WO2013144579A1 - Use of flagellin as a vaccine - Google Patents

Abstract

The present invention relates to the field of vaccines and in particular to the use of flagellin to protect against a fiagellin-producing or flagellin-devoid Y. ruckeri strains, in for example fish. The present invention provides products, uses and methods for vaccinating/immunising organisms, such as fish against pathogen infection.

Description

Use of Flagellin as a Vaccine

Field of the Invention

The present invention relates to the field of vaccines and in particular to the use of flagellin to protect against infection of V. ruckeri, in for example fish. The present invention provides products, uses and methods for vaccinating/immunising organisms, such as fish against Y. ruckeri infection.

Background to the invention

Resistance to infection in vertebrates relies on a complex interaction between two separate but complementary arms of the immune system: adaptive immunity and innate immunity. Adaptive immunity refers to the recognition of specific molecular epitopes by either T or B lymphocytes and the resulting responses that powerfully target only a very narrow range of infectious agents. In contrast, innate immunity involves multiple cell types and tissues and relies on more general recognition of molecular patterns that are specific to classes of microorganisms. Many bacteria possess flagella, which attach to a rotatory motor embedded in the bacterial cell wall, providing motility to the organism. The body of the flagellum consists of a mass of protofilaments, each of which is a long, end-to-end polymer of a single protein, flagellin. Flagellin has a relatively conserved structure even among widely diverse bacterial species. Flagellin was recognized decades ago to be highly immunogenic, although the tools with which to fully understand this property were not available at the time.

Hiyashi et al. (Nature, (2001 ), 410:1099-1 103) demonstrated that flagellin was the component of Listeria culture supernatants that activated TLR5, and subsequent work in many laboratories confirmed this finding for flagellins from various organisms. To date, flagellin is the only known activator of TLR5, and until recently flagellin-induced inflammation was believed to be fully dependent on TLR5 expression. Hynes et al., ( Vaccine, (201 1 ), 29, 7678 - 7687 teaches that an innate immune response is stimulated in Atlantic Salmon in response to administration of recombinant flagellin from Vibrio anguillarum . The authors propose that flagellin may be used as an vaccine adjuvant.

Summary of the Invention

The present invention is based on the isolation of the flagellin protein of Yersinia ruckeri and the observation that it can be used to raise an innate immune response in an organism, which protects the organism from subsequent challenge from bacteria which do not express flagellin on their surface, as well as from those which do.

Thus, in a first aspect, the present invention provides the flagellin protein of Yersinia ruckeri for use in raising an innate immune response in an organism. The protein may find particular application as a vaccine, which may protect against challenge from organisms which express the flagellin protein, as well as those which do not express the flagellin protein. The protein could also be used to obtain an immune serum for use in another organism.

Thus, the flagellin protein of the present invention may be cross-protective against species and/or strains of organism which express a flagellin protein, as well as species and/or strains of organism which do not express a flagellin protein.

The flagellin protein is encoded by a nucleotide sequence derived from Y. ruckeri. In a particularly preferred embodiment the protein comprises the sequence as shown in Figure 6. The protein consists of 424 amino acids and has an estimated molecular weight of about 43.55 KDa.

The present invention also provides an immunogenic analogue, fragment or modification of the polypeptide of Figures 7. An immunogenic analogue, fragment, or modification of said polypeptide is one that generates an innate immune response in an organism, especially fish, against V. ruckeri. Immunogenicity of an analogue, fragment or modified polypeptide can be evaluated by administering the particular molecule to an organism, such as a fish and then subsequently challenging the organism with pathogenic V. ruckeri, in order to see if the particular molecule is protective.

Immunogenic analogues of the polypeptide according to Figure 6 include polypeptides having amino acid substitutions that do not eliminate polypeptide immunogenicity in an organism, especially fish. Substitutes for an amino acid may be selected from other members of the class to which the amino acid belongs. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, praline, phenylalanine, tryptophan, and tyrosine. Polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine and glutamine. The positively charged (basic) amino acids include arginine, lysine and histidine. The negatively charged (acidic) amino acids include aspartic acid and glutamic acid. Examples of preferred conservative substitutions include Lys for Arg and vice versa to maintain a positive charge; Glu for Asp and vice versa to maintain a negative charge; Ser for Thr so that a free -OH is maintained; and Gin for Asn to maintain a free NH₂.

Fragments of said flagellin polypeptide of the invention include polypeptides containing deletions or additions of one or more contiguous or non-contiguous amino acids that do not eliminate the immunogenicity of the protein fragment in an organism, especially fish are also contemplated. Fragments of said polypeptide contain at least about 25 amino acids, up to about 50 - 75, 100- 150, or 200 - 300 amino acids.

A modified flagellin protein of the present invention includes proteins that are chemically and enzymatically derivatised at one or more constituent amino acids, including side chain modifications, backbone modifications, and N- and C-terminal modifications including acetylation, hydroxylation, methylation, amidation, phosphorylation and the attachment of carbohydrate or lipid moieties, cofactors, and the like.

The polypeptides of the present invention can be expressed from an appropriate nucleic acid molecule. The present invention therefore extends to a nucleic acid molecule capable of expressing the polypeptide, immunogenic analogue, fragment or modification thereof. The nucleic acid may comprise the sequence as shown in Figure 6 or an appropriate modification or fragment thereof.

The nucleic acid molecule of the invention can be DNA, RNA, or a combination thereof, and can include any combination of naturally occurring, chemically modified or enzymatically modified nucleotides. The nucleic acid molecule can be equivalent to a polynucleotide fragment encoding the flagellin protein from V. ruckeri defined hereinabove, or it can include said polynucleotide fragment in addition to one or more additional nucleotides or polynucleotides. For example, the nucleic acid molecule of the invention can be a vector, such as an expression or cloning vector.

A vector useful in the present invention can be circular or linear, single-stranded or double stranded, and can include DNA, RNA, or any modification or combination thereof. The vector can be a plasmid, a cosmid, or a viral vector, such as a bacteriophage. Preferably, the nucleic acid molecule of the invention takes the form of an expression vector that is capable of expression in an organism or in a cell of the organism, in culture or in vivo. An organism or cell in which the coding sequence of the vector can be expressed can be eukaryotic or prokaryotic, and can be, without limitation, a bacterium, a yeast, an insect, a protozoan, or animals, such as a fish or a mammal. Preferably, the vector is expressible in a fish and/or in a conventional protein expression system, including bacteria, such as E. coli, yeast, such as Pichia pastoris, mammalian cell culture or insect cells.

When the vector is intended for use in bacterial, yeast, mammalian or insect expression systems, the coding sequences of the vector may be engineered to utilise the conventional genetic code rather than the Y. ruckeri genetic code that is employed in the native Y. ruckeri coding sequences as described herein and the skilled addressee is well aware of how to optimise the codons for improving expression in a particular host organism.

It should be understood that the nucleic acid molecule of the invention can be single-stranded or double-stranded, and further that a single-stranded nucleic acid molecule of the invention includes a polynucleotide fragment having a nucleotide sequence that is complementary to a nucleotide sequence that encodes said flagellin protein or portion thereof according to the invention. As used herein, the term "complementary" refers to the ability of two single stranded polynucleotide fragments to base pair with each other.

Further, a single-stranded nucleic acid molecule of the invention also includes a polynucleotide fragment having a nucleotide sequence that is substantially complementary to a nucleotide sequence that encodes said flagellin protein or portion thereof according to the invention, or to the complement of the nucleotide sequence that encodes said flagellin protein or portion thereof. Substantially complementary polynucleotide fragments can include at least one base pair mismatch, such that at least one nucleotide present on a first polynucleotide fragment will not base pair to at least one nucleotide present on a second polynucleotide fragment, however the two polynucleotide fragments will still have the capacity to hybridize. The present invention therefore encompasses polynucleotide fragments which are substantially complementary. Two polynucleotide fragments are substantially complementary if they hybridize under hybridization conditions exemplified by 2xSSC (SSC: 150 mM NaCI, 15 mM trisodium citrate, pH 7.6) at 55°C. Substantially complementary polynucleotide fragments for purposes of the present invention preferably share at least about 85% nucleotide identity, preferably at least about 90%, 95% or 99% nucleotide identity. Locations and levels of nucleotide sequence identity between two nucleotide sequences can be readily determined using, for example, CLUSTALW multiple sequence alignment software.

The invention further includes a nucleic acid molecule comprising a polynucleotide fragment that hybridises to at least a portion of the complement of the sequences provided by Figure 6 under standard hybridisation conditions, provided that the polynucleotide fragment encodes a polypeptide comprising at least an immunogenic portion of the flagellin protein of the present invention. Standard hybridisation conditions are exemplified by 2xSSC (SSC: 150 mM NaCi, 15 mM trisodium citrate, pH 7.6) at 55°C.

The present invention further provides a vaccine for use in preventing or controlling disease in fish caused by Y. ruckeri. The vaccine may be a polypeptide or polynucleotide vaccine. Said polynucleotide vaccine comprises a polynucleotide fragment, preferably a DNA fragment, having a nucleotide sequence encoding an immunogenic polypeptide comprising at least an antigenic portion of the flagellin protein from Y. ruckeri as shown in Figure 6.

The polypeptide vaccine of the invention comprises the immunogenic protein having amino acid sequence shown in Figure 6, an immunogenic analogue, fragment, or modification of said protein. This type of vaccine is referred to herein as a "protein subunit vaccine" even if it contains the entire flagellin protein sequence. The flagellin protein or immunogenic analogue, fragment, or modification thereof for use in the protein subunit vaccine of the invention can be naturally occurring (i.e. isolated from Y. ruckeri) or recombinant. A protein subunit vaccine of the invention is conveniently administered to fish using bath immersion, ingestion, topical administration, or direct injection, preferably intraperitoneal or intramuscular injection. A protein subunit vaccine formulated for oral administration can contain the polypeptide encapsulated in for example, a biodegradable polymer as described hereinafter. In addition, the protein subunit vaccine can be administered to an animal via a live vector, such as recombinant Tetrahymena.

The invention further provides a method for immunising fish, especially salmonids, such as rainbow trout against Y. ruckeri by administering to the fish a protein subunit vaccine, polypeptide, or nucleic acid of the invention.

The amount of protein subunit vaccine to be administered to an animal depends on the type and size of animal, the condition being treated, and the nature of the protein, and can be readily determined by one of skill in the art. In fish, for example, if the protein subunit vaccine is to be injected, the amount per injection is preferably between about 0.1 pg and about 1000 pg per 10 g fish; more preferably it is between about 1 pg and about 100 μg per 10 g of fish. For administration by immersion, the concentration of the protein in the aquatic medium is preferably at least about 10 ng/mL; at most it is preferably about 50 pg/mL, preferably it is less than about 1 pg/mL. For oral administration the amount per dose is preferably between about 0.1 pg and about 100 pg per 10 g fish; more preferably it is between about 1 pg and about 10 pg per 10 g of fish. Conveniently, the protein subunit vaccine may include an adjuvant. Further, one or more boosters are preferably administered at time periods subsequent to the initial administration to create a higher level of immune response in the animal.

A polynucleotide vaccine optionally further comprises a promoter, such as the CMV promoter, operably linked to the coding sequence for the flagellin polypeptide or analogue, fragment or modification thereof (e.g., U.S. Pat. No. 5,780,44, Davis). The polynucleotide may be cloned within a vector such as a plasmid. There are numerous plasmids known to those of ordinary skill in the art useful for the production of polynucleotide vaccines.

Other possible additions to the polynucleotide vaccine constructs include nucleotide sequences encoding cytokines, such as granulocyte macrophage colony stimulating factor (GM-CSF), interleukin-12 (IL-12) and co-stimulatory molecules such B7-1 , B7-2, CD40. The cytokines can be used in various combinations to fine-tune the response of the animal's immune system, including both antibody and cytotoxic T lymphocyte responses, to bring out the specific level of response needed.

Plasmid DNA can also be delivered using attenuated bacteria as delivery system, a method that is suitable for DNA vaccines that are administered orally. Bacteria are transformed with an independently replicating plasmid, which becomes released into the host cell cytoplasm following the death of the attenuated bacterium in the host cell. An alternative approach to delivering the polynucleotide to an animal involves the use of a viral or bacterial vector. Examples of suitable viral vectors include adenovirus, po!io virus, pox viruses such as vaccinia, canary pox, and fowl pox, herpes viruses, including catfish herpes virus, adenovirus-associated vector, retroviruses and bacteriophage. Exemplary bacterial vectors include attenuated forms of Salmonella, Shigella, Edwardsiella ictaluri, and Yersinia ruckeri. Preferably, the polynucleotide is a vector, such as a plasmid, that is capable of autologous expression of the nucleotide sequence encoding said flagellin protein, analogue, fragment or modification thereof. In one embodiment, the vaccine is a DNA vaccine comprising a DNA fragment having a nucleotide sequence that encodes a polypeptide having amino acid sequences shown in Figure 6, an immunogenic analogue, fragment, or modified version thereof.

Polynucieotide-based immunisation induces an immune response to a polypeptide expressed in vivo from a heterologous polynucleotide fragment introduced into the fish. This method can be advantageous over other methods because heterologous nucleic acid expression may continue for a length of time sufficient to induce a relatively strong and sustained immune response without the need for subsequent "booster" vaccinations. A polynucleotide vaccine comprising a polynucleotide fragment having a nucleotide sequence encoding said flagellin protein can be administered to a fish using biolistic bombardment, bath immersion, ingestion or direct injection, as described for example, in U.S. Pat. No. 5,780,448 (Davis), preferably intraperitoneal or intramuscular injection. A preferred method of administration is biolistic bombardment, as with a "gene gun". A polynucleotide vaccine formulated for oral administration preferably contains DNA encapsulated in a biodegradable polymer. Examples of a suitable biodegradable polymer include chitosan and homo- or co-polyers of polylactic acid and polyglycolic acid. The invention thus further provides a method for immunising fish, such as salmonids against Y. ruckeri by administering to the fish a polynucleotide vaccine of the invention, preferably a DNA vaccine.

The amount of polynucleotide vaccine to be administered to an animal depends on the type and size of animal, the condition being treated, and the nature of the polynucleotide, and can be readily determined by one of skill in the art. In fish, for example, if the polynucleotide vaccine is to be injected, the amount per injection is preferably at least about 10 ng; at most it is preferably about 50 pg, more preferably it is less than about 1 pg. If the polynucleotide vaccine is to be administered using a gene gun, the amount per dose is preferably at least about 1 ng; at most it is preferably about 10 pg, more preferably it is less than about 1 pg. For administration by immersion, the concentration of the polynucleotide in the aquatic medium is preferably at least about 10 ng/mL; at most it is preferably about 50 pg/mL, preferably it is less than about 1 pg/mL. For oral administration the amount per dose is preferably at least about 10 pg; at most it is preferably about 10 pg, preferably less than about 1 pg. In some applications, one or more booster administrations of the vaccine at time periods subsequent to the initial administration are useful to create a higher level of immune response in the animal.

Advantageously organisms/fish that are actively immune following exposure of flagellin from one serotype may be cross-protected against heterologous strains. Thus, in one embodiment, the vaccine of the invention (whether in the form of a protein vaccine or a poiynucleotide vaccine) is monovalent, in that it is derived from a particular flagellin protein from a particular serotype of Y. ruckeri and effective to treat or prevent infection of the vaccinated species by that serotype. Preferably, the monovalent vaccine also prevents infection by other V. ruckeri biogroups, thus offering broad protection. For example, the present inventors have observed that immunisation of fish with the flagellin protein from Y. ruckeri is able to protect fish from infection of not just motile Y. ruckeri (i.e. bacteria which express the flagellin protein), but also non-motile Y. ruckeri, which do not express the flagellin protein. Thus, in a preferred aspect, the present invention provides products and methods of vaccinating organisms/fish against infection from motile (i.e. flagellin expressing) and non-motile (non-flagellin expressing) bacteria.

In another embodiment, the vaccine of the invention (whether in the form of a protein vaccine or a polynucleotide vaccine) is a combined vaccine or a multivalent vaccine that prevents infection by other Y. ruckeri of more than one serotype, and/or prevents infection by other pathogenic organisms, such as other bacteria, viruses, protozoa etc.

In one embodiment of the vaccine of the invention, the flagellin protein or an immunogenic portion, analogue or modified version thereof may be linked, for example, at its carboxy-terminus to a further component. The further component may serve to facilitate uptake of the flagellin protein or an immunogenic portion, analogue or modified version thereof, or enhance its immunoginicity/processing. For example, the flagellin protein or an immunogenic portion, analogue or modified version thereof may be linked to at least two molecules of the C3d component of complement, using molecular cloning techniques. Preferably, the flagellin protein or immunogenic portion, analogue or modified version thereof is linked to about three molecules of the C3d component of complement. The C3d molecule can be either homologous or heterologous with respect to the species to be vaccinated. Complement genes have been cloned and characterised in salmonids (J. Lambris et a!., J. Immunol. 151 :6123- 6134 (1993); J. Sunyer et al., Proc. Natl. Acad. Sci USA 93:8546-8551 (1996)). For vaccinations of fish, the flagellin protein or immunogenic portion, analogue or modified version thereof is preferably linked to a salmonid C3d, such as trout C3d or catfish C3d. In the case of a protein subunit vaccine, the recombinant protein may be conveniently expressed in bacteria, before being administered to fish. The receptor for C3d, namely CD21 , is expressed primarily on B cells and the follicular dendritic cells of lymphoid tissues. In the case of a polynucleotide vaccine, a plasmid encoding a fusion protein that incorporates the flagellin protein or immunogenic portion, analogue or modified version thereof, linked at its carboxy-terminus to at least two molecules of the C3d component is administered to the fish.

The immune-stimulating compositions of the invention may be optionally mixed with excipients or diluents that are pharmaceutically acceptable as carriers and compatible with the active component(s). The term "pharmaceutically acceptable carrier" refers to a carrier(s) that is "acceptable" in the sense of being compatible with the other ingredients of a composition and not deleterious to the recipient thereof. Suitable excipients are well known to the person skilled in the art. Examples include; water, saline (e.g. 0.85% sodium chloride; see Ph. Eur. monograph 2001 :0062), buffered saline, fish oil with an emulsifier (e.g. a lecithin, Bolec MT), inactivant (e.g. formaldehyde; see Ph. Eur. monograph 1997:0193), mineral oils, such as light mineral oils, alhydrogel, aluminium hydroxide. Where used herein, the term "oil adjuvant" to embraces both mineral oils and synthetic oils. A preferred adjuvant is Montanide ISA 71 1 (SeppicQuai D'Orsay, 75321 Paris, France) which is a manide oleate in an oil suspension. In addition, if desired, the immune-stimulating composition (including vaccine) may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the immune-stimulating composition.

Adjuvants used in immunization may include alum or a DNA molecule having unmethylated CpG dinucleotides therein (also referred to as CpG adjuvant). Oligonucleotides having unmethylated CpG dinucleotides have been shown to activate the immune system (A. Krieg, et al., "CpG motifs in Bacterial DNA Trigger Directed B Cell Activation" Nature 374:546-549 (1995)). Administration of a CpG adjuvant cloned into plasmid vectors would be simultaneous with the administration of a bacteriophage vaccine. Alternatively, CpG adjuvant sequences could be included in the genome of the phage vector itself.

Oligonucleotides having CpG motifs may be optionally modified at their phosphodiester linkages for stability purposes. Such modifications are well known by those of skili in the art. For example, phosphodiester bonds in an oligonucleotide may be replaced by phosphorothioate linkages.

The present invention also relates to methods for formulation of such proteins to render them suitable for administration by for example immersion or orally via incorporation into fish food. In one embodiment of the invention pertaining to formulation of the vaccine for the immersion vaccination of fish, the polypeptide or nucleic acids may be packaged within a micro-particulate delivery system, which may include, but is not limited to, latex beads, poly(lactide-co-glycolide) microspheres, atelocollagen "minipellets", bentonite, orporous apatite ceramics including hypoxyapatite (HA) and beta-tricalcium phosphate (TCP).

For example, for an immersion vaccine, an aqueous suspension is preferred. For an oral vaccine a fish oil and lecithin carrier system may be used. For an injection vaccine ontanide ISA71 1®, Speic at a ratio of 30:70 may be used.

A vaccine composition may be administered as a course of a number of discrete doses over a period of time. For example it may be administered over a period of around 2-21 days.

Vaccination may be repeated at daily, twice-weekly, weekly or monthly intervals. For example a boost vaccination may be administered after the initial dose. For example a boost may be administered at around 4-14 weeks after the vaccination. The initial vaccination and any boost may be carried out using the same or different modes of administration. For example, the initial may be by injection and the boost may be by oral administration. An example regime includes a first vaccination by injection, followed by a course of orally administered boost vaccine, or a booster prior to an expected outbreak. However, it will be appreciated that any suitable route of administration(s) and/or regime(s) may be employed.

In an example embodiment, the polypeptide or polynucleotide may be diluted to a suitable concentration in an enclosed tank containing water as used for the normal culturing of the relevant fish species and fish fry and the fish/fry are immersed in this solution for a period of, say, several hours. The fish may then be returned to their normal culturing conditions. With this practice the polypeptides/polynucleotides may enter the gills or digestive tract of the fish and subsequently induce an immune response.

In another embodiment, microparticles containing the polypeptides/polynucleotides are incorporated into a typical fish food preparation and fed to fish in place of ordinary feed. In this method the recombinant proteins will enter the digestive tract stimulating an immune response in systemic or gut-associated lymphoid tissues. This method has the advantage of being suitable for use in netted enclosures where sealed tanks are not available.

Other adjuvants, carriers etc., and modes of administration may be found by referring to Gudding et a! (1999) Veterinary Immunology and Immunopathology 72, 203-212.

Y. ruckeri is mainly a problem in salmonids and other fish in freshwater and seawater. It is most prominent in the farming of rainbow trout in freshwater but charr is also fairly sensitive to this disease. In some countries it is a common pathogen in the farming of salmonids and it has been detected in 20 wild species of fish both in freshwater and seawater. Therefore the species that can be vaccinated with the V. ruckeri vaccine is very diverse, and may include animals maintained in aquaculture systems, in public aquaria and by hobbyists.

The goal of vaccination against Y. ruckeri infection is to elicit an innate immune response, such that upon subsequent exposure to the bacteria an immune reaction against the bacteria occur resulting in protection against lethal infections.

The present invention further includes monoclonal or polyclonal antibodies, whether derived from fish, rodents, mammals, avians, or other organisms, that bind to the flagellin proteins described herein, including immunogenic analogues, fragments and modifications thereof. Production and isolation of monoclonal and polyclonal antibodies to a selected polypeptide sequence is routine in the art see for example "Basic methods in Antibody production and characterisation" Howard & Bethell, 2000, Taylor & Francis Ltd. Such antibodies may be used in diagnostic procedures, as well as for passive immunisation.

Sera from immune fish is known to confer passive immunity against both viral and bacterial pathogens when injected into non-immune fish (Hedrick et al. Trans. Amer, Fish Soc. 116: 277-281 (1987); Viele et al. J. Fish Biol. 17:379-386 (1980)) and thus, sera from animals immunised with a polypeptide or polynucleotide according to the present invention, may be of use.

Additionally, knowledge of the flagellin protein nucleotide and amino acid sequences set forth herein also opens up new possibilities for detecting, diagnosing and characterising Y. ruckeri in fish populations. For example, an oligonucleotide probe or primer based on a conserved region of the flagellin protein can be used to detect the presence of the flagellin protein in a fish or in water. The invention therefore includes methods for detecting and characterising Y. ruckeri, for example in aquaculture facilities.

One aspect of the present invention relates to a DNA construct comprising a replicable expression vector and nucleic acid encoding the f!agellin protein or analogue, fragment or modified version thereof.

Expression vectors for the production of the molecules of the invention include plasmids, phagemtds, viruses, bacteriophages, integratable DNA fragments, and other vehicles, which enable the integration of DNA fragments into the genome of the host. Expression vectors are typically self-replicating DNA or RNA constructs containing the desired gene or its fragments, and operably linked genetic control elements that are recognised in a suitable host cell and effect expression of the desired genes.

These control elements are capable of effecting expression within a suitable host. Generally, the genetic control elements can include a prokaryotic promoter system or a eukaryotic promoter expression control system. Such system typically includes a transcriptional promoter, an optional operator to control the onset of transcription, transcription enhancers to elevate the level of RNA expression, a sequence that encodes a suitable ribosome binding site, RNA splice junctions, sequences that terminate transcription and translation and so forth. Expression vectors usually contain an origin of replication that allows the vector to replicate independently of the host cell.

A vector may additionally include appropriate restriction sites, antibiotic resistance or other markers for selection of vector containing cells.

Plasmids are the most commonly used form of vector but other forms of vectors which serve an equivalent function and which are, or become, known in the art are suitable for use herein. See, e.g., Pouwels et al. Cloning Vectors: a Laboratory Manual ( 1985 and supplements), Elsevier, N.Y.; and Rodriquez, et al. (ads.) Vectors: a Survey of Molecular Cloning Vectors and their Uses, Buttersworth, Boston, Mass (1988), which are incorporated herein by reference.

In general, such vectors contain in addition specific genes, which are capable of providing phenotypic selection in transformed cells. The use of prokaryotic and eukaryotic viral expression vectors to express the nucleic acid sequences coding for the recombinant proteins of the present invention are also contemplated.

The vector is introduced into a host cell by methods known to those of skill in the art. Introduction of the vector into the host cell can be accomplished by any method that introduces the construct into the cell, including, for example, calcium phosphate precipitation, microinjection, e!ectroporation or transformation. See, e.g., Current Protocols in Molecular Biology, Ausuble, F.M., ea., John Wiley & Sons, N.Y. (1989).

Another aspect relates to a host cell transformed with any one of the nucleic acid constructs of the present invention. Suitable host cells include prokaryotes, lower eukaryotes, and higher eukaryotes. Prokaryotes include gram negative and gram positive organisms, e.g., E. coli and B. subtilis. Lower eukaryotes include yeast, S. cerevisiae and Pichia, and species of the genus Dictyostelium.

"Host cell" as used herein refers to cell which can be recombinantly transformed with vectors constructed using recombinant DNA techniques.

A drug resistance or other selectable marker is intended in part to facilitate the selection of the transformants. Additionally, the presence of a selectable marker, such as drug resistance marker may be of use in keeping contaminating microorganisms from multiplying in the culture medium. Such a pure culture of the transformed host cells would be obtained by culturing the cells under conditions which require the induced phenotype for survival. However, the use of plasmids containing such drug resistance markers when administered directly to a fish to be treated is not desired - plasmids lacking such drug resistance markers are preferred.

The host cells according to the present invention are capable of producing a biologically active protein or protein fragment of the invention. Such protein or protein fragment is encoded by the nucleic acid sequence of the invention and is capable of eliciting in an animal protective immunity against a specific adenoviral pathogen.

A process for the production of the recombinant protein or peptide of the invention is also within the scope of the invention. The process comprises the steps of (a) transforming a host cell with the nucleotide sequence of the invention or transfecting a host cell with a nucleic acid construct of the invention; (b) culturing the celts obtained in (a) under conditions in which expression of the protein takes place; and (c) isolating the expressed recombinant protein or peptide from the cell culture or/and the culture supernatant.

The polypeptide may be partially purified from the host before being used as a vaccine. Where the polypeptide is secreted from the host cell, the cells may be separated from the media by centrifugation, the cells being pelleted and the media being the supernatant. In such a situation, the supernatant, which contains the secreted polypeptide, may be used directly as a vaccine, or in a vaccine composition. Alternatively, the polypeptide may be partially purified from this supernatant, for example using affinity chromatography.

The method may further comprise admixing the partially purified polypeptide with another component, such as another polypeptide and/or an adjuvant, diluent or excipient.

Vaccines may contain immunogens/antigens used to control other diseases i.e. vaccine composition may be included within a multivalent vaccine which includes immunogens/antigens against other diseases of fish. . Products and methods of this invention may be useful in the immunization of aquaculture species against many pathogens. Such pathogens include but are not limited to hemmorrhagic septicemia virus, infectious hematopoietic necrosis virus, infectious pancreatic necrosis virus, virus causing spring viremia of carp, channel catfish virus (Herpesvirus ictaluri), grass carp hemorrhagic virus, nodaviridae such as nervous necrosis virus or striped jack nervous necrosis virus, infectious salmon anaemia virus, Aeromonas salmonicida, Renibacterium saimoninamm, Yersinia, Pasteurella (including piscicida), Vibrosis (including anguillarum and ordalii), Edwardsiella (including ictaluri and tarda), Streptococci, and !chthyophthirius.

In a still further aspect the present invention provides a fish or fish population which has been treated or immunised with a vaccine or composition described elsewhere herein.

Detailed Description The present invention will now be further described by way of example and with reference to the figures, which show:

Figure 1 : Immunodetection of flagellin with an anti-flagellin antibody. A: Proteins fractionated on a 10% (w/v) SDS-PAGE gel. B: Immunodetection of flagellin after blotting proteins to a membrane and hybridizing with the anti-flagellin monoclonal antibody #15D8. M: Molecular weight marker (29 to 200 kDa; Sigma). Lanes 1 : Native flagellin (5 pg) purified from the serotype 01 (BA19) isolate via the acid disassociation and re-association method described by Ibrahim er al. (1985). Lanes 2 and 3: Whole cell proteins (WCPs) of bacterial strains used for challenges. Lane 2: WCPs of a serotype 01 {= motile) strain (YR1 ). Lane 3: WCPs of the EX 5 (= non-motile) R1 strain. See text for details.

Figure 2: Toxicity of native Y. ruckeri flagellin to naive rainbow trout over a range of concentrations.

Figure 3: Use of native flagellin as a vaccine (50 pg/fish) for rainbow trout against challenge with a serotype 01 (YR1 ) and EX5 (R1 ) Y. ruckeri strain. Control fish were mock-vaccinated with PBS (Hi) or immunized with native Y. ruckeri flagellin (■) 28 days before challenging. Standard errors, where applicable, are included.

Figure 4: PCR amplification of the serotype 01 (BA19) Y. ruckeri flagellin (ftiC) gene using primers (FLA-F and FLA-R). Primers were based on conserved N- and C- terminal sequences of the Y. enterocolitica flagellin gene. : Molecular weight marker (A Hind\\\; Fermentas). Lane 1 : PCR product using Y. ruckeri genomic DNA as a template. Lane 2: Negative PCR control. A detectable PCR product of -1200 bp, the estimated size of fliC, is visible in lane 1.

Figure 5: Screening of six E. coli XL1 -Blue transformants for pET28-b plasmid with a Y. ruckeri flagellin gene (fliC) insert (YRF1 ). Plasmids were purified via the alkaline lysis method before digesting overnight with Xho\ and Nde\ at 37°C. M: Molecular weight marker (λ -//rid III). Lanes 1-6: Digested plasmids isolated from XL1 -Blue E. coli transformants. DNA fragments in lanes 3 and 4 gave a detectable fragment of approx.1000 bp (indicated), showing that the Y. ruckeri fliC gene was incorporated into the plasmid in the correct orientation.

Figure 6: Open reading frame (ORF) of the gene predicted to encode flagellin (fliC) from Y. ruckeri (A) and the deduced amino-acid sequence (B). Figure 7: Alignment of the predicted native amino-acid sequence of Y. ruckeri flagellin with that of the 39.6 kDa flagellin protein from Y. enterocolitica (PIR: S69767). The amino acid sequence of Y. ruckeri flagellin is shown in bold, whereas conserved areas between the two proteins are highlighted. Figure 8: Phylogenetic tree of Y. ruckeri flagellin with that of other bacterial flagellin monomers.

Figure 9: Predicted secondary structure of V. ruckeri recombinant flagellin (r-flagellin) (including His tags) and Y enterocolitica FleC flagellin monomers. Both proteins have conserved helical domains at both the N- and C- terminals.

Figure 10: Induction, overexpression and purification of recombinant Y. ruckeri flagellin (r-flagellin). A: Proteins fractionated on a 10% (w/v) SDS-PAGE gel. B: I mmunodetection of flagellin with the monoclonal antibody #15D8. Lane 1 : Whole- cell proteins (WCPs) of a motile serotype 01 Y. ruckeri strain (BA1 9) used to source the flagellin {fliC) gene. Lane 2: WCPs of the E. coli BL21 /YRF1 transformant before induction . Lane 3: WCPs of BL21 /YRF1 4 h after induction with 1 mM IPTG. Lane 4: Soluble fraction of induced cells. Lane 5: Insoluble fraction of induced cells; Lane 6: Final r-flagellin product ( 1 pg ) after further purification steps (see Materials & Methods) used to vaccinate fish.

Figure 11 : SDS-PAGE analysis of r-flagellin preparations. After running samples on a 10% (w/v) SDS-PAGE gel, proteins were stained with Coomassie brilliant blue- R250 (A; Lane 1 and B) or silver nitrate (A; Lane 2) following electrophoresis. R- flagellin was purified from IBs (A) or by passing r-flagellin (expressed as soluble protein) through an IMAC column (B). Lane A; 1 : r-flagellin (5 pg). A; Lane 2: r- flagellin (20 ng). B; Lane 1 : Soluble fraction of induced E. coli BL21 -DE3/YRF1 . B; Lane 2 to 4: I MAC elutes 1 (5 pg), 2 (5 pg) and 3 (2 pg). M: Molecular weight marker. See text for details.

Figure 12: Silver staining of native and recombinant Y. ruckeri flagellin (r-flagellin). Proteins were fractionated on a 12% (w/v) SDS-PAGE gel before staining proteins with silver nitrate. M : Molecular weight marker. Lanes 1 to 3: Native flagellin (20 ng). Lanes 4 to 6: r-flagellin (20 ng).

Figure 13: Use of Y. ruckeri r-flagellin to protect fish against intraperitoneal (i.p. ) challenge with the EX5 (R1 ) isolate. Control fish were i.p. injected with 100 μΙ PBS (1), whereas other groups were vaccinated with various concentrations (10, 25 and 50 g per fish) of r-flagellin in 100 μΙ PBS (■). After 14-days, fish were i. p. challenged with 1 x 10⁵ cells of the EX5 (R1 ) strain. Survival after 7 days post- challenge is shown above. The standard errors of controls are included (N = 20).

Figure 14: Using recombinant V. ruckeri flagellin (r-flagellin) to prevent mortalities and/or the development of symptoms associated with ERM after challenging with the EX5 (R1 ) strain. Controls were administered with PBS (B) or vaccinated with various concentrations (10, 25 and 50 g per fish) of r-f!agellin (■). The total number of mortalities, in combination with the number of fish showing signs of ERM, is presented above as an absolute percentage. Standard error is shown where appropriate (N=20).

Figure 15: Confirmation that the Y. ruckeri EX5 (R1 ) strain does not produce detectable flagellin under iron-limiting and/or temperature limiting conditions. WCP of the V. ruckeri EX5 (R1 ) strain were separated on a 10% SDS-PAGE (A) after growing overnight in TSB at 28^°C (Lanes 2 and 3) or 17^°C (Lane 4). Cells were grown in the absence (Lane 2) or presence (Lanes 3 and 4) of the iron chelator 2, 2 -bipyridyl (200 μΜ). Proteins were blotted onto a nitrocellulose membrane before hybridizing with the anti-flagellin antibody (B). Only the recombinant flagellin is detectable, whereas no flagellin is detected in any of the EX5 (R1 ) WCP preparations. M: Molecular weight marker.

Materials and Methods General materials

Unless otherwise stated in the text, chemicals and reagents were purchased from Sigma-Aldrich (UK) or Fisher Scientific (UK). All chemicals, enzymes and other materials were stored and handled in accordance with the manufacturers' instructions.

Bacterial strains, antibiotics and storage conditions

Bacterial strains and vectors used in this study are outlined in Table 1. Y. ruckeri isolates were originally sourced from dead or moribund rainbow trout (Oncorhynchus mykiss, Walbaum) by Professor B. Austin and for this work were obtained from the fish pathogen collection of the School of Life Sciences, Heriot- Watt University. V. ruckeri cultures were routinely grown on tryptone soya agar (TSA) or in tryptone soya broth (TSB) with incubation at 28°C or 16°C for 18-72 h. Presumptive V. ruckeri strains were identified following Austin and Austin (2007). E. coli isolates were grown on nutrient agar (NA) or Luria-Bertani agar (LA) plates at 37^°C for 18-72 h. For liquid cultures, single colonies of E. coli were grown in nutrient broth (NB) or LB broth at 28^°C or 37^°C for 18 to 72 h. Heat labile chemicals (i.e. antibiotics) were sterilised by filtration using 0.22 pm porosity filters (Mi!lipore). When required, antibiotics were added to media after autoclaving (121 °C, 15 min) and cooling (~50°C). Iron-deficient media was prepared by the addition of 2'2'- bipyridyl ( 00 pM/ml) after washing glassware once with 1 M HCI and then several times in dH₂0 prior to autoclaving. Bacterial stock cultures were stored at -70°C in TSB, NB or LB broth supplemented with 30% (v/v) sterile glycerol.

Table 1 ; Bacterial strains and plasmids used in this study

Name Characteristics/Uses Reference/Source

Y. ruckeri

BA19 Serotype 01 _» biotype 1 (motile) This study

YR1 Austin et al. (2003)

EX5 (R1 ) Serotype 01 , biotype 2 (non-motile)

E. coli

BL21 -DE3 Overexpressing recombinant proteins Stratagene, UK

XL1 -Blue Maintaining recombinant plasmids

Plasmids

pET28-b Gene cloning for overexpression Invitrogen, UK Motility assays

Motility was determined by stab inoculating a single bacterial colony into the bottom of motility plates (Columbia broth supplemented with 0.3% [w/v] Bacteriological agar No 3, average depth = 3 mm) before incubating at 28°C for 24 h (Coquet et at., 2002, Evenhuis ef a/., 2009). Strains were considered to be motile if migration (= swimming) zones were visible from the point of inoculation after incubation. In addition to using semi-solid agar, swimming ability was observed using light microscopy (magnification of x400) while taking water movement and Brownian motion into consideration.

DNA methods

DNA purifications Genomic DNA was obtained from fresh bacterial cultures grown overnight using the QIAGEN DNeasy^® blood and tissue kit as per the manufacturers' instructions. Plasmid DNA was purified via the alkaline lysis method outlined by Birnboim (1983). All DNA was stored at -20°C until required. Restriction enzyme digests of plasmid DNA

Cleavage of plasmid DNA (1 -2 g) with restriction endonucleases was routinely carried out in a reaction volume of 20 μΙ containing restriction enzyme(s) (1 unit of enzyme per 1 μg of DNA) and enzyme- specific buffer (1 x from 10 x stock). Reactions were brought to the final volume using sterile dH₂0. All restriction enzymes and buffers used in this study are illustrated in Table 2. Digests were routinely incubated for 3 h or overnight before deactivating by heating (as described by the manufacturers) or by gel purifying DNA fragments. The efficiency of the DNA digest was confirmed by running a small amount (5 μΙ) on a 1 % (w/v) agarose gel before excising the band of interest and purifying DNA. Table 2: Restriction enzymes and digestion buffers used in this study. All restriction digests were performed at 37^°C.

Enzyme Buffers

10 mM Tris-HC! (pH 8.0 at 37°C), 5 mM MgCI₂, 100 mM KCI, 0.02% (v/v) Triton X-100 and 0.1 mg/ml BSA.

50 mM Tris-HCI (pH 7.5 at 37°C), 10 mM MgCI₂, 100 mM NaCI, 0.02% (v/v) Triton X-100 and 0.1 mg/ml BSA.

10 mM Tris-HCI (pH 8.5 at 37°C), 10 mM MgCI₂, 100 mM KC! and 0.1 mg/ml BSA.

50 mM Tris-HCI (pH 7.5 at 37°C), 10 mM MgCI₂, 100 mM NaCI and 0.1 mg/ml BSA.

50 mM Tris-HCI (pH 7.5 at 37°C), 10 mM MgCI₂, 100 mM NaCI and 0.1 mg/ml BSA

DNA ligations

Up to 10 pg of digested DNA was ligated in a total reaction volume of 20μΙ. A vector to insert molar ratio of 1 :3 was used as routine. A typical reaction mix (20 μΙ) contained 2μΙ of 10 x ligation buffer (400 mM Tris-HCI [pH 7.8], 100 mM MgCI₂, 100 mM DTT, 5 mM ATP), 1 μΙ of T4 DNA ligase (5 units/μΙ, Fermentas), DNA and dH₂0 up to the final volume. Digested DNA was allowed to ligate overnight at 6°C before terminating the reaction by heat inactivation (70°C, 10 min). The efficiency of ligation reactions was confirmed by running a small sample (-5 μΙ) alongside a digested, non-ligated sample on a 1 % (w/v) agarose gel. Polymerase chain reaction (PCR)

Primers were designed to be -20 bp long in order to give an annealing temperature between 50^°C and 60^°C. The 3'-terminal nucleotides of the primers were designed to contain G or C when possible to enhance primer binding to template DNA. Primers were produced by MWG and upon receipt were re-suspended in sterile dH₂0 (final concentration of 100 pm/μΙ) before storing at -2Q°C. All primers used in this study are illustrated in Table 3. A standard PCR reaction contained 5 μΐ 10 x Dream Taq™ PCR buffer (Fermentas), 1 μΙ of each primer (100 pmol/μΙ), template DNA (up to 100 ng of genomic DNA or 10 ng of plasmid DNA), and 0.2 μΙ (1.5 units) of Taq polymerase (Dream Tag™, Fermentas) brought to a final volume of 50 μ! with (sterile) Millipure dH₂0. For reactions where the PCR product was used for cloning, conditions were as described except 5 μΙ of 10 x High Fidelity Taq buffer (Fermentas) and 0.2 μΙ (1 .5 units) of Pfu Taq polymerase (Fermentas) was added instead of Dream Taq™ buffer and Taq polymerase. The reaction mixture was pipetted into a 0.2 ml thin walled PCR tube (AxyGen, Inc) and placed in a thermal cycler (Gen Amp^® PCR system 2700, Applied Biosystems). A standard PCR cycle consisted of an initial denaturation step of 5 min at 94^°C followed by variable cycles of denaturation (30 s at 94^°C), annealing (30 s at primer specific temperatures) and extension ( 1 min at 74°C). A final step at 74°C for 7 min completed primer extension before holding at 10°C. Annealing temperatures were considered to be the T_m - 5°C. Negative controls contained dH₂0 in place of template DNA. PCR products were analysed by agarose gel electrophoresis and stored at -20^°C until required.

Table 3: Names, sequences and melting temperatures (T_m) of primers used in this study. The Nde\ (bold, underlined) and Xho\ (underlined) restriction sites are included.

Primer Sequence (5" -> 3') T_m ( C) Reference

FLA-F CGCCATATGGCGGTCATTAACACTAAC 61 This study

FLA-R TACTCGAGACGCAGCAGAGACAACACA 64

FLG-L CCGTTGATGTTAGAGGTGAA 50

FLG-R GGCGGCGCAACGGGTACAGC 62

Agarose gel electrophoresis of DNA

DNA was analysed by electrophoretically separating fragments on a 1 % (w/v) agarose gel after Sambrook ef al. (1989). A RunOne™ Electrophoresis Cell (EmbiTec) was used for fractionating DNA. Standard molecular weight markers (λ/Η nd III, Fermentas) were run alongside DNA samples to give detectable fragments of 23130, 9416, 6557, 4361 , 2322, 2027 and 564 bp on a 1 % (w/v) agarose gel. DNA gels were photographed under UV light using a UVP gel documentation system.

Gel purification of DNA

After separating on a 1 % (w/v) agarose gel, DNA (including plasmids and PCR products) was purified using a GeneJET™ gel extraction kit (Fermentas) following the manufacturer's instructions. Preparation and transformation of chemically competent E. coli cells

Chemically competent E. coli cells were prepared following a calcium chloride method outlined by Inoue et al. (1990). Cells were transformed using the heat shock method outlined by Sambrook ei al. (1989).

Cfoning of the Y. ruckeri flagellin (fliC) gene

Specific forward (FLA-F) and reverse (FLA-R) flagellin primers were designed using conserved N- and C- terminals of fliC from V. enterocolitica (GenBank accession No: ADB96220.1 ) as a sequence template. This Y. enterocolitica strain was chosen due to a protein-protein BLAST (Basic Local Alignment Search Tool) showing 100% identity to 185 amino acid flagellin fragment of Y. ruckeri ATCC 29473 (GenBank accession No: ZP_04618012.1 ). Y. ruckeri genomes were shown to possess these primer-specific sequences by performing a DNA BLAST on the sequenced genome of Y. ruckeri ATCC 29473. In addition, FLA-F and FLA-R primers included 5' sequences which would allow PCR fragments to contain Xho\ and Nde\ restriction sites (Table 3). Amplification of Y. ruckeri flagellin was performed using genomic DNA isolated from the motile serotype 01 BA19 strain. PCR conditions were as above, albeit with an annealing temp at 55^°C for the first 5 cycles followed with an annealing temp at 64°C for 25 cycles. The initial reduction in annealing temperature (55^°C) allowed the incorporation of Xho\ and Nde\ restriction sites within the PCR product. After running a small amount (5 μΙ) of the PCR mix on a 1 % (w/v) agarose gel to ensure that the fliC gene was successfully amplified, PCR products were digested with Xho\ and Nde\. The pET28-b plasmid was also digested overnight with Xho\ and A/del. After digesting, PCR products and plasmid DNA were gel purified and ligated together to create YRF1 (pET28-b + fliC). Chemically competent E. co/ XL1- Blue cells, prepared using the calcium chloride method, were transformed with 10 pi of this ligation mixture before plating onto pre-warmed LA (+ 50 pg/ml kanamycin) plates. After incubating at 37°C overnight, any resulting colonies were grown in LB (+ 50 g/ml kanamycin) before purifying plasmids and digesting with Xho\ and Nde\ to confirm the presence of insert. A positive E. coli XL1 -Blue transformant, which contained the YRF1 construct (termed E. coli XL1 -Blue/YRF1 ), was stored at -70^°C with glycerol or used to purify the recombinant plasmid.

Induction and overexpression of Y. ruckeri fla ellin

Purified plasmid YRF1 was used to transform chemically competent E. coli BL21 - DE3 strains using the heat shock method. Transformants were selected by plating out on LA plates (+ 50 Mg/ml kanamycin) and grown overnight at 37°C. Resulting colonies (termed E coli BL21 -DE3/YRF1 ) were inoculated into 10 mi of LB (+ 50 pg/ml kanamycin) and grown for a further 18 h (37^°C, 250 rpm). This starter culture was used to inoculate fresh LB (+ 50 Mg/ml kanamycin, 1 : 100 dilution) and grown (37^°C, 250 rpm) until reaching mid to late log phase (OD₆oo> 0.6). Gene expression was induced by the addition of isopropyl β-D-l -thiogalactopyranoside (IPTG) to a final concentration of 1 m and grown for a further 4 h. Induced cells were harvested (4°C, 13,000 rpm, 20 min) before purifying the recombinant protein as IBs or by passing soluble protein through an iMAC column.

Protein methods Determination of protein concentrations

Protein concentrations were measured using the protein assay based on the Bradford dye binding procedure (Bradford, 1976) using a standard curve based on bovine serum albumin (BSA).

Purification of native Y. ruc ren^' flagellin

Native flagellin was purified from a motile Y. ruckeri serotype 01 (BA19) strain following an acid disassociation and re-association method outlined by Ibrahim ef al. (1985). A starter culture, which was grown from a single colony overnight in 10 ml of TSB (23°C, 150 rpm), was used to inoculate 6 x 1 L volumes (1 :1000 dilution) of TSB and grown for a further 18 h (23°C, 150 rpm). Cells were harvested (4^°C, 6000 rpm, 40 min) and gently mixed with ice cold saline (0.9% [w/v] NaCI) supplemented with 2 mM PMSF to form a moderately thick suspension. The pH of the suspension was then reduced to pH 2 using 1 M HCI and maintained at room temp under constant stirring for 40 min to disassociate fiagella. Bacterial cells, now stripped of flagellin, were removed by centrifugation (4°C, 6,000 rpm, 40 min). The supernatant, containing flagellin as soluble monomers, was centrifuged (10°C, 26,000 rpm, 2 h) to remove insoluble contaminants before adjusting the pH to 7.2 with 1 M NaOH to reinitiate flagellin polymerization. To precipitate protein, ammonium sulphate was slowly added to the solution with vigorous stirring to achieve two-thirds saturation (2.67 ) before holding overnight at 4^°C. The resulting precipitate (= flagellin protein) was centrifuged (4°C, 20,000 rpm, 30 min) and dissolved in sterile buffer (50 mM Tris-HCI [pH 8.0], 50 mM NaCI [pH 7.5]) prior to dialysing in pre-treated dialysis tubing (Medicell International ltd, molecular weight cut-off = 14 kDa). Dialysis was initially performed under running tap water for 2 h and then for 18 h at 4°C with constant stirring in 6 L of dH₂0. Purified flagellin was stored at 4°C supplemented with 0.01 % (w/v) sodium azide until required. Purity and identity of native flagellin was confirmed via SDS-PAGE and immunodetection. Prior to administering to fish, the sample was diluted to the required concentration with sterile phosphate buffered saline (PBS; 137 mM NaCI, 2.7 mM KCI, 10 mM Na₂HP0₄, 2 mM KH₂P04 [pH 7.4])

Solubilisation and purification of recombinant Y. ruckeri flagellin

Pellets of induced cells were re-suspended in 10 ml of buffer A (50 mM Tris-HCI [pH 7.5], 50 mM NaCI, 5 mM EDTA, 0.1% [w/v] sodium azide, 2 mM PMSF, 1 mg/ml lysozyme) and stored on ice for 30 min. Cells were lysed by passing through a French pressure cell press (3 repeats at 14,000 psi) with 5 min intervals on ice. Recombinant flagellin (r-flagellin), expressed in inclusion bodies (IBs), was pelleted by centrifugation (10^°C, 25,000 rpm, 1 h) before the supernatant (= soluble fraction) was removed. IBs were washed three times in 10 ml buffer A supplemented with 1 % (v/v) Triton X-100 to remove any contaminating material. Excess Triton was removed by washing the pellet twice with buffer A without Triton-X100. IBs were denatured and solubilised in buffer B (50 mM NaCI, 2 mM PMSF, 0.1 % [w/v] sodium azide, 8 M urea [pH 7.4]) by freeze-thawing, vortexing and sonication. Any insoluble material was removed by centrifugation (4°C, 13,000 rpm, 30 min) before dialysing in pre-treated dialysis tubing (below). Dialysis was initially carried out under running tap water for 2 h and then for 18 h at 4°C with constant stirring in 6 L of dH₂0. Any precipitate (= insoluble r-flagellin) which formed was dissolved by changing the pH of the solution to 2 with 1 M HCI while stirring at room temp for 30 min. Any pH 2 insoluble material was removed by centrifugation (4°C, 24,000 rpm, 40 min). Purity of r-flagellin was confirmed via SDS-PAGE and immunodetection with the anti- flagellin antibody #15D8. Finally, the solution was diluted with sterile PBS to give the required concentration of r-flagellin before administering to fish.

Purification of soluble r-flagellin using HisTrap™ FF Columns

Y. ruckeri r-flagellin, expressed as soluble protein, was purified by passing through a HisTrap™ FF (IMAC) Column (GE Healthcare, UK) following the manufacturer's instructions. Purity of protein elutes was confirmed by running 10 pg of protein on a 10% (w/v) SDS-PAGE.

Sodium dodecyl sulphate polyacrylamide gel electrophoresis of proteins (SDS PAGE)

SDS-PAGE was carried out using a discontinuous buffer system described by Laemmli (1970). After assembling the gel casting apparatus (Mighty Small II, Hoefer), the polyacrylamide resolving gel (10-12% [w/v] polyacrylamide [19:1 acrylamide: bisacrylamide, Me!ford], 375 mM Tris-HCI [pH 8.8], 0.1 % [w/v] SDS, 0.1 % [w/v] ammonium persulphate (APS), 0.05% [v/v] W. N'./v -tetramethyl- ethylenediamine [TEMED]) was poured between the glass plates. The gel solution was overlaid with water saturated n-butanol to ensure a flat surface and allowed to polymerise at room temperature for 30 min. After removing the n-butanol, the stacking gel (4% [w/v] polyacrylamide, 125 mM Tris-HCI [pH 6.8], 0.1 % [w/v] SDS, 0.05% [w/v] APS, 0.1 % [v/v] TEMED) was cast directly over the resolving gel with an appropriate comb in place to create loading wells. Gels were stored overnight at 4^°C. Once set, combs were removed, and the gel (still within the glass plates) was gently placed within the electrophoresis apparatus. Buffer tanks were then filled with 1 x SDS-PAGE running buffer (24 mM Tris-HCI [pH 8.3], 192 mM glycine, 0.1 % [w/v] SDS) before loading the sample and running the gel. Protein samples were mixed (1 : 1 ) with 2 x sample loading buffer (150 mM Tris-HCI, 1 .2% [w/v] SDS, 60% [v/v] glycerol, 15% [v/v] β-mercaptoethanol, 0.09% [w/v] bromophenol blue). For SDS-PAGE analysis of crude whole cell proteins, 1 ml of bacterial culture was centrifuged (13,000 rpm, 10 min) before resuspending the bacterial pellet in 200 μΙ of 1 x sample Ioading buffer. All protein samples were vigorously vortexed for 5 min before heating to 95^°C for 15 min. Any insoluble material was removed by centrifugation (13,000 rpm, 10 min) before Ioading 10- 20μΙ (1-20 pg protein) into each well. Electrophoresis was carried out at 150 V with water cooling the system for 1 .5 h, or until the Ioading dye had reached the end of the gel. Molecular weight markers (29 to 200 kDa; Sigma) were run alongside protein samples as standard. Following electrophoresis, gels were carefully removed from the apparatus/glass plates and stained with Coomassie brilliant blue- R250 or stained with silver nitrate to visualize proteins. All gels were scanned with an ImageScanner™ II (GE Healthcare) after staining. If the gel was to be used in an immunoblot, staining was omitted and proteins were electrophorettcally transferred to a nitrocellulose membrane.

Coomassie brilliant blue-R250 staining Polyacryiamide gels were stained in Coomassie brilliant blue solution (50% [v/v] methanol, 10% [v/v] acetic acid, 0.1 % [w/v] Coomassie brilliant blue-R250) overnight. The stain was discarded, and gels were repeatedly washed in destain solution (10% [v/v] methanol, 10% [v/v] acetic acid) until the background became clear and protein bands were distinct. Finally, the destain solution was discarded and gels were stored in dH₂0.

Silver staining of protein gels

Following SDS-PAGE, the gel was removed from the apparatus and fixed (30 min) in fixer A (50% [v/v] methanol, 10% [v/v] acetic acid), followed by fixing (30 min) in fixer B (5% [v/v] methanol, 7.5% [v/v] acetic acid). The gel was then washed in dH₂0 (4 x 10 min) prior to sensitizing (30 min) in DTT (5 Mg/ml). Next, proteins were stained (30 min) with 0.1 % (w/v) silver nitrate before rinsing in dH₂0 (4 x 10 min). The gel was developed in 100 ml of ice-cold 3% (w/v) sodium carbonate (+ 0.05% [v/v] formaldehyde) until protein bands became clear and distinct. The reaction was terminated by the addition of 5 ml 2.3 M citric acid (10 min) prior to washing the gel in dH₂0 (4 5 min). Finally, the gel was stored in 1 % (v/v) acetic acid. immunodetection of flagellin

Proteins fractionated by SDS-PAGE were blotted onto a nitrocellulose membrane (0.2 pm pore size, BioRad) using a electrophoretic method previously described by Towbtn ei al. (1979). Blotted membranes were then briefly washed in 1 x TBST (50 mM Tris-HC! [pH 7.5], 150 mM NaC!, 0.05% [v/v] Tween 20) before blocking (2 h) in Western blocking buffer (1 % [w/v] non-fat skimmed milk powder [Marvel] in 1 x TBST). The membrane was then hybridized (2 h or overnight at 4 °C) with the anti- flagellin MCA antibody #15D8 (Feng ei al., 1990) diluted 1 :2000 in Western blocking buffer. Unbound antibody was removed by washing in 1 x TBST prior to hybridizing (45 min) with a 1 : 10,000 dilution of goat anti-mouse horse radish peroxidase-iinked IgG in Western blocking buffer. Any unbound antibody was again removed by washing (5 x 5 min) in 1 x TBST before covering the surface of the membrane in Lumi-Light^® substrate (Roche). The X-ray was then exposed to an X- ray film and developed in accordance with the manufacturers instructions (Kodak). Fish trials

Ethics statement

All vaccinations and bacterial challenges were carried out in compliance with the Animals (Scientific Procedures) Act 1986 by a UK Home Office license holder (Ref: PIL60/00107) under instruction. Rainbow trout were sedated by immersion in anaesthetic (0.1 % [w/v] Ethyl 3-aminobenzoate methane sulphonate salt [MS222]) prior to intraperitoneal (i.p.) injection and monitored for 15 min post-injection to ensure recovery from anaesthesia. Handling and movement of livestock was limited to prevent overstressing. When required, fish were sacrificed by immersion in concentrated MS222. Remaining carcasses were disposed of following university regulations. Maintenance of fish stocks

Non-vaccinated rainbow trout (average weight = 4 to 5g) were purchased from a commercial fish farm in Scotland. The health status of fish was checked at 48 h after arrival to the aquarium and then every two weeks according to Austin and Austin (1989). Livestock were maintained in continuously aerated, dechlorinated and free flowing freshwater at ~ 2°C in polypropylene tanks. Fish were fed daily to satiation with a commercial pellet diet (Trouw Nutrition, UK). Dose determination of Y. rucfreri flagellin

Native or recombinant flagellin (r-flagellin) was administered to fish (average weight = 5 to 6 g) by i.p. injection over a range of concentrations (0, 10, 20, 30, 40, 50, 100, 150, 200 and 250 pg/fish) in sterile PBS to a final volume of 100 μΙ/fish. For each concentration, 5 rainbow trout were vaccinated (N = 5). Fish were monitored for a period of 14 days post-vaccination.

LD_fio dose determination of Y, ruckeri challenge strains YR1 and R1 A lethal dose for 60% of the population (LD₆₀) was calculated by the Probit method of Wardiaw (1985) for strains YR1 and R1 . Thus, groups of rainbow trout (N = 5) were i.p. injected with 100 μΙ/fish of pathogen suspended in saline ranging from 10⁵ to 10⁹ cells/ml before recording mortalities over 14 days. Fish immunizations and bacterial challenges

Rainbow trout (average weight = 5 to 6 g) were randomly chosen from fish stocks and vaccinated via i.p. injection with 100 μΙ volumes of native flagellin (50 pg/fish) or r-flagellin (12, 25 or 50 pg/fish). Controls were i.p. injected with 100 μ! volumes of sterile PBS. During the 14 or 28 day period between vaccination and challenge, groups of all experimental fish remained within the one tank, but differentiated by various clippings of the caudal fin. Livestock were then separated into different tanks 48 h prior to i.p. challenge with YR1 (9 x 10⁶ live cells/fish) or R1 (4 x 10⁶ live ceils/fish) in a total volume of 100 μΙ saline. The number of cells administered to fish was estimated to be the LD₆₀ values for non-vaccinated rainbow trout with an average weight of 5 to 6 g. Control fish were challenged with Y. ruckeri (YR1 or R1 ) or i.p. injected with sterile PBS. Test subjects were monitored daily after challenge and then more frequently following mortality. Bacteriological examination of infected fish

Bacteria were recovered from dead or moribund fish following challenge. From each test group (including the controls), five fish were examined. Firstly, fish surfaces were washed with 70% (v/v) ethanol before dissecting with a sterile blade. Internal organs (e.g. liver, kidney and spleen) were swabbed before streaking onto a TSA plate and incubating overnight at 28°C. Once grown, bacteria were streaked out onto a fresh TSA plate and incubated (28°C) until single colonies formed. Isolates were identified using bacteriological methods previously outlined by Austin and Austin (2007).

Statistical analysis

Experimental analysis was calculated as the absolute percentage (%) of fish surviving two weeks post-challenge. In addition, the relative percent survival (RPS ) of rainbow trout was calculated after Amend (1981 ).

Percent mortality in vaccinated group

RPS * (%) x 100

Percent mortality in control group

Results

Purity of native Y. ruckeri flagellin In addition to investigating the role of flagellin in protecting against ERM as part of a whole-ceil vaccine, the use of flagellin as a purified, sub-unit vaccine was also explored. Native flagellin was obtained from live serotype 01 (BA19) Y, ruckeri cells following the acid disassociation and re-association method outlined by Ibrahim ef a/. (1985). Initial attempts were made to acquire flagellin from cultures grown in M9 minimal as this was originally thought to prevent contamination from protein-rich broth (Ibrahim ef al. , 1985). However, bacterial growth was poor (OD₆oo 5 0.4), resulting in a low yield of flagellin (< 166 pg/L). On the other hand, when grown overnight in 6 x 1 L of TSB, 5 mg of flagellin (approx. 833 pg/L) could be recovered without any apparent contamination with media proteins. No flagellin could be obtained when using the Y. ruckeri EX5 (R1 ) culture as a source of the protein.

After purifying protein using a method described by Ibrahim ef al. (1985), 5 pg was fractionated on a 10% (w/v) SDS-PAGE gel {Fig 1 ; A: Lane 1 ). A protein band approximately 45 kDa in weight was clearly visible after staining with Coomassie brilliant blue-R250. No other protein bands were observed. Western blotting and immunodetection with the anti-flagellin antibody (#15D8) confirmed that this 45 kDa protein was flagellin (Fig 1 ; B: Lane 1 ). Given that only one protein band was observable, this flagellin preparation was considered to be of a sufficient purity for testing protein toxicity for fish and for use as a sub-unit vaccine.

Toxicity of native Y. ruckeri flagellin to rainbow trout

Native flagellin was intraperitoneally (i.p.) administered to naive rainbow trout (average weight = 5 to 6 g) at various amounts (0, 10, 20, 30, 40, 50, 100, 150, 200 and 250 pg/ fish) to determine what effect this may have for health. Groups of five fish were used to test each concentration of native flagellin. Antigen was administered in a total volume of 100 pi PBS. Prior to injection, fish were anesthetised. Livestock was then observed for 3 days post-injection, after which any remaining fish were sacrificed in an overdose of anaesthetic.

Results from this experiment are shown in Fig 2. It was evident that concentrations up to 50 pg of native flagellin/fish did not have a detrimental effect on health. Postmortem examination of trout showed no signs of disease, nor did they show any physiological changes either externally (e.g. skin, eyes, mouth) or internally (e.g. liver, intestine or spleen). Conversely, fish administered with higher concentrations of the native preparation died. In fact, fish did not fully recover from the anaesthesia administered for vaccination and died shortly afterwards. There was no observable inflammation and/or reactions at the site of injection in fish which died or lived following injection. Since i.p. injection of 50 pg flagellin/fish did not cause death, nor was it apparently detrimental to fish health, this concentration was considered to be safe for use on larger scale vaccinations. Protection conferred by native Y. ruckeri flagellin

The protective properties of native V. ruckeri flagellin protein for rainbow trout against challenge with a serotype 01 (YR1 ) or EX5 (R1 ) Y. ruckeri strain were determined. Rainbow trout (average weight = 5 to 6 g; N = 80) were sedated in anaesthetic and i. p. vaccinated with native flagellin (50pg/fish). Controls were mock-vaccinated with sterile PBS (N = 60). All fish recovered from anaesthesia within a matter of minutes and showed no signs of disease or distress. After 28 days post-vaccination, half of the flagellin-vaccinates (N = 40) were i.p. challenged with the serotype 01 (YR1 ) strain (8 x 10⁵ cells/ml), whereas the other half (N = 40) were i.p. challenged with the EX5 (R1 ) isolate {4.5 x 10⁵ cells/fish). Fish mock- vaccinated with PBS were either challenged with the serotype 01 (YR1 ) (8 x 1 0⁵ cells/ml; N = 25) or EX5 (R1 ) (4.5 x 10⁵ cells/fish; N = 25) strain. A further control group of trout mock-vaccinated with PBS (N = 10) were mock-challenged with PBS. Prior to i. p. injection, all fish were again sedated in anaesthetic and fully recovered from anaesthesia. Survival rates for all groups 14 days post-chailenge are outlined in Fig 3.

All fish administered with native flagellin (N = 80) after 14 days post-challenge survived (RPS = 100%) (Fig 3). Furthermore, fish injected with flagellin showed excellent signs of health and behaviour compared to control fish surviving challenge. Protection was strain-independent as half (N = 40) were challenged with the serotype 01 (YR1 ) isolate, whereas the second half (N = 40) were challenged with the EX5 (R1 ) strain. These results are significant insofar as native flagellin can protect against both a flagellin-producing (i.e. serotype 01 ) (Fig 1 ; Lane 2) and flagellin-devoid (i.e. EX5) (Fig 1 ; Lane 3) Y. ruckeri strain.

Post-mortem examination of fish which succumbed to disease following bacterial challenge all showed signs of haemorrhaging and liquefaction of internal tissues. Bacteria was recovered from internal tissues (e.g . kidney, spleen and ascetic fluid) as pure cultures and were confirmed to be Y. ruckeri serotype 01 (YR1 ) or EX5 (R1 ) depending on the strain used for challenge.

Overall, these results demonstrate that native flagellin can be an efficacious vaccine in preventing ER in rainbow trout. The ability to protect against a strain which does not produce this protein (i.e. EX5) also suggests that it may be a potent non-specific vaccine. Thus, the next rational step in this study was to investigate the possibility of cloning/overexpressing the protein encoding Y. ruck eri flagellin for use as a recombinant vaccine.

Cloning of the Y. ruckeri fliC gene

The Y ruckeri genome has been sequenced, although it is currently Sacking annotation and is available only as short sequence reads (NCBI Accession: PRJNA55249; ID: 55249). Moreover, the Y. ruckeri fliC gene has not been described within the literature. Still, the sequence of a 185 amino acid (aa) peptide from Y ruckeri, which was considered to be a "flagellin-like" protein, was available within the NCBI protein database (GenBank accession No: ZP_04618012.1 ). Protein BLAST analysis of the peptide sequence showed that it shared a high level of protein identity (90%) to that of Y enterocolitica flagellin. BLAST analysis of the gene encoding Y enterocolitica flagellin (fliC) (GenBank accession No: ADB96220.1 ) found it to be similar to other Yersinia spp., particularly at both the N- and C- terminals. Similar sequences were also found within the genomic library of the Y ruckeri strain ATCC 29473, suggesting that the gene of interest was not dissimilar to that of other Yersinia. Consequently, primers containing restriction sites for Xho\ and Nde\ could be designed based upon conserved N- and C- terminal sequences to amplify the fliC gene of Y. ruckeri.

A PCR reaction using Pfu enzyme and genomic DNA from the serotype 01 (BA 9) strain as a template, with the primers FLA-F/FLA-R, resulted in a single product -1200 bp in size (Fig 4). This PCR product (termed fliC) was purified, digested with the restriction enzymes Xho\ and Nde\, and cloned into vector pET28-b to create the plasmid YRF1 (pET28-b + fliC). The ligation mixture was then used to transform chemically-competant E. coli strain XL1 -Blue bacteria. Six colonies were picked and grown overnight before purifying plasmid DNA from each culture. Purified plasmids were digested with the restriction enzymes Nde\ and Xho\ (Fig 5). Of the six p!asmids digested, two (Fig 5; Lanes 3 and 4) gave a detectable band of -1000 bp, indicating that the fliC PCR product was correctly inserted within the pET28-b vector. The E. co// XL1 -Blue transformant, containing the YRF1 plasmid shown in Fig 5 (Lane 3), was termed E. coli XL1 -Blue/YRF1 . This strain was stored as glycerol stocks at -70°C and used in all subsequent experiments as a source of YRF1.

Sequencing the YRF1 plasmid insert

The YRF1 plasmid from the E. coli XL1 -Blue/YRF1 transformant was sequenced using the FLA-F and FLA-R primers. Additional sequences adjacent to original primers were obtained by sequencing with the internal primers FLG-L and FLG-R. Each sequencing reaction was repeated to ensure that the DNA sequence was correct. The final fliC sequence, along with the predicted amino acids encoded by this ORF, is shown in Fig 6.

Analysis of the fliC DNA sequence showed that the gene has an overall G+C content of 52.6%, a number which is not dissimilar to that predicted for the Y. ruckeri genome (Ewing ef a/., 1978). The deduced protein sequence (Fig 6; B) consists of 424 amino acids and has an estimated molecular weight of 43.55 kDa. The protein also has histidine (His) tags successfully incorporated at both the N- and C- terminal. BLAST analysis of this sequence showed that it is similar (69% identity) to that of the Y. enterocolitica 39.6 kDa flagellin protein (Fig 7). A phylogenetic tree of the flagellin monomer amino acid sequence (Fig 8) could be constructed using the online phylogeny program (http://www.phvioqeny.fr/). What is apparent from this tree is that the amino acid sequence of Y. ruckeri flagellin is most similar to flagellin of other Yersinia spp. Some degree of amino-acid relatedness was also shown between Y. ruckeri flagellin and that of Serratia, Salmonella and E. coli flagel!ins (Fig 8). However, the 39.6 kDa flagellin monomer from Y. enterocolitica is the most closely related flagellin species. In particular, amino-acid sequences were highly conserved at the N- and C-terminals between both proteins (Fig 7). Using the web based Sequence Annotated by Structure program (SAS) (http://www.ebi.ac.uk/thomton-srv/databases/sas), the secondary structure of both Y. ruckeri and Y. enterocolitica flagellin proteins were predicted to be helical at each terminal, with some variability in the central sequences (Fig 9). At this stage it was established that the gene encoding the Y. ruckeri flagellin monomer (fliC), or at least a gene encoding a protein with significant identity to flagellin, was successfully cloned within the pET28-b vector. Therefore, the YRF1 construct could be used to overexpress recombinant Y. ruckeri flagellin (r-flagellin).

Overexpression and purification of recombinant Y. ruckeri ' flagellin (r-flagellin)

All results regarding the induction and purification of recombinant flagellin (r- flagellin) are shown in Fig 10. After confirming that the Y. ruckeri flagellin gene was cloned (above), the YRF1 construct was used to transform the E. coli BL21 DE3 expression strain. Prior to induction with IPTG, the E. coli BL21 DE3 transformant (E, coli BL21 DE3/YRF1 ) is either expressing low levels of r-flagellin or perhaps endogenous E. coli flagellin (Fig 10; B: Lane 2). However, the addition of 1 mM IPTG significantly induced expression of r-flagellin (Fig 10; B: Lane 3), predominately as insoluble inclusion bodies (IBs) (Fig 10; B: Lane 5). A moderate amount of soluble r-flagellin was also present (Fig 10; B: Lane 4), although preliminary attempts to purify the His-tagged protein by binding to an IMAC column was unsuccessful. Nonetheless, the recombinant protein could be cleaned and purified by exploiting the insoluble nature of inclusion bodies.

It is estimated that the production of r-flagellin, under the current conditions of induction (see Materials and Methods), was in the range of 40 mg of protein/L. This is approximately 8 times more than what could be obtained from 6 L of bacterial culture using the acid dtsassociation and re-association. By varying culture and induction conditions it was later shown that growing the E. coli BL21 DE3/YRF1 transformant at 28°C (OD₆₀₀ > 1.5), before inducing with 0.1 mM IPTG for 4 h, can significantly increase the amount of soluble flagellin without adversely affecting overall flagellin yield. Preliminary tests have also shown that soluble r-flagellin could be purified using an IMAC column (Fig 11 ; B).

To ensure that the final r-flagellin product (Fig 11 ) which was purified from inclusion bodies was relatively pure and without major contaminants (e.g. other proteins or LPS), the sample was again separated on a 10% (w/v) SDS-PAGE gel and visualised by staining with Coomassie brilliant blue R250 or silver nitrate (Fig 11 ; A). Aside from the recombinant protein, no other protein or carbohydrate bands were observed within the geis. Although this does not rule out the potential presence of very low level contaminants which may not be visible on the SDS- PAGE gels, it does suggest that it is of sufficient purity for use in fish trials.

Toxicity of r-flagellin to rainbow trout

Since native Y. ruckeri flagellin caused fish mortality at higher levels, it was considered vital that r-flagellin was also administered to fish (average weight = 5 to 6 g) over a range of amounts (0, 10, 25, 50, 100, 150, 200 Mg/fish) before commencing large-scale vaccinations in order to test for toxicity. For each test group, at least 5 fish were injected with each amount. After anaesthesia, each preparation was administered in volumes of 100 μΙ. All fish had recovered from anaesthetic within 15 min and showed no signs of distress. After 48 h, all fish remained alive (100% survival), again showing excellent signs of health. Additionally, there was no sign of inflammation or discolouration on any fish at the point of injection, nor were there any observable changes between the internal organs of test or control fish (i.e. those which did not receive injections), in this respect it is likely that Y. ruckeri flagellin was not the cause of death in fish previously administered with the native preparation since all fish administered with the recombinant protein survived.

One explanation as to why the native preparation killed fish at high doses is the presence of additional molecules and/or compounds which are toxic for fish at higher concentrations (e.g. LPS). Silver staining of both native and recombinant protein was performed to detect any contaminating material (Fig 12). Whereas the r-flagellin preparation was again shown to be pure, a low molecular weight band was present within the native preparation. This may be low molecular weight proteins from growth media or the lipid A region of LPS. However, the characteristic "smear" of carbohydrate from LPS was not detectable, suggesting that LPS is not a major contaminant. Contamination with other proteins was considered to be minimal.

A notable difference between fish administered with r-flagellin or native flagellin was the rate by which fish recovered from anaesthetic. Whereas trout administered with r-flagellin recovered within a matter of minutes, fish injected with higher concentrations of native flagellin failed to fully recover before dying. Thus, r-flagellin could be safely administered to fish at relatively high concentrations without any detrimental effects to health.

Protection conferred by r-flagellin

The protective effect of r-flagellin against V. ruckeri infections for rainbow trout (average weight = 5 to 6 g) was investigated. Groups of non-vaccinated rainbow trout (average weight = 5 to 6 g) were administered with a low range of r-flagellin (0, 10, 25 and 50 pg/ fish in 200 μΙ PBS). The highest concentration of r-flagellin tested was again 50 pg/fish as this concentration sufficiently protected against bacterial challenge when using the native protein as a vaccine. Each group consisted of 20 fish (N = 20) and were anaesthetised prior to administering the vaccine by i.p. injection. All fish fully recovered from anaesthesia and resumed feeding. No discoloration and/or inflammation at the site of injection were observable. Livestock were maintained in the aquarium, without disturbing, for 14 days as opposed to 28 days to determine if protection was observable within a shorter time period. Fish were then sedated in anaesthetic before injecting freshly grown V. ruckeri EX5 [R1] ceils (1 x 10⁵ bacterial cells/fish). All fish fully recovered from anaesthesia and were closely observed for 7 days post-challenge.

Results from this challenge are shown in Fig 13. In this case, all fish administered with r-flagellin survived (RPS = 100%), whereas those mock-vaccinated with PBS showed mortalities of 30 %. Many of those which died showed characteristic signs of ERM including haemorrhaging around/within the oral cavity and exophthalmia. Other symptoms included the darkening of skin, internal scaring/liquefaction of tissues and the formation of petechial haemorrhaging around the fins, gills and anus. Infected fish also produced excessive amounts of mucus. When taking any of these symptoms into consideration, in combination with the number of fish which died, 75 % of all fish showed disease-related symptoms (Fig 14). On the other hand the majority of r-flagellin vaccinated fish (59/60) showed excellent signs of health.

Interestingly, all r-flagellin vaccinated fish showed heightened levels of hunger compared to the controls. To investigate what effect this may have on fish physiology, all fish were weighed and measured 7 days posi-challenge. Although data between the control and vaccinated groups was not significantly different, it nonetheless shows that the vaccine does not have a detrimental effect on health. Overall, this data demonstrates that the r-flagellin protein, even at low concentrations (e.g. 10 pg/fish), can be an efficacious vaccine for preventing the development of ERM associated symptoms and mortalities. Protection can also be conferred after a relatively short period of time (e.g. 14 days). In addition, the mode of protection appears to be non-specific insofar as the Y. ruckeri EX5 (R1 ) strain used to challenge vaccinates is not producing the flagellin molecule used as a vaccine.

Investigating the EX5 (R1 ) strain for motility and flagellin production Although the V. ruckeri EX5 (R1 ) strain does not produce detectable flagellin under standard culturing conditions (Fig 1 ; Lane 3), this does not rule out its production under conditions which are known to induce virulence. Furthermore, these conditions are known to be somewhat similar to the conditions encountered by the pathogen inside the host. Thus experiments were carried out to investigate if motility and flagellin expression could be induced in EX5 by varying culture conditions.

The Y. ruckeri EX5 (R1 ) strains grown at 28^'C in TSB were non-motile. Culturing over a range of temperatures (e.g. 17, 20, 25, 30^°C) in TSB, with or without the iron chelator 2, 2'-dipyridyl (100 μ ), did not influence the non-motile phenotype. This shows that motility is not induced under conditions which are known to influence virulence-gene expression. In addition, EX5 (R1 ) isolates remained non-motile irrespective of culturing conditions even when recovered from dead or moribund fish.

Western blots using WCPs from the EX5 (R1 ) isolate, which was again grown under iron-limiting and/or temperature limiting conditions (17°C as opposed to 28°C), are shown in Fig 15. Hybridizing with the anti-flagellin antibody (#15D8) similarly demonstrated that flagellin was not produced by the EX5 (R1 ) strain under any of the conditions known to induce virulence. Taking these results into consideration, it is unlikely that flagellin would be expressed within the host.

Claims

1. A flagellin protein, immunogenic analogue, fragment or modified version from Yersinia ruckeri for use in a method of raising an innate immune response in an organism or to obtain an immune serum.

2. A vaccine composition comprising a flagellin protein, immunogenic analogue, fragment or modified version from Yersinia ruckeri, together with a pharmaceutically acceptable excipient.

3. The protein, immunogenic analogue, fragment or modified version or vaccine according to either of claims 1 or 2 for use in a method of protecting against challenge from organisms which express the flagellin protein and/or organisms which do not express the flagellin protein.

4. The protein, immunogenic analogue, fragment or modified version or vaccine according to any preceding claim wherein the flagellin protein is encoded by the nucleotide sequence shown in SEQ ID NO:5.

5. The protein, immunogenic analogue, fragment or modified version or vaccine according to claims 1-3 wherein the protein, immunogenic analogue, fragment or modified versions is derived from the sequence shown in SEQ ID NO:6,

6. A nucleic acid molecule capable of expressing the protein, immunogenic analogue, fragment or modified version from Yersinia ruckeri for use in a method of raising an innate immune response in an organism or to obtain an immune serum.

7. The protein, immunogenic analogue, fragment or modified version, nucleic acid molecule or vaccine according to any preceding claim which is administered to fish using bath immersion, ingestion, topical administration, or direct injection, preferably intraperitoneal or intramuscular injection.

8. A DNA vaccine comprising a DNA fragment having a nucleotide sequence that encodes a polypeptide having the amino acid sequence shown in SEQ ID NO:6, or an immunogenic analogue, fragment, or modified version thereof.

9. The protein, immunogenic analogue, fragment or modified version, nucleic acid, or vaccine according to any preceding claim for use in a combined vaccine or a multivalent vaccine that prevents infection by other Y. ruckeri of more than one serotype, and/or prevents infection by other pathogenic organisms, such as other bacteria, viruses or protozoa.

10. The protein, immunogenic analogue, fragment or modified version, nucleic acid, or vaccine according to any preceding claim wherein the flagellin protein or an immunogenic portion, analogue or modified version thereof is linked, at its carboxy-terminus to a further component.

1 1. The protein, immunogenic analogue, fragment or modified version, nucleic acid, or vaccine according to claim 10 wherein the further component is one or more C3d components of complement.

12. The protein, immunogenic analogue, fragment or modified version, nucleic acid, or vaccine according to any preceding claim for use in a method of treating salmonoids such as Rainbow Trout and/or Charr.

13. A monoclonal or polyclonal antibody, whether derived from fish, rodents, mammals, avians, or other organisms, that specifically binds to the Y ruckeri flagellin protein as shown in SEQ ID NO: 6, or immunogenic analogue, fragment and/or modified version thereof.

14. A fish or fish population which has been treated or immunised with a protein, immunogenic analogue, fragment or modified version, nucleic acid, or vaccine or vaccine according to any of claims 1 - 12.