WO2013151505A1 - Method of making a prognosis for lung cancer - Google Patents

Abstract

The present disclosure relates to single nucleotide polymorphisms (SNP) as genetic markers indicative of a patient's survival from lung cancer and responsiveness to treatment, enabling improved prediction of a patient's risk, prognosis of lung cancer.

Description

METHOD OF MAKING A PROGNOSIS FOR LUNG CANCER

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority of Singapore patent application No. 201202407-1, filed April 2, 2012, the contents of it being hereby incorporated by reference in its entirety for all purposes.

FIELD OF THE INVENTION

[0002] The present invention relates generally to the field of biotechnology. In particular, the present invention relates to single nucleotide polymorphisms (SNP) as genetic markers that indicate a patient's survival from lung cancer and responsiveness to treatment, in order to enable improved prediction of a patients risk and prognosis of lung cancer.

BACKGROUND OF THE INVENTION

[0003] Lung cancer is a leading cause of cancer mortality worldwide. It has been established that approximately 116,090 men and 103,350 women were diagnosed with lung and bronchial cancer and 159,390 men and women died of lung and bronchial cancer in 2009.

[0004] There are two major types of lung cancer, namely non-small cell lung cancer (NSCLC) which accounts for 75% of cases and small cell lung cancer (SCLC). As NSCLC accounts for the majority of cases worldwide, it is imperative to understand its key causation factors in order to improve therapeutic treatments. Lung cancer is well known to be correlated with the exposure to cigarette consumption. About 10% of smokers develop lung cancer. Nevertheless, the disease can occur in the absence of cigarette consumption. This suggests the existence of inter-individual genetic differences in susceptibility.

[0005] In recent years, there has been increased interest in genes, for which polymorphisms were associated with an increased risk of lung cancer. Studies such as the identification of single nucleotide polymorphisms (SNPs) in KLF6 and nicotine acetylcholine receptor (CHRNA) gene regions are associated with risk of lung cancer have emphasized their importance in lung cancer development.

[0006] In addition, much effort has been expended to identify genetic determinants in patient outcomes, so as to improve clinical treatment decisions and for the design of therapeutic agents. The epidermal growth factor receptor (EGFR) mutations, for instance, are common in patients with NSCLC, and are known to confer survival benefit and better clinical outcome when treated with EGFR tyrosine kinase inhibitors (TKIs). To date, no known genetic variants have been reported, that could help determine the dose and clinical outcomes in NSCLC patients receiving anti-cancer treatments.

[0007] Recent introduction of targeted therapy and increasing numbers of available chemotherapeutic regimens, such as platinums, taxanes and gemcitabine, do not effectively cure lung cancer patients, with varied response towards treatment and occurrence of drug toxicity. In addition, prognosis remains dismal in lung cancer patients albeit careful evaluation of clinico-pathological factors that determine patient response to therapy, such as tumor, nodes and metastasis (TNM) staging, performance status, gender and weight loss.

[0008] Accordingly, there is a need for providing improved methods for making a prognosis regarding the development of lung cancer.

SUMMARY OF THE INVENTION

[0009] In a first aspect, there is provided a method of making a prognosis as to whether a patient having or at risk of developing cancer is likely to survive a cancer, wherein the method comprises determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from the patient, wherein the at least one SNP is selected from the group consisting of POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868138), and RRM1-269=CC/CA (rsl2806698).

[0010] In a second aspect, there is provided a method for predicting responsiveness to an anti-cancer treatment in a patient having or at risk of developing cancer, comprising determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from the patient, wherein the at least one SNP comprises POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868138), and RRM1-269=CC/CA (rsl2806698) and wherein the presence or absence of the at least one SNP is indicative of the responsiveness of the patient to the anti-cancer treatment.

[0011] In a third aspect, there is provided a method for determining susceptibility of a patient having or at risk of developing a cancer to an anti-cancer treatment, wherein the method comprises determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from a patient, wherein the at least one SNP comprises POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868138), and RRM1-269=CC/CA (rsl 2806698).

[0012] In a fourth aspect there is provided a kit comprising at least one reagent to determine the presence or absence in a sample of at least one single nucleotide polymorphism (SNP) selected from the group consisting of POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868138), and RRM1-269=CC/CA (rsl2806698).

BRIEF DESCRIPTION OF THE DRAWINGS

[0013] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the accompanying drawings, in which:

[0014] Fig. 1 relates to Kaplan Meier plots showing the significant differences in survival times of Non-Small Cell Lung Cancer (NSCLC) patients with SNP-SNP combinations of {*)POLA2 +1747=GA/GG together with SLC28A2+65=CC, or (b)POLA2 +1747=GA/GG together with SLC28A2+225=CC. Nucleotides are numbered according to their position in transcribed DNA in reference to the translational start site ATG (+1). Variants in non-coding DNA are numbered in parenthesis in reference to the translational start site ATG (+1).

DETAILED DESCRIPTION OF THE PRESENT INVENTION

[0015] Before the present methods and kits are described, it is to be understood that this invention is not limited to particular methods, kits and experimental conditions described, as such methods, kits and conditions may vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0016] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, as it will be understood that modifications and variations are encompassed within the spirit and scope of the instant disclosure.

[0017] The present invention relates to the genetic profiling of cancer patients or patients at risk of developing cancer to identify single nucleotide polymorphisms (SNPs) affecting a patient's survival from cancer and assisting in improving clinical treatment decisions. The detection of SNPs associated with cancer has the potential to classify patients according to genetic factors, as a means for improving prediction of risk, prognosis and selection of treatments. Therefore, the present invention provides methodologies and kits for predicting a patient's chance of survival based upon the presence or absence of at least one SNP. The present invention also relates to associating the occurrence of SNPs with the survival and responsiveness of a cancer patient receiving anti-cancer treatment.

[0018] As used herein, the terms "single nucleotide polymorphism" or "SNP" refer to a DNA sequence variation or a genetic variant that occurs when a nucleotide, e.g., adenine (A), thymine (T), cytosine (C), or guanine (G), in the genome sequence is altered to another nucleotide. The - or + and the number recited for each SNP are defined as number of nucleotides 5' or 3' counting from the A of the ATG-translation initiation codon, respectively. For example, S28A2+225=CC/CA indicates the SNP in which the nucleotide at position 225 (3' direction) from the A of the ATG- translation initiation codon of coding DNA encoding the S28A2 protein is changed from C to A.

[0019] It is common practice to describe the SNP as rsID for easy database lookup and extended (e.g. POLA2+1747=GG/GA) for better readability. POL2A+1747 indicates the coding DNA encoding the POLA2 protein on the positive strand on the 1747th nucleotide starting from the A of the ATG-translation initiation codon.

[0020] The term "gene" refers to a nucleic acid sequence that comprises control and coding sequences necessary for the production of a polypeptide or precursor. The polypeptide can be encoded by a full length coding sequence or by any portion of the coding sequence. A genetic "locus" or "loci" refer to sequences found in a primary transcript (the exons and introns of a gene sequence and upstream and downstream transcribed non-coding regions), as well as regulatory regions. A "gene variant" refers to alternative forms of a gene or gene loci by a single nucleotide, or several nucleotides, and can include substitutions, deletions and insertions of nucleotides.

[0021] The presence of SNPs and encoded proteins as disclosed herein has been found in a plurality of tissues and/or organs isolated from mammals. For example, the POL2A+1747 SNP and encoded protein thereof can be found in tissues including but not limited to lung, adrenal gland, bladder, blood, bone, bone marrow, brain, cervix, connective tissue, embryonic tissue, esophagus, eye, heart, intestine, kidney, larynx, liver, lymph, lymph node, mammary gland, mouth, muscle, ovary, pancreas, placenta, prostate, salivary gland, skin, spleen, stomach, testis, thymus, thyroid, trachea, umbilical cord and uterus. Additionally, the POLA2 protein as described above has been found to be expressed in numerous types of cancers. For example, cancers in which the POLA2 protein as described may be expressed include but are not limited to lung cancer, adrenal cancer, bladder carcinoma, breast (mammary gland) cancer, cervical cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, germ cell cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, lymphoma, skin cancer, soft tissue/muscle tissue cancer and uterine cancer. Thus, the presence or absence of SNPs and the encoded protein in cancer tissues may influence the pathogenesis of the cancer or impact upon the efficacy of any anti-cancer treatment regimens being undertaken by cancer patients.

[0022] An extensive search of publications and genome databases on genes and SNPs associated with lung cancer was carried out to identify potentially relevant genetic variations for further assessment. Based on this study a cohort of genes and SNPs were identified as potentially relevant to the susceptibility and risk of lung cancer patients to their survival. SNPs are identified herein using the rs identifier numbers in accordance with the National Center for Biotechnology Information (NCBI) dbSNP database.

[0023] It was possible to identify variant loci of genes encoding proteins involved in lung cancer. It may be of interest to identify variant loci of genes encoding proteins involved in the transport, metabolism and activity of agents used in lung cancer treatment. Examples of public genome database that can be used may comprise but are not limited to Genecards, NCBI and pharmGKB.

[0024] In one example, the gene variant loci selected for analysis may be carefully chosen but not limited to the following parameters: i) analysis of published results, ii) encoding of a non-synonymous change (that is, encoding for a protein with a sequence that differ from that of the wild-type protein, resulting in a different localization, structure, activity or function), iii) presence in a coding and non-coding region and iv) a reported allele frequency of greater than about 5%.

[0025] If the gene variant loci is present in a coding region, the protein function and activity may have a greater probability of being altered (that is, by "altered"' it is meant that the protein function, level and activity in may be different from these observed in a protein having the same identifier but encoded by a gene where the variant loci is not present);

whereas if present in the non-coding region, the transcription (and thus the level of protein) may be affected (increased or decreased) if the variant gene loci is present in the cis -or trans - regulatory region of the gene or the gene splicing may be affected if the variant gene loci is present in an intron.

[0026] In the present invention, SNPs of interest identified to be associated with lung cancer and survival of lung cancer patients include, but are not limited to those found in the respective genes of cytidine deaminase (CD A), deoxycytidine kinase (DCK), deoxycytidylate deaminase (DCTD), DNA polymerase alpha subunit B (POLA2), ribonucleotide reductase

(RRM1, RRM2), nucleoside transporter family genes (S28A1, S28A2, S28A3) and thymidylate synthase (TYMS).The SNPs include but are not limited to a variant at the gene loci of CDA+79, CDA+208, CDA+435, DCK(+3122), DCK +36791, DCTD+315, POLA2+1747, RRMl(-756), RRMl(-269), S28A1+419, S28A1+565, S28A1+709, S28A1+1368, S28A1+1528, S28A1+1561, S28A2+65, S28A2+225, S28A3+338, TYMS(- 100), TYMS(-58), TYMS(+15705), as represented in Table 1 below.

Locus SNP ID (rsID) Genomic sequence surrounding the SNP (±25 base pairs)

CDA +79 rs2072671 TGCTGGTTTGCTCCCAGGAGGCCAAG[A/C]AGTCAGCCTACT

GCCCCTACAGTCA

CDA +208 rs60369023 CGCTGGGCATCTGTGCTGAACGGACC[A/G]CTATCCAGAAGG

CCGTCTCAGAAGG

CDA +435 rsl 048977 TTTGGGCCTG AGG ACCTGC AG AAGAC [C/T] C AGTGAC AGCC A

GAGAATGCCCACT

DCK +3122 rs3775289 GGGAGCTAGAAAATAAGCTA[G/A]TTAATAAATTAATT

TTCTAT

DCK +36791 rsl 803484 TTGGTATAAATTAATTTGTTAATTAA[A/G]TATTTCTTA

AGTATAAACCTTATGA

DCTD +315 ss44552974 GATGTGAAAGGCTGTAGTATGTATGT[A/C/G/T]GCCTTG

TTCCCTTGTAATGAATGCG

POLA2 +1747 rs487989 TCTACCTTAGGAGGCCGGCAGCGGAC[A/G]GGGCAGAG

AGGCAGAGCCCATGCAT RRM1 -756 rsl 1030918 GGTACTGACCCTGCCCTGCTTAAAAT[C/T]CTCTCAGGG commonly reported CTCTGATTTGCGTCAG

as RRM1 -524

RRM1 -269 rsl2806698 TACACGTCGCCTGTCAGTCTGTGAAG[A/C]CTACCCCGG commonly reported GCGTGGGCCGCAGCGT

as RRM1 -37

S28A1 +419 rs2277576 AGCAGGCGGGGATGGCCCTGAGGCTT[-

/ A/ CTC/ G] AG AAACCTCCTC AGCTTTGGCCCC A

S28A1 +565 rs2290272 GGTGTCCTTCGCAGGAATCTGCGTGTTC[G/A]TCGCTCTCCTC

TTTGCCTGCTC

S28A1 +709 rs8187758 TTCATTGCGTTCGAGTGGCTGGGCGAG[C/A]AGATCCGGGTA

GGTATGTGGGGTCTGG

S28A1 +1368 rs2242048 CAGAAACGCACCTGGAAGCTGAGCCC[C/T]TGGATGTCCACC

ATGTCTCCCAGCC

S28A1 +1528 rs2242047 CCACTCCTCGGCCCCTGCCAGGCGGC[A/G]TTGCTTGTACTT

GGAGAGGTCTTGA

S28A1 +1561 rs2242046 ACTCACGGAGATCCACTGCTTCCTGT[C/T]GCCGACCCA

CTCCTCGGCCCCTGCC

S28A2 +65 rs61637002 CACAGTGGAGACTGGCACAGTGAACC[C/T]GGGGCTGG

AGCTCATGGTAATCACC

S28A2 +225 rs 060896 AGAAGTTTCTGCAAAACACACGCCAG[A/C]TTGTTCAA

GAAGATCCTGTTGGGCC

S28A3 +338 rsl0868138 TGTCTGTTTTTGCTTCCTGGACAGGTT[A/G]TCTGGTTATGGT

GATTTCGGCCTGTGTG

TYMS -100 rs34743033 AAAGGCGCGCGGAAGGGGTCCTGCCA[(CCGCGCCACT

TCGCCTGCCTCCGTCCCG)2/3/4]

GCCCGCCGCGCCATGCCTGTGGCCG

TYMS -58 rs2853542 CCTGCCTCCGTCCCGCCGCGCCACTT[C/G]GCCTGCCTC

CGTCCCGCCGCGCCAC

TYMS +15705 rs34489327 TGATGTAGAGTGTGGTTATGAACTTTf- /TTAAAG]ATAGTTGTTTTATATGTTGCTATAA

[0027] In one example, the SNPs are a variant at the gene loci of POLA2+1747,

S28A2+65, S28A2+225, RRM1-756, S28A3+338, or RRM1-269.

[0028] In one example, the SNP of POLA2+1747 refers to a nucleotide mutation of guanine to adenine (G > A) at position 1747, with a wild-type genotype of GG and variant genotype GA. Hereinafter also referred to as POLA2+1747=GG/GA.

[0029] In one example, the SNP of S28A2+65 refers to a nucleotide mutation of cytosine to thymine (C > T) at position 65, with a wild-type genotype of CC and variant genotype CT.

Hereinafter also referred to as S28A2+65=CC/CT.

[0030] In one example, the SNP of S28A2+225 refers to a nucleotide mutation of cytosine to adenine (C > A)at position 225, with a wild-type genotype of CC and a variant genotype of

CA. Hereinafter also referred to as S28A2+225=CC/CA. [0031] In one example, the SNP of RRM1-756 refers to a nucleotide mutation of thymine to cytosine (T >C) at position -756, with a wild-type genotype of TT and a variant genotype of TC. Hereinafter also referred to as RRM1 -756=TT/TC.

[0032] In one example, the SNP of RRM1-269 refers to a nucleotide mutation of cytosine to adenine (C > A) at position -269, with a wild-type genotype of CC and a variant genotype of C A. Hereinafter also referred to as RRM 1 -269=CC/C A.

[0033] In one example, the SNP of S28A3+338 refers to a nucleotide mutation of adenine to guanine (A > G) at position 338, with a wild-type genotype of AA and a variant genotype of AG. Hereinafter also referred to as S28A3+338=AA/AG.

[0034] In one example, genomic DNA may be isolated from samples obtained from the patients by techniques described in the art. The genomic DNA may be subsequently amplified by polymerase chain reaction (PCR) by using any methodology available in the art, thus providing amplified regions of interest of the genomic DNA. The primers used to amplify the DNA may be already known in the art, or designed using available software. The parameters, enzymes and reagents used to perform the PCR may be carefully chosen to ensure the integrity of DNA after amplification. The PCR products may be purified and isolated to allow their sequencing. Numerous molecular biology art describe methods, apparatus and reagents for purification of PCR products. Purified PCR products may be sequenced.

[0035] In one example, the PCR products may be sequenced by techniques described and well known in the art. Examples of available techniques and methods for sequencing of PCR products may include subcloning and sequencing or direct sequencing of the PCR product using methods well known to the skilled person in the art. For example, pyrosequencing may be used to directly sequence purified PCR products.

[0036] Based upon statistical analysis of the above identified SNPs and clinical data from lung cancer patients, certain SNP genotypes and combinations of SNP genotypes were identified as relevant indicators of a patient's likely survival. In particular, the above SNPs of POLA2+1747, S28A2+65, S28A2+225, RRM1-756, S28A3+338, or RRM1-269 were all identified as relevant to determining the survival of a lung cancer patient, as shown in Table 1 of the present disclosure.

[0037] Therefore, in one example the present invention is a method of making a prognosis as to whether a patient having or at risk of developing cancer is likely to survive a cancer, wherein the method comprises determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from the patient, wherein the at least one SNP is selected from the group consisting of POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756-TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868l38), and RRM1-269=CC/CA (rsl2806698).

[0038] In one example the cancer includes but is not limited to lung cancer, adrenal cancer, bladder carcinoma, breast (mammary gland) cancer, cervical cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, germ cell cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, lymphoma, skin cancer, soft tissue/muscle tissue cancer or uterine cancer.

[0039] The term "lung cancer" refers to small cell lung cancer (SCLC) or non-small cell lung cancer (NSCLC). The non-small cell lung cancer may be further defined as any of the three subtypes of adenocarcinoma, large-cell carcinoma and squamous-cell carcinoma. Accordingly, in one example the method further defines that the lung cancer is non-small cell lung cancer.

[0040] The term, "prognostic" or "prognosis" in the context of the present invention refers to predicting the probable course and outcome of lung cancer or the likelihood of recovery from lung cancer. The prognosis can include the presence, likely survival, or the aggressiveness of the disease in relation to the stage of pathogenesis of the lung cancer. It is to be noted that the result of the methods claimed herein does not forestall the decision of the physician regarding his or her final assessment of the patient's situation and survival chance as this might be influenced by many other factors. The methods of the present invention can aid the physician in making a decision.

[0041] The term "survival" refers to a prolongation of life expectancy of the patient and the mortality of patients relating to death or the susceptibility to death. This can refer to the length of time during and after treatment that the cancer does not grow, and includes the amount of time patients have experienced a complete response or a partial response, as well as the amount of time patients have experienced stable disease.

[0042] The term "presence" refers to the variant genotype of the SNP being present in the patient sample, and the term "absence" refers to the wild-type genotype of the SNP being present. [0043] The term "sample" refers to a biological sample from a patient that may include a single cell or multiple cells or fragments of cells or an aliquot of body fluid, taken from the subject, by means including venipuncture, excretion, ejaculation, massage, biopsy, needle aspirate, lavage sample, scraping (buccal), surgical incision or intervention or other means known in the art.

[0044] The phrase "at risk of developing" in the context of cancer refers to the possible presence or absence of genetic or environmental factors that are known to correlate with an increase or decrease in susceptibility to cancer of a patient.

[0045] Any combination of the identified SNPs determined present or absent may be used in making a prognosis of a cancer patient's likely chance of survival. However, as demonstrated in the examples disclosed herein the association of all SNPs with survival of lung cancer patients revealed that POLA2+1747=GG/GA (rs487989) was significantly associated with survival of lung cancer patients in comparison to other identified SNPs. As shown in Figure 1, patients . with the GA variant of POLA2+1747 were shown to have a prolonged life expectancy in comparison to a patient with the wild-type GG genotype. Further, the differential impact of the POLA2+1747 genotype on a patient's chance of survival is further highlighted by a survivability analysis, that illustrates the significantly higher probability of death for a lung cancer patient with wild-type GG genotype (89.19%) as opposed to a lung cancer patient with the GA variant of POLA2+1747. These results suggesting POLA2+1747=GG/GA (rs487989) as a potentially important prognostic marker of a patient's survival of lung cancer.

[0046] In view of these findings and in an attempt to understand the possible underlying mechanism of the SNP and reason for its impact on a patient's chance of survival, the subcellular localization of the encoded protein of DNA polymerase alpha subunit B was investigated. As shown by wet-lab and confocal microscopic studies, in relation to POLA2+1747=GG/GA (rs487989), the presence or absence of the SNP was shown to alter the subcellular localization of the encoded protein of DNA polymerase alpha subunit B. Without being bound by theory, it is deduced that this localization is likely to affect the regulatory activity of the encoded protein of DNA polymerase alpha subunit B and induce better survival of lung cancer patients. It is suggested that this change in localization results in the inhibition of the lung cancers proliferation and ultimately lung cancer cell death. [0047] As a result of these findings, further statistical analysis was carried out based upon POLA2+1747=GG/GA (rs487989) in combination with each of the remaining SNPs as indicators of the survival time of lung cancer patients. It was observed that a combination of POLA2+1747=GG/GA with either of S28A2+65=CC/CT (rs61637002) or S28A2+225=CC/CA^■ (rs 1060896) resulted in a statistically significant association with the survival of lung cancer patients, and highlighted their potential use as indicators of the survival of lung cancer patients.

[0048] Accordingly, a further example of the above method includes determining the presence or absence of at least one single nucleotide polymorphism (SNP) comprising POLA2+1747=GG/GA (rs487989). In one example of the above method, the at least one single nucleotide polymorphism (SNP) comprises POLA2+1747=GG/GA (rs487989). In a further example, the SNP is the variant genotype of POLA2+1747= GA or the SNP is the wild-type genotype of POLA2+ 1747= G A.

[0049] In another example, the method further includes determining the presence or absence of at least one single nucleotide polymorphism (SNP) comprising POLA2+1747=GG/GA (rs487989) and S28A2+65=CC/CT (rs61637002) or S28A2+225=CC/CA (rsl 060896).

[0050] As indicated above, the SNPs referred to herein have been identified based partly upon the statistical analysis of clinical data obtained from a cohort of lung cancer patients. As defined in the examples disclosed herein the cohort of patients was undergoing chemotherapeutic treatment when the data was collated. In this regard, it is suggested that the SNPs disclosed herein and their encoded proteins may influence the transport, activity and metabolism of chemotherapeutic agents and may affect the efficacy of treatment and influence a patient's response to the treatment and affect the prognosis of the patient's survival.

[0051] In one example, the method further includes the patient undergoing anti-cancer treatment that may include, but is not limited to any of chemotherapeutic treatment, surgical treatment, radiation therapy or a combination thereof.

[0052] A "chemotherapeutic treatment" refers to the administration to a patient of a chemotherapeutic drug, agent, compound or pharmaceutical that used for killing cancer cells. A "surgical treatment" refers to the act of surgery or surgical procedures that involve the use of operative manual and instrumental techniques on a patient to investigate and/or treat a pathological condition such as disease or injury. A "radiation treatment" in the context of cancer refers to the use of high-energy radiation such as ionizing radiation to shrink tumors and kill cancer cells.

[0053] In another example, the method can include, but is not limited to the patient undergoing chemotherapeutic treatment with an antimetabolite, platinum complex, spindle poison, DNA crosslinking drug and alkylating agent, bleomycin, antibiotic, and topoisomerase inhibitor. These chemotherapeutics treatments can be administered individually, or in combination with one another.

[0054] In one example of the above method, the patient is undergoing chemotherapeutic treatment with gemcitabine and the patient's lung cancer is NSCLC.

[0055] An intention of the present invention is to improve the effective treatment management of cancer patients. As previously mentioned the SNPs disclosed herein may influence the transport, metabolism and activity of chemotherapeutic treatment administered to a patient and thus influence the efficacy of the treatment and survival of a cancer patient. Accordingly, another example of the present invention refers to a method for predicting responsiveness to an anti-cancer treatment in a patient having or at risk of developing cancer, comprising determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from the patient, wherein the at least one SNP comprises POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl 637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918),

S28A3+338=AA/AG(rsl0868138), and RRM1-269=CC/CA (rsl2806698) and wherein the presence or absence of the at least one SNP is indicative of the responsiveness of the patient to the anti-cancer treatment.

[0056] The term "responsiveness" or being "responsive" to an anti-cancer treatment refers to a patient's clinical response to a treatment and can include a complete response with evaluable but non-measurable disease, where the tumor and all evidence of disease had disappeared. On the other hand, it can also mean a partial response that is anything less than a complete response. On the other hand, it can also mean a non-response where the tumor or evidence of disease has remained constant or has progressed.

[0057] In another example, the present invention refers to a method for determining susceptibility of a patient having or at risk of developing a cancer to an anti-cancer treatment, wherein the method comprises determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from a patient, wherein the at least one SNP comprises POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918),

S28A3+338=AA/AG(rsl0868138), and RRM1-269=CC/CA (rsl2806698).

[0058] The term "susceptibility" in the context of the present invention refers to a patient's ability to be responsive to anti-cancer treatment, and relates to the presence or absence of a SNP.

[0059] It is established that all drugs exhibit intersubject pharmacokinetics and pharmacodynamics variability; that is different populations around the world may handle drugs differently. The factors influencing drug metabolism and mechanism of action may be intrinsic and/or extrinsic. Intrinsic factors in a patient's population may include but are not limited to age, gender, body weight, genetic factors such as polymorphism, presence of diseases influencing the absorption, distribution, metabolism and elimination of the drugs and ethnicity and/or race. Extrinsic factors in a patient's population may include but are not limited to diet, medical practice, life style, tobacco use, alcohol use, concomitant medication and environment. To improve treatment of patients having disorders or diseases such as cancer it is important to identify the factors influencing the efficacy of a drug in a patient's population.

[0060] In one example of the above methods, the cancer includes but is not limited to lung cancer, adrenal cancer, bladder carcinoma, breast (mammary gland) cancer, cervical cancer, colorectal cancer, esophageal cancer, gastrointestinal cancer, germ cell cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, lymphoma, skin cancer, soft tissue/muscle tissue cancer and uterine cancer. In another example the cancer is lung cancer such as non- small cell lung cancer. In another example of the above methods, the anti-cancer treatment is a chemotherapeutic treatment using gemcitabine.

[0061] The present invention also indicates towards the association of the identified SNP genotypes with the survival of lung cancer patients of differing ethnic descents. The term "ethnic" as used herein relates to large groups of people classed according to common racial, national, tribal, religious, linguistic, or cultural origin or background. The term "race" is a term that was once commonly used in physical anthropology to denote a division of humankind possessing traits that are transmissible by descent and sufficient to characterize it as a distinct human type. Ethnic factors are used by the International Conference on Harmonization in a document (ICH E5: Ethnic Factors in the Acceptability of Foreign Clinical Data) that makes recommendations for strategies to permit clinical data collected in one region to be used to support drug and biologic registrations in another region while allowing for the influence of ethnic factors. In this document, ethnic populations are classified as Asian, Black and Caucasian.

[0062] For example, in its draft guideline recommendations, the Federal Drug Administration (FDA) requires an analysis of data according, inter alia, to demographic subgroups (age, gender, race). For ethnicity, the FDA recommends Hispanic or Latino and not Hispanic or Latino as the minimum choice to be offered to trial participants. For race, the minimum choices are American Indian or Alaska Native, Asian, Black or African American, Native Hawaiian or Other Pacific Islander and White.

[0063] The likely chance of survival between individuals of differing ethnic populations is considered, where the differences in the distribution of genotypes may be associated with the efficacy of the treatment being administered to the patient. In the examples disclosed herein the clinical data and statistical analysis was based upon a cohort of lung cancer patient's that were of Asian descent, such as Chinese descent. Accordingly, it is suggested that the use of the SNP of POLA2+1747=GG/GA (rs487989) as a prognostic marker and indicator of a patient's responsiveness to treatment may also be an important prognostic marker of lung cancer within Asian populations. Nevertheless, in one example the SNP of POLA2+1747=GG/GA (rs487989) is also found in African and Caucasian populations and can also be used as a prognostic marker in these populations.

[0064] Accordingly, one further example of the above methods includes the patient being a mammal or a human. The human can be further defined by ethnic descent to include but not limited to Caucasian, African or Asian. In one example the patient is of Asian descent, such as Chinese descent. An individual of Caucasian descent refers to people who have ancestors from the geographic region of Northern, Eastern, or Central Europe. Generally the individuals are from regions including, but not limited to, North America, England, Russia, and Germany, and preferably, at least one ancestor is from Northern, Eastern, or Central Europe. An individual of African descent refers to people who have ancestors from the geographic region of the African continent. An individual of Asian descent refers to people who have ancestors from the geographic region of the Asian continent including but not limited to China, Japan, Malaysia, India, Indonesia, Vietnam, Laos, Cambodia, Myanmar Brunei, Philippines, Papua New Guinea, Timor and Singapore. Preferably, at least one ancestor is from the Asian continent.

[0065] The present invention further provides prognostic kits for identifying the presence or absence of the at least one SNPs. In one example the kit comprises at least one reagent to determine the presence or absence in a sample of at least one single nucleotide polymorphism (SNP)selected from the group consisting of POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868138), and RRM1-269=CC/CA (rsl2806698) and instructions for use.

[0066] In one example, the kit may further include but is not limited to probes or primers for detecting the genotypes of the SNPs and amplification of a sequence comprising the at least one SNP which allows the determination of the genotype defined by the SNPs. The reagents can be defined as those necessary to isolate a nucleic acid from a sample and detect the presence or absence of at least one SNP.

[0067] The term "primer" refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products.

[0068] The term "probe" refers to an oligonucleotide (i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantly or by PCR amplification, which is capable of hybridizing to another oligonucleotide of interest. A probe may be single-stranded or double-stranded. It is contemplated that any probe used in the present invention will be labeled with any "reporter molecule," so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present disclosure be limited to any particular detection system or label. [0069] The term "increased" in the context of a patient's chance of survival refers to the increased prolongation of life expectancy relative to the presence or absence of an SNP. The term "decreased" in the context of a patient's chance of survival refers to the maintenance or reduce life expectancy relative to the presence or absence of an SNP.

[0070] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.

[0071] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.

[0072] Other embodiments are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.

EXAMPLES

[0073] EXAMPLE 1

[0074] In order to examine the associations between SNP genotypes and the survival of lung cancer patients, in addition to the responsiveness to anti-cancer treatments, in one example a statistical approach was adopted based upon clinical data and using a number of established biostatistic analysis tools. The following example is merely a representative embodiment of the present invention and in not intended to be limiting in any way.

[0075] Association of genotypes and the survival of NSCLC patients after

gemcitabine therapy

[0076] An extensive search of publications and genome databases (e.g. Genecards, GenBank and pharmGKB) on sequence variants and SNPs in genes encoding proteins involved in pathways of gemcitabine transport, metabolism and activity identified 21 SNPs that qualified for analysis. The 21 SNPs identified were CDA+79, CDA+208, CDA+435, DCK (+3122), DCTD+315, POLA2+1747, RRM1 (-756), RRM1 (-269), S28A1+419, S28A1+565, S28A1+709, S28A1+1368, S28A1+1528, S28A1+1561, S28A2+65, S28A2+225, S28A3+338, TYMS (-100), TYMS (-58), TYMS (+15705).

[0077] The frequency of the qualifying variants was characterized by pyrosequencing, from the germline DNA of 94 Asian donors and 53 NSCLC patients who were receiving gemcitabine drug treatment. The NSCLC patients who were newly diagnosed were treated with gemcitabine at 750-1 OOOmg/m on days 1 and 8. Blood collection and DNA extraction was carried out followed by search for gene variant loci of genes encoding involved in Gemcitabine transport, metabolism and activity in NCBI database. PCR and pyrosequencing was performed later, followed by the statistical analyses.

[0078] Pyrosequencing of samples from 53 Chinese NSCLC patients enabled frequency genotyping of all 21 SNPs. The association between each of the SNPs and survival rate and responsiveness to gemcitabine treatment for each NSCLC patient was assessed. The association of all SNPs with mortality was ranked based on their p-value by performing fisher's exact probability test between genotypes. Table 2shows the p-value of 5 SNPs where POLA2+1747 variant genotype G>A (rs487989) is the most significant SNP among 21 SNPs (p=0.0447).

Table 2. Association between the 21 SNP genotypes and mortality of 53 NSCLC patients receiving gemcitabine, based on the corresponding P value. Fisher's exact probability test and chi-squared test are used. Only the top 5 ranked SNP genotypes are shown. [0079] Using the conditional probability test, we further studied the effects of this POLA2+1747variant genotype on the mortality of patients. We found that the probability of death for patients with wild-type GG genotype is significantly higher (89.19%) than those with the GA variant genotype (50%).

[0080] To support the importance of POLA2+1747, the SNP-SNP interactions between POLA2+1747 and the remaining 20 SNPs were analyzed in their effect on the survival time of NSCLC patients. 20 SNP-SNP interaction pairs were formulated with POLA2+1747 and the remaining 20 SNPs. The log-rank test was then employed to investigate the association of the 20 SNP-SNP interaction pairs and patients' survival time. The 20 SNP-SNP interaction pairs were ranked based on their p-values. 5 ranked pairs are shown in Table 3. Among them, statistically significant differences on survival time were observed in POLA2+1747&S28A2+65 (p=0.0004) and POLA2+1747&S28A2+225 (p=0.0010).

Table 3. Association between POLA2+1747=GG/GA interaction pairs and the overall survival time of 43 NSCLC patients receiving gemcitabine, based on the corresponding p-value. Log-rank test and chi- squared test are used. Only the top 5 ranked genotype interaction pairs are shown.

[0081] A Kaplan Meier Plot of the SNP pair POLA2+1747&S28A2+65 is illustrated in Figure 1(a). We observed that: when S28A2+65=CC, there is a statistically significant difference in overall survival time between the POLA2+1747=GA group and the POLA2+1747=GG group. The median survial time for both groups are 13.18 months and 7.39 months respectively. Figure 1(b) illustrates the Kaplan Meier Plot of the SNP pair POLA2+1747 & S28A2+225. We also observed that: when S28A2+225 = CC, there is a statistically significant difference in overall survival time between the POLA2+1747=GA group and the POLA2+1747=GG group. The median survial time for both groups are 13.17 months and 7.39 months respectively.

[0082] These results confirmed the finding that genotyp variants of SNPs may be associated with mortality and survival time of lung cancer patients. This is exemplified by the above results in relation to POLA2+1747=GA variants, that were found to exhibit a tendancy to survive longer than their GG counterparts.Further, these results indicates that the non- synonymous SNPs, such as POLA2+1747=GA are an important interactor associated with increased survival time. [0083] EXAMPLE 2

[0084] Subcellular localization of wild type POLA2 and mutant POLA2 proteins

[0085] Subcellular localization of proteins can help elucidate functional changes between wild type and mutant genotypes. As a basic study, it is experimentally shown that a point mutation introduced into a gene locus can be functionally significant in leading to a change in cell localization that is likely to affect regulatory activity and induces better survival in lung cancer patients.

[0086] For the purpose of demonstrating the above and to validate the results shown in Example 1 the subcellular localization of wild type POLA2 and mutant POLA2 proteins was investigated.

[0087] POLA2+1747=GG/GA SNP encodes for a glycine to arginine amino acid change (G583R) in the mutated POLA2 protein (POLA2 G583R). To study the subcellular distribution of the mutant and wild type DNA polymerase alpha subunit B, GFP fusion proteins were constructed and transfected HEK 293 cells.

[0088] Untransfected HEK 293 cells were used as mock control to check the efficiency of the transfection reagent or other nonspecific effects. HEK 293 cells transfected with empty pEGFP-N3 vector were used to check the localization of GFP fusion proteins. To ensure that these proteins were successfully expressed in HEK 293 cells after transfection, we developed western blots containing HEK 293 cell lysate proteins and immunostained the blots with Mouse anti-GFP, followed by Goat anti mouse IgG-HRP. No protein band is observed for untransfected HEK 293 cells. Protein band size of about 27 kDa is observed for GFP control. On the other hand, the lanes for GFP constructs containing mutant POLA2 G583R and wild type POLA2 show us the expected protein band size of about 97 kDa each (27 kDa for GFP vector alone plus 70 kDa for the mutant and wild type DNA polymerase alpha subunit B).This indicates that the proteins are successfully expressed in the transfected cells.

[0089] Wet-lab and confocal microscopic studies showed a differential subcellular localization of the GFP-tagged POLA2 wild type and mutant G583R proteins. As a basic study, we experimentally showed that this point mutation is functionally significant, leading to a change in localization that is likely to affect regulatory activity and induces better survival in NSCLC patients treated with gemcitabine.

[0090] The subcellular localization of the mutant and wild type DNA polymerase alpha subunit B was studied with microscopy. Untransfected HEK 293 cells show no green fluorescence from GFP. For the pEGFP-N3 control, the green fluorescence protein is predominantly localized in the cytoplasm.

[0091] It was found that wild type DNA polymerase alpha subunit B is localized in the nucleus (DAPI-stained), whereas, the DNA polymerase alpha subunit B mutant (POLA2 G583R) is predominantly localized in the cytoplasm.

[0092] In summary, the wild type POLA2 is known to facilitate nuclear DNA replication and is predominantly found in the nucleus, whereas the mutant POLA2 G583R protein is strongly associated with better survival in NSCLC patients is mainly localized in the cytoplasm. Thus, considering that DNA polymerase alpha subunit B is required for cell viability, the localizing in the cytoplasm, may result in inhibition of the nuclear DNA polymerase alpha activity. This supports the conclusion that the mutant POLA2 confers a protective effect in NSCLC patients who possess the POLA2+1747=GG/GA SNP genotype, as the tumour DNA could not replicate. This inhibits tumour cell proliferation, and ultimately results in tumour cell death. It has been established that the POLA2+1747=GG/GA is a genetic determinant of clinical outcomes in NSCLC patients.

[0093] EXPERIMENTAL METHODS [0094] Study Population

[0095] A study population consisted of 53 NSCLC Chinese patients receiving gemcitabine treatment were selected. The tumor response rate was 48.8% and the median overall survival and time to progression was 9.43 months and 5.5 months, respectively. 33 (76.7%) of the patients were male and the median age was 64 years (range 39-74 years). All patients were newly diagnosed cases and treated with first line gemcitabine. [0096] Blood Collection and genomic DNA extraction

[0097] From each subject, 8ml of peripheral blood was drawn into heparinised vacutainer tubes and mononuclear cells isolated by Ficoll-Hypaque density gradient centrifugation (GE Healthcare, Chalfont St. Giles, United Kingdom). DNA was extracted from the mononuclear cells using the purgene DNA purification Kit (Gentra Systems, Minneapolis, MN).

[0098] Polymerase Chain Reaction (PCR)

[0099] 50 ng DNA was amplified in a 25 μΐ reaction containing 1 x FastStart Reaction buffer, 2nM magnesium chloride, 10 μΜ deoxynucleotide mix and 1 unit FastStart Taq Polymerase (Roche Diagnostics Mannheim, Germany) and 5_M each of forward and reverse primers. Primer sequences are described in Table 1 and were obtained either from previous reportsor using PSQ Assay design software (Biotage AB, Uppsala, Sweden). PCR cycling comprised 4 min at 95°C, followed by 40 cycles of 30s at 95°C, 30s at the appropriate annealing temperature (Table 1) and lmin at 72°C, before conclusion with a 1 min incubation at 72°C in a Master Cycler (Eppendorf, Hamburg, Germany).

[00100] Pyrosequencing

[00101] PCR products were incubated with 3μ1 of streptavidin magnetic beads (Amersham Pharmacia Biotech, Uppsala, Sweden) and 1* binding buffer (lOmM Tris-HCl, 2M sodium chloride, ImM EDTA, 0.1% Tween 20) and thoroughly mixed for lOmin at 37°C. The product mix was then denatured by 5 s incubation in 0.2M sodium hydroxide solution and washed in annealing buffer (20mM Tris-acetate, 2mM magnesium acetate) for 10s. The single-stranded products were transferred to an annealing buffer containing 15 pmol of the sequencing primer and incubated for 2min at 80°C in a Hybaid Maxi 14 hybridizationoven (Thermo Electron, USA). Pyrosequencing was then performed on a PSQ96MA pyrosequencer instrument (Biotage AB, Uppsala, Sweden) with optimized nucleotide dispensation orders. [00102] BIOSTATIC ANALYSIS [00103] Biostatistics [00104] Fisher's exact probability test was used to assess the relationship between each of the 21 SNPs and the mortality of the 43 NSCLC patients based on the p- values between genotypes. Conditional probability of death given a genotype of a SNP was used to characterize the differential effects on mortality. Chi-squared test was employed to confirm the significance (P value) of the difference between genotypes. Differences were considered statistically significant when the P value was less than 0.05. All statistical tests were two- sided. Kaplan-Meier method and log-rank test were used to compare overall survival time for interaction pairs. SPSS software version 14.0 (SPSS Inc., Chicago, IL) was used. [00105] Fischer exact probability test

[00106] A statistical test well known in the field of medical research. It tests the independence of rows and columns in a 2 X 2 contingency table (with 2 horizontal rows crossing 2 vertical columns creating 4 places for data) based on the exact sampling distribution of the observed frequencies.

[00107] The Fisher exact test for 2 x 2 tables is used when members of two independent groups can fall into one of two mutually exclusive categories. The test is used to determine whether the proportions of those falling into each category differ by group. Fisher's exact test returns exact one-tailed and two-tailed p- values for a given frequency table.

[00108] The probability of observing a given set of frequencies A, B, C, and D in a 2 x 2 contingency table, given fixed row and column marginal totals and sample size TV, is:

[00109] Fisher's exact test computes the probability, given the observed marginal frequencies, of obtaining exactly the frequencies observed and any configuration more extreme, "more extreme," refers to any configuration (given observed marginals) with a smaller probability of occurrence in the same direction (one-tailed) or in both directions (two- tailed).

[001 10] Chi-Squared Test [00111] A well known statistical test that uses the chi-square statistic to test the fit between a theoretical frequency distribution and a frequency distribution of observed data for which each observation may fall into one of several classes.

[00112] The formula for calculating chi-square (X²) is :X²= (o-ef/e

That is, chi-square is the sum of the squared difference between observed (ø) and the expected (e) data (or the deviation, d), divided by the expected data in all possible categories.

[00113] Kaplan-Meier method

[00114] Kaplan-Meier method is used for survival analysis. It enables to calculate the incidence rate of events by using information for all subjects at risk for a particular event (in this case NSCLC). The graph/plot in Figure 1 shows the difference in mortality/survivability between the 2 groups of patients with and without the SNP.

[00115] Logrank test

[00116] The logrank test is used to test the null hypothesis that there is no difference between the populations in the probability of an event (in this case death) at any time point. This analysis is based on the times of events (death) and for each such time the observed number of deaths in each group and number expected if there were in reality no difference between the groups, is calculated.

[00117] WET LAB PROCEDURES

[00118] Isolation of total RNA from HEK 293 cell culture

[00119] HEK 293 cells were lysed directly in a 10 cm culture dish using TRIZOL® Reagent (Invitrogen, Carlsbad, CA, USA). Total RNA was isolated and used for further experiments only if the RNA was found intact by running on 1% denaturing agarose gel.

[00120] Reverse transcription of total RNA and POLA2 gene amplification by PCR

[00121] Using Superscript™ III One-Step RT-PCR System with Platinum® Taq High Fidelity (Invitrogen), total RNA was reverse transcribed into complimentary DNA (cDNA), followed by amplification of the wild type POLA2 using forward primer with Kpnl restriction site; 5' -AAGGTACCATGTCCGCATCCGCCCAGCA- 3' and reverse primer with BamHl restriction site; 5' -AAGGATCCGATCCTGACGACCTGCACAGCA- 3' . Amplicon size was verified by running the PCR product and GeneRuler™ 100 base pairs DNA ladder on 0.8% agarose gel. [00122] Cloning of POLA2 amplicon and sequence verification

[00123] The POLA2 amplicon was cloned into pGEM®-T easy vector (Promega, USA), and subsequently transformed into Escherichia coli DH5a bacteria. The plasmid DNA was extracted and purified using QIAprep Spin Miniprep Kit (QIAGEN, Germany). Next, the concentration and purity of plasmid DNA was measured usingNanoDrop (Thermo Fisher Scientific, USA). The resultant plasmid was digested with EcoRI and ran on 0.8% agarose gel to identify recombinant clones. Integrity of the wild type POLA2 constructs was verified by sequencing. Point mutation was introduced into POLA2 using the XL QuikChange Site- Directed Mutagenesis Kit, and POLA2+1747=GG/GA were verified by sequencing. Wild type POLA2 and POLA2+1747=GG/GA were then cloned into pEGFP-N3 (Clontech, USA) at Kpnl and BamHI restriction sites.

[00124] Cell culture and transfection

[00125] HEK 293 cells were grown in Dulbecco's modification of Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% PSG (penicillin/streptomycin/glutamine) on 6-well plate and maintained at 37°C and 5% C0₂. HEK 293 cells were transiently transfected using Lipofectamine 2000 (Invitrogen), following the manufacturer's protocol. After 5 hours of transfection with POLA2-GFP constructs in Opti-MEM® I Reduced Serum Medium (Cat. No. 31985-062), 30% FBS was added into each well, and incubated at 37°C and 5% C0₂ overnight. After 17-18 hours of transfection with POLA2-GFP constructs using Lipofectamine 2000 (Invitrogen), cells were lysed in IX cell lysis buffer from Matchmaker™Chemiluminescent Co-IP System (Clontech) with 25X complete EDTA free protease inhibitor (Roche, Germany) and 100X Phenylmethylsulfonyl fluoride (Sigma-Aldrich®, USA). [00126] Western blotting

[00127] Equivalent volumes (20 μΐ) of cell lysates were loaded onto 8% SDS-PAGE gels to resolve proteins. Then, proteins were transferred onto PVDF membrane and blocked using 5% non-fat dry milk for 1 hour to reduce non-specific binding and incubated overnight at 4°C with mouse anti-GFP (Roche) at 1 :2500 dilution in 0.5% non-fat dry milk followed by Goat anti mouse IgG-HRP (Santa Cruz Biotechnology, US) at 1 :10000 dilution in 0.5% non-fat dry milk for 1 hour at room temperature. Immunoblots were developed using Amersham™ ECL™ Prime Western Blotting Detection Reagent (GE healthcare, Sweden), following the manufacturer' s protocol .

[00128] Confocal laser scanning microscopic analysis

After 17-18 hours of transfection with the POLA2-GFP constructs using Lipofectamine 2000 (Invitrogen), HEK293 cells grown on glass cover slips were fixed with 2% paraformaldehyde in PBS at room temperature. Slides were blocked at room temperature for 1 hour with 5% BSA in 0.1% Triton/PBS and then immunostained with mouse anti-GFP (Roche) at 1 :100 dilution followed by the Alexa Fluor 488 donkey anti-mouselgG (Invitrogen, Molecular Probes) (1 :2000 dilution) at room temperature for an hour. Images were captured with Zeiss LSM Meta confocal inverted microscope with a magnification of 63 x .

Claims

Claims

A method of making a prognosis as to whether a patient having or at risk of developing cancer is likely to survive a cancer, wherein the method comprises determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from the patient, wherein the at least one SNP is selected from the group consisting of POLA2+1747=GG/GA (rs487989), S28A2+65= C/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868138), and RRM1-269=CC/CA (rsl2806698).

The method according to claim 1, wherein the cancer is selected from the group consisting of a lung cancer, an adrenal cancer, a bladder carcinoma, a breast (mammary gland) cancer, a cervical cancer, a colorectal cancer, an esophageal cancer, a gastrointestinal cancer, a germ cell cancer, a head and neck cancer, a kidney cancer, a leukemia, a liver cancer, a lymphoma, a skin cancer, a soft tissue/muscle tissue cancer and an uterine cancer.

The method according to claim 2, wherein the lung cancer is a small cell lung cancer or a non-small cell lung cancer.

The method according to claim 1, wherein the patient suffers from cancer or wherein the patient suffers from cancer and undergoes anti-cancer treatment.

The method according to claim 1, wherein the patient is undergoing anti-cancer treatment.

The method according to claim 5, wherein the anti-cancer treatment is selected from the group consisting of a chemotherapeutic treatment, a surgical treatment, a treatment with radiation therapy or any combination thereof.

The method according to claim 6, wherein the chemotherapeutic treatment comprises treatment with an antimetabolite, platinum complex, spindle poison, DNA crosslinking drug and alkylating agent, bleomycin, antibiotic, and topoisomerase inhibitor or combinations thereof.

8. The method according to claim 7, wherein the antimetabolite is gemcitabine.

9. The method according to claim 1, wherein the patient is a mammal or a human.

10. The method according claim 9, wherein the human is an ethnic Asian, or an ethnic Caucasian, or an ethnic African.

11. The method according to claim 10, wherein the human is an ethnic Asian.

12. The method according to claim 1, wherein the single nucleotide polymorphism (SNP) is POLA2+1747=GG/GA (rs487989).

13. The method according to claim 1, wherein the presence of the at least one SNP indicates an increased chance of survival.

14. The method according to claim 13 , wherein the SNP is POLA2+ 1747= G A

15. The method according to claim 1, wherein the presence of the at least one SNP indicates a decreased chance of survival.

16. The method according to claim 15, wherein the SNP is POLA2+1747=GG

17. The method according to claim 1, wherein the presence of POLA2+1747=GA indicates an increased chance of survival for a patient suffering from lung cancer and undergoing anti-cancer treatment.

18. The method according to claim 1, wherein the presence of POLA2+1747=GG indicates a decreased chance of survival for a patient suffering from lung cancer and undergoing anti-cancer treatment.

19. A method for predicting responsiveness to an anti-cancer treatment in a patient having or at risk of developing cancer, comprising determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from the patient, wherein the at least one SNP comprises POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1- 756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868138), and RRM1- 269=CC/CA (rsl2806698) and wherein the presence or absence of the at least one SNP is indicative of the responsiveness of the patient to the anti-cancer treatment.

20. The method according to claim 19, wherein the single nucleotide polymorphism (SNP) is POLA2+1747=GG/GA (rs487989).

21. The method according to claim 19, wherein the presence of the at least one SNP indicates an increased chance of survival.

22. The method according to claim 21, wherein the SNP is POLA2+1747= GA

23. The method according to claim 19, wherein the presence of the at least one SNP indicates a decreased chance of survival.

24. The method according to claim 23, wherein the SNP is POLA2+1747=GG

25. The method according to claim 19, wherein the presence of POLA2+1747=GA indicates an increased responsiveness to the treatment and an increased chance of survival for a patient suffering from cancer.

26. The method according to claim 19, wherein the presence of POLA2+1747=GG indicates a decreased responsiveness to the treatment and a decreased chance of survival for a patient suffering from cancer.

27. The method according to claim 19, wherein the cancer is selected from the group consisting of a lung cancer, an adrenal cancer, a bladder carcinoma, a breast (mammary gland) cancer, a cervical cancer, a colorectal cancer, an esophageal cancer, a gastrointestinal cancer, a germ cell cancer, a head and neck cancer, a kidney cancer, a leukemia, a liver cancer, a lymphoma, a skin cancer, a soft tissue/muscle tissue cancer and an uterine cancer.

28. The method according to claim 19, wherein the lung cancer is a small cell lung cancer or a non-small cell lung cancer. The method according to claim 19, wherein determining the presence or absence of at least one single nucleotide polymorphism (SNP), comprises:

isolating a nucleic acid from the sample;

selecting at least one primer and/or at least one probe for amplification of a sequence comprising the at least one SNP, or at least one primer and/or at least one probe for amplification of a sequence which allows the determination of the haplotype defined by the SNPs.

A method for determining susceptibility of a patient having or at risk of developing a cancer to an anti-cancer treatment, wherein the method comprises determining the presence or absence of at least one single nucleotide polymorphism (SNP) in a sample obtained from a patient, wherein the at least one SNP comprises POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl 0868138), and R M1-269=CC/CA (rsl2806698).

A kit comprising:

at least one reagent to determine the presence or absence in a sample of at least one single nucleotide polymorphism (SNP) selected from the group consisting of POLA2+1747=GG/GA (rs487989), S28A2+65=CC/CT (rsl637002), S28A2+225=CC/CA (rsl060896), RRM1-756=TT/TC (rsl 1030918), S28A3+338=AA/AG(rsl0868l38), and RRM1-269=CC/CA (rsl2806698).

The kit according to claim 31, wherein the at least one reagent comprises:

a reagent to isolate a nucleic acid from the sample; and

at least one primer and/or at least one probe for amplification of a sequence comprising the at least one SNP, or at least one primer and/or at least one probe for amplification of a sequence which allows the determination of the genotype defined by the SNPs.