WO2013152026A1 - Use of apolipoprotein a-1 for promoting bone formation - Google Patents

Abstract

The present invention relates to use of an apo lipoprotein A-l (ApoA-1) polypeptide or its variant or mimetic peptide, or a vector encoding the same, or an agent that enhances endogenous Apo A-l level, for promoting bone formation. In particular, the present invention is applicable to treatment of bone diseases or conditions, where bone formation is desired, such as bone loss diseases e.g. osteoporosis, or bone fracture.

Description

TITLE OF THE INVENTION

USE OF APOLIPOPROTEIN A-l FOR PROMOTING BONE FORMATION

TECHNOLOGY FIELD

[0001] The present invention relates to use of apo lipoprotein A-l (ApoA-1) for promoting bone formation. In particular, the present invention relates to use of ApoA-1 in the treatment of bone diseases or conditions, where bone formation is desired, such as bone loss diseases e.g. osteoporosis, or bone fracture. BACKGROUND OF THE INVENTION

[0002] Bone remodeling (or called bone metabolism) is a continuous process of bone formation (i.e. new bone tissue is formed) and bone resorption (i.e. mature bone tissue is removed from the skeleton). The process of bone remodeling is active throughout the whole life of an individual, which not only maintains the bones' normal functions such as structural support to the whole body and storage of calcium, but also repairs damages when injuries in bone occur e.g. bone fracture. Bone formation involves osteogenic differentiation from mesenchymal stem cells in bone marrow (BM-MSCs). BM-MSCs are a pluripotent cell type that can differentiate into osteo-, adipo- or chrondro-lineage cells (Rodan, G. A., and Reszka, A. A. (2002) Curr Mol Med 2, 571-577), where an inverse relationship is sometimes found between adipogenesis and osteogenesis. An imbalance in the regulation of bone remodeling would lead to a variety of metabolic bone diseases such as bone loss.

[0003] Osteoporosis is a disease with severe degree of bone loss, which is a worldwide epidemic disease, particularly occurring in older people, post-menopausal women, or patients who have received long-term hormonal treatment or suffered from hyperthyroidism or tumors of adrenal glands. Nowadays there are several kinds of drugs approved by US Food and Drug Administration (FDA) for the osteoporosis therapy. One of them is bisphosphonate, an antiresorptive agent, which can help to maintain bone integrity by reducing bone turnover (Rodan, G. A., and Reszka, A. A. (2002) Curr Mol Med 2, 571 -577). The other widely used drug is parathyroid hormone (PTH), an anabolic agent, which can help to stimulate bone formation (Dempster, D. W., Cosman, E, Parisien, M., Shen, V, and Lindsay, R. (1993) Endocr Rev 14, 690-709). However, there are still some problems for use of these drugs in therapy. For example, bisphosphonate has been reported to increase the incidence of osteonecrosis of the jaw (Zavras, A. I. (2011) Ann N Y Acad Sci 1218, 55-61). In addition, PTH may lead to hypercalcemia (Greenspan, S. L., Bone, H. G., Ettinger, M. P., Hanley, D. A., Lindsay, R., Zanchetta, J. R., Blosch, C. M., Mathisen, A. L., Morris, S. A., and Marriott, T. B. (2007) Ann Intern Med 146, 326-339). Recently, some literature reported that hyperlipidemia impaired anabolic effects of PTH (Sage, A. P., Lu, J., Atti, E., Tetradis, S., Ascenzi, M. G., Adams, D. J., Demer, L. L., and Tintut, Y. (2011) J Bone Miner Res 26, 1197-1206), and thus the PTH treatment is not suitable for patients with hyperlipidemia. Further, PTH is expensive and has to be

administrated daily by subcutaneous injection, which is painful and inconvenient for patients. Therefore, there is still a need to develop an alternative drug for the treatment of bone diseases.

[0004] Apo lipoprotein A-I (ApoA-1) is a major protein component of high-density lipoprotein (HDL) which regulates removal of cholesterol. ApoA-1 activates

ATP-binding-cassette transporter Al (ABCA1), extracellular signal-regulated kinase (ER ), signal transducer and activator of transcription (STAT3), and/or Jun

N-terminal kinase (JNK)-mitogen activated protein kinase (MAPK) pathways ( Liu,D., Ji, L., Tong, X., Pan, B., Han, J.Y. Huang, Y., Y. Chen, E., Pennathur, S., Zhang, Y, Liu, L. Y, Tang , C. (2011) Am J Physiol Cell Physiol 301 : C739-C748; Liu , Y, Tang, C, (2012) Biochimica et Biophysica Acta 1821 :522-529; No fer, J.R., Feuerborn, R., Levkau, B, Sokoll, A., Seedorf, U and Assmann, G. (2003) J Biol Chem 278, 53055- 5306). The reduced level of ApoA-1 expression in plasma was found to be associated with cardiovascular disease, obesity, or other metabolic syndrome (Peterson, S. J., Drummond, G., Kim, D. H., Li, M., Kruger, A. L., Ikehara, S., and Abraham, N. G. (2008) J Lipid Res 49, 1658-1669; and Morgantini, C, Imaizumi, S., Grijalva, V., Navab, M., Fogelman, A. M., and Reddy, S. T. (2010) Diabetes 59, 3223-3228).

However, no prior art discloses the use of ApoA-1 in promotion of bone formation.

BRIEF SUMMARY OF THE INVENTION

[0005] In the present invention, it is unexpectedly found that ApoA-1 has superior activity to promote bone formation. Particularly, we demonstrated that ApoA-1 is a positive regulator of osteogenesis that promotes osteogenic differentiation of hBM-MSCs, based on the results that both early and late markers of osteogenesis (Alkaline phosphatase (ALP) activity assay and calcium deposition (Alizarin red assay)) are significantly induced by treatement of ApoA-1 , while knockdown of endogenous ApoA-1 inhibits ostero genesis. In addition, we also demonstrated that ApoA-1 inhibits adipogenesis of hBM-MSCs that favors the shift to osteogenesis. We also showed that the bone promoting activity of ApoA-1 involves the ATP-binding-cassette transporter Al (ABCAl), extracellular signal-regulated kinase (ER ), signal transducer and activator of transcription (STAT3), and/or Jun N-terminal kinase (JNK)-mitogen activated protein kinase (MAPK) pathways. Further, we conducted in vivo studies showing that ApoA-1 transgenic animals exhibit higher bone volume, bone surface density, trabecular bone number and trabecular number, but less bone loss and reduced trabecular spacing, as compared with wild type animals (without ApoA-1 transgene), evidencing the effect of ApoA-1 in prevention and amelioration of osteoporosis.

[0006] Therefore, in one aspect, the present invention proivdes a method for promoting bone formation by administering to a subject in need thereof an effective amount of a composition, which comprises (i) an ApoA-1 polypeptide or a biologically functional variant or mimetic peptide thereof, or (ii) a vector comprising a nucleic acid fragment encoding the above-mentioned ApoA-1 polypeptide or biologically functional varient or mimetic pepetide, or (iii) an agent that enhances endogenous ApoA-1 level; together with (iv) a physiologically acceptalbe carrier.

[0007] In particular, the method of the invention is useful in treatment of bone diseases or conditions, where bone formation is desired, such as bone loss diseases e.g. osteoporosis or bone fracture, etc.

[0008] We also provide a method for stimulating osteogenic differentiation of mesenchymal stem cells, comprising contacting the cells with an effective amount of an ApoA-1 polypeptide or a biologically functional variant or mimetic peptide thereof.

[0009] The present invention also provides a composition for promoting bone formation, which comprises an effective amount of (i) an ApoA-1 polypeptide, or a biologically functional variant or mimetic peptide thereof, or (ii) a vector comprising a nucleic acid fragment encoding the above-mentioned ApoA-1 polypeptide or biologically functional varient or mimetic pepetide, or (iii) an agent that enhances endogenous ApoAl level; together with (iv) a physiologically acceptable carrier.

[0010] This invention provided is the use of (i) an ApoA-1 polypeptide, or a biologically functional variant or mimetic peptide, or (ii) a vector comprising a nucleic acid fragment encoding the above-mentioned ApoA-1 polypeptide or biologically functional varient or mimetic pepetide, in the manufacrture of a composition for promoting bone formation. In some embodiments, the composition can be a food product or supplement, or medicament. The present invention also provides the use of (iii) an agent that enhances endogenous ApoAl level in the manufacrture of a medicament for promoting bone formation.

[0011] The details of one or more embodiments of the invention are set forth in the description below. Other features or advantages of the present invention will be apparent from the following detailed description of several embodiments, and also from the appending claims.

BRIEF DESCRIPTION OF THE DRAWINGS

[0012] The foregoing summary, as well as the following detailed description of the invention, will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities shown.

[0013] In the drawings:

[0014] Fig. 1 shows the flow chart of human ORF library construction.

[0015] Fig. 2 shows the results of the gain-of- function screening of potential sub-libraries that enhance osteogenesis.

[0016] Fig.3 shows (A) induction of alkaline phosphatase (ALP) activity in the MSC clones infected with candidate gene (ApoA-1 gene); and (B) the effect of ApoA-1 gene knockdown in MSCs by two different shRNA (clone- 1 and clone-2), leading to inhibition of ALP activity.

[0017] Fig. 4 shows (A) the dose-dependent induction of ALP activity (early marker of osteogenesis) by treatment of ApoA-1; (B) increase of the RNA level of ALP by treatment of ApoA-1, and (C) the dose-dependent induction of calcium deposition (late marker of osteogenesis) by treatment of ApoA-1. All experiments were performed three times independently. Results are expressed as the mean ±SD. *, p <0.05; **, p < 0.01; p<0.001; pO.0001. p-values were analyzed using

Student's t-test.

[0018] Fig. 5 shows (A) the block of early osteogenesis (ALP activity) by knockdown of endogenous ApoA-1 gene; and (B) the block of late osteogenesis (calcium deposition) by knockdown of endogenous ApoA-1 gene.

[0019] Fig. 6 shows that the JNK inhibitor SP600125 blocked (A) early osteogenesis (ALP activity) and (B) late osteogenesis (calcium deposition), induced by ApoA-1 ; and (C) induction of JNK phosphorylation by ApoA-1 (western blotting analysis).

[0020] Fig. 7 shows the inhibition of adipogenesis by ApoAl . Oil red staining that demonstrate the differentiation of adipocytes was performed in hBM-MSCs culture in the absence (A) or presence (B) of ApoA-1.

[0021] Fig. 8 shows induction of the early osteogenesis of MSCs by ApoA-1 mimetic peptide L-4F.

[0022] Fig. 9 shows the ApoAl effects in osteoporosis disease in the mouse model. Various structural parameters, including (A) bone volume per tissue volume (BV/TV), (B) bone surface density (bone surface/tissue volume; BS/TV), (C) trabecular bone number (TbN), and (D) trabecular separation (TbSp), and (E) three-dimentional micro-computed tomography pictures of the femur of ApoA-1 transgenic mice (ApoAl -TG) and wild-type mice (WT), with bilateral ovariectomy or with sham opertaion (OVX and Sham). Data are presented as mean ±SD. P-values were analyzed using Student's t-test. *P<0.05, **P<0.01.

[0023] Fig. 10 shows Osteogenic differentiation induced by ApoA-1 is mediated through STAB. (A) hBM-MSCs were treated with ApoA-1 and STAT3 inhibitor Stattic (2.5uM) or transfected with dominant negative of STAT3 (STAT3-DN) during osteogenesis. Western blotting of STAT3 protein and phopho-STAT3 (Y705 or S727) levels in human BM-MSCs after cells were induced differentiation for 7 days. (B) ALP activity was determined after cells treated were treated with ApoA-1 and STAT3 inhibitor Stattic (2.5uM) or transfected with dominant negative of STAT3 (STAT3-DN) were induced differentiation for 7 days. Data are represented by ALP activity normalized to relative cell viability. (C) Cells treated in were treated with ApoA-1 and STAT3 inhibitor Stattic (2.5uM) or transfected with dominant negative of STAT3 (STAT3-DN) were stained with Alizarin Red S for 21 days to examine the matrix mineralization and quantified by spectrophotometer at 450 nm. (D): MSCs were treated with ApoA-1 and STAT3 inhibitor Stattic (2.5uM) for 7 days. Relative levels of ALP and BSP mRNA were determined by real-time quantitative polymerase chain reaction (qPCR). Data are represented by normalized to relative levels of GADPH mRNA. All experiments were performed three times independently. Results are expressed as the mean ±SD. *, p < 0.05; **, p < 0.01; ***, p<0.001; ****, pO.0001. p-values were analyzed using Student's t-test. Abbreviations: ApoA-1, apo lipoprotein A-1 ; ALP, alkaline phosphatase; hBM-MSC, human bone marrow mesenchymal stem cells.

[0024] Fig. 11 shows osteogenic differentiation induced by Apo A-1 is mediated through ERK-MAPK signaling. (A) MSCs were treated with Apo A-1 and ERK inhibitor U0126 (20 μΜ) during osteogenesis. The ERK and STAT3 protein levels were detected by western blot analysis in human BM-MSCs after cells were induced differentiation for 7 days. (B) ALP activity was determined after cells treated in with Apo A-1 and ERK inhibitor U0126 (20 μΜ) were induced differentiation for 7 days. Data are represented by ALP activity normalized to relative cell viability. (C)Cells treated with Apo A-1 and ERK inhibitor U0126 (20 μΜ) were stained with Alizarin Red S on 21 days to examine the matrix mineralization and quantified by spectrophotometer at 450 nm. (D) MSCs were co-treated with ApoA-1 and ERK inhibitor U0126 (20 μΜ) for 7 days. Relative levels of ALP and BSP mRNA were determined by real-time quantitative polymerase chain reaction (qPCR). Data are represented by normalized to relative levels of GADPH mRNA. All experiments were performed three times independently. Results are expressed as the mean ±SD. *, p < 0.05; **, p < 0.01; p<0.001; pO.0001. p-values were analyzed using Student's t-test. Abbreviations: ApoA-1, apo lipoprotein A-1; ALP, alkaline phosphatase; hBM-MSC, human bone marrow mesenchymal stem cells.

[0025] Fig. 12 shows ABCAl is essential for ApoA-1 -mediated osteogenesis in BM-MSCs. (A) BM-MSCs were infected with three different shRNAs targeting ABCAl (sh- ABCAl -29092, sh- ABCAl -29093, and sh- ABCAl -29089) or control shRNA (shRFP) and the ABCAl protein and phospho-STAT3Y705 level was determined by western blot analysis. (B) MSCs were infected with three different sh-ABCAl or shRFP and cells were induced to osteogenic differentiation. ALP activity were measured 7 days after differentiation were induced. Data are represented by ALP activity normalized to relative cell viability. All experiments were performed three times independently. Results are expressed as the mean ±SD. p <0 .0001. p-values were analyzed using Student's t-test. Abbreviations: ApoA-1, apo lipoprotein A-1 ; ALP, alkaline phosphatase; BM-MSC, bone marrow mesenchymal stem cells. DETAILED DESCRIPTION OF THE INVENTION

[0026] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as is commonly understood by one of skill in the art to which this invention belongs.

[0027] As used herein, the articles "a" and "an" refer to one or more than one (i.e., at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0028] The term "polynucleotide" or "nucleic acid" refers to a polymer composed of nucleotide units. Polynucleotides include naturally occurring nucleic acids, such as deoxyribonucleic acid ("DNA") and ribonucleic acid ("RNA") as well as nucleic acid analogs including those which have non-naturally occurring nucleotides. Polynucleotides can be synthesized, for example, using an automated DNA synthesizer. The term "nucleic acid" typically refers to large polynucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T." The term "cDNA" refers to a DNA that is complementary or identical to an mRNA, in either single stranded or double stranded form.

[0029] The term "complementary" refers to the topological compatibility or matching together of interacting surfaces of two polynucleotides. Thus, the two molecules can be described as complementary, and furthermore the contact surface characteristics are complementary to each other. A first polynucleotide is complementary to a second polynucleotide if the nucleotide sequence of the first polynucleotide is identical to the nucleotide sequence of the polynucleotide binding partner of the second polynucleotide. Thus, the polynucleotide whose sequence 5 '-TATAC-3 ' is complementary to a polynucleotide whose sequence is 5 '-GTATA-3 '."

[0030] The term "encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide (e.g., a gene, a cDNA, or an mRNA) to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Therefore, a gene encodes a protein if transcription and translation of mRNA produced by that gene produces the protein in a cell or other biological system. It is understood by a skilled person that numerous different polynucleotides and nucleic acids can encode the same polypeptide as a result of the degeneracy of the genetic code. It is also understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides described there to reflect the codon usage of any particular host organism in which the polypeptides are to be expressed. Therefore, unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.

[0031] The term "recombinant nucleic acid" refers to a polynucleotide or nucleic acid having sequences that are not naturally joined together. A recombinant nucleic acid may be present in the form of a vector. "Vectors" may contain a given nucleotide sequence of interest and a regulatory sequence. Vectors may be used for expressing the given nucleotide sequence or maintaining the given nucleotide sequence for replicating it, manipulating it or transferring it between different locations (e.g., between different organisms). Vectors can be introduced into a suitable host cell for the above mentioned purposes.

[0032] Examples of vectors include, but are not limited to, plasmids, cosmids, phages, YACs or PACs. Typically, in vectors, the given nucleotide sequence is operatively linked to the regulatory sequence such that when the vectors are introduced into a host cell, the given nucleotide sequence can be expressed in the host cell under the control of the regulatory sequence. The regulatory sequence may comprises, for example and without limitation, a promoter sequence (e.g., the cytomegalovirus (CMV) promoter, simian virus 40 (SV40) early promoter, T7 promoter, and alcohol oxidase gene (AOX1) promoter), a start codon, a replication origin, enhancers, an operator sequence, a secretion signal sequence (e.g., a-mating factor signal) and other control sequence (e.g., Shine-Dalgano sequences and termination sequences). Preferably, vectors may further contain a marker sequence (e.g., an antibiotic resistant marker sequence) for the subsequent screening procedure. More preferably, in vectors, the given nucleotide sequence of interest may be connected to another nucleotide sequence other than the above-mentioned regulatory sequence such that a fused polypeptide is produced and beneficial to the subsequent purification procedure. Said fused polypeptide includes, but is not limited to, a His-tag fused polypeptide and a GST fused polypeptide.

[0033] The term "polypeptide" refers to a polymer composed of amino acid residues linked via peptide bonds. The term "protein" typically refers to relatively large polypeptides. The term "peptide" typically refers to relatively short polypeptides. The term "L form peptide" refers to a peptide comprising all L form amino acids. The term "D form peptide" refers to a peptide comprising at least one D amino acid.

[0034] Amino acids can be expressed by three letters or one letters. Table 1 lists standard amino acid abbreviations.

[0035] Table 1 : Standard amino acid abbreviations

[0036] ApoA-1 is a major protein component of high-density lipoprotein (HDL). Endogenous Apo A-I is synthesized by the liver and small intestine as a preproprotein (267 amino acid residues) and subsequently secreted and cleaved to generate a mature polypeptide having 243 amino acid residues. The mature ApoA-1 of 243 amino acid residues consists of ten 22-mer amphipathic a- helices in tandem. Typically, ApoA-1 has the lipid binding activity and the ability of promoting cholesterol efflux as known in the art.

[0037] In one embodiment, a full-length human ApoA-1 polypeptide (267 amino acids) can be used in the present invention.

Full-length Human ApoA-1 amino acid sequence (SEQ ID NO: 1)

MKAAVLTLAV LFLTGSQARH FWQQDEPPQS PWDRVKDLAT VYVDVLKDSG RDYVSQFEGS ALGKQLNLKL LDNWDSVTST FSKLREQLGP VTQEFWDNLE KETEGLRQEM SKDLEEVKAK VQPYLDDFQK KWQEEMELYR QKVEPLRAEL QEGARQKLHE LQEKLSPLGE EMRDRARAHV DALRTHLAPY SDELRQRLAA RLEALKENGG ARLAEYHAKA TEHLSTLSEK AKPALEDLRQ GLLPVLESFK VSFLSALEEY TKKLNTQ

[0038] In another embodiment, a mature human ApoA-1 polypeptide (243 amino acids) can be used in the present invention.

Mature form of Human ApoA-1 amino acid sequence (SEQ ID NO: 2)

DEPPQSPWDR VKDLATVYVD VLKDSGRDYV SQFEGSALGK QLNLKLLDNW DSVTSTFSKL REQLGPVTQE FWDNLEKETE GLRQEMSKDL EEVKAKVQPY LDDFQKKWQE EMELYRQKVE PLRAELQEGA RQKLHELQEK LSPLGEEMRD RARAHVDALR THLAPYSDEL RQRLAARLEA LKENGGARLA EYHAKATEHL STLSEKAKPA LEDLRQGLLP VLESFKVSFL SALEEYTKKL NTQ

[0039] As used herein, "a ApoA-1 variant" or "a biologically functional variant of ApoA-1" can be used interchangeably in the present invention. It will be well understood by the skilled persons that inherent in the definition of a "biologically functional variant" means that there is a limited number of changes or modifications that may be made within a certain portion of the molecule irrelevant to the activity or function of the protein and still result in a molecule with an acceptable level of equivalent biological activity. The term "acceptable level" can mean at least 20%, 50%, 60%, 70%, 80%, or 90% of the level of the referenced protein as tested in a standard assay as known in the art. Biologically functional variant polypeptides are thus defined herein as those polypeptides in which certain amino acid residues may be substituted. Polypeptides with different substitutions may be made and used in accordance with the invention. Modifications and changes may be made in the structure of such polypeptides and still obtain a molecule having similar or desirable characteristics. For example, certain amino acids may be substituted for other amino acids in the peptide/polypeptide structure without appreciable loss of activity. [0040] Amino acid substitutions are generally based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. For example, arginine (Arg), lysine (Lys), and histidine (His) are all positively charged residues; and alanine (Ala), glycine (Gly) and serine (Ser) are all in a similar size. Therefore, based upon these considerations, arginine (Arg), lysine (Lys) and histidine (His); and alanine (Ala), glycine (Gly) and serine (Ser) may be defined as biologically functional equivalents. One can readily design and prepare recombinant genes for microbial expression of polypeptides having equivalent amino acid residues. Alternately, modifications of cDNA or genomic genes may be readily accomplished by well-known site-directed mutagenesis techniques and employed to generate analogs and derivatives of ApoAl .

[0041] As used herein, the ApoA-1 variant maintains the acceptable level of equivalent biological activity of the natural or wild type ApoA-1, i.e. the lipid binding activity and the ability of promoting cholesterol efflux, which can be identified by one of skill in the art by performing conventional tests in this art. Conventional tests are available to analyze a given ApoA-1 polypeptide or a variant or mimetic peptide for the ApoA-1 activities as described herein, such as cholesterol efflux assay as described in JBC, 2003, 278, 53055-53062 and lipid binding studies as described in J Lipid Res. 2008, 49, 2302-2311.

[0042] In one embodiment, a biologically functional variant of ApoA-1 of the invention comprises the amino acid sequence having at least 50%, 60%>, or 65%, or 70%), or 75%), or 80%>, or 85%, or 90%>, or 95% identity with the amino acid sequence of SEQ ID NO: 1 or 2, and retains the ApoA-1 activities as described herein.

[0043] To determine the percent identity of two amino acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid sequence for optimal alignment with a second amino acid sequence). In calculating percent identity, typically exact matches are counted. The determination of percent homology or identity between two sequences can be accomplished using a mathematical algorithm known in the art, such as BLAST and Gapped BLAST programs, the NBLAST and XBLAST programs, or the ALIGN program.

[0044] As described herein, an ApoA-1 mimetic peptide is a peptide, which "mimics" endogenous ApoA-1 so that it maintains the typical ApoA-1 activities, i.e. the lipid binding activity and the ability of promoting cholesterol efflux. In some embodiments, the mimetic peptide has less than 100 amino acid residues, particularly, less than 80 amino acid residues, more particularly less than 60 amino acid, even more particularly less than 40 amino acid residues. In one embodiment, the ApoA-1 mimetic peptide includes at least one class A amphipathic a-helix having positively charged amino acid residues clustered at a hydrophobic-hydrophilic interface and negatively-charged amino acid residues clustered at a center of a hydrophilic face. Other characteristic properties of Apo A-l mimetic peptides include but limit peptides with a non-polar side chain of aromatic amino acids, e.g. phenylalanine or tyrosine, and positively-charged amino acids (e.g., glutamic acid) between the two a-helices having a proper distance (e.g., approximately 3.6 amino acid residues). In certain embodiments, the peptide is about 40 or fewer amino acids in length. In some embodiments, the peptide comprises all "L" amino acids, while in some other embodiments, the peptide comprises at least one "D" amino acid residue. In certain embodiments, all enantiomeric amino acids comprising the peptide are "D" amino acids. Examples of Apo A-l mimetic peptides are of the amino acid sequence listed below:

[0045] Table 2: Apo A-l mimetic peptides

[0046] References about Apo A-l mimetic peptides can be found in Arterioscler Thromb Vase Biol 2005, 25: 1325-1331, Arterioscler Thromb Vase Biol 2005, 25: 1325-1331, J Pharmacol Exp Ther. 2012, 340, 716-722, J Pharmacol Exp Ther. 2012, 340, 716-722, Lipids Health Dis. 2011, 30, 224, Atherosclerosis. 2011, 217, 395-400, J Clin Invest. 1994, 94, 1698-1705, and J Biol Chem. 2012, 21, 287, 43730-43740.

[0047] In certain embodiments, the mimetic peptide is a D or L peptide whose sequence is selected from the group consisting of SEQ ID NOS: 3-8.

[0048] Optionally, the mimetic peptide can be further modified. In some embodiments, the mimetic peptide can optionally comprise a protecting group modification (e.g. one or more modifications coupled to the amino and/or to the carboxyl terminus). Suitable protecting groups include, but are not limited to, acetyl (Ac), amide, C3-20 alkyl group, Fmoc, t-butoxycarbonyl (Tboc), a benzoyl group, a propionyl, a carbobenzoxy, a propyl, a butyl, a pentyl, a hexyl, or an N-methyl anthranilyl. In certain embodiments, the peptide comprises a first protecting group coupled to the amino terminus (e.g. Acetyl) and a second protecting group coupled to the carboxyl terminus (e.g. amide).

[0049] In some embodiments, the mimetic peptide (e.g. ECT-642) can combine with phospholipids, lipid, or cholesterol, such as sphingomyelin and

l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), forming a

peptide/phospholipid complex.

[0050] The lipoproteins of the invention may be obtained from natural source, or produced by chemical synthetic procedures or recombinant expression techniques. In one embodiment, a recombinant expression vector containing a polynucleotide sequence encoding the lipoprotein of the invention can be constructed and introduced into host cells, which may be cultured under suitable conditions for expression of the lipoprotein. The polynucleotide sequence encoding the lipoprotein of the invention is available in this art. In one embodiment, the polynucleotide sequence encoding the lipoprotein of the invention is as follows:

Human ApoA-1 nucleotide sequences (SEQ ID NO: 9):

atgaaagctgcg gtgctgacct tggccgtgct cttcctgacg gggagccagg ctcggcattt ctggcagcaa gatgaacccc cccagagccc ctgggatcga gtgaaggacc tggccactgt gtacgtggat gtgctcaaag acagcggcag agactatgtg tcccagtttg aaggctccgc cttgggaaaa cagctaaacc taaagctcct tgacaactgg gacagcgtga cctccacctt cagcaagctg cgcgaacagc tcggccctgt gacccaggag ttctgggata acctggaaaa ggagacagag ggcctgaggc aggagatgag caaggatctg gaggaggtga aggccaaggt gcagccctac ctggacgact tccagaagaa gtggcaggag gagatggagc tctaccgcca gaaggtggag ccgctgcgcg cagagctcca agagggcgcg cgccagaagc tgcacgagct gcaagagaag ctgagcccac tgggcgagga gatgcgcgac cgcgcgcgcg cccatgtgga cgcgctgcgc acgcatctgg ccccctacag cgacgagctg cgccagcgct tggccgcgcg ccttgaggct ctcaaggaga acggcggcgc cagactggcc gagtaccacg ccaaggccac cgagcatctg agcacgctca gcgagaaggc caagcccgcg ctcgaggacc tccgccaagg cctgctgccc gtgctggaga gcttcaaggt cagcttcctg agcgctctcg aggagtacac taagaagctc aacacccagt ga

[0051] The expressed protein may subsequently be recovered from host cells by techniques known in the art, such as reverse phase chromatography high performance liquid chromatography, gel electrophoresis, ion exchange chromatography, affinity chromatography and the like. In another embodiment, the lipoproteins of the invention or its variants or mimetic peptides may be produced by a chemical synthesis method which is conducted by coupling the carboxyl group (C-terminus) of one amino acid to the amino group (N-terminus) of another. Examples of the chemical synthesis method include, but are not limited to, a solid-phase synthesis such as t-Boc solid-phase peptide synthesis and Fmoc solid-phase peptide synthesis. The relevant techniques used herein such as polynucleotide synthesis, polymerase chain reaction (PCR), cloning, vector construction, cell transformation, protein expression, peptide synthesis and purification, are well known in the art and described in, for example, Sambrook et al, Molecular Cloning: A Laboratory Manual, 2^nd ed., Cold Spring Harbor Laboratory Press (1989), and Frederick M.A. et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc. (2001).

[0052] According to the invention, the ApoA-1 polypeptide or its variant or mimetic peptide, or a vector comprising a nucleic acid fragment encoding the same, or an agent that enhances the endogenous ApoA-1 level, can be administered to a subject to promote bond formation.

[0053] Suitable expression vector for producing ApoA- 1 include any one that is known in the art that can cause protein expression of the ApoA-1 encoding nucleic acid sequences in mammalian cells. Suitable promoters and other regulatory sequences can be chosen as is desirable for a particular application, which can be inducible, tissue specific, event specific, etc. Examples of promoters are

cardiac-specific promoters, myosin light chain-2, E-cadherin promoter, C-reactive protein gene promoter, human enolase promoter, thy-a antigen and gamma-enolase promoters. Other promoters can be selected for expression of the ApoA-1 polypeptide or its variant or mimetic peptide of the invention.

[0054] Vial or non- viral expression vectors may be used to deliver a nucleic acid fragment encoding the ApoA-1 polypeptide or its variant or mimetic peptide to cells in vitro or in vivo, resulting in expression of the desired proteins. Various methodologies vectors available for delivering and expressing a polynucleotide in vivo for the purpose of treating diseases are available. Among the various targeting techniques available, transcriptional targeting using tissue-specific and event-specific transcriptional control elements is also discussed.

[0055] In one certain embodiment, an agent (e.g. a compound) that enhances the endogenous ApoA-1 level such as increasing expression amounts/stability or decreasing catabolism amount can be administered to a subject in need to promote bone formation. Examples of agent that increase ApoAl level include but are not limited to RVX-208 as described in Curr Opin Investig Drugs. 2010, 11 , 357-64, and I-BET151 as described in Bioorganic & Medicinal Chemistry Letters 2012, 22, 2963-2967.

[0056] The term "bone formation" as used herein refers to bone growth or regeneration (formation of new bone tissues). Osteogenesis is a differentiation process of a progenitor cell (e.g. bone marrow mesenchymal stem cells) toward osteo-lineage cells, forming a mature bone forming osteoblast, which is the primary cell responsible for forming the bone organic matrix and incorporation of

hydro xyapatite crystals during mineralization of the matrix. A positive regulator of osteogenesis stimulates differentiation of a progenitor cell into an osteoblast, thus promoting bone formation.

[0057] The term "bone loss disease" as used herein refer to a pathological disease or disorder, or a condition or state, in a mammal, in which there is an imbalance between bone formation and bone resorption such that would result in this mammal exhibiting an abnormal mass of bone, if no treatment is given. Osteoporosis is a typical example of such disease, characterized by low bone mass and micro architerctural deterioration of bone tissue, which would lead to increased bone fragility and fracture risk. According to the definition of World Health Organization (WHO), osteoporosis is of a bone mineral density 2.5 standard deviations or more below the bone density of a reference standard (average of young, healthy adults). Primary osteoporosis refers to bone mass loss unrelated to other illness and is normally associated with aging and age-related decrease of gonadal function such as postmenopausal osteoporosis.

Secondary osteoporosis refers to osteoporosis caused by other reasons than the age-related degeneration included by primary osteoporosis. Many diseases or conditions may cause bone loss, including but are not limited to, prolong

immobilization, hypogonadal states (e.g. surgical removal of the ovaries or testes), endocrine disorders (e.g. Cushing's syndrome and hyperparathyroisim),

gastrointestinal disorders (e.g. Crohn's disease and ulcerative colitis), malnutrition (e.g. deficiencies of vitamin D, K or B 12), rheumato logic disorders (e.g. rheumatoid arthritis, systemic lupus erythematosus and polyarticular juvenile idiopathic arthritis), renal insufficiency, hematologic disorders (e.g. multiple myeloma and leukemia), inherited disorders (e.g. osteogenesis imperfect, Marfan syndrown, homocystinuria and Ehlers-Danlos syndrome), and tumors (particularly breast, prostrate, lung and kidney tumors). Some therapy can cause bone loss, such as steroid treatment, gastric or gastrointestinal bypass procedure, aromatase inhibitor treatment, androgen deprivation treatment and immunosuppressant drug treatment. The method of the present invention also applies to bone fracture or damage where bone healing is desired.

[0058] The term "treatment" or "treating" refers to an action, application or therapy, wherein a subject, including a human being, is subjected to medical aid with the purpose of improving the subject's condition, directly or indirectly. Particularly, the term refers to reducing incidence, or alleviating symptoms, eliminating recurrence, preventing recurrence, preventing incidence, improving symptoms, improving prognosis or combination thereof in some embodiments. The skilled artisan would understand that treatment does not necessarily result in the complete absence or removal of symptoms. In one embodiment, a method for treating a bone loss disease, such as osteoporosis, in a human patient, as described herein, is associated with administering to the patient an effective amount of an ApoA-1 polypeptide, acting as a positive regulator of osteogenesis, thereby promoting bone formation and thus alleviating or eliminating symptoms of the bone disease in the subject.

[0059] The term "subject" as used herein includes human and non-human mammals such as companion animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) or laboratory animals (e.g., rats, mice, guinea pigs, and the like).

[0060] For purpose of delivery, the lipoproteins of the invention or polynucleotide encoding the same or the agent that enhances the endogenous ApoA-1 level can be formulated into a composition with a physiologically acceptable carrier or embedded by an implant. "Physiologically acceptable" as used herein means that the carrier is compatible with the active ingredient contained in the composition, preferably capable of stabilizing the active ingredient, and not deleterious to the subject to be treated. The carrier may serve as a diluent, vehicle, excipient, or medium for the active ingredient. Some examples of suitable carriers include physiologically compatible buffers, such as Hank's solution, Ringer's solution, physiological saline buffer, lactose, dextrose, sucrose, sorbitol, mannitol, starches, gum acacia, calcium phosphate, alginates, tragacanth, gelatin, calcium silicate, micro crystalline cellulose,

polyvinylpyrrolidone, cellulose, sterile water, syrup, and methyl cellulose. The composition of the invention can additionally include lubricating agents such as talc, magnesium stearate, and mineral oil; wetting agents; emulsifying and suspending agents; preserving agents such as methyl- and propylhydroxy-benzoates; sweetening agents; and flavoring agents.

[0061] In some embodiments, the composition of the invention can be used as a food product or supplement, to maintain good conditions of bone healthy for daily life.

[0062] In some embodiments, transgenic plants where a recombinant DNA construct is introduced to express ApoAl (or its variant or mimetic peptide) or the plant product thereof (such as fruit or seed) can be obtained as a food source to supply ApoAl and thus to promote bone formation in a subject in need. Preferred transgenic plants includes, but are not limited to, crop plants such as rice, wheat, barley, sorghum, maize and oats or economic plants such as tomatoes and bananas. The introduction, into the organism (transformation), of the nucleic acid according to the invention, can be effected in principle by all methods with which the skilled persons is familiar. In the case of plants, the method which have described for the transformation and regeneration of plants from plant tissues or plant cells can be exploited for transient or stable transformation. Suitable methods are the biolistic method or by protoplast transformation, electroporation, microinjection and the agrobacterium-mediated gene transfer.

[0063] An "effective amount" or an "effective dose," in connection with administration of a pharmacological agent, as used herein, refers to an amount of a drug or pharmaceutical agent which, as compared to a corresponding subject who has not received such amount, results in an intended pharmacological result, or an effect in treatment, healing, prevention, or amelioration of a disease, disorder, or side effect, or a decrease in the rate of advancement of a disease or disorder. The effective amount or dose of a pharmacological agent may vary depending on particular active ingredient employed, the mode of administration, and the age, size, and condition of the subject to be treated. Precise amounts of a pharmacological agent are required to be administered depend on the judgment of the practitioner and are peculiar to each individual.

[0064] The composition according to the invention can be in the form of tablets, pills, powders, lozenges, sachets, cachets, elixirs, suspensions, emulsions, solutions, syrups, soft and hard gelatin capsules, suppositories, sterile injectable solutions, and packaged powders.

[0065] The composition of the invention may be delivered through any physiologically acceptable route. These routes can include, but are by no means limited to parenteral administration, systemic administration, oral administration, nasal administration, rectal administration, intraperitoneal injection, intravascular injection, subcutaneous injection, transcutaneous administration, inhalation administration, and intramuscular injection.

[0066] It is also unexpected found that ApoA-1 has superior activity on stimulating osteogenic differentiation of mesenchymal stem cells. Therefore, the present invention also provides a method for stimulating osteogenic differentiation of mesenchymal stem cells, comprising contacting the cells with an effective amount of an ApoA-1 polypeptide or a biologically functional variant or mimetic peptide thereof. The method may further comprise applying such stem cells in the treatment or regenerative medicine.

[0067] The present invention is further illustrated by the following examples, which are provided for the purpose of demonstration rather than limitation. Those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

[0068] Examples

[0069] Mesenchymal stem cells (MSCs) are the prominent source for regenerative medicine. MSCs not only have the ability to proliferate in vitro and in vivo but also have the potential to differentiate into osteo-, adipo- or chrondro-lineage cells {Science 284, 143-147). However, the detail mechanism of osteogenic differentiation is unclear. We utilized an unbiased cDNA library that contains 12,000 human open reading frame (ORF) clones to screen for the genes that promote human bone marrow-derived MSCs (hBM-MSCs) differentiate into osteoblasts. Base on the results of alkaline phosphatase (ALP) activity, an early marker in osteogenesis, some candidate genes were obtained from the gain-of- function screen. Furthermore, by a loss-of-function study performed with at least two independent short hairpin RNAs (shRNAs), we demonstrated that these candidate genes are essential for the process of osteogenesis. Among them, we carried out a serious of experiments and demonstrated that ApoA-1 is a positive regulator of osteogenesis, which therefore may be used to promote bone formation and in the treatment of bone diseases or conditions, where bone formation is desired, such as bone loss diseses (e.g. osteoporosis) or bone fracture.

[0070] I. Material and Methods

[0071] 1. Cell culture and reagents

[0072] Human bone marrow mesenchymal stem cells were purchased from Lonza (Basel, Switzerland) and were cultured in MesenPro RS medium (Invitrogen),

HEK293T cells maintained in DMEM-HG plus 10% FBS (Invitrogen) obtained from National RNAi core facility of Academic Sinica. Human recombinant apo lipoprotein Al were bought from Prospec (NJ, USA). DMEM-low glucose medium, DMEM-high glucose and fetal bovine serum (FBS) were ordered from Invitrogen. Dexamethasome, β-glycerophosphate, and L-ascorbic acid phosphate were bought from Sigma.

[0073] 2. Osteogenic differentiation

[0074] Cells were maintained in osteogenic- induction medium (DMEM-LG, 10% FBS, 0.1 μΜ dexamethasome, 10 mM β-glycerophosphate, 0.05 mM L-ascorbic acid phosphate). Osteogenic induction medium was replaced twice a week in the process of differentiation.

[0075] 3. Cell viability assay and alkaline phosphatase activity assay

[0076] To examine relative cell viability, after cells induced into osteoblasts for 7 days, 10%> Alamar blue reagent (Serotec) was added and OD 570nm/600nm were measured by microplate reader (Bio-Rad) after incubated for 1 h at 37°C and 5% C0₂. Then, cells were washed twice with PBS and incubated with alkaline phosphatase substrate p-NPP (Sigma) for room temperature 5 to 20 minutes. The ALP activity was calculated by measured the absorbance at OD 405 nm and normalized to the relative cell number that was assessed by Alamar Blue activity (AB).

[0077] 4. Alizrain Red S assay

[0078] After cells were differentiated into osteoblast for 21 days, cells were fixed with ice-cold 70 % ethanol in -20°C for 1 hr, and stained with 40mM Alizarin Red (pH4.2) for 10 min. Following staining, wells were washed for five times with PBS and photographed by microscope. For quantification, wells were extracted by 10% cetylpridinium chloridie (Sigma) for 15 minutes and the absorbance of the reaction product was measured at OD 570 nm by the microplate reader (Bio-Rad).

[0079] 5. Real-time reverse transcription PCR

[0080] Total RNA was isolated by RNeasy Micro kit (Qiagen) according to the manufacturer's instructions. After RNA isolation, DNase-treated RNA was processed by superscript III (Invitrogen) for cDNA synthesis, and then real time PCR was performed with ABI 7900 by using SYBR GREEN 2x master mix (KAPA biosystems). Finally, the expression of mRNA was normalized to corresponding GADPH level. PCR primers were as follows: GADPH forward: 5 '-catcaccatcttccaggagc-3 ' (SEQ ID NO: 10), GADPH reverse: 5 '-atgccagtgagcttcccg ttc-3 ' (SEQ ID NO: 11); ALP forward: 5 '-tggagcttcagaagctcaaca cca-3 ' (SEQ ID NO: 12), ALP reverse: 5 '-atctcgttgtctgagtaccagtcc-3 ' (SEQ ID NO: 13); BSP forward: 5 '-AACCTACAACCCCACCACAA-3 '(SEQ ID NO: 14), BSP reverse: 5 '-AGGTTCCCCGTTCTCACTTT-3 '(SEQ ID NO: 15).

[0081] 6. Lentiviral infection

[0082] Lentivirus production was performed in HEK293T cells using TurboFect (Fermentas, Glen Burnie MD, USA). One day before trans fection, 4 x 10⁵ cells per well were plated in 6-well plates. The next day, cells were transfected with 1 μg of the plasmids encoding each of the following: shApoAl, shABCAl , and vector controls along with 1 μg helper plasmids (pCMVR8.91 and pMD.G) (National RNAi Core Facility). 16-24 h later the medium was replaced, and 72 h after transfection the supernatant was harvested. For infections, 4 x 10⁴ cells were transduced with a multiplicity of infection (MOI) of 1. For lentivirus infection, hBM-MSCs were infected with control shRFP virus, ApoA-1 shRNA virus, and shABCAl virus in the presence of 8ug/ml Protamine Sulfate. The following day, cells were wash twice with PBS and induced into osteoblasts. The ShRNAs were of the sequences as follows: Human ApoA-1 shRNA-1 :

clone ID: TRCN0000029114

Target sequence: GCTCGGCATTTCTGGCAGCAA (SEQ ID NO: 16)

Human ApoA-1 shRNA-2:

clone ID: TRCN0000029116

Target sequence: GTGTACGTGGATGTGCTCAAA (SEQ ID NO: 17) Human ABCA1 shRNA-29092:

clone ID: TRCN0000029092

Target sequence: GCCTCGTGAAGTATGGAGAAA (SEQ ID NO: 18)

Human ABCA1 shRNA-29093 :

clone ID: TRCN0000029093

Target sequence: GCTGTGGAAGAACCTCACTTT (SEQ ID NO: 19)

Human ABCA1 shRNA-29089:

clone ID: TRCN0000029089

Target sequence: GCCTCTATTTATCTTCCTGAT (SEQ ID NO: 20)

[0083] 7. Peptide synthesis

[0084] The sequence of ApoA-1 mimetic peptide L-4F (Kelowna International Scientific Inc.) is as previously described (Am J Physiol Cell Physiol 298, 1538-1548).

L-4F Peptide sequence: Ac-DWFKAFYDKVAEKFKEAF-NH₂ (SEQ ID NO: 3) Control peptide sequence: Ac-DWFAKDYFKKAFVEEFAK-NH₂ (SEQ ID NO: 21)

[0085] 8. Recombinant protein production

[0086] APOAl Human Recombinant from E.coli fused to a His-Tag at N-terminus (264 amino acid sequence; ) was produced and purified by proprietary

chromatographic techniques. The 264 amino acid sequence (SEQ ID NO: 22) is as follows:

MGSSHHHHHH SSGLVPRGSH MDEPPQSPWD RVKDLATVYV DVLKDSGRDY VSQFEGSALG KQLNLKLLDN WDSVTSTFSK LREQLGPVTQ EFWDNLEKET EGLRQEMSKD LEEVKAKVQP YLDDFQKKWQ EEMELYRQKV EPLRAELQEG ARQKLHELQE KLSPLGEEMR DRARAHVDAL RTHLAPYSDE LRQRLAARLE ALKENGGARL AEYHAKATEH LSTLSEKAKP ALEDLRQGLL PVLESFKVSF LSALEEYTKK LNTQ

[0087] 9. Animals and Surgery

[0088] C57BL/6-Tg(APOA-I)lRub/J mice carrying the human ApoA-1 transgene were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). The C57BL/6J mice used as the wild-type control were purchased from BioLASCO Taiwan Co., Ltd. (Charles River Technology, Taipei, Taiwan). All protocols were approved by the Institutional Animal Care and Utilization Committee of Academia Sinica. Eight- week-old female ApoA-1 transgenic mice or C57BL/6 wild type mice were performed bilateral ovariectomy or sham operation which the ovaries were exteriorized but replaced intact under general anesthesia. All of the mice were sacrificed 8-12 weeks after the surgery and the femurs were removed for analyses. [0089] 10. Micro-Computed Tomography Analysis

[0090] Trabecular bone microarchitecture of the distal femur was analyzed with micro-computed tomography (Skyscan-1076, Skyscan, Belgium). The x-ray was set at 50 kV, 200 uA, 0.5 mm aluminum filter, 0.4u of rotation step, 0.5 mm Al filter, and 9 um/pixel of scan resolution. Cross-sections were reconstructed by NRecon software (Skyscan) and files were then processed by CTAn software (Skyscan).

[0091] II. Results

[0092] 1. Human ORF library construction and a gain-of-function screen identifies potential plates that enhance osteogenesis

[0093] We utilized an unbiased cDNA library that contains 12,000 human ORF clones to screen for the genes that promote human bone marrow-derived MSCs (hBM-MSCs) differentiate into osteoblasts. Fig. 1 shows the flow chart of the human ORF library construction in our study. The eight categories of the clones as recited in the third step in Fig.1 are shown in Table 3 as below.

Table 3 : Eight categories of the clones included in this study.

[0094] 2. A gain-of-function screen identifies potential plates that enhance osteogenesis

[0095] Subsequently, the MSCs were infected with 136 pooled human ORF sub-libraries or control (GFP) lentivirus. The ALP activity, an early marker of osteogenesis, was examined after 5 days of induction (data not shown). Candidate sub-libraries were obtained from the gain-of-function screening. The candidate sub-libraries were further examined by calcium deposition, a late marker of osteogenesis. Briefly, MSCs were infected with twenty-five candidate sub-libraries and analyzed for calcium deposition by Alizarin Red S at Day21 post-induction and the absorbance was measured at 570 nm. Fig. 2 shows the results of the gain-of- function screen (25 candidate plates).

[0096] 3. Identification of ApoA-1 as a positive regulator of osteogensis

[0097] To identify the candidate gene which can promote osteogenesis, MSCs were infected with single gene of the pooled human ORF 2002 sub-library and then the ALP activity, an early marker of osteogenesis, was examined after 5 days of induction. ApoAl was found to be one of the candidate genes in pool 2002 that promote osteogenesis. The ALP activity was normalized by the relative cell number that was measured by AlamarBlue activity (AB). Fig.3A shows that overexpression of ApoA-1 gene enhanced ALP activity in MSCs.

[0098] In addition, to measure the effects of each of the gene knockdown in MSCs, the cells were infected with lentivirus carrying two independent shRNAs of the ApoAl genes or control shRNA (shCtrl) in a 96-well plate, and then the ALP/AB activity was examined. Fig. 3B shows that the knockdown of ApoA-1 gene inhibited the osteogenesis of MSCs.

[0099] The results suggest that ApoA-1 is a positive regulator of osteogensis.

[00100] 4. ApoA-1 promotes osteogenic differentiation of hBM-MSCs

[00101] MSCs were treated with different doses of ApoA-1 and then the ALP/AB activity was measured (* P<0.05). Fig. 4A shows the dose-dependent induction of the early osteogenesis of MSCs by ApoA-1.

[00102] In addition, the RNA level of ALP was also measured. Fig. 4B shows that the RNA level of ALP is also increased by ApoA-1 treatment.

[00103] Further, to examine matrix mineralization, the late marker of osteogenesis, MSCs were stained with Alizarin Red S at Day21 post-induction and then quantification was made by measuring the absorbance at 570 nm. ** P<0.01 ; **** * P<0.00001. Fig. 4C shows the dose-dependent induction of the late osteogenesis of MSCs by ApoA-1.

[00104] The results demonstrate that ApoA-1 promotes osteogenic differentiation of MSCs in a dose dependent manner.

[00105] 5. Knockdown endogenous ApoA-1 inhibits osteogenesis

[00106] To test the effects of the endogenous ApoA-1 in osteogenesis of MSCs,

MSCs were respectively infected by lentiviruses with two independent shRNAs targeting ApoA-1 or control shR A (shCtrl), and then the ALP/AB activity was examined. In addition, MSCs were stained with Alizarin Red S after cells infected with indicated shRNAs. **, p < 0.01; ***, p< 0.001; ****, p <0 .0001.

[00107] Fig. 5 A shows that silencing of ApoA-1 blocked the early osteogenesis of MSCs. Fig. 5B shows that silencing of ApoA-1 blocked the late osteogenesis of MSCs.

[00108] The results demonstrate that knockdown endogenous ApoA-1 inhibits osteogenesis of MSCs.

[00109] 6. ApoA-1 stimulates osteogenic differentiation through Jun N-terminal kinases (JNK)-Mitogen-actiyated protein kinases (MAPK) pathway, signal transducer and activator of transcription (STAT3) pathway, extracellular signal-regulated kinase (ERK) pathway, and ATP-binding-cassette transporter Al (ABCA1) pathway

[00110] To determine the pathway of the stimulation of osteogenic differentiation by ApoA-1, MSCs were treated with osteogenic induction medium (OIM), ApoA-1, and JNK inhibitor (lOuM), and ALP/AB activity was determined. Fig. 6 A shows that the JNK inhibitor SP600125 blocks the early osteogenesis induced by ApoA-1.

[00111] In addition, MSCs were stained with Alizarin Red S to examine the matrix mineralization. Fig. 6B shows that the JNK inhibitor SP600125 blocks the late osteogenesis induced by Apo A- 1.

[00112] Furthermore, cells were treated with OIM, ApoA-1, and/or JNK inhibitor (5 or lOuM) after cells were starved for 24 fir. Cell lysates were isolated for Western blot analysis. Fig. 6C shows that ApoA-1 induces JNK phosphorylation.

[00113] The results suggest that ApoA-1 stimulates osteogenic differentiation through JNK-MAPK pathway.

[00114] In addition, Figs. 10-12 provided data showing that the stimulation of osteogenic differentiation by ApoA-1 also involves the STAT3, ERK and ABCA1 pathways.

[00115] 7. ApoA-1 inhibits adipogenesis in MSCs

[00116] MSCs were induced toward adipogenesis in the presence or absence of ApoA-1. After inducing adipogenesis for 21 days, cells were stained with Oil Red O for lipid droplet deposition. Following staining, cell morphology was photographed to observe intracellular lipid droplet by phase-contrast microscope. Scale bar is 50 μΜ. Fig. 7 shows that ApoA-1 inhibits adipogenesis in MSCs, which favors the shifting to osteogenesis.

[00117] 8. Effect of L-4F on human MSC-derived osteogenesis

[00118] MSCs were induced toward osteogenesis in the presence or absence of ApoA-1 mimetic peptide L-4F, and then the ALP/AB activity was measured (* P<0.05). Fig. 8 shows induction of the early osteogenesis of MSCs by ApoA-1 mimetic peptide L-4F.

[00119] 9. Transgenic Apo A- 1 ameliorates osteoporosis in ovariectomized mice

[00120] In Alizarin red stain and alkaline phosphatase assay, we demonstrated that ApoA-1 promotes osteogenesis in vitro. Next, to investigate whether ApoA-1 could prevent bone loss in vivo, a disease model that mimics postmenopausal osteoporosis, ovariectomy-induced osteoporosis were performed. The ApoAl transgenic mice did not have measurable bone loss or symptom of osteoporosis after the ovariectomy. The bone microarchitecture of ApoA-1 transgenic (ApoAl-TG) mice and wild type mice were examined by micro-computed tomography (micro-CT) after ovariectomy. The bone volume (BV/TV) of the ovariectomized mice was significantly higher (60%) in ApoAl-TG mice when compare it to wild type mice (Fig.9A). In addition, other structural parameters such as bone surface density and trabecular bone number of the ovariectomized mice were 56% and 74% higher in ApoAl-TG mice than wild type mice (Fig. 9B and 9C). In the ApoAl-TG mice, there is slightly reduced in the trabecular separation (Fig. 9D), although it is not statistic significance. Furthermore, by micro-CT scans of the bone microarchitecture in ovariectomized mice, ApoA-l-TG mice showed less bone loss than the wild type mice (Fig. 9E). Taken together, these results indicated that the stimulatory effect of ApoA-1 ameliorate the reduction in bone volume induced by ovariectomy.

[00121] III. Conclusions

[00122] In this study, we found that ApoA-1 not only can enhance the expression of early osteogenesis marker (ALP activity) but also stimulate the expression of late osteogenesis marker (Alizarin Red staining). In addition, we also discovered the c-Jun N-terminal kinase (JNK) pathway is involved in ApoA-1 -mediated function. Inhibition of JNK pathway by SP600125, a JNK inhibitor, blocked the enhancement of osteogenesis markers and the mineralization of bone by ApoA-1. Other pathways, the ATP-binding-cassette transporter Al (ABCAl), extracellular signal-regulated kinase (ERK), signal transducer and activator of transcription (STAT3) pathways are also involved. We also demonstrated in the animal model that ApoA-1 can promote bone formation and prevent bone loss, and thus is effective in the treatment of osteoporosis in vivo. Taken together, our results demonstrate that ApoA-1 is a positive regulator of osteogenesis, which stimulates ALP activity and mineralization through JNK, ABCAl, ERK, and/or STAT3 pathways in the osteogenesis process of hBM-MSCs, and is useful for promting bone formation and effective in the treatment of bone loss diseases e.g. osteoporosis.

Claims

CLAIMS What is claimed is:

1. A method for promoting bone formation in a subject in need thereof, comprising administering to the subject an effective amount of a composition comprising (i) an apo lipoprotein A- 1 (ApoA-1 polypeptide or a biologically functional variant or mimetic peptide thereof, or (ii) a vector comprising a nucleic acid fragment encoding the ApoA-1 polypeptide or the biologically functional variant or mimetic peptide thereof, or (iii) an agent that enhances endogenous ApoA-1 level; together with (iv) a physiologically acceptable carrier.

2. The method of claim 1, wherein the ApoA-1 polypeptide comprises SEQ ID NO: 1 or 2.

3. The method of claim 1, wherein the variant has the amino acid sequence having at least 60%, or 65%, or 70%, or 75%, or 80%, or 85%, or 90%, or 95% identity with SEQ ID NO: 1 or 2.

4. The method of claim 1, wherein the mimetic peptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 3-8.

5. The method of any of claims 1-4, wherein the subject is afflicted with a bone loss disease or bone fracture.

6. The method of claim 5, wherein the bone loss disease is primary or secondary osteoporosis.

7. A method for stimulating osteogenic differentiation of mesenchymal stem cells, comprising contacting the cells with an effective amount of an Apo A- 1 polypeptide or a biologically functional variant or mimetic peptide thereof.

8. The method of claim 7, wherein the ApoA-1 polypeptide comprises SEQ ID NO: 1 or 2.

9. The method of claim 7, wherein the variant has the amino acid sequence having at least 60%, or 65%, or 70%, or 75%, or 80%, or 85%, or 90%, or 95% identity with SEQ ID NO: 1 or 2.

10. The method of claim 7, wherein the mimetic peptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 3-8.

11. Use of (i) an apo lipoprotein A-l (ApoA-1 polypeptide or a biologically functional variant or mimetic peptide thereof, or (ii) a vector comprising a nucleic acid fragment encoding the Apo A-l polypeptide or the biologically functional variant or mimetic peptide thereof, or (iii) an agent that enhances endogenous Apo A-l level in the manufacrture of a composition for promoting bone formation in a subject.

12. The use of claim 11, wherein the ApoA-1 polypeptide comprises SEQ ID NO: 1 or 2.

13. The use of claim 11, wherein the variant has the amino acid sequence having at least 60%, or 65%, or 70%, or 75%, or 80%, or 85%, or 90%, or 95% identity with SEQ ID NO: 1 or 2.

14. The use of claim 11, wherein the mimetic peptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 3-8.

15. The use of any of claims 11-14, wherein the subject is afflicted with a bone loss disease or bone fracture.

16. The use of claim 15, wherein the bone loss disease is primary or secondary osteoporosis.

17. A composition for use in promoting bone formation in a subject, comprising (i) an apo lipoprotein A-l (ApoA-1 polypeptide or a biologically functional variant or mimetic peptide thereof, or (ii) a vector comprising a nucleic acid fragment encoding the Apo A-l polypeptide or the biologically functional variant or mimetic peptide thereof, or (iii) an agent that enhances endogenous Apo A-l level; together with (iv) a physiologically acceptable carrier.

18. The composition of claim 17, wherein the ApoA-1 polypeptide comprises SEQ ID NO: 1 or 2.

19. The composition of claim 17, wherein the variant has the amino acid sequence having at least 60%, or 65%, or 70%, or 75%, or 80%, or 85%, or 90%, or 95% identity with SEQ ID NO: 1 or 2.

20. The composition of claim 17, wherein the mimetic peptide comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 3-8.

21. The composition of any of claims 17-20, wherein the subject is afflicted with a bone loss disease or bone fracture.

22. The composition of claim 21, wherein the bone loss disease is primary or secondary osteoporosis.