all or substantially all of the FRs correspond to those of a human antibody. A humanized antibody optionally may comprise at least a portion of an antibody constant region derived from a human antibody. A "humanized form" of an antibody, e.g., a non-human antibody, refers to an antibody that has undergone humanization.
A "deimmunized" antibody is an antibody with reduced immunogenicity based on disruption of HLA binding, an underlying requirement for T cell stimulation.
The term "hypervariable region" or "HVR," as used herein refers to each of the regions of an antibody variable domain which are hypervariable in sequence and/or form structurally defined loops ("hypervariable loops"). Generally, native four-chain antibodies comprise six HVRs; three in the VH (HI , H2, H3), and three in the VL (LI , L2, L3). HVRs generally comprise amino acid residues from the hypervariable loops and/or from the "complementarity determining regions" (CDRs), the latter being of highest sequence variability and/or involved in antigen recognition. Exemplary hypervariable loops occur at amino acid residues 26-32 (LI), 50-52 (L2), 91-96 (L3), 26-32 (HI), 53-55 (H2), and 96-101 (H3) (Chothia and Lesk, J. Mol. Biol. 196:901- 917, 1987). Exemplary CDRs (CDR-L1 , CDR-L2, CDR-L3, CDR-H1 , CDR-H2, and CDR-H3) occur at amino acid residues 24-34 of LI , 50-56 of L2, 89-97 of L3, 31-35B of HI , 50-65 of H2, and 95-102 of H3 (Kabat et al, Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, MD, 1991). With the exception of CDR1 in VH, CDRs generally comprise the amino acid residues that form the hypervariable loops. CDRs also comprise "specificity determining residues," or "SDRs," which are residues that contact antigen. SDRs are contained within regions of the CDRs called abbreviated-CDRs, or a-CDRs. Exemplary a- CDRs (a-CDR-Ll , a-CDR-L2, a-CDR-L3, a-CDR-Hl , a-CDR-H2, and a-CDR-H3) occur at amino acid residues 31-34 of LI , 50-55 of L2, 89-96 of L3, 31-35B of HI , 50-58 of H2, and 95-102 of H3 (See Almagro and Fransson, Front. Biosci. 13: 1619-1633, 2008). Unless otherwise indicated, HVR residues and other residues in the variable domain (e.g., FR residues) are numbered herein according to Kabat et al.
The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope, except for possible variant antibodies, e.g., containing naturally occurring mutations or arising during production of a monoclonal antibody preparation, such variants generally being present in minor amounts. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by a variety of techniques, including but not limited to the hybridoma method, recombinant DNA methods, phage-display methods, and methods utilizing transgenic animals containing all or part of the human immunoglobulin loci, such methods and other exemplary methods for making monoclonal antibodies being described herein.
The term "package insert" is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, combination therapy, contraindications and/or warnings concerning the use of such therapeutic products.
"Percent (%) amino acid sequence identity" with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
The term "pharmaceutical formulation" refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
A "pharmaceutically acceptable carrier" refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject., A pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
As used herein, "treatment" (and grammatical variations thereof such as "treat" or "treating") refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and can be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In some embodiments, antibodies of the invention are used to delay development of a disease or to slow the progression of a disease.
The term "variable region" or "variable domain" refers to the domain of an antibody heavy or light chain that is involved in binding the antibody to antigen. The variable domains of the heavy chain and light chain (VH and VL, respectively) of a native antibody generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three hypervariable regions (HVRs, See, e.g., Kindt et al. Kuby Immunology, 6th ed., W.H. Freeman and Co., page 91, 2007). A single VH or VL domain may be sufficient to confer antigen-binding specificity. Furthermore, antibodies that bind a particular antigen may be isolated using a VH or VL domain from an antibody that binds the antigen to screen a library of complementary VL or VH domains, respectively (See, e.g., Portolano et al, J. Immunol. 150:880- 887, 1993; Clarkson et al, Nature 352:624-628, 1991).
The term "vector," as used herein, refers to a nucleic acid molecule capable of propagating another nucleic acid to which it is linked. The term includes the vector as a self- replicating nucleic acid structure as well as the vector incorporated into the genome of a host cell into which it has been introduced. Certain vectors are capable of directing the expression of nucleic acids to which they are operatively linked. Such vectors are referred to herein as "expression vectors".
In another aspect, the antibody or derivatives thereof comprises a heavy chain variable domain (VH) sequence having at least 80 %, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%), 99%), or 100% sequence identity to an amino acid sequence selected from the group of: SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24.
In another aspect, the antibody or derivatives thereof comprises a light chain variable domain (VK or VL) sequence having at least 80 %, 85 %, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%), 98%), 99%), or 100% sequence identity to an amino acid sequence selected from the group of: SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23.
In certain embodiments, the VH sequence or VK/VL sequence having at least 80 %>, 85 %>, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to said SEQ ID No. contains substitutions (e.g., conservative substitutions), insertions, or deletions relative to the reference sequence, but an anti-Sp-ADAMTS-5 antibody comprising that sequence retains the ability to bind to the spacer domain of ADAMTS-5. In certain embodiments, a total of 1 to 4 amino acids have been substituted, inserted and/or deleted in the sequence of the CDRH3 such as in SEQ ID No. 62. In certain embodiments, substitutions, insertions, or deletions occur in regions outside the HVRs (i.e. , in the FRs).
Preferably, the antibody of the invention is antibody CRB0017, CRB0093, CRB0094, CRB0102, CRB0123, CRB0124, as defined in Table III.
In certain embodiments, the antibody or fragment thereof of the invention has a dissociation constant (Kd) of < 100 nM, < 10 nM, < 1 nM, < 0.1 nM, < 0.01 nM, or < 0.001 nM or less, e.g. from 10-8 M to 10"13 M, e.g. , from 10"9 M to 10"13 M.
In one embodiment, Kd is measured by a radiolabeled antigen binding assay (RIA) performed with the Fab version of an antibody of interest and its antigen as described by the following assay. Solution binding affinity of Fabs for antigen is measured by equilibrating Fab with a minimal concentration of ( I)-labeled antigen in the presence of a titration series of unlabeled antigen, then capturing bound antigen with an anti-Fab antibody-coated plate (see, e.g. , Chen et al, J. Mol. Biol. 293:865-881(1999)).
The invention will be described now by non-limiting examples referring to the following figures.
Figure 1. ADAMTS-4 and ADAMTS-5 schematic representation. Both enzymes are multidomain metalloproteinases secreted from the cell into the extracellular space. Both enzymes have a similar domain arrangement consisting of a signal sequence (SS), a prodomain (Pro), a catalytic metalloproteinase domain (Cat), a disintegrin (Dis) domain, a thrombospondin type I (TS) domain, a cysteine- rich (CysR) domain, and a spacer (Sp) domain. In addition, ADAMTS-5 contains an extra TS domain after the spacer domain.
Figure 2. Western blot analysis of ADAMTS-5 p75 after FPLC purification, using an antibody against the FLAG tag of the protein. Western blots were probed with monoclonal antibody recognizing the fusion proteins containing a FLAG peptide sequence (Sigma Aldrich, Monoclonal ANTI-FLAG M2, dilution 1 : 1000). For detection using chemiluminescent peroxidase substrate, an anti-mouse IgG-peroxidase (1 : 10,000) was employed. TS5= ADAMTS-5 Transfected cells; NT= Non Transfected cells; M= Mock. Figure 3. ELISA reactivity of isolated anti- Sp_ AD AMT S -5 scFvs with Spacer-GST and GST negative control. Spacer-GST and GST antigens were coated at 10μg/mL. Anti- Sp_ADAMTS-5scFvs were used at 50 and/or 5 μg/mL (data not shown). The mean absorbance at 450nm of the experiments performed in duplicate wells is shown with SD indicated by the bars.
Figure 4. Sandwich ELISA. Dilution curves of coated CRB0017_IgG4 binding to Spacer- GST and/or GST in solution at 30 μg/mL. As secondary antibody an anti-GST (1 : 1000) was used following an anti-rabbit IgG HRP (1 :2000) for final detection. The mean absorbance at 450nm of the experiments performed in duplicate wells is shown with SD indicated by the bars.
Figure 5. Kinetic analysis of CRB0017_IgG4 binding Spacer-GST in solution using Biacore X-100. 5610 RU of CRB0017_IgG4 were immobilized on CM5 chip. The association and dissociation were performed for 180s and 800s respectively. Kinetic rate constants and affinity determined for CRB0017_IgG4/Spacer-GST interaction are shown in the table below. Figure 6. Immunoprecipitation (IP) of ADAMTS-5 full length (TS5-FL) by CRB0017_IgG4. 0.1 μg of dialyzed/affinity purified TS5-FL were immunoprecipitated (IP) with anti- Sp_ADAMTS-5 CRB0017_IgG4 antibody (11, 22 and 25 μg in lane 1, 2 and 3, respectively) or with 11 μ of unrelated antibody as a negative control (lane 4). Immunoprecipitates were analysed by immunoblotting with anti-FLAG antibody (1 : 1000). CRB0017_IgG4- immunoprecipitated ~ 81kDa TS5-FL band was observed corresponding to TS5-FL p75 protein. The molecular mass of immunoprecipitated TS5-FL protein is slightly higher than predicted from its amino acid composition. This difference is due to N-glycosylation in the Dis, CysR, Sp domains and to O-glycosylation at the C-term domain. Molecular mass markers are indicated to the left-hand side of the Figure.
Figure 7. IP of ADAMTS-4 full length (TS4-FL) by CRB0017_IgG4. 0.2 μg of dialyzed/affinity purified TS4-FL were immunoprecipitated (IP) with anti- Sp_ADAMTS-5 CRB0017_IgG4 antibody (30 and 60 μg in lane 1 and 2, respectively) or with an unrelated antibody (30 μg) as a negative control (lane 3). In lane 4, dialyzed/affinity purified TS4-FL was loaded as a positive control. Immunoprecipitates were analysed by immunoblotting with anti-FLAG antibody (1 : 1000). CRB0017_IgG4-immunoprecipitated ~75kDa TS5-FL band was observed corresponding to TS4-FL p68 protein. The molecular mass of immunoprecipitated TS4-FL protein is slightly higher than predicted from its amino acid composition and this is mainly due to N- and O- glycosylation in the protein. Molecular mass markers are indicated to the left-hand side of the Figure.
Figure 8. Effect of anti-Sp_ADAMTS-5 IgG4 in in vitro proteolysis of bovine cartilage induced by IL-la. Figure represents IL-la 5ng/ml activity in the absence or presence of CRB0017 IgG4 after 48h of incubation (three different independent experiments). As a negative control in each experiments a human native IgG4 (Serotec) was used. As a positive control in each experiment a synthetic ADAMTS-5 inhibitor (Cpd 23) and a natural ADAMTS-5 inhibitor (TIMP-3) were used. The results are expressed as % GAG release, i.e. the quantitation of glycosaminoglycans (GAGs) in the form of aggrecan fragments released from the cartilage in culture; this method measures cytokine efficiency in simulating cartilage metabolism.
Figure 9. Evaluation of the effect of the HelixB- ADAMTS-5 binding protein CRB0016_IgG4 in the STR/ort mouse model of osteoarthritis. CRB0016_IgG4 was administered intraarticularly in both knees of each animal, once at the start of the experiment and again after 6 weeks, at doses of 1,2 and 12 μg/knee. Three months after first administration, CRB0016_IgG4 did not modify the course of OA in the STR/ort mouse strain, as assessed histo-pathologically. Grade is defined as the depth of the lesion through the articular cartilage. Stage is defined as the horizontal extent of cartilage involvement within one side of a joint compartment irrespective of the underlying grade. Taken together, both constitute an index of the severity or pathologic progression of the osteoarthritic process, and indeed the OARSI score is defined as grade x stage. Cell loss is defined as the fraction of articular chondrocytes that have undergone cell death, within the articular compartment considered. GAG (glycosaminoglycan) loss is defined as and assessed by the loss of a cation stain that presents metachromasy towards GAGs, such as for instance Toluidine blue or Safranin O. Mankin has defined his score as the sum of grade, cell loss and GAG loss, while the total score is defined as the sum of the OARSI score and cell loss and GAG loss. All of the above parameters constitute features of OA, and their scoring gives a measure of the severity and progression of the pathology.
Figure 10. Evaluation of the effect of CRB0017_IgG4 in the STR/ort mouse model of osteoarthritis. CRB0017_IgG4 was administered intraarticularly in both knees of each animal, once at the beginning of the experiment and again after 6 weeks, at doses of 1,2 and 12 μg/knee. Three months after first administration, CRB017_IgG4 showed a dose-dependent activity in reducing OA severity in the STR ort mouse model. All parameters are defined as in Fig. 9.
Figure 11. A) CRB0017_IgG4 is able to recognize ADAMTS-5 secreted from permeabilized or non permeabilized cells in a dose dependent manner. As controls, anti-catalytic and two anti-cys domain of ADAMTS-5 commercial antibodies were used. B) CRB0017_IgG4 does not cross-reacted with any protein on the cell surface of HEK293 cells.
Figure 12. Supernatants harvested from Hek293-ADAMTS-5 (ADAMTS-5 cond. Medium) and Hek293 (Hek-293 cond. Medium) were challenged in a sandwich ELISA using mAb CRB0017_IgG4 in coating as described in the material section below, "no mAb CRB0017" is a control condition in which wells are not coated with CRB0017_IgG4, "no medium" is a control condition in which no supernatant was added to the wells and "Ab" " is a control condition in which only the secondary antibody was added to the wells. As shown in figure, CRB0017_IgG4 is able to recognize ADAMTS-5 secreted from HEK293 expressing cells with high specificity.
Figure 13. Unilateral medial meniscal tear model (MMT) is a widely used rat surgical model of knee OA. Rapidly progressive degenerative changes occur, that consist in chondrocyte and proteoglycan loss, matrix fibrillation and clefting, osteophyte formation. One week after surgery, rats were treated intraarticularly with CRB0017_IgG4 35μg/knee, CRB0017 70μg/knee, or vehicle. After 3 weeks from injection the animals were sacrificed and the femorotibial joints processed for histology. All histological scores were dose-dependently decreased by treatment with CRB0017_IgG4 compared to vehicle.
Figure 14. Competitive inhibition of mAb ADAMTS-5 binding to mAb CRB0017-coated plates by free Syndecan-4. mAb CRB0017 (2 μg/ml in coating buffer) were adsorbed to immunoplates before blocking. ADAMTS-5 (4 μg/ml) in presence of Syndecan-4 (O. ^g/ml) were incubated before adding to the immobilized mAb CRB0017. ADAMTS-5 binding to mAb CRB0017-coated plates were revealed using anti-FLAG commercial antibody.
Figure 15. mAbs anti-spacer CRB0017_IgG4, CRB0093_IgG4, CRB094_IgG4 and CRB0124_IgG4 are able to recognize specifically full length ADAMTS-5 in sandwich ELISA with comparable specificity. mAb CRB0123_IgG4 display a higher binding capacity for ADAMTS-5 than the other anti-spacer mAbs in this assay.
DETAILED DESCRIPTION OF THE INVENTION
DESCRIPTION OF THE SEQUENCES
SEQ. ID NO:l: A S4_HUMAN A disintegrin and metalloproteinase with thrombospondin motifs 4 (UniProtKB/Swiss-Prot : 075173.3)
SEQ. ID NO 2: ATS5_HUMAN A disintegrin and metalloproteinase with thrombospondin motifs 5 (UniProtKB/Swiss-Prot : Q9UNA0.2)
In the following: VK = light chain, VH = heavy chain, CDRL =
complementary determining region of light chain, CDRH =
complementary determining region of heavy chain.
SEQ ID NO: 3 to SEQ ID NO: 94, SEQ ID NO: 125 to 132 and SEQ ID NO: 135 to SEQ ID NO: 137 are amino acid sequences, SEQ ID NO: 95 to 120 are nucleotide sequences.
SEQ. ID NO 3, C B0017VK
SEQ. ID NO 4, C B0017VH
SEQ. ID NO 5, C B0018VK
SEQ. ID NO 6, C B0018VH
SEQ. ID NO 7, C B0019VK
SEQ. ID NO 8, C B0019VH
SEQ. ID NO 9, C B0091VK
SEQ. ID NO 10, C B0091VH
SEQ. ID NO 11, C B0092VL
SEQ. ID NO 12, C B0092VH
SEQ. ID NO 13, C B0093VK
SEQ. ID NO 14, CRB0093VH
SEQ. ID NO 15, C B0094VL SEQ. ID NO 16, C B0094VH
SEQ. ID NO 17, CRB0102VK
SEQ. ID NO 18, C B0102VH
SEQ. ID NO 19, C B0122VL
SEQ. ID NO 20, C B0122VH
SEQ. ID NO 21, C B0123VK
SEQ. ID NO 22, C B0123VH
SEQ. ID NO 23, C B0124VL
SEQ. ID NO 24, C B0124VH
SEQ. ID NO 25, C B0016VK
SEQ. ID NO 26, C B0016VH
SEQ. ID NO 27, CDRL1_17
SEQ. ID NO 28, CDRL2_17
SEQ. ID NO 29, CDRL3_17
SEQ. ID NO 30, CDRL1_18
SEQ. ID NO 31, CDRL2_18
SEQ. ID NO 32, CDRL3_18
SEQ. ID NO 33, CDRL1_19
SEQ. ID NO 34, CDRL2_19
SEQ. ID NO 35, CDRL3_19
SEQ. ID NO 36, CDRL1_91
SEQ. ID NO 37, CDRL2_91
SEQ. ID NO 38, CDRL3_91
SEQ. ID NO 39, CDRL1_92
SEQ. ID NO 40, CDRL2_92
SEQ. ID NO 41, CDRL3_92
SEQ. ID NO 42, CDRL1_93
SEQ. ID NO 43, CDRL2_93
SEQ. ID NO 44, CDRL3_93
SEQ. ID NO 45, CDRL1_94
SEQ. ID NO 46, CDRL2_94
SEQ. ID NO 47, CDRL3_94
SEQ. ID NO 48, CDRL1_102
SEQ. ID NO 49, CDRL2_102
SEQ. ID NO 50, CDRL3_102
SEQ. ID NO 51, CDRL1_122
SEQ. ID NO 52, CDRL2_122
SEQ. ID NO 53, CDRL3_122
SEQ. ID NO 54, CDRL1_123
SEQ. ID NO 55, CDRL2_123
SEQ. ID NO 56, CDRL3_123
SEQ. ID NO 57, CDRL1_124
SEQ. ID NO 58, CDRL2_124
SEQ. ID NO 59, CDRL3_124
SEQ. ID NO 60, CDRH1_17
SEQ. ID NO 61, CDRH2_17
SEQ. ID NO 62, CDRH3_17
SEQ. ID NO 63, CDRH1_18
SEQ. ID NO 64, CDRH2_18
SEQ. ID NO 65, CDRH3_18
SEQ. ID NO 66, CDRH1_19
SEQ. ID NO 67, CDRH2_19
SEQ. ID NO 68, CDRH3_19
SEQ. ID NO 69, CDRH1_91
SEQ. ID NO 70, CDRH2_91
SEQ. ID NO 71, CDRH3 91 SEQ. ID NO: 72, CDRH1_92
SEQ. ID NO: 73, CDRH2_92
SEQ. ID NO: 74, CDRH3_92
SEQ. ID NO: 75, CDRHl_93
SEQ. ID NO: 76, CDRH2_93
SEQ. ID NO: 77, CDRH3_93
SEQ. ID NO: 78, CDRHl_94
SEQ. ID NO: 79, CDRH2_94
SEQ. ID NO: 80, CDRH3_94
SEQ. ID NO: 81, CDRH1_102
SEQ. ID NO: 82, CDRH2_102
SEQ. ID NO: 83, CDRH3_102
SEQ. ID NO: 84, CDRH1_122
SEQ. ID NO: 85, CDRH2_122
SEQ. ID NO: 86, CDRH3_122
SEQ. ID NO: 87, CDRHl_123
SEQ. ID NO: 88, CDRH2_123
SEQ. ID NO: 89, CDRH3_123
SEQ. ID NO: 90, CDRHl_124
SEQ. ID NO: 91, CDRH2_124
SEQ. ID NO: 92, CDRH3_124
SEQ. ID NO: 93, lexA-Spacer
SEQ. ID NO: 94, Spacer-GST
SEQ. ID NO: 95, CRB0016_VK
SEQ. ID NO: 96, CRB0016_IgG4
SEQ. ID NO: 97, CRB0017_VK_CK
SEQ. ID NO: 98, CRB0017_IgG4
SEQ. ID NO: 99, CRB0017_VK
SEQ. ID NO: 100, CRB0017_VH
SEQ. ID NO: 101, CRB0018_VK
SEQ. ID NO: 102, CRB0018_VH
SEQ. ID NO: 103, CRB0019_VK
SEQ. ID NO: 104, CRB0019_VH
SEQ. ID NO: 105, CRB0091_VK
SEQ. ID NO: 106, CRB0091_VH
SEQ. ID NO: 107, CRB0092_VL
SEQ. ID NO: 108, CRB0092_VH
SEQ. ID NO: 109, CRB0093_VK
SEQ. ID NO: 110, CRB0093_VH
SEQ. ID NO: 111, CRB0094_VL
SEQ. ID NO: 112, CRB0094_VH
SEQ. ID NO: 113, CRB0102_VL
SEQ. ID NO: 114, CRB0102_VH
SEQ. ID NO: 115, CRB0122_VL
SEQ. ID NO: 116, CRB0122_VH
SEQ. ID NO: 117, CRB0123_VK
SEQ, ID NO: 118, CRB0123_VH
SEQ. ID NO: 119, CRB0124_VL
SEQ. ID NO: 120, CRB0124_VH
SEQ. ID NO: 121, HUMAN SPACER DOMAIN_AA
SEQ. ID NO: 122, HELIX_B_ADAMTS-5_AA
SEQ. ID NO: 123, HUMAN SPACER DOMAIN
SEQ. ID NO: 124, HELIX_B_ADAMTS-5
SEQ. ID NO: 125, CRB0017_scFv
SEQ. ID NO: 126, CRB0018_scFv
SEQ. ID NO: 127, CRB0019 scFv SEQ. ID NO: 128, CRB0091_scFv
SEQ. ID NO: 129, CRB0092_scFv
SEQ. ID NO: 130, CRB0093_scFv
SEQ. ID NO: 131, CRB0094_scFv
SEQ. ID NO: 132, CRB0102_scFv
SEQ. ID NO: 133, HUMAN ADAMTS-5_cDNA
SEQ. ID NO: 134, HUMAN ADAM S-4_cDNA
SEQ. ID NO: 135, CRB0122_scFv
SEQ. ID NO: 136, CRB0123_scFv
SEQ. ID NO: 137, CRB0124_scFv
SEQ. ID NO: 138, small peptide linker
SEQ. ID NO: 139-216, synthetic primers
MATERIALS AND METHODS SPLINT library from human lymphocytes.
The development of therapeutic antibodies for use in the treatment of human diseases has long been a goal for many researchers in the antibody field. One way to obtain these antibodies is through Single Pot Library of Intracellular Antibodies (SPLINT libraries) constructed from human lymphocytes. SPLINT technology expresses human scFv (single chain antibody fragment) libraries cloned in pMVl vector, a vector derived from pLinker220 vector (Visintin et al, 2004. J Immunol Methods. 290: 135-153), as fusion to the VP16 activation domain. The variable regions are linked with a small peptide linker (SGGSTSGSGKPGSGEGSSGT, SEQ ID No. 138). pMVl contains LEU2 gene that permits maintenance of the plasmid and selection on media lacking leucine in yeast strain L40 and the bla gene that permits the selection of plasmid in E.coli.
For construction of human SPLINT libraries the peripheral blood donations from one hundred, non-immunized donors were used. Approximately 2-20 ml of blood samples from each donor were collected. B-lymphocytes were isolated from peripheral blood by using Ficoll plaque reagent (Amersham, USA). Briefly, the diluted blood sample (1 : 1 of blood per PBS) was carefully layered on top of the Ficoll plaque reagent, and then the two phase solution was centrifuged at 400 x g for 30 minutes. B-lymphocytes were collected from the interface between the two phases. Total RNA was extracted from B-lymphocytes by RNeasy Mini Kit (Qiagen) according to manufacturer's instruction. Total RNA was prepared from the B lymphocytes and pooled together before being used for the isolation of mRNA. mRNA was prepared using Oligotex mRNA mini kit (Qiagen) according to manufacturer's instruction. ThermoScript™ RT-PCR System (Invitrogen) was used for cDNA synthesis reactions according to manufacturer's instruction. Oligo (dT)20 were used to synthesize cDNA of V- genes repertoire. In order to reduce amplification bias, the authors performed 62 (for hS PLINT huuS_ PLINT_09) and 75 (for huSPLINT IO) independent PCR reactions to amplify V gene segments, using all possible combinations within a primer set (for huSPLINT_09 see Table I; for huSPLINT IO see Table II).
The primer sequences, which in theory encompass the entire repertoire of human antibody genes, were obtained from IMGT/GENE-DB (Giudicelli et al, 2005. Stud Health Technol Inform. 116:3-8), and modified according to previously published protocols (Sblattero and Bradbury, 1998. Immunotechnology. 3 :271-278); (Marks et al, 1991. Eur J Immunol. 21 :985- 991);(Orlandi et al, 1992. Biotechnology. 24:527-531). In this method, the individual rearranged heavy- and light-chain variable regions are amplified separately and are linked through a series of overlapping polymerase chain reaction (PCR) steps to give the final scFv products that are used for cloning (Visintin et al, 2004. J Immunol Methods . 290: 135-153). The PCR reactions for huSPLINT_9 (Table I) included seven VH forward primers paired with four VH reverse primers which generated a total of twenty-eight reactions; whereas four VK forward primers paired with four reverse primers generated a total of sixteen reactions; and nine νλ forward primers paired with two νλ reverse primers generated a total of eighteen reactions.
Table I: huSPLINT_09 PCR primers reverse (rv) and forward (fw) for human V-genes chain
PRIMERS SEQUENCE
TTATCCTCGAGCGGTACCCAGGTGCAGCTGCAGGAGTCSG SEQ I D No . 13 9
TTATCCTCGAGCGGTACCCAGGTACAGCTGCAGCAGTCA SEQ I D No . 14 0
TTATCCTCGAGCGGTACCCAGGTGCAGCTACAGCAGTGGG SEQ I D No . 14 1
VHfw TTATCCTCGAGCGGTACCGAGGTGCAGCTGKTGGAGWCY SEQ I D No . 142
TTATCCTCGAGCGGTACCCAGGTCCAGCTKGTRCAGTCTGG SEQ I D No . 143 TTATCCTCGAGCGGTACCCAGRTCACCTTGAAGGAGTCTG SEQ I D No . 144 TTATCCTCGAGCGGTACCCAGGTGCAGCTGGTGSARTCTGG SEQ I D No . 145 o GATTGGTTTGCCGCTAGCTGAGGAGACRGTGACCAGGGTG SEQ I D No . 14 6
GATTGGTTTGCCGCTAGCTGAGGAGACGGTGACCAGGGTT SEQ I D No . 147
VHrv
GATTGGTTTGCCGCTAGCTGAAGAGACGGTGACCATTGT SEQ I D No . 14 8
GATTGGTTTGCCGCTAGCTGAGGAGACGGTGACCGTGGTCC SEQ I D No . 14 9
AGCAAGCGGCGCGCATGCCGACATCCRGDTGACCCAGTCTCC SEQ I D No . 150
AGCAAGCGGCGCGCATGCCGAAATTGTRWTGACRCAGTCTCC SEQ I D No . 151
VK†W
AGCAAGCGGCGCGCATGCCGATATTGTGMTGACBCAGWCTCC SEQ I D No . 152 AGCAAGCGGCGCGCATGCCGAAACGACACTCACGCAGTCTC SEQ I D No . 153
GAAGTTATGGTCGACCCTCCGGATTTGATTTCCACCTTGGTCC SEQ I D No . 154
GAAGTTATGGTCGACCCTCCGGATTTGATCTCCASCTTGGTCC SEQ I D No . 155
Vicrv
GAAGTTATGGTCGACCCTCCGGATTTGATATCCACTTTGGTCC SEQ I D No . 156 GAAGTTATGGTCGACCCTCCGGATTTAATCTCCAGTCGTGTCC SEQ I D No . 157 AGCAAGCGGCGCGCATGCCCAGTCTGTSBTGACGCAGCCGCC SEQ ID No. 158
AGCAAGCGGCGCGCATGCCTCCTATGWGCTGACWCAGCCAC SEQ ID No. 159
AGCAAGCGGCGCGCATGCCTCCTATGAGCTGAYRCAGCYACC SEQ ID No. 160
AGCAAGCGGCGCGCATGCCCAGCCTGTGCTGACTCARYC SEQ ID No. 161 νλίνν AGCAAGCGGCGCGCATGCCCAGDCTGTGGTGACYCAGGAGCC SEQ ID No. 162
AGCAAGCGGCGCGCATGCCCAGCCWGKGCTGACTCAGCCMCC SEQ ID No. 163 AGCAAGCGGCGCGCATGCCTCCTCTGAGCTGASTCAGGASCC SEQ ID No. 164 AGCAAGCGGCGCGCATGCCCAGTCTGYYCTGAYTCAGCCT SEQ ID No. 165 AGCAAGCGGCGCGCATGCCAATTTTATGCTGACTCAGCCCC SEQ ID No. 166
GAAGTTATGGTCGACCCTCCGGATAGGACGGTSASCTTGGTCC SEQ ID No. 167 νλι-ν
GAAGTTATGGTCGACCCTCCGGAGAGGACGGTCAGCTGGGTGC SEQ ID No. 168
VL_PTfw CGCTGGATTGTTATTACTCGCAGCAAGCGGCGCGCATGCC SEQ ID No. 169
ACCGCTCGAGCCTTCACCGGAACCTGGTTTCCCAGAACCGCTGGTCGACCCTCC SEQ
VL_PTrv
ID No. 170
GGAGGGTCGACCAGCGGTTCTGGGAAACCAGGTTCCGGTGAAGGCTCGAGCGGTA
VH_PT fv
SEQ ID No. 171
VH_PTrv CCAGGCCCAGCAGTGGGTTTGGGATTGGTTTGCCGCTA SEQ ID No. 172
VL_FINALfw TACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTC SEQ ID No. 173
VH_FINALrv TGGTGATGGTGAGTACTATCCAGGCCCAGCAGTGGGTTTG SEQ ID No. 174
The PCR reactions for huSPLINT IO (Table II) included six VH forward primers paired with four VH reverse primers which generated a total of twenty-four reactions; whereas six VK forward primers paired with five VK reverse primers generated a total of thirty reactions; and seven νλ forward primers paired with three νλ reverse primers generated a total of twenty- one reactions.
Tablell: huSPLINT IO PCR primers reverse (rv) and forward (fw) for human V-genes chain
PRIMERS SEQUENCE
AGCAAGCGGCGCGCATGCCCAGGTGCAGCTGGTGCAGTCTGG SEQ ID No. 175
AGCAAGCGGCGCGCATGCCCAGGTCAACTTAAGGGAGTCTGG SEQ ID No. 176
AGCAAGCGGCGCGCATGCCGAGGTGCAGCTGGTGGAGTCTGG SEQ ID No. 177
VHfw
AGCAAGCGGCGCGCATGCCCAGGTGCAGCTGCAGGAGTCGGG SEQ ID No. 178
AGCAAGCGGCGCGCATGCCGAGGTGCAGCTGTTGCAGTCTGC SEQ ID No. 179
AGCAAGCGGCGCGCATGCCCAGGTACAGCTGCAGCAGTCAGG SEQ ID No. 180
Q. GAAGTTATGGTCGACCCTCCGGATGAGGAGACGGTGACCAGGGTGCC SEQ ID No.
CO
3
JZ 181
GAAGTTATGGTCGACCCTCCGGATGAAGAGACGGTGACCATTGTCCC SEQ ID No.
VHrv 182
GAAGTTATGGTCGACCCTCCGGATGAGGAGACGGTGACCAGGGTTCC SEQ ID No.
183
GAAGTTATGGTCGACCCTCCGGATGAGGAGACGGTGACCGTGGTCCC SEQ ID No. 184
TTATCCTCGAGCGGTACCGACATCCAGATGACCCAGTCTCC SEQ ID No. 185
TTATCCTCGAGCGGTACCGATGTTGTGATGACTCAGTCTCC SEQ ID No. 186
TTATCCTCGAGCGGTACCGAAATTGTGTTGACGCAGTCTCC SEQ ID No. 187
VKfw
TTATCCTCGAGCGGTACCGACATCGTGATGACCCAGTCTCC SEQ ID No. 188
TTATCCTCGAGCGGTACCGAAACGACACTCACGCAGTCTCC SEQ ID No. 189
TTATCCTCGAGCGGTACCGAAATTGTGCTGACTCAGTCTCC SEQ ID No.190
GATTGGTTTGCCGCTAGCACGTTTGATTTCCACCTTGGTCCC SEQ ID No.191
GATTGGTTTGCCGCTAGCACGTTTGATCTCCAGCTTGGTCCC SEQ ID No.192
Vicrv GATTGGTTTGCCGCTAGCACGTTTGATATCCACTTTGGTCCC SEQ ID No.193
GATTGGTTTGCCGCTAGCACGTTTGATCTCCACCTTGGTCCC SEQ ID No.194
GATTGGTTTGCCGCTAGCACGTTTAATCTCCAGTCGTGTCCC SEQ ID No. 195
VXfw TTATCCTCGAGCGGTACCCAGTCTGTGTTGACGCAGCCGCC SEQ ID No.196
TTATCCTCGAGCGGTACCCAGTCTGCCCTGACTCAGCCTGC SEQ ID No.197
TTATCCTCGAGCGGTACCTCCTATGTGCTGACTCAGCCACC SEQ ID No.198
TTATCCTCGAGCGGTACCTCTTCTGAGCTGACTCAGGACCC SEQ ID No.199
TTATCCTCGAGCGGTACCCACGTTATACTGACTCAACCGCC SEQ ID No.200
TTATCCTCGAGCGGTACCCAGGCTGTGCTCACTCAGCCGTC SEQ ID No.201
GATTGGTTTGCCGCTAGCACCTAGGACGGTGACCTTGGTCCC SEQ ID No.202
VXrv GATTGGTTTGCCGCTAGCACCTAGGACGGTCAGCTTGGTCCC SEQ ID No.203
GATTGGTTTGCCGCTAGCACCTAAAACGGTGAGCTGGGTCCC SEQ ID No. 204
VH PTfw CGCTGGATTGTTATTACTCGCAGCAAGCGGCGCGCATGCC SEQ ID No. 205
ACCGCTCGAGCCTTCACCGGAACCTGGTTTCCCAGAACCGCTGGTCGACCCTCC SEQ ID
VH PTrv
No.206
GGAGGGTCGACCAGCGGTTCTGGGAAACCAGGTTCCGGTGAAGGCTCGAGCGGTA SEQ
VL PT fv
ID No.207
VL PTrv CCAGGCCCAGCAGTGGGTTTGGGATTGGTTTGCCGCTA SEQ ID No.208
VH FINALfw TACCTATTGCCTACGGCAGCCGCTGGATTGTTATTACTC SEQ ID No.209
VL FINALrv TGGTGATGGTGAGTACTATCCAGGCCCAGCAGTGGGTTTG SEQ ID No.210
The PCRs led to the representation in the repertoire of variable regions derived from all conceivable framework assemblies. All primers contained either BssHII or Nhel restriction sites or linker sequence. The final pull-through PCR could be done with two primers (PTfw&PTrv). After the final scFv gene repertoires had been sequentially digested with BssHII and Nhel, they were ligated directly into pre-digested and dephosphorylated pMVl vector. From one ligation reaction and thirty electroporations for each library, the authors were able to obtain the final huSPLINT_09 and huSPLINT IO libraries each consisting of ~108 different scFv molecules with 0.04% of clones from no-insert ligation.
Cloning of Spacer- AD AMTS-5 bait and expression in yeast cell L40. cDNA encoding human Spacer-ADAMTS-5 (SEQ. ID No. 123) was amplified from ADAMTS-5 pSecTag2A using primers:
5 '-TGGCTGGAATTCACAAAGATTGTTGGA-3 ' SEQ ID No. 211
5 '-GTCGACGGATCCTTAAGTGTGTGATCCCAC-3 ' SEQ ID No. 212
The EcoRI-BamHI digested cDNA was cloned into pMICBDl vector (Visintin et al, 2004. J Immunol Methods. 290: 135-153) designed to contain bacterial cloramphenicol resistance, TRP1 gene (which allows yeast containing this plasmid to grow in minimal medium lacking tryptophan) and the 2μ origin of replication. This plasmid contains the entire region of the Escherichia coli lexA protein, expressed from the yeast alcohol dehydrogenase I (ADH1) promoter, followed by a polylinker for cDNA insertion, to generate in- frame fusions to lexA. Bait was sequenced to confirm in-frame fusion of the insert with lexA binding domain in the vector.
L40 yeast cells were transfected with bait Sp_ADAMTS-5/MICBDl vector by using lithium acetate transformation protocol. The transformants were assayed for histidine prototropy on YC-Lys/- Ura/-His/-Trp plates (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790; Visintin et al, 2004. J Immunol Methods. 290:135-153.; Visintin et al, 2004. Methods. 34:200-214; Visintin et al, 2002. J Mol Biol. 317:73-83.; Visintin et al, 1999. Proc Natl Acad Sci U S A. 96: 11723-11728). Yeast colonies were assayed for β-galactosidase activity using colony lift filters, as previously described (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790). The transfection of the bait did not result in activation of the lacZ gene (data not shown).
Cloning of HelixB- ADAMTS-5 bait and expression in yeast cell L40.
cDNA encoding an a-helix (helixB, SEQ. ID No. 124) at the surface position of the human catalytic domain of ADAMTS-5 was assembled using primers:
5'-AATTCAACGCTGCCACCACACTCAAGAACTTTTGCAAGTGGCAGCACCAACAC AACTAACTGCA-3' SEQ ID No. 213
5 ' -GTTAGTTGTGTTGGTGCTGCC ACTTGC AAAAGTTCTTGAGTGTGGTGGC AGCGT TG-3' SEQ ID No. 214
The EcoRI-PstI digested cDNA was cloned into pMICBDl vector (Visintin et al, 2004. J Immunol Methods. 290: 135-153). L40 yeast cells were transfected with bait helixB/MICBDl vector by using lithium acetate transformation protocol. The transformants were assayed for histidine prototropy on YC-Lys/- Ura/-His/-Trp plates (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790). Yeast colonies were assayed for β-galactosidase activity using colony lift filters, as previously described (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790). The transfection of the bait did not result in activation of the lacZ gene (data not shown).
Western blot analysis of Spacer- AD AMTS-5 bait.
An overnight yeast culture was diluted in 5 ml of YC medium at OD600 0.15 and grown at 30°C up to OD600 0.6. 1 ml of culture was centrifuged at lOOOOxg for 5 min and the cell pellet resuspended in Laemmli buffer, resolved on 12% SDS-PAGE, and transferred onto a PVDF membrane (Millipore). Polyclonal antibody anti-LexA (Invitrogen) was used, followed by anti-rabbit-HPR (DAKO). The ECL-chemiluminescence system (Amersham) was used for detection (data not shown).
SPLINT selections.
SPLINT libraries were transformed into L40 yeast strain expressing the bait (Sp ADAMTS- 5/MICBD1 or HelixB-ADAMTS-5/MICBDl) using the lithium acetate method and the selection as described (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790; Visintin et al, 2004. J Immunol Methods. 290:135-153.; Visintin et al, 2004. Methods. 34:200-214; Visintin et al, 2002. JMol Biol. 317:73-83.; Visintin et al, 1999. Proc Natl Acad Sci U S A. 96: 11723-11728). Transformed yeast cells were plated on solid medium lacking Trp (W), Leu (L), Uracil (U), Lys (K) and His (H) (YC-WHULK). Expression of selective marker Trp (W) is provided by pMICBDl plasmid, Leu (L) by pMVl plasmid, and Uracil (U), Lys (K) and His (H) are prototroph markers of the yeast strain. Positive clones were grown on selective medium YC-WHULK. β-Galactosidase assays were performed as described (Visintin and Cattaneo, 2001. Antibody Engineering. 1 :790; Visintin et al, 2004. J Immunol Methods. 290: 135-153.; Visintin et al, 2004. Methods. 34:200-214; Visintin et al, 2002. J Mol Biol. 317:73-83.; Visintin et al, 1999. Proc Natl Acad Sci U S A. 96: 11723-11728). 11 positive anti-Sp_ADAMTS-5scFvs were isolated after secondary screening from four independent screening of different SPLINT libraries (mSPLINT, huSPLINT_09 and huSPLINT IO). The results of the selections performed for Sp AD AMTS-5 bait are summarized in Table III.
Table III. Summary of Sp_AD AMTS-5 SPLINT selections BAIT SPLINT N.≠ N.≠ CLONES CLONE CRB SEQ ID
LIBRARY CLONES (II screening) No.
(I screening)
Sp_ADAMTS-5/MICBD 1 mSPLINT 15 3 M6 CRB0017 3;4
7A CRB0018 5;6
14 CRB0019 7;8
Sp_ADAMTS-5/MICBD 1 huSPLINT_09 121 4 7A CRB 0091 9;10
C21 CRB 0092 11 ;12
47A CRB 0093 13;14
48B CRB 0094 15;16
Sp_ADAMTS-5/MICBD 1 huSPLINT IO 90 1 15A CRB0102 17;18
Sp_ADAMTS-5/MICBD 1 huSPLINT IO 99 3 S39 CRB0122 19;20
S50 CRB0123 21 ;22
S53a CRB0124 23;24
Cloning and expression of recombinant Spacer- AD AMTS-5-GST protein.
Human Spacer domain of ADAMTS-5 (SEQ. ID NO: 121 and 123) was cloned into Nco- Xhol restriction sites of pET41b (Novagen). The cDNA encoding the Spacer domain was amplified from ADAMTS-5 pSecTag2A using primers:
5 '-ATCCATGGTCACAAAGATTGTTGGAACC-3 ' SEQ ID No. 215
5 '-ATCTCGAGTTAAGTGTGTGATCCCACTTTATTG-3 ' SEQ ID No. 216
Sp_ADAMTS-5-GST/pET41b plasmid was transformed into Rosetta 2 (DE3) E.coli (Novagen) by heat shock transformation system (Hanahan, 1983. J Mol Biol. 166:557-580.) and plate onto LB Kan/Cam plates.
The day after, a single colony was inoculated and diluted into lOmL LB Kan/Cam media. Transformed bacteria was grown overnight at 37°C shacking at 250 RPM.
The day after, overnight grown bacteria were diluted in 500mL LB Kan/Cam media and then paced to grow at 37°C with 250 RPM shacking since the culture have reached OD(600)=0.7. Then 0.2mM (final concentration) IPTG was added. Induced bacteria were incubated for 5-6 hours at 25°C with 250 RPM shacking. Bacteria were finally centrifuged at 6000 RPM for 15 minutes and pellet was frozen at -80°C.
Reformatting of anti-ADAMTS-5scFvs to entire IgG antibodies.
Anti-catalytic_ADAMTS-5 CRB0016 scFv and anti-Sp_ADAMTS-5 CRB0017 scFv were reformatted to entire chimeric IgG antibodies by coupling the murine antigen-binding variable domains to human constant domains. For each antibody the cDNAs encoding the light and heavy chain (Fc from human IgG4) were generated by GENEART (Germany) with suitable restriction sites for subcloning. Sequences were optimized for mammalian expression (CHO- S cell line) (SEQ.ID. NO: 95 and 96; 97 and 98). After synthesis of both chains, the cDNAs were sub-cloned in expression plasmids (pcDNA3.1 derivates containing an extended CMV promoter for expression of the gene of interest) using Hindlll and Xhol as cloning sites. For each antibody chain, two expression plasmids were generated: one plasmid containing the cDNA encoding the light chain, one containing the cDNA encoding the heavy chain. The expression plasmid containing the correct inserts was verified by restriction analysis and DNA sequence analysis of the insert.
Anti-Sp_ADAMTS-5 CRB0093, CRB0094, CRB0102, CRB0123 and CRB0124 scFvs were also reformatted to entire fully human IgG4 antibodies following the cloning procedure adopted for CRB0016 and CRB0017 described above.
Production of recombinant chimeric CRB0016_IgG4 and CRB0017_IgG4 antibodies from transfected cells.
Anti-ADAMTS-5 antibodies were produced from transfected cells. CHO-S cells were transfected with plasmids encoding CRB0016 and CRB0017 heavy and light chains. Conditioned media from transfected cells were recovered by removing cells and debris. Clarified conditioned media were loaded onto protein A-sepharose column. Non-specific bindings were removed by extensively binding buffer washes (20 mM sodium phosphate pH 7.0 ). Bound antibody proteins on the protein A column were recovered by acidic antibody elution from protein A (0.1 M glycine-HCl pH 3.0). Eluted proteins were immediately neutralized with 1M Tris-HCl pH=9.0 (ΙΟΟμί per mL eluted fractions). Pooled eluted fractions were dialyzed against PBS. Aggregated antibody proteins were removed by size exclusion chromatography.
Purification of recombinant Spacer- AD AMTS-5-GST protein.
Thawed Sp_ADAMTS-5-GST induced and expressing bacteria was resuspended in 20mL of Lysis Buffer (PBS, 10 μg/mL DNase, 20 μg/mL Lysozime). Resuspended pellets were incubated for 45 minutes at 4°C with rocking. After incubation lysed bacteria were sonicated in ice for 3 times (15 seconds each). After 10 minutes centrifugation at 6000 RPM at 4°C the supernatant was collected, filtered with 0.2 □ micron filter and processed for purification. GST Trap column(GE) was connected with AKTA Purifier (GE) and washed with 5CV of water at 5mL/min flux. Then column was washed with 5CV of PBS at 5mL/min flux. Column was then connected to a peristaltic pump and loaded at lmL/min flux with filtered supernatant. After washing with 5CV of PBS at 5mL/min flux the column was reconnected to AKTA purifier and washed again with 2CV of PBS at 5mL/min flux. Protein was eluted at 100% elution buffer (PBS, lOmM Glutathione). Fractions of the peak were collected into 2mL eppendorf tubes. Pool of 3 main central fractions diluted in PBS was concentrated using Amicon Ultra 15 according to manufacturer's specifications. Concentrated protein was quantified with Protein 80 BioAnalyser (Agilent). Aliquots were stored at -80°C.
Expression and refolding of anti-Sp_ADAMTS-5scFvs in the cytoplasm of E. coli.
Anti- Sp_AD AMT S -5 scFv fragments (SEQ, ID 125, 126, 127, 128, 129, 130, 131, 132, 135, 136, 137) were subcloned into Ncol/Notl restriction sites of pETM-13 bacterial expression vector. E. coli BL21DE3 harbouring the expression plasmid was cultured in 500mL of 2YT/Kan medium until the mid-exponential phase (OD600 = 0.75) and then induced with IPTG (1.5 mM) for additional 5-6 h at 37°C with shaking (180 rpm). The cells were harvested at 6000rpm (Beckman) and the pellets were used for inclusion bodies (IB) preparation. A large-scale expression method as inclusion bodies of E. coli was optimized, using in vitro refolding (Patil et al, 2008. JBiotechnol. 134:218-221. Epub 2008 Jan 2018); (Umetsu et al, 2003. J Biol Chem. 278:8979-8987. Epub 2003 Jan 8977). Pellet was resuspended at 5mL/g-l with IBR buffer (50mM Tris/HCl, 0.5mM EDTA, 20μg/mL lysozime, ^g/mL DNase at pH 8) and put on shaking plate for lh at RT. Sample was sonicated for 45 sec on ice for three pulses, followed by 1 min incubation on ice. The lysate was then centrifuged for lOmin at 4°C at 6,000 rpm. The pellet was resuspended in 20mL of wash buffer 1 (lOmM Tris pH 8, ImM EDTA, 1% Triton X-100), vortexed and then the inclusion bodies were sedimented by centrifugation at 10,000rpm for lOmin at 4°C. Pellet was washed with 20mL wash buffer 2 (lOmM Tris pH8, ImM EDTA, 1M NaCl), vortexed and then centrifugated at 10,000rpm for lOmin at 4°C. Finally pellet was washed with 20mL wash buffer 3 (lOmM Tris pH8, ImM EDTA), vortexed and centrifugated at 10,000rpm for lOmin at 4°C. The IB preparation was solubilised at 5mLg-l with solubilization buffer (lOOmM Tris/HCl; 6M guanidine HC1; ImMEDTA; lOOmM DTT at pH 8). The solubilised proteins were incubated for 2 h at room temperature under vigorous agitation. After lowering the pH of the protein solution at pH 4 with HC1 1M, the insoluble material was removed by centrifugation at 10,000rpm for lOmin. In order to remove DTT from the solute a triple dialysis against IBD buffer (6M guanidine HC1 at pH 4) was performed. The solubilised and quantified proteins were diluted 35mg/L, as quickly as possible, into cold REF buffer (lOOmMTris/HCl; 0.5M arginine; 375μΜ oxidized 1-gluthatione; 5mM EDTA at pH 8.5). The protein solution was dispensed every 50 minutes with a pipette directly into the REF buffer while vortexing. After 16 h of the last addition the sample was first concentrated and the remaining guanidinium was removed by dialysis into IEXA buffer (according to pi of scFv and thus to ionic exchange protocol subsequently employed). The refolded scFvs were purified by a ion exchange chromatography stored aliquoted at -80°C.
Specificity ELISA: Anti-Sp_ADAMTS-5 scFvs versus Sp_ADAMTS-5-GST.
Nunc Maxi-Sorp Immunoplate was coated with lOOmL Sp_ADAMTS-5-GST and GST at ^g/mL in coating buffer (lOOmM Na2C03 pH 9.6). Plate was incubated overnight at 4°C. next day, the unbound antigens were discarded and plate was washed 3x with PBS. Nonspecific binding was blocked by adding 200mL of 3% MPBS (3% fat free milk in PBS). Plate was incubated for lh at RT. Plate was washed 3xTPBS (0.1% Tween20 in PBS) and 3xPBS. 100 μΕ of serial dilution of anti-Sp_ADAMTS-5scFv (0.5-50 μg/mL) in 3% MPBS was added to appropriate wells. Then plate was incubated for 2h at RT. After washing with 3xTPBS and 3xPBS, 100 μΕ of anti-V5 antibody (Invitrogen) diluted 1 :5000 in 3% MPBS was added to each well. Plate was incubated for lh and 30min at RT. After washing with 3xTPBS and 3xPBS 100 μΕ of anti-mouse HRP (DAKO) diluted 1 :2000 in 3% MPBS was added to each well. Plate was incubated for lh at RT. After washing with 3xTPBS and 3xPBS 80 μΐ^ of TMB (Sigma) was added. Plate was incubated in dark chamber until samples reach the desired signal. 80 μΐ, of stopping solution (500mM H2S04) was added to each well before reading. Data were collected measuring OD(450nm) by LD 400 Luminescence Detector (Beckman Coulter). Sandwich ELISA: Anti-Sp_ADAMTS-5 mAb versus Sp_ADAMTS-5-GST.
Nunc Maxi-Sorp Immunoplate was coated with serial dilution of lOOmL of anti- Sp_ADAMTS-5 immunoglobulin in coating buffer (lOOmM Na2C03 pH 9.6). Plate was incubated overnight at 4°C. The next day, the unbound antibodies were discarded and plate was washed 3x with PBS. Non-specific binding was blocked by adding 200μί of 3% MPBS (3% fat free milk in PBS). Plate was incubated for lh at RT. Plate was washed 3xTPBS (0.1% Tween20 in PBS) and 3xPBS. 100 μΕ of Sp_ADAMTS-5-GST and GST (30 μg/mL) in 3% MPBS was added to appropriate wells. Then plate was incubated for 2h at RT. After washing with 3xTPBS and 3xPBS, 100 μΕ of anti-GST antibody (Sigma) diluted 1 : 1000 in 3% MPBS was added to each well. Plate was incubated for lh and 30min at RT. After washing with 3xTPBS and 3xPBS 100 μΐ, of anti-rabbit HRP (DAKO) diluted 1 :2000 in 3% MPBS was added to each well. Plate was incubated for lh at RT. After washing with 3xTPBS and 3xPBS 80 of TMB (Sigma Aldrich) was added. Plate was incubated in dark chamber until samples reach the desired signal. 80 μΙ_, of stopping solution (500mM H2SO4) was added to each well before reading. Data were collected measuring OD(450nm) by LD 400 Luminescence Detector (Beckman Coulter).
Evaluation of anti-Sp_ADAMTS-5scFv and/or mAb affinity and kinetic constants by Surface Plasmon Resonance measurements.
Binding kinetics of Sp_ADAMTS-5-GST binding to anti- Sp AD AMT S -5 antibody (scFv or IgG) immobilized by amine coupling in a carboxymethyl dextran matrix of a CM5 chip. Standard immobilization procedures were used (Schuck, 1997. Annu Rev Biophys Bio mo 1 Struct. 26:541-566). 20-50 μg/mL of scFv or IgG was dissolved in acetate buffer (suitable pre-concentration buffer at least 2 pH unit below the pi of the immunoglobulin in order to get a net positive charge). Immobilization level of 5000 RU for the immunoglobulin and 1000 RU for scFv was set to get a low density immobilization of the ligand. Mild regeneration condition of the chip (contact time of 30 seconds at lOmM glycine pH2) was used.
Sp_ADAMTS-5-GST was diluted into PBS+0.005% Tween20 running buffer at 5 serial dilution (starting in the micromolar range and diluting 1 :2) and applied at a flow rate of 30 μΐ/min. Sample condition Step was set initially with contact time of 60 seconds and dissociation time of 400 seconds. On the basis of the resulting sensograms, in the kinetic/affinity step, the analyte concentrations, contact time, dissociation time and regeneration solution were adjusted.
Data were analysed by Bioevaluation Software: the quality of the data fitting can be checked by the value of Chi2 and of the U-value.
Evaluation of binding capacity of anti-spacer ADAMTS-5 mAbs to ADAMTS-5 target antigen.
mAbs anti-spacer CRB0017_IgG4, CRB0093_IgG4, CRB0094_IgG4, CRB0123_IgG4 and CRB0124_IgG4 were coated at 2 μg/mL in lOOmM Na2C03 pH 9.6 and incubated at 4° C overnight. Next day the unbound immunoglobulin was discarded off the plate and wash 3X with TBS. Plate was blocked by adding 200μί of protein free blocking buffer (Pierce- undiluted) and incubated for lhour at 37°C. Plate was washed as above. Then ΙΟΟμΙ, per well of purified ADAMTS-5 (4 μ§/ηι1) in Blocking buffer (dil. 1 :2 in TBS) and as negative control, ΙΟΟμΙ per well of Blocking buffer dil. 1 :2 in TBS were added. Plate was incubated for lhour at 37°C. Plate was subsequently washed 3X with TTBS. 100 μΐ per well of Mouse Anti-Flag Antibody (Sigma; cod F3165) dil 1 :8000 was added in blocking buffer (dil. 1 :2 with TTBS). Plate was incubated for lhour at 37°C. Plate was washed Wash 3X with TTBS. 100 μΐ of anti-mouse antibody (DA O) diluted 1 :2000 in TTBS was added and plate was incubated for lhour at 37°C. Plate was finally washed 3X with TTBS and 3X with TBS. For detection 100 μΐ of TMB was added and incubated in the dark till the signal is visible (normally 5-15 min). ΙΟΟμί per well of Stopping solution was added to stop reaction and to proceed to O.D. measurement.
Cloning and expression of ADAMTS-4 and ADAMTS-5 3xFLAG full length forms.
cDNA encoding human ADAMTS-5 (SEQ. ID NO: 133) and human ADAMTS-4 (SEQ. ID NO: 134) sequences were amplified to introduce restriction site for Kpn I (5' termini) and for Xho I (3' termini) and to remove the region coding for propeptide. After digestion with Kpnl and Xhol, the inserts were subcloned into pSecTag2A vector (Invitrogen).
ADAMTS-5 3XFLAG/pSecTag2A and ADAMTS-4 3XFLAG/pSecTag2A were transfected in FreeStyle™ 293-F cell line. Cells were adapted to suspension culture in FreeStyle™ 293 Expression Medium. Anti-clumping agent (Invitrogen) was added to the medium, before or post-transfection. Cells were transfected with FreeStyle™ MAX Reagent complex in animal- origin free OptiMEM™ SFM. Transfected cells were incubated at 37°C, 8% C02 on a stirring platform set at 75 rpm. 100 μg/ml heparin was added into the culture 24 hour post- transfection. ADAMTS-5 3XFLAG and ADAMTS-4 3XFLAG expressions reached a significant protein activity 48-72 hours post-transfection. After 2-3 days, supernatants were harvested and stored at -80°C until purification.
Full length ADAMTS-4/ ADAMTS-5 3xFLAG protein purification.
300 ml of ADAMTS-5 3XFLAG/ ADAMTS-4 3XFLAG supernatants were loaded into lmL anti-FLAG M2 Affinity Gel (Sigma- Aldrich). Samples were applied at flow rate of 1 mL/min with pressure of 0,5 MPa and the columns were washed with 10 volumes of 50 mMTris-HCl (pH 7,4), 10 mM CaC12, 10 μΜ ZnCl, 0.02% Brij-35 containing 1 M NaCl in order to remove heparin bound to the enzyme. Elution of FLAG fusion proteins was achieved by competition with 200 μ /ηι1 of 3XFLAG peptide (Sigma- Aldrich) in aggrecanase reaction buffer (50 mM Tris-HCl (pH 7,4), 150 mM NaCl, 10 mM CaC12, 10 μΜ ZnCl, 0.02% Brij-35). A flow rate of 1 mL/min was maintained throughout the purification procedure and fractions of 1,0 ml were collected. The fractions containing the eluted proteins were pulled together and concentrated 5X using a Vivaspin concentrator (Sartorius) (30 kD of cut-off).
Western blot analysis of ADAMTS-4/ADAMTS-5 3xFLAG purified proteins.
ADAMTS-5 3X FLAG and ADAMTS-5 3X FLAG purified samples, were resuspended in Sample buffer (Invitrogen), heated for 10 min and loaded onto a 10% SDS-polyacrylamide gel electrophoresis system (Invitrogen, NuPage System) and then subjected to Western blotting. The separated proteins were transferred to PVDF membrane (GE Healthcare). The membranes were blocked 30' with Starting Block Solution (Pierce) and incubated lh with primary monoclonal antibody anti 3XFLAG (Sigma) 1 : 1000 at °RT. After incubation at °RT (lh) with peroxidase-coupled secondary antibody anti mouse (AbCam), diluted 1 : 10.000, protein bands were detected by using Super Signal Dura West (Pierce). Images were acquired with a CCD camera using a Las3000 Imaging System (Fuji) (see figure 2 for ADAMTS-5 western blot).
Analysis of enzymatic activity.
The purified full length enzymes ADAMTS-4 3X FLAG and ADAMTS-5 3X FLAG were tested for activity by an enzymatic assay. Aggrecan purified from bovine nasal cartilage entrapped in polyacrylamide (Nagase and Woessner, 1980. Anal Biochem. 107:385-392) was used as a substrate to determine aggrecan-degrading activity.
Aggrecan/polyacrylamide particles samples (5,0 ± 0.2 mg dry weight) were placed in 1,5 mL tubes with 400 μΐ of TNC (0,1 M Tris-HCl, 0,1 M NaCl, 10 mM CaC12, 0,1% CHAPS; pH 7,5) and 100 μΐ of recombinant ADAMTS-4 (p68, FL) and ADAMTS-5 (p75, FL) preparations, expressed in transiently transfected FreeStyle-293 cells and incubated at 37°C for 6 or 24 h. The reactions were stopped with 500 of stop solution (50 Mm Tris, 200 mM Sodium acetate, 100 mM EDTA; pH=6.8) and the particles were separated from the liquid phase by centrifugation (10000 rpm, 4 min, 4°C). The amount of sulphated glycosaminoglycans (GAGs) in the supernatant was determined by a colorimetric assay (1,9 dimethyl methylene blue, DMB). Standard curve (Chondroitin Sulphate extracted from bovine trachea) and samples were diluted in PBS-BSA 1%. After a 5-20 min of reaction, samples were read at 590 nm. The GAGs concentration of each sample was calculated from absorbance measurements (blank subtracted) and compared to the reference standard curve.
Cartilage explant and culture.
Bovine nasal cartilage disks were obtained from eight month male bovine nasal septum. In brief, 2-mm-diameter punches of cartilage were obtained from the nasal cartilage. The punches were first washed three times with PBS-AASS buffer (lxPBS, 100 U/ml penicillin G, 100 μg/ml streptomycin and 2.5 μg/ml amphotericin B). The punches were subsequently incubated at 37°C in an atmosphere of 5% C02, in microplate wells containing DMEM 10%, 100 U/ml penicillin G, 100 μg/ml streptomycin and 2.5 μg/ml amphotericin B (DMEM-AASS media). After three hours the samples were washed with PBS-AASS buffer and incubated with DMEM-AASS media. 48h after the preparation of the cartilage cells, samples were treated with 5ng/mL IL-la plus different concentration of the inhibitor (i.e. CRB0017_IgG4 and TIMP-3) and incubated in DMEM, 0.1% BSA + AASS for 48h. After treatments supernatants and small pieces of cartilage were collected and used for GAG analysis (the measurement of GAG release is the quantitation of glycosaminoglycans - GAGs- in the form of aggrecan fragments released from the cartilage in culture). The punches of cartilages were first incubated with 500μg/mL papain at 65°C for 2h for the measurement of the percentage of total GAG remaining in the tissue. The sulphated glycosaminoglicans (GAGs) determination is done by a colorimetric assay with 1,9 dimethylmethylene blue (DMB). Standard curve (Chondroitin Sulphate extracted from bovine trachea), medium samples and and digested cartilage samples were diluted in PBS-BSA 1%. After a 5-20 min of reaction samples were read at 590 nm. Immunoprecipitation of ADAMTS-5 and ADAMTS-4 3xFLAG full length proteins.
Immunoprecipitation was performed using Protein G Immunoprecipitation Kit (SIGMA). To reduce background caused by non-specific adsorption of irrelevant cellular proteins to the Protein G Agarose, a pre-clearing step was perfomed. 50 μΐ of the Protein G Agarose suspension was added to the sample (ADAMTS-5 or ADAMTS-4 purified proteins) in a microcentrifuge tube and incubate for 2 hours at 4 °C with rocking. Beads was pelleted by centrifugation at 12,000g for 30 seconds in a microcentrifuge and the collected supernatant (precleared sample) was transferred to a fresh tube. This sample was used for immunoprecipitation. Add to the sample the anti-Sp_ADAMTS-5 and adjusted the volume to 600 μΐ, in IP buffer. This sample was added to a capped spin column and incubated overnight at 4 °C. The day after, 50 μΐ, of washed Protein G Agarose beads was added to the column. After 2h of rocking incubation at 4 °C the tip of the spin column was broken off and the column was placed into 2mL eppendorf tube. The tube was spinned at 12,000xg for 30 seconds at 4 °C. The beads in the spin column were resuspended in 700 μΐ of lxIP buffer and then column was centrifuged at 12,000xg for 30 seconds at 4 °C. This washing step was repeated for 3 times. The last wash was performed with O. lxIP buffer. Beads were resuspended with 50 of hot lx Laemmli Sample Buffer. After 10 minutes incubation at 95°C, proteins were eluted by centrifugation at 13,000xg for 1 minute. The sample was loaded onto SDS-PAGE gel for western blot analysis.
Binding of present invention antibodies on Hek-293-ADAMTS-5-3XFLAG/Hek-293 in Cell-ELISA format.
The Cell-Based ELISA format allows target cellular proteins, to be analyzed in the same well, thus minimizing well-to-well variability. FreeStyle™ 293-F cell line stably expressing ADAMTS-5 3XFLAG were used. Cells were coltured as suspension culture in FreeStyle™ 293 Expression Medium. FreeStyle™ 293-F cells expressing ADAMTS-5 3XFLAG and FreeStyle™ 293-F cells
were seeded in 96-well plates (100.000 cells/well) and incubated for lh at at 37°C. Cells were then treated with CRB0017_IgG4 (final concentration 10-5-2 μg/ml) and incubated for lh at at 37°C. Cells were then fixed with 4% p-formaldehyde (50 μΕΛνεΙΙ) in HBSS (with Ca/Mg) for 15 min at RT and permeabilized or not in the wells with 100 μΐ of 0,1 % Igepal in TBS (100 μΕΛνεΙΙ) for 15 min at RT. Cells were then washed with TBS (100 μΕΛνεΙΙ) followed by quenching with 1 % H202 in TBS (100 μΕΛνεΙΙ) for 20 min RT. Cells were subsequently washed with TBS (100 μΕΛνεΙΙ) followed by blocking with 5 % BSA in TBS (100 μΕ/well) for 30 min RT. After washing cells 3X with Tween 0,1% in TBS (TTBS)- (100 μΕ/well) cells were then incubated with secondary antibody (100 μΕ/well donkey anti-human -HRP Antibody 1 :5000 in TTBS) for 30 min at RT. After washing cells 3X with TTBS (200 μΕΛνεΙΙ) cells were detected adding TMB ΙΟΟμΕΛνεΙΙ. Reaction was stopped detection with 0,5 M H2S04 (ΙΟΟμΕΛνεΙΙ) within 15 minutes. pAb Anti- ADAMTS-5 Cys 636-649 (Abcam#abl 11918) and pAb Anti- ADAMTS-5 Cys 600-700 (Abeam # ab41037) were used to detect the effective retention and/or secretion of ADAMTS-5. Evaluation of binding capacity of present invention antibodies to ADAMTS-5.
mAb CRB0017_IgG4 was coated at 2 μg/mL in lOOmM Na2C03 pH 9.6 and incubated at 4° C overnight. Next day the unbound immunoglobulin was discarded off the plate and wash 3X with TBS. Plate was blocked by adding 200μί of protein free blocking buffer (Pierce- undiluted) and incubated for lhour at 37°C. Plate was washed as above. Then ΙΟΟμί per well of either HEK-293-ADAMTS-5-3XFLAG or HEK-293 (negative control) conditioned medium supplemented with Heparin 100 μg/ml was added. Plate was incubated for lhour at 37°C. Plate was subsequently washed 3X with TTBS. 100 μΐ per well of Mouse Anti-Flag Antibody (Sigma; cod F3165) dil 1 :8000 was added in blocking buffer (dil. 1 :2 with TTBS). Plate was incubated for lhour at 37°C. Plate was washed Wash 3X with TTBS. 100 μΐ of anti-mouse antibody (DAKO) diluted 1 :2000 in TTBS was added and plate was incubated for lhour at 37°C. Plate was finally washed 3X with TTBS and 3X with TBS. For detection 100 μΐ of TMB was added and incubated in the dark till the signal is visible (normally 5-15 min). ΙΟΟμί per well of Stopping solution was added to stop reaction and to proceed to O.D. measurement.
Evaluation of the capacity of Syndecan-4 to interfere in CRB0017_IgG4 anti-spacer ADAMTS-5 binding to ADAMTS-5 antigen.
ΙΟΟμΙ per well of CRB0017_IgG4 (2 μg/ml) was coated in immunoplate in coating buffer (2 μg/ml) and incubated at 4° C overnight. The unbound immunoglobulin was discarded off the plate and wash 3X with TBS. Non-specific binding was blocked by adding 200μ1 per well of Blocking buffer (undiluted) and incubated for 1 hour at 37°C. In the meantime tubes were prepared with [ADAMTS-5 (4 μg/ml) + Syndecan-4 (R&D System# 2 18-SD-050) in Blocking buffer dil. 1 :2 in TBS; range of concentrations tested for Syndecan-4: 0.05-2 μg/ml; in the conditions set up for this assay, the maximum interference effect has been obtained with 0.1 μg/ml. Plate was then washed as above. ΙΟΟμΙ per well of either ADAMTS-5 (4 μg/ml) or [ADAMTS-5 (4 μg/ml) + Syndecan-4 (0.1 μg/ml) in Blocking buffer dil. 1 :2 in TBS were added. As negative control, to some well were added ΙΟΟμΙ of Blocking buffer dil. 1 :2 in TBS. Some wells were added with ΙΟΟμΙ of Syndecan-4 (at appropriate concentration) as a control. Plate was incubated for 1 hour at 37°C. After incubation plate was washed 3X with TTBS. ΙΟΟμΙ per well of anti-Flag antibody (Sigma) diluted 1 :2000 in Blocking buffer (dil. 1 :2 with TTBS) was added. In wells with just Syndecan-4, ΙΟΟμΙ per well of Anti- Syndecan-4 ( Santa Cruz Biotechnology # sc-12766) diluted 1 :5000 in Blocking buffer (dil. 1 :2 with TTBS) was added. Plate was then incubated for 1 hour at 37°C. After incubation plate was washed 3X with TTBS. ΙΟΟμΙ per well of peroxidase-conjugated anti-mouse antibody (Jackson ImmunoResearch) diluted 1 :5000 in TTBS were added and plate was incubated for 1 hour at 37°C. Plate was finally washed 3X with TTBS and 3X with TBS and ΙΟΟμΙ per well of TMB was added. Plate was incubated in the dark till the signal was visible (normally 5-15 min; in any case not more than 30 min). ΙΟΟμΙ per well of Stopping solution was added to proceed to O.D. measurement
Evaluation of the effect of anti-ADAMTS-5 mAbs in the STR/ort mouse model of osteoarthritis.
STR/ort male mice (Mason et al, 2001. Osteoarthritis Cartilage. 9:85-91) were recruited at 5 months of age (n=20-22), randomized for treatment in each cage, with 4 animals per cage, weighed and treated intraarticularly in each knee with either anti-ADAMTS-5 IgG4 1.2 μg, anti-ADAMTS-5 IgG4 12 μg, or vehicle. After 6 weeks the intraarticular administration of anti-ADAMTS-5 IgG4 was repeated with the same doses. After 3 months from recruitment the animals were sacrificed by cervical dislocation and hind limbs explanted and fixed in formalin o/n. Hind limbs were embedded in paraffin, 5 -micron thick sections were produced and stained with toluidine blue and then scored in a blind fashion according to both Mankin's (Mankin et al, 1971. J Bone Joint Surg Am. 53:523-537) and the OARSI methods (Pritzker et al, 2006. Osteoarthritis Cartilage. 14: 13-29). This method produces an OA score with a range 0-24 based on the most advanced grade (6) and the more extending stage (4). Statistical analysis was performed with Student's t test comparing vehicle vs. basal, and with ANOVA followed by Dunn's or Dunnett's tests comparing all treatment groups vs. vehicle.
Evaluation of present invention antibodies in the Medial Meniscal Tear (MMT) rat model of osteoarthritis.
Unilateral medial meniscal tear (MMT) in rats results in rapidly progressive cartilage degenerative changes characterized by chondrocyte and proteoglycan loss, fibrillation, osteophyte formation and chondrocyte cloning. Progressive degenerative changes occur 3-6 weeks post-surgery: tibial cartilage degeneration may be focally severe with degenerative changes of lesser severity in the surrounding matrix and prominent osteophytes.
Male Lewis rats weighing 200 g were used. Right knees underwent surgery or sham-surgery. The medial collateral ligament was transected and the medial meniscus was grasped with a hemostat and reflected proximally toward the femur. The meniscus was transected with a scalpel or small surgical scissors. Sham operation consisted in only opening skin and capsula. One week after surgery rats were treated intraarticularly in the operated knee with present invention antibodies such as either CRB0017_IgG4 34 μg, CRB0017_IgG4 72 μg, or vehicle. Four weeks after surgery the animals were sacrificed by cervical dislocation and the operated knees explanted and fixed in formalin o/n. and embedded in paraffin; 5-micron thick sections were produced and stained with toluidine blue and then scored in a blind fashion according to both Mankin's and the OARSI methods. Statistical analysis was performed with Student's t test comparing vehicle vs. sham, and with ANOVA.
RESULTS
Selection of specific anti-Spacer domain antibodies using SPLINT technology.
To select specific anti-spacer domain of ADAMTS-5 by SPLINT technology, the spacer domain of ADAMTS-5 (aa 732 to aa 874 of SEQ. ID NO. 2) was cloned to the 3 Of LexA (LexA-Sp_ADAMTS-5; SEQ. ID NO: 93) and used to challenge a mouse SPLINT (mSPLINT) and two-different human SPLINT (huSPLINT_09 and huSPLINT IO) libraries (Visintin et al, 2004. J Immunol Methods. 290: 135-153). From the selection procedure a total of 325 colonies able to grow in the absence of histidine and showing activation of β- Galactosidase were obtained. The scFv-VP16 plasmids were isolated and sorted by their restriction patterns and sequences. The specificity of scFvs with different DNA fingerprints were re-analyzed using yeast strains expressing LexA-Sp_ADAMTS-5 and LexA-lamin, as non relevant antigen. 11 different anti-Spacer domain scFvs were thus identified. Analysis of the V region nucleotide sequences of the selected anti-Spacer scFv revealed that they were derived from germline V region genes (Table IV) with very few somatic mutations (data not shown).
Table IV: Analysis of the V region nucleotide sequences of the selected anti-Spacer scFv
CLONE CRB SEQ .ID VH-gene/J-gene and allele VL-gene/J-gene and allele
identification identification
M6 CRB0017 3;4 Musmus IGHV1-7*01 F; Musmus Musmus IGKV2-112*01 F;
IGHJ2*01 F Musmus IGKJ2*01 F
7A CRB0018 5;6 Musmus IGHV4-1 *02 F; Musmus Musmus IGKV3-10*01 F; Musmus
IGHJ1*01 F IGKJ5*01 F
14 CRB0019 7;8 Musmus IGHV14-3*02 F; Musmus IGKV6-23*01 F; Musmus
Musmus IGHJ4*01 F IGKJ2*01 F 7A CRB0091 9;10 Homsap IGHV4-34*01 F; Homsap IGKV1-17*01 F; Homsap
Homsap IGHJ4*02 F IGKJ2*01 F
C21 CRB0092 11 ;12 Homsap IGFTV3-13*01 F; Homsap IGLV1 -40*02 F; Homsap
Homsap IGHJ6*02 F IGLJ7*01 F
47A CRB0093 13;14 Homsap IGFTV3-72*01 F; Homsap IGKV1-39*01 F; Homsap
Homsap IGHJ3*01 F IGKJ2*01 F
48B CRB0094 15: 16 Homsap IGHV4-34*01 F; Homsap IGLV2- 14*01 F; Homsap
Homsap IGHJ5*02 F IGLJ3*02 F
15A CRB0102 17;18 Homsap IGHV1-24*01 F; Homsap IGKV5-2*01 F; Homsap
Homsap IGHJ4*02 F IGKJ4*01 F
S39 CRB0122 19;20 Homsap IGHV3-23*01 F; Homsap IGLV9-49*01 F; Homsap
Homsap IGHJ3*02 F IGLJ1 *01 F
S50 CRB0123 21 ;22 Homsap IGHV3 -30*03 F; Homsap IGKV1D-17*02 [F];
Homsap IGHJ6*02 F Homsap IGKJ1 *01 F
S53a CRB0124 23;24 Homsap IGHV1 -24*01 F; Homsap IGLV3-1 *01 F; Homsap
Homsap IGHJ4*02 F IGLJ2*01 F
The amino acid sequences of V regions of the isolated anti-Sp_ADAMTS-5scFvs are in the group of sequences consist ing of SEQ.ID NO: 3 and 4; 5 and 6; 7 and 8; 9 and 1 0: 1 1 and 12; 13 and 14; 1 5 and 16; 1 7 and 18; 19 and 20; 21 and 22; 23 and 24.
Expression and refolding of anti-Spacer scFv in the cytoplasm of E.coli.
To identify potential anti-spacer in vivo binders, cDNAs expressing anti-Sp_ADAMTS-5 scFv were cloned into E.coli pET41b expression vector. The proteins were well expressed in the cytoplasm and mostly retained in inclusion bodies (IB). scFv fragments can be refolded by dialysis after solubilization of IB (Umetsu et al, 2003. J Biol Chem. 278:8979-8987. Epub 2003 Jan 8977). The authors performed the technique of refolding by dilution (Patil et al, 2008. JBiotechnol. 134:218-221. Epub 2008 Jan 2018). The refolding condition of scFv was optimized for each sample. Refolded scFv were subsequently quantified by Bioanalyzer 2100 (Agilent) and tested by ELISA and Biacore analysis.
Binding specificity of anti- ADAMTS-5 to human ADAMTS-5.
To understand the specificity of the panel of anti-Sp_ADAMTS-5scFvs isolated from SPLINT libraries, the immunoreactivity for Spacer-GST (SEQ. ID NO: 94) and ADAMTS-5 FL of these antibodies was demonstrated. All the isolated anti-Spacer scFvs were reactive with the GST fusion protein of the truncated form of ADAMTS-5 in ELISA assay. However the CRB0017, CRB0018 and CRB0093 scFvs were highly specific and only weak binding was observed to GST protein used as negative control (Fig. 3).
Reformatted chimeric immunoglobulin CRB0017_IgG4 displays the same immunoreactivity pattern in ELISA assay in a dose dependent fashion (Fig.4). Similar results were obtained with the monoclonal antibodies CRB0102 and CRB0123 (data not shown). Moreover, the chimeric anti-Sp_ADAMTS-5 CRB0017_IgG4 (comprising mouse variable regions) was able to immunoprecipitate the recombinant ADAMTS-5 FL protein as well as recombinant human ADAMTS-4 FL (Fig. 6 and 7). In addition, the authors carried out surface plasmon resonance (SPR) analyses to determine the binding kinetics of CRB0017_IgG4. The chimeric monoclonal antibody (mAb) was either immobilized on a CM5 chip followed by injections at various concentration of Sp_ADAMTS-5-GST or used as ligand in combination with Sp_ADAMTS-5-GST-immobilized sensor chip. Using a bivalent binding model, the authors determined steady state binding constants (KD2). When used as binder, the authors measured a binding strengths by SPR around subnanomolar- 7 nM of KD2 (data not shown). CRB0017_IgG4 displayed also a strong affinity (KDi of ~2 nM) when immobilized on sensor chip (Fig. 5) that correlated better with the binding values as determined by antigen-specific ELISA (Fig. 4).
Evaluation of binding capacity of anti-spacer ADAMTS-5 mAbs to ADAMTS-5 target antigen
Purified ADAMTS-5 enzyme was challenged in ELISA using mAbs CRB0017_IgG4, CRB0093_IgG4, CRB094_IgG4, CRB0123_IgG4 and CRB0124_IgG4 in coating. As shown in figure 15, mAbs CRB0017, CRB0093, CRB0094 and CRB00124 showed comparable specificity to ADAMTS-5 while mAb CRB0123_IgG4 display a higher binding capacity for ADAMTS-5 than mAb CRB0017_IgG4 in this assay (Fig. 15).
Binding of present invention antibodies on Hek-293-ADAMTS-5-3XFLAG/Hek-293 in Cell-ELISA format.
In-Cell ELISA use quantitative immunocytochemistry to measure protein expression or post- translational modifications in cultured cells. Cells are fixed in a 96-well plate and targets of interest are detected with highly specific, well-characterized monoclonal antibodies and levels are quantified with enzyme-labeled secondary antibodies. Using this method, the binding between full length ADAMTS-5 expressed by stable HEK293 line and CRB0017_IgG4 was evaluated. The enzyme is both efficiently secreted by this cell line and is also retained into the extracellular matrix (ECM). When CRB0017_IgG4 was challenged with this recombinant cell line, it was able to recognized, in a dose dependent manner, the enzyme ADAMTS-5 at its native folding condition (Fig. 11) Evaluation of binding capacity of mAb CRB0017 to ADAMTS-5.
Supematants harvested from FreeStyle™ 293-F cell line stably expressing ADAMTS-5 3XFLAG (the harvesting was done at every dilution of the poo! of stably transfected cells) that contained the native full length enzyme ADAMTS-5 and FreeStyle™ 293-F cell lines were challenged in a sandwich ELISA assay using mAb CRB0017_IgG4 in coating. The supematants were used immediately after collection, in order to preserve the function of ADAMTS-5 and to avoid as much as possible the autocatalysis of the enzyme.
As shown in fig. 12, the antibody was able to recognize the enzyme ADAMTS-5 present in the conditioned medium with high specificity. Evaluation of the capacity of Syndecan-4 to interfere in CRB0017_IgG4 anti-spacer ADAMTS-5 binding to ADAMTS-5 antigen.
It was demonstated that syndecan-4 is functionally involved in cartilage degradation by hypertrophic OA chondrocytes through inhibiting the activation of ADAMTS-5 mediated aggrecan cleavage (Echtermeyer, F. et al. 2009. Nat Med. 15(9): 1072-6). ADAMTS-5 activation depends on direct interaction with syndecan-4 on the surface of osteoarthritic chondrocytes; the mechanisms involved in cartilage degradation seem to involve both direct binding of ADAMTS-5 to Syndecan-4 and the regulation of ADAMTS-5 activation by MMP-3, which is regulated by Syndecan-4 in an ER -dependent manner.
The exact pathways by which Syndecan-4 expression is induced during OA, as well as the mechanisms by which it is involved in cartilage remodelling, are still under intense investigation. In order to evaluate the possibility that mAb anti- ADAMTS-5 CRB0017 can modulate the pathological responses of chondrocytes mediated by Syndecan-4 we set up a preliminary in vitro assay to demonstrate the ability of mAb CRB0017 to interfere with ADAMTS-5-Syndecan-4 interaction. As shown in Fig. 14, when Syndecan-4 is added to the wells, the OD is decreased with respect to wells in which only ADAMTS-5 was added to CRB0017_IgG4. This demonstrates that the specific interaction between ADAMTS-5 and mAb CRB0017 was effectively dissociated by Syndecan-4.
It was demonstrated that the spacer domain and the TSP type- 1 domains are im ortant for a tight interaction with the extracellular matrix. Moreover, it was demonstrated that ADAMTS- 5 is bound to the heparan sulphate chains of Syndccan-4 and by this mechanism is fixed to the cell surface. It is not yet understood which is the domain of ADAMTS-5 involved in binding with Syndecan-4. Loss of binding as the final outcome of antibody action does not allow at the moment any conclusion on direct competition (same binding epitope) vs indirect (steric hindrance) mechanism for dissociation even if any mechanism finally leading to impaired binding properties have resulted in loss of interaction between ADAMTS-5 and Syndecan-4.
Measurement of anti- ADAMTS-5 neutralizing activity.
The authors also evaluated the inhibition of IL- la-induced aggrecan degradation in the bovine cartilage tissue. 48h after the treatments, the proportion of total GAG remaining in the tissue was measured. This analysis revealed that CRB0017_IgG4 inhibited GAG release (50% inhibition) from tissue at 20nM concentration (Fig. 8). In this experiment, the control antibody (nhIgG4) was not able to interfere with the enzyme at the same concentration. Moreover, the natural inhibitor TIMP-3 did not show markedly to inhibit the IL-la-mediated conversion and release process when tested at the concentration of 20nM (data not shown). The chemical compound Cpd23, a 3,3-dimethyl-5-hydroxypipecolic hydroxamate-based inhibitor of aggrecanase and MMP-13 (used at the concentration of ΙμΜ, Noe et al., 2005. Bioorg Med Chem Lett. 15:2808-2811), was used as positive control, because it displays a better inhibitory effect respect to the natural inhibitor TIMP-3 in this assay.
Evaluation of the effect of CRB0016_IgG4 in the STR/ort mouse model of osteoarthritis.
The HelixB- ADAMTS-5 binding protein CRB0016_IgG4 was administered intraarticularly in both knees of each animal, once at the start of the experiment and again after 6 weeks, at doses of 1,2 and 12 μg/knee.
After three months, the authors observed that the knees from vehicle treated animals displayed severe OA with clefting and erosion of the articular cartilage to the subchondral bone, with prominent chondro-osseous metaplasias and often inflammation and pannus. No significant changes in any of the parameters examined were associated with administration of CRB0016_IgG4 at either dose.
The procedure of blind scoring of the histological samples did not show effect of the compound in decreasing cartilage damage. Taken together, these data show that knee intraarticular administration of the HelixB-ADAMTS-5 binding protein CRB0016_IgG4 twice in three months could not reduce the severity of the osteoarthritic pathology in the STR/ort mice.
Evaluation of the effect of CRB0017_IgG4 in the STR/ort mouse model of osteoarthritis. CRB0017_IgG4 was administered intraarticularly in both knees of each animal, once at the start of the experiment and again after 6 weeks, at doses of 1,2 and 12 μg/knee. After three months, the authors observed that the knees from vehicle treated animals displayed severe OA with clefting and erosion of the articular cartilage to the subchondral bone, with prominent chondro-osseous metaplasias and often inflammation and pannus. OA Mankin's score was significantly decreased in the CRB0017_IgG4 12 μg group compared to vehicle. The OA grade x stage takes into account not only the depth of the damage (grade), but also its extension on the articular surface (stage). The OA grade x stage was significantly lower in the CRB0017_IgG4 12 μg group compared to vehicle. Administration of CRB0017_IgG4 1.2 μg was associated with a trend to a decrease with both scoring methods. In conclusion the authors observed that CRB0017_IgG4 can modify the course of OA in the STR/ort mouse strain, by delaying cartilage breakdown as assessed histologically. The procedure of blind scoring of the histological samples clearly showed a dose dependent effect of the compound in decreasing cartilage damage.
Taken together, these data show that knee intraarticular administration of CRB0017_IgG4 twice in three months dose-dependently reduced the severity of the osteoarthritic pathology in the STR/ort mice.
Evaluation of present invention antibodies in the Medial Meniscal Tear (MMT) rat model of osteoarthritis.
3 weeks after injection, the authors observed that the knees from vehicle treated animals displayed severe OA with clefting and erosion of the articular cartilage to the subchondral bone, with prominent osteophytes, inflammation and pannus. Administration of CRB0017_IgG4 was associated with a dose-related decrease in all histo-patho logical severity scores (Fig. 13). The procedure of blind scoring of the histological samples showed a dose dependent decrease in OA severity following intra-articular treatment with CRB0017_IgG4.
Some proteolytic enzymes, in addition to their catalytic domains, have also non-catalytic ancillary domains that are important modulators of the interaction between the enzyme and substrate or inhibitors. Members of the ADAMTS family of enzymes degrade proteoglycans and thereby have the potential to alter tissue architecture and regulate cellular function.
In particular, ADAMTS-4 and ADAMTS-5 can cleave the aggrecan at various sites, releasing the chondroitin and keratansulfate-bearing regions of the molecule from the tissue. This was demonstrated to be an early and crucial step in the development of osteoarthritis. These enzymes can also be proteolyzed to smaller isoforms, which have altered proteolytic activity. Unfortunately, the 3D domain architecture of the full-length aggrecanases is not known, because it is very difficult to obtain the X-ray structures of these enzymes, due to their complex production and purification.
To date, only a portion of the entire X-ray structure of the ADAMTS- 1, ADAMTS-4 and ADAMTS-5 enzymes are available (the structure .solved by X-ray crystallography comprise only the catalytic and disintegrin domains) and thus it is impossible to extrapolate the arrangements and orientation of all the domains respect to the catalytic domain. The crystal structures of the catalytic and disintegrin domains of ADAMTS-4 and ADAMTS-5 determined by Mosyak (Mosyak et al, 2008. Protein Sci. 17: 16-21) indicated that the enzymes display an Open' form when it is bound to the inhibitor and a 'closed' form when it is auto -inhibited and nonbinding. On this basis, the author proposed that mature aggrecanase exists as a mix of two isomers, that can coexist in equilibrium. In this "ensemble" only one of this form is proteolytically active. Moreover, it was demonstrated that both full length form of ADAMTS-5 and ADAMTS-4 are highly active against their natural substrate, aggrecan, and the deletion of the C-terminal non-catalytic domains of the enzymes greatly reduces their activity (Kashiwagi et al, 2004. J Biol Chem. 279:10109-10119); (Gendron et al, 2007. J Biol Chem. 282: 18294-18306); (Fushimi et al, 2008. J Biol Chem. 283:6706-6716). This suggests that the domains on their own or in the protein-binding fashion may perturb the equilibrium to the more open form.
The invention provides the evidence that antibodies directed against an ancillary non catalytic domain, such as the spacer domain of ADAMTS-5, strongly inhibit the enzymatic activity of this protein. In particular, the results obtained with the anti-spacer domain antibody CRB0017_IgG4 illustrate the concept that the inhibition of the aggrecanase-2 within the spacer domain is more effective than the inhibition of the enzyme within the catalytic domain. Notably, it has been shown that, while CRB0017_IgG4 is able to strongly inhibit in vitro and in vivo the proteolytic effect of ADAMTS-5, an anti-catalytic antibody, such as CRB0016_IgG4, is not able to produce such an effect. The outstanding results obtained with the antibodies of the present invention, in particular with CRB0017_IgG4 are due to their blocking properties on the spacer domain of ADAMTS- 5. By binding to the active site of ADAMTS-5, the antibodies of the invention trigger the enzyme to assume a "closed" form thus inhibit the enzyme directly or favour the interaction of the enzyme with its natural inhibitor TIMP-3, as hypothesized by Troeberg (Troeberg et al, 2009. Matrix Biol. 28:463-469).
Moreover, data obtained so far suggested that the inhibition of the binding between ADAMTS-5 and Syndecan-4 by mAb CRB0017_IgG4 could have a role in modulating the pathological responses of chondrocytes mediated by Syndecan-4.
Apart from induction of enzymes by activated chondrocytes, the function of Syndecan-4 is further regulated by interaction with matrix molecules and cell surface proteoglycans. Syndecan-4 is a transmembrane heparan sulfate proteoglycan that seems crucial for the activity of ADAMTS-5.
It was demonstrated that the loss of Syndecan-4 activity markedly reduced OA cartilage pathology in the murine DMM OA model. This was demonstrated both in Syndecan-4 knockouts as well as in WT mice, locally treated by intraarticular injections with Syndecan-4 specific antibodies. In vitro studies identified direct interaction of Syndecan-4 with ADAMTS-5. In addition, it was demonstrated that ADAMTS-5 activity is dependent on MMP-3 and the latter activity is controlled by Syndecan-4.
Syndecans undergo regulated proteolytic cleavage at ectodomain sites near the membrane by matrix metalloproteinases and metzincins family of endoproteases, a process called shedding, both as part of normal turnover as well as in response to external stimuli and is regulated by multiple pathways. Besides disrupting syndecan signaling, the released soluble ectodomain acts as an antagonist to compete with intact syndecans for its ligands. While syndecan ectodomain shedding is known to be activated by physiological stimulants and the ectodomains are being ascribed pathophysiological roles, in particular in tumorigenesis and inflammation, little is known about how their release from the cell surface is regulated. Thus it could be of interest to see if the anti-ADAMTS-5 CRB0017_lgG4 could help a further understanding of this process.

Claims

1. An antibody, recombinant or synthetic antigen-binding fragments thereof able to recognise and bind an epitope comprised in the aa. 732 to aa. 874 region of SEQ ID No. 2 of ADAMTS-5.
2. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 1 comprising at least one heavy chain complementary determining region (CDRH3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 62, 65, 68, 71, 74, 77, 80, 83, 86, 89 and 92.
3. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 2 further comprising a heavy chain complementary determining region (CDRH2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ ID No. 61, 64, 67, 70, 73, 76, 79, 82, 85, 88 and 91.
4. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 3 further comprising a heavy chain complementary determining region (CDRH1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ ID No. 60, 63, 66, 69, 72, 75, 78, 81, 84, 87 and 90.
5. The antibody, recombinant or synthetic antigen-binding fragments thereof according to any one of claim 2 to 4 further comprising at least one light chain complementary determining region (CDRL3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 29, 32, 35, 38, 41, 44, 47, 50, 53, 56 and 59.
6. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 5 further comprising one light chain complementary determining region (CDRL2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: 28, 31, 34, 37, 40, 43, 46, 49, 52, 55 and 58.
7. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 6 further comprising one light chain complementary determining region (CDRL1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: 27, 30, 33, 36, 39, 42, 45, 48, 51, 54 and 57.
8. The antibody, recombinant or synthetic antigen-binding fragments thereof according to any one of previous claims comprising a heavy chain complementary determining regions (CDRHl) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 60, 63, 66, 69, 72, 75, 78, 81, 84, 87 and 90 and a heavy chain complementary determining regions (CDRH2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 61, 64, 67, 70, 73, 76, 79, 82, 85, 88 and 91 and a heavy chain complementary determining regions (CDRH3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 62, 65, 68, 71 , 74, 77, 80, 83, 86, 89 and 92.
9. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 8 further comprising a light chain complementary determining regions (CDRL1) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 27, 30, 33, 36, 39, 42, 45, 48, 51, 54 and 57 and a light chain complementary determining regions (CDRL2) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 28, 31, 34, 37, 40, 43, 46, 49, 52, 55 and 58 and a light chain complementary determining regions (CDRL3) amino acid sequence having at least 80 % identity to an amino acid sequence selected from the group consisting of: SEQ. ID NO: 29, 32, 35, 38, 41 , 44, 47, 50, 53, 56 and 59.
10. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 8 comprising a CDRHl amino acid sequence having at least 80 % identity to SEQ ID No. 60, a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 61 and a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 62.
11. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 10 further comprising a CDRL1 amino acid sequence having at least 80 % identity to SEQ ID No. 27, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 28 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 29.
12. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 8 comprising a CDRH1 amino acid sequence having at least 80 % identity to SEQ ID No. 81, a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 82 and a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 83.
13. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 12 further comprising a CDRL1 amino acid sequence having at least 80 % identity to SEQ ID No. 48, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 49 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 50.
14. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 8 comprising a CDRH1 amino acid sequence having at least 80 % identity to SEQ ID No. 87, a CDRH2 amino acid sequence having at least 80 % identity to SEQ ID No. 88 and a CDRH3 amino acid sequence having at least 80 % identity to SEQ ID No. 89.
15. The antibody, recombinant or synthetic antigen-binding fragments thereof according to claim 14 further comprising a CDRL1 amino acid sequence having at least 80 % identity to SEQ ID No. 54, a CDRL2 amino acid sequence having at least 80 % identity to SEQ ID No. 55 and a CDRL3 amino acid sequence having at least 80 % identity to SEQ ID No. 56.
16. The antibody, recombinant or synthetic antigen-binding fragments thereof according to any one of previous claims being a monoclonal antibody or a chimeric or a humanized, or a deimmunized or a fully human antibody.
17. The antibody, recombinant or synthetic antigen-binding fragments thereof according to any one of previous claims for use in the treatment and/or prevention of a condition associated with cartilage degradation.
18. The antibody, recombinant or synthetic antigen-binding fragments thereof according to any one of previous claims for use in the human treatment and/or prevention of osteoarthritis or rheumatoid arthritis.
19. A nucleic acid molecule encoding the antibody, recombinant or synthetic antigen-binding fragments thereof as defined in claims 1 to 18.
20. The nucleic acid molecule encoding the antibody, recombinant or synthetic antigen- binding fragments thereof according to claim 19 comprising at least one nucleic acid sequence selected from the group consisting of SEQ ID No. 99 to SEQ ID No. 120.
21. An expression vector encoding the antibody according to any one of claim 1-18.
22. A host cell comprising the nucleic acid according to claim 19 or 20.
23. The host cell of claim 22 that produces the antibody according to any one of claim 1-18.
24. A method of producing the antibody according to any one of claim 1-18 comprising culturing the cell that produces the antibody of claim 23 and recovering the antibody from the cell culture.
25. A pharmaceutical composition comprising at least one antibody, recombinant or synthetic antigen-binding fragments thereof according to any one of claim 1 to 18 and pharmaceutically acceptable excipients.
26. The composition according to claim 25 for use in intra-articular administration.
PCT/EP2013/057649 2012-04-13 2013-04-12 Anti-adamts-5 antibody, derivatives and uses thereof WO2013153189A1 (en)

Priority Applications (11)

Application Number Priority Date Filing Date Title
MX2014012295A MX2014012295A (en) 2012-04-13 2013-04-12 Anti-adamts-5 antibody, derivatives and uses thereof.
CN201380019819.6A CN104245737B (en) 2012-04-13 2013-04-12 5 antibody of anti-ADAMTS, its derivant and purposes
US14/390,466 US9631029B2 (en) 2012-04-13 2013-04-12 Anti-ADAMTS-5 antibody, derivatives and uses thereof
RU2014145536A RU2014145536A (en) 2012-04-13 2013-04-12 ANTIBODY AGAINST ADAMTS-5, ITS DERIVATIVES AND THEIR APPLICATION
KR1020147031200A KR20150003278A (en) 2012-04-13 2013-04-12 Anti-adamts-5 antibody, derivatives and uses thereof
IN1868MUN2014 IN2014MN01868A (en) 2012-04-13 2013-04-12
CA2869031A CA2869031A1 (en) 2012-04-13 2013-04-12 Anti-adamts-5 antibody, derivatives and uses thereof
JP2015504963A JP2015518476A (en) 2012-04-13 2013-04-12 Anti-ADAMTS-5 antibodies, derivatives and uses thereof
AU2013246880A AU2013246880B2 (en) 2012-04-13 2013-04-12 Anti-ADAMTS-5 antibody, derivatives and uses thereof
EP13715240.1A EP2836516B1 (en) 2012-04-13 2013-04-12 Anti-adamts-5 antibody, derivatives and uses thereof
HK15102792.9A HK1202296A1 (en) 2012-04-13 2015-03-18 Anti-adamts-5 antibody, derivatives and uses thereof adamts-5

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP12164107.0A EP2650310B1 (en) 2012-04-13 2012-04-13 Anti-ADAMTS-5 antibody, derivatives and uses thereof
EP12164107.0 2012-04-13

Publications (1)

Publication Number Publication Date
WO2013153189A1 true WO2013153189A1 (en) 2013-10-17

Family

ID=48083198

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2013/057649 WO2013153189A1 (en) 2012-04-13 2013-04-12 Anti-adamts-5 antibody, derivatives and uses thereof

Country Status (19)

Country Link
US (1) US9631029B2 (en)
EP (2) EP2650310B1 (en)
JP (1) JP2015518476A (en)
KR (1) KR20150003278A (en)
CN (1) CN104245737B (en)
AR (1) AR090668A1 (en)
AU (1) AU2013246880B2 (en)
CA (1) CA2869031A1 (en)
DK (1) DK2650310T3 (en)
ES (1) ES2588484T3 (en)
HK (1) HK1202296A1 (en)
HU (1) HUE031089T2 (en)
IN (1) IN2014MN01868A (en)
MX (1) MX2014012295A (en)
PL (1) PL2650310T3 (en)
PT (1) PT2650310T (en)
RU (1) RU2014145536A (en)
TW (1) TWI579302B (en)
WO (1) WO2013153189A1 (en)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017211666A1 (en) 2016-06-09 2017-12-14 Galapagos Nv 5-[3-[piperazin-1-yl]-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as adamts 4 and 5 inhibitors for treating e.g. osteoarthritis
US9926281B2 (en) 2014-12-22 2018-03-27 Galapagos Nv 5-[(piperazin-1-yl)-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as ADAMTS inhibitors for the treatment of osteoarthritis
IT201800003818A1 (en) * 2018-03-21 2019-09-21 Fond Per Listituto Oncologico Di Ricerca Ior NEW PROSENESCENCE DRUGS
US10550100B2 (en) 2016-06-09 2020-02-04 Galapagos Nv 5-[3-[piperzin-1-yl]-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as ADAMTS 4 and 5 inhibitors for treating E.G. osteoarthritis
US11261260B2 (en) 2017-06-02 2022-03-01 Merck Patent Gmbh ADAMTS binding immunoglobulins
WO2022128849A1 (en) 2020-12-15 2022-06-23 Galapagos Nv Solid forms of (5s)-cyclopropyl-5-[3-[(3s)-4-(3,5-difluorophenyl)-3-methyl-piperazin-1-yl]-3-oxo-propyl]imidazolidine-2,4-dione

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JOP20170013B1 (en) 2016-01-22 2021-08-17 Merck Sharp & Dohme Anti-coagulation factor xi antibodies
BR112018075858A2 (en) 2016-06-14 2019-04-02 Merck Sharp & Dohme Corp. anti-clotting factor xi antibodies
FI129515B (en) 2020-11-06 2022-03-31 Salarusta Oy Hica for use in prophylaxis and/or treatment of a disease or condition involving degradation of cartilage and/or disruption of cartilage homeostasis and/or integrity
CN116256518A (en) * 2023-02-24 2023-06-13 广东兴亚生物科技有限公司 Tumor diagnosis marker, diagnosis kit and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000053774A2 (en) 1999-03-08 2000-09-14 Neurocrine Biosciences, Inc. Metalloproteinases and methods of use therefor
WO2001011074A2 (en) 1999-08-06 2001-02-15 The Cleveland Clinic Foundation Nucleic acids encoding zinc metalloproteases
US20060004066A1 (en) * 2003-12-04 2006-01-05 Wyeth Method for treating ADAMTS-5-associated disease
WO2011002968A2 (en) 2009-07-02 2011-01-06 Glaxo Group Limited Polypeptides and method of treatment

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5859205A (en) * 1989-12-21 1999-01-12 Celltech Limited Humanised antibodies
US5484590A (en) * 1993-09-09 1996-01-16 La Jolla Cancer Research Foundation Expression of the developmental I antigen by a cloned human cDNA encoding a member of a β-1,6-N-acetylglucosaminyltransferase gene family

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000053774A2 (en) 1999-03-08 2000-09-14 Neurocrine Biosciences, Inc. Metalloproteinases and methods of use therefor
WO2001011074A2 (en) 1999-08-06 2001-02-15 The Cleveland Clinic Foundation Nucleic acids encoding zinc metalloproteases
US20060004066A1 (en) * 2003-12-04 2006-01-05 Wyeth Method for treating ADAMTS-5-associated disease
WO2011002968A2 (en) 2009-07-02 2011-01-06 Glaxo Group Limited Polypeptides and method of treatment

Non-Patent Citations (46)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1980
ALMAGRO; FRANSSON, FRONT. BIOSCI, vol. 13, 2008, pages 1619 - 1633
AMANDA J. FOSANG ET AL: "ADAMTS-5: THE STORY SO FAR", EUROPEAN CELLS AND MATERIALS, vol. 15, 5 February 2008 (2008-02-05), pages 11 - 26, XP055021758, ISSN: 1473-2262 *
CHEN ET AL., J. MOL. BIOL., vol. 293, 1999, pages 865 - 881
CHOTHIA; LESK, J. MOL. BIOL., vol. 196, 1987, pages 901 - 917
CHRISTOPHER KINTAKAS ET AL: "Emerging roles for ADAMTS5 during development and disease", MATRIX BIOLOGY, ELSEVIER, NL, vol. 30, no. 5, 25 May 2011 (2011-05-25), pages 311 - 317, XP028242100, ISSN: 0945-053X, [retrieved on 20110612], DOI: 10.1016/J.MATBIO.2011.05.004 *
CLARKSON ET AL., NATURE, vol. 352, 1991, pages 624 - 628
ECHTERMEYER, F ET AL., NAT MED, vol. 15, no. 9, 2009, pages 1072 - 6
FLANNERY, CURR, vol. 11, pages 614 - 619
FUSHIMI ET AL., J BIOL CHEM., vol. 283, 2008, pages 6706 - 6716
GENDRON ET AL., J BIOL CHEM., vol. 282, 2007, pages 18294 - 18306
GIUDICELLI ET AL., STUD HEALTH TECHNOL INFORM, vol. 116, 2005, pages 3 - 8
GLASSON ET AL., NATURE, vol. 434, 2005, pages 644 - 648
HANAHAN, J MOL BIOL., vol. 166, 1983, pages 557 - 580
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, PUBLIC HEALTH SERVICE, NATIONAL INSTITUTES OF HEALTH
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", vol. 1-3, 1991, NIH PUBLICATION, pages: 91 - 3242
KASHIWAGI ET AL., J BIOL CHEM., vol. 279, 2004, pages 10109 - 10119
KINDT ET AL.: "Kuby Immunology", 2007, W.H. FREEMAN AND CO., pages: 91
MALFAIT A-M ET AL: "Inhibition of ADAM-TS4 and ADAM-TS5 prevents aggrecan degradation in osteoarthritic cartilage", JOURNAL OF BIOLOGICAL CHEMISTRY, THE AMERICAN SOCIETY OF BIOLOGICAL CHEMISTS, INC, US, vol. 277, no. 25, 21 June 2002 (2002-06-21), pages 22201 - 22208, XP002318178, ISSN: 0021-9258, DOI: 10.1074/JBC.M200431200 *
MANKIN ET AL., J BONE JOINT SURG AM, vol. 53, 1971, pages 523 - 537
MARKS ET AL., EUR J IMMUNOL., vol. 21, 1991, pages 985 - 991
MASON ET AL., OSTEOARTHRITIS CARTILAGE, vol. 9, 2001, pages 85 - 91
MILNER; CAWSTON, CURR DRUG TARGETS INFLAMM ALLERGY, vol. 4, 2005, pages 363 - 375
MOSYAK ET AL., PROTEIN SCI, vol. 17, 2008, pages 16 - 21
NAGASE; WOESSNER, ANAL BIOCHEM., vol. 107, 1980, pages 385 - 392
NOE ET AL., BIOORG MED CHEM LETT, vol. 15, 2005, pages 2808 - 2811
ORLANDI ET AL., BIOTECHNOLOGY, vol. 24, 1992, pages 527 - 531
PATIL ET AL., JBIOTECHNOL, vol. 134, 2008, pages 218 - 221
PORTOLANO ET AL., J. IMMUNOL., vol. 150, 1993, pages 880 - 887
PRITZKER ET AL., OSTEOARTHRITIS CARTILAGE, vol. 14, 2006, pages 13 - 29
REMINGTON'S PHARMACEUTICAL SCIENCES, 1980
SBLATTERO; BRADBURY, IMMUNOTECHNOLOGY, vol. 3, 1998, pages 271 - 278
SCHUCK, ANNU REV BIOPHYS BIOMOL STRUCT, vol. 26, 1997, pages 541 - 566
STANTON ET AL., NATURE, vol. 434, 2005, pages 648 - 652
TROEBERG ET AL., FASEB J, vol. 22, 2008, pages 3515 - 3524
TROEBERG ET AL., MATRIX BIOL, vol. 28, 2009, pages 463 - 469
TROEBERG L ET AL: "The C-terminal domains of ADAMTS-4 and ADAMTS-5 promote association with N-TIMP-3", MATRIX BIOLOGY, ELSEVIER, NL, vol. 28, no. 8, 1 October 2009 (2009-10-01), pages 463 - 469, XP026778919, ISSN: 0945-053X, [retrieved on 20090728], DOI: 10.1016/J.MATBIO.2009.07.005 *
UMETSU ET AL., J BIOL CHEM., vol. 278, 2003, pages 8979 - 8987
VISINTIN ET AL., J IMMUNOL METHODS, vol. 290, 2004, pages 135 - 153
VISINTIN ET AL., J MOL BIOL., vol. 317, 2002, pages 73 - 83
VISINTIN ET AL., JIMMUNOL METHODS, vol. 290, 2004, pages 135 - 153
VISINTIN ET AL., METHODS, vol. 34, 2004, pages 200 - 214
VISINTIN ET AL., PROC NATL ACAD SCI U S A., vol. 96, 1999, pages 11723 - 11728
VISINTIN; CATTANEO, ANTIBODY ENGINEERING, vol. 1, 2001, pages 790
ZENG ET AL., BIOCHIM BIOPHYS ACTA, vol. 1760, 2006, pages 517 - 524
ZUCKER ET AL., ONCOGENE, vol. 19, 2000, pages 6642 - 6650

Cited By (12)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9926281B2 (en) 2014-12-22 2018-03-27 Galapagos Nv 5-[(piperazin-1-yl)-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as ADAMTS inhibitors for the treatment of osteoarthritis
US10487060B2 (en) 2014-12-22 2019-11-26 Galapagos Nv 5-[(piperazin-1-yl)-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as ADAMTS inhibitors for the treatment of osteoarthritis
US10941117B2 (en) 2014-12-22 2021-03-09 Galapagos Nv 5-[(piperazin-l-yl)-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as ADAMTS inhibitors for the treatment of osteoarthritis
US11718588B2 (en) 2014-12-22 2023-08-08 Galapagos Nv 5-[(piperazin-1-yl)-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as ADAMTS inhibitors for the treatment of osteoarthritis
WO2017211666A1 (en) 2016-06-09 2017-12-14 Galapagos Nv 5-[3-[piperazin-1-yl]-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as adamts 4 and 5 inhibitors for treating e.g. osteoarthritis
WO2017211668A1 (en) 2016-06-09 2017-12-14 Galapagos Nv (5r)-5-[3-[(3s)-4-(4-chloro-3-methoxy-5-methyl-phenyl)-3-methyl-piperazin-1-yl]- 3-oxo-propyl]-5-methyl-imidazolidine-2,4-dione as adamts 4 and 5 inhibitor for treating e.g. osteoarthritis
US10550100B2 (en) 2016-06-09 2020-02-04 Galapagos Nv 5-[3-[piperzin-1-yl]-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as ADAMTS 4 and 5 inhibitors for treating E.G. osteoarthritis
US10829478B2 (en) 2016-06-09 2020-11-10 Galapagos Nv 5-[3-[piperazin-1-yl]-3-oxo-propyl]-imidazolidine-2,4-dione derivatives as ADAMTS 4 and 5 inhibitors for treating e.g. osteoarthritis
US11261260B2 (en) 2017-06-02 2022-03-01 Merck Patent Gmbh ADAMTS binding immunoglobulins
IT201800003818A1 (en) * 2018-03-21 2019-09-21 Fond Per Listituto Oncologico Di Ricerca Ior NEW PROSENESCENCE DRUGS
WO2019180636A1 (en) * 2018-03-21 2019-09-26 Fondazione Per L' Istituto Oncologico Di Ricerca (Ior) New prosenescence drugs
WO2022128849A1 (en) 2020-12-15 2022-06-23 Galapagos Nv Solid forms of (5s)-cyclopropyl-5-[3-[(3s)-4-(3,5-difluorophenyl)-3-methyl-piperazin-1-yl]-3-oxo-propyl]imidazolidine-2,4-dione

Also Published As

Publication number Publication date
DK2650310T3 (en) 2016-09-12
PT2650310T (en) 2016-09-01
PL2650310T3 (en) 2017-01-31
JP2015518476A (en) 2015-07-02
CN104245737B (en) 2017-04-05
EP2836516A1 (en) 2015-02-18
AU2013246880A1 (en) 2014-10-16
EP2650310A1 (en) 2013-10-16
AU2013246880B2 (en) 2016-04-21
ES2588484T3 (en) 2016-11-03
EP2650310B1 (en) 2016-06-08
HUE031089T2 (en) 2017-06-28
TWI579302B (en) 2017-04-21
AR090668A1 (en) 2014-11-26
US20150056210A1 (en) 2015-02-26
CA2869031A1 (en) 2013-10-17
TW201402606A (en) 2014-01-16
KR20150003278A (en) 2015-01-08
RU2014145536A (en) 2016-06-10
CN104245737A (en) 2014-12-24
US9631029B2 (en) 2017-04-25
IN2014MN01868A (en) 2015-07-03
EP2836516B1 (en) 2017-07-26
HK1202296A1 (en) 2015-09-25
MX2014012295A (en) 2014-11-10

Similar Documents

Publication Publication Date Title
AU2013246880B2 (en) Anti-ADAMTS-5 antibody, derivatives and uses thereof
AU2020201219A1 (en) Methods of treating or preventing cholesterol related disorders
CA2781050C (en) Pcsk9 antagonists
AU2009290438B2 (en) PCSK9 antagonists
AU2016202983A1 (en) PCSK9 antagonists
WO2012170607A2 (en) Use of pcsk9 antagonists
WO2013166448A1 (en) Stable formulations containing anti-pcsk9 antibodies
US20140004122A1 (en) Methods for treating or preventing cholesterol related disorders
JP7112659B2 (en) ANTI-PCSK9 ANTIBODY AND USES THEREOF
JP2013543382A (en) Antibodies targeting the osteoclast-related protein Siglec-15
US20200270365A1 (en) Pcsk9 antibody, antigen-binding fragment thereof, and medical uses thereof
EP2615114A2 (en) Antigen binding proteins to proprotein convertase subtilisin kexin type 9 (PCSK9)
AU2013200743A1 (en) PCSK9 antagonists
NZ618300B2 (en) Methods of treating or preventing cholesterol related disorders
NZ734570B2 (en) Methods of treating or preventing cholesterol related disorders

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13715240

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2869031

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 14390466

Country of ref document: US

ENP Entry into the national phase

Ref document number: 2015504963

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: MX/A/2014/012295

Country of ref document: MX

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2013246880

Country of ref document: AU

Date of ref document: 20130412

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2013715240

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2013715240

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 20147031200

Country of ref document: KR

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2014145536

Country of ref document: RU

Kind code of ref document: A

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112014025291

Country of ref document: BR

REG Reference to national code

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112014025291

Country of ref document: BR

Free format text: COM BASE NA RESOLUCAO 81/2013, SOLICITA-SE A APRESENTACAO DA DECLARACAO REFERENTE AO CONTEUDO DE LISTAGEM DE SEQUENCIA.

Ref country code: BR

Ref legal event code: B01E

Ref document number: 112014025291

Country of ref document: BR

ENPW Started to enter national phase and was withdrawn or failed for other reasons

Ref document number: 112014025291

Country of ref document: BR