WO2013144409A2 - Vectors for identifying hematopoietic lineage - Google Patents

Vectors for identifying hematopoietic lineage Download PDF

Info

Publication number
WO2013144409A2
WO2013144409A2 PCT/ES2013/070200 ES2013070200W WO2013144409A2 WO 2013144409 A2 WO2013144409 A2 WO 2013144409A2 ES 2013070200 W ES2013070200 W ES 2013070200W WO 2013144409 A2 WO2013144409 A2 WO 2013144409A2
Authority
WO
WIPO (PCT)
Prior art keywords
cells
hematopoietic
cell
nucleic acid
isolated
Prior art date
Application number
PCT/ES2013/070200
Other languages
Spanish (es)
French (fr)
Other versions
WO2013144409A3 (en
Inventor
Francisco MARTÍN MOLINA
Pilar MUÑOZ FERNÁNDEZ
Miguel GARCÍA TOSCANO
Karin BENABDELLAH
Marién COBO PULIDO
Per Anderson
Original Assignee
Fundación Pública Andaluza Progreso Y Salud
Instituto De Salud Carlos Iii
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fundación Pública Andaluza Progreso Y Salud, Instituto De Salud Carlos Iii filed Critical Fundación Pública Andaluza Progreso Y Salud
Publication of WO2013144409A2 publication Critical patent/WO2013144409A2/en
Publication of WO2013144409A3 publication Critical patent/WO2013144409A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C12N15/86—Viral vectors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0647—Haematopoietic stem cells; Uncommitted or multipotent progenitors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00—Vector systems having a special element relevant for transcription
    • C12N2830/008—Vector systems having a special element relevant for transcription cell type or tissue specific enhancer/promoter combination

Definitions

  • the present invention is encompassed within the field of biotechnology and more specifically within the field of cell biology and virology.
  • the present invention discloses the use of viral vectors, specifically, lentiviral vectors (LVs) for the identification and isolation of hematopoietic cells derived from pluripotent or multipotent cells.
  • viral vectors specifically, lentiviral vectors (LVs) for the identification and isolation of hematopoietic cells derived from pluripotent or multipotent cells.
  • Pluripotent cells such as iPSs (pluripotent induced cells) or ESCs (embryonic stem cells of the English “Embryonic Stem Cells”) are unique tools for the study of organogenesis, for the development of in vitro models of human genetic diseases (Cancer, neurodegenerative diseases, primary immunodeficiencies, etc.) as well as a potential source of cells for use in therapy.
  • the in vitro differentiation of said pluripotent cells towards hematopoietic lineage provides a unique tool for the study of human hematopoietic development in healthy individuals as well as in individuals presenting diseases related to the immune system.
  • these cells are a unique platform to carry out pharmacological tests (toxicological and / or therapeutic) in the different hematopoietic lines that can be derived from them.
  • a first aspect of the present invention relates to a method for the identification and / or isolation of hematopoietic progenitor cells comprising the following steps:
  • a pluripotent or multipotent stem cell or a group of pluripotent or multipotent stem cells with a nucleic acid molecule capable of integrating into the genome of said cell comprising a first nucleic acid sequence that is operably linked to a second sequence of nucleic acid, where the first nucleic acid sequence comprises the promoter sequence SEQ ID No 1 (proximal promoter) and where the second nucleic acid sequence comprises a marker gene;
  • Identify and / or isolate hematopoietic progenitor cells by analyzing the expression of the marker gene and optionally at least one hematopoietic marker present therein.
  • the first nucleic acid sequence comprises SEQ ID No. 2 (alternative promoter).
  • the nucleic acid molecule capable of integrating into the cell genome is SEQ ID No. 3 (WE vector) or SEQ ID No. 4 (AWE vector).
  • the marker gene encodes for at least one marker protein selected from the list consisting of GFP and eGFP (enhanced green fluorescence protein).
  • the hematopoietic progenitor cells identified and / or isolated are characterized as being negative for the following three phenotypic markers: CD45, CD31 and CD34.
  • the hematopoietic progenitor cells identified and / or isolated are characterized as being positive for CD34 and negative for CD45.
  • the hematopoietic progenitor cells identified and / or isolated are characterized as being positive for CD34 and CD45.
  • the stem cell is pluripotent and is selected from the list consisting of: induced pluripotent cells (iPSs), non-human embryonic stem cells, bone marrow stem cells, blood stem cells of umbilical cord, peripheral blood stem cells and body fat stem cells.
  • iPSs induced pluripotent cells
  • the pluripotent stem cell or group of pluripotent stem cells are induced pluripotent cells (iPSs) or non-human embryonic stem cells.
  • HPCs isolated hematopoietic progenitor cells
  • a third aspect of the invention relates to a population of isolated hematopoietic progenitor cells obtainable according to the method described in the first aspect of the invention or any of its preferred aspects.
  • a fourth aspect of the invention relates to a composition
  • a composition comprising an isolated hematopoietic progenitor cell or an isolated population of hematopoietic progenitor cells obtainable according to the method described in the first aspect of the invention or in any of its preferred aspects.
  • said composition is a pharmaceutical composition that optionally comprises a pharmaceutically acceptable carrier. More preferably, said composition further comprises a second active ingredient.
  • a fifth aspect of the invention refers to the composition of the fourth aspect of the invention for use as a medicament.
  • a hematopoietic nature preferably selected from primary immunodeficiencies and / or autoimmune diseases.
  • AWE and WE vectors mark hematopoietic lineage cells that derive from the differentiation of human pluripotent cells.
  • LTR Long Repeated Terminal Sequence, from English, Long Terminal Repeat.
  • eGFP Enhanced Green Fluorescent Protein.
  • CMV cytomegal virus promoter.
  • EF l-ot elongation factor 1-ot, from English, Elongation Factor 1-a.
  • the NT histogram corresponds to the control of the experiment, where embryonic cells AND-1 controls are shown without incubation with any type of vector. The vectors used in transduction are indicated at the top of the histograms.
  • D Flow cytometry histograms showing the absence of expression of the AWE vector in differentiated embryonic cells towards neural tissue (labeled with the A2B5 antibody in the 3 histograms on the left).
  • non-transduced cells (NT) and vectors expressing GFP were used under the constitutive promoter EF l-ot (pLVTHM).
  • the same histogram on the right shows the same cells transduced with the AWE vector but differentiated to the hematopoietic lineage (as indicated by CD45 marking; Y axis).
  • Figure 2 The expression kinetics of GFP directed by the AWE and WE vectors mimic the hematopoietic differentiation kinetics.
  • the graphs show the correlation between the percentages of GFP (A) and CD45 (B) expression in hESCs AND-1 cells transduced with the AWE, WE and pLVTHM lentiviral vectors at different days of differentiation (0, 10, 15 and 22) , as indicated in each graph.
  • FIG. 3 The transduction of pluripotent cells (hESCs) with the AWE and WE vectors allows visualizing progenitors that give rise to myeloid colonies.
  • Pluripotent cells (hESCs) transduced with the AWE and WE vectors were incubated in culture medium with H4434 methylcellulose (Stem Cell Technologies, USA) for 15 days.
  • the graph shows the efficiency of colony formation (CFU) of the transduced hESCs cells with the AWE and WE vectors by comparing them with the non-transduced hESCs pluripotent cells (NT).
  • CFU colony formation
  • the AWE and WE vectors express GFP in hemogenic progenitors and hematopoietic cells derived from pluripotent cells.
  • H9 pluripotent cells transduced with the AWE vector were incubated with hematopoietic half differentiation for 10 (upper histograms), 15 (central histograms) and 22 (lower histograms) days. Cells transduced on different days were isolated and the expression of markers CD45, CD31 and CD34 was analyzed. The GFP + populations (histograms on the right) and the GFP- (histograms on the left) were first analyzed for the expression of CD45 (Y axis) and CD31 (X axis).
  • GFP + populations (histograms on the right) surrounded by a circle correspond to a new negative hematopoietic precursor for CD31, CD34 and CD45 (CD31-CD34-CD45-), which appears in the initial stages of hematopoietic differentiation and that gradually disappears in the late stages of differentiation (days 15 and 22)
  • Panel B shows the same experimental test performed in panel A but using the pLVTHM vector that expresses GFP through the constitutive promoter
  • Panel C shows the same experimental test performed on panel A and B but using the WE vector.
  • Figure 5 AWE vectors identify a new population with hemogenic capacity and negative CD31.
  • Pluripotent cells transduced with the AWE vector were incubated in the middle of ethical hematopopy differentiation. On day 1 1, said cells were isolated and stained with anti-CD45 and anti-CD31 antibodies (upper histogram). Negative cells for CD31 and CD45 were separated into two populations; positive for the expression of GFP (histogram on the right) and negative for the expression of GFP (histogram on the left) for the expression of GFP. The histograms below (right and left) show the enrichment of separate populations in GFP positive cells.
  • transduction refers to the entry of a viral vector into a cell and the expression (eg, transcription and / or translation) of the sequences it carries in its genome.
  • transfection refers to the introduction of non-viral genetic material (plasmids) and the expression of the sequences it carries.
  • transgene is understood as any nucleic acid sequence that is inserted into the genome of an organism and that comes from a different organism. Therefore, a transgene can be a coding sequence, a non-coding sequence, a cDNA, a gene or a fragment or part thereof, a genomic sequence, a regulatory element and the like. They can be marker sequences (internal or surface) or gene sequences for replacement or complementation for a native gene in the target cell.
  • the term "marker” or “biomarker” is understood as a protein or a fragment thereof, or the sequence encoding said protein or fragment, which distinguishes a cell (or group of cells) from another cell (or group of cells).
  • the fluorescent protein eGFP T has been used as a marker in the present invention
  • pluripotent stem cell / s / pluripotent cell / s refers to those cells that have the ability to self-renew by mitotic divisions or to continue the path of differentiation for which It is programmed and, therefore, produce cells of one or more mature, functional and fully differentiated tissues.
  • Pluripotent stem cells cannot form a complete organism, but any other type of cell corresponding to the three embryonic lineages (endoderm, ectoderm and mesoderm). as well as the germinal and sack vite linen. They can therefore form cell lineages.
  • Sources of pluripotent stem cells for the purposes of the present invention are known pluripotent induced cells (iPSs), both human and non-human embryonic stem cells, bone marrow stem cells, umbilical cord blood stem cells, peripheral blood and body fat stem cells.
  • iPSs pluripotent induced cells
  • the pluripotent stem cells described in the present invention are not limited to those described herein, any of those known for the same purpose may be used.
  • multipotent stem cells are those that can only generate cells of their same layer or lineage of embryonic origin (for example: a bone marrow mesenchymal stem cell, having nature mesodermal, will give rise to cells of that layer such as myocytes, adipocytes or osteocytes, among others).
  • iPSs for the purposes of the present invention is understood as a specific type of pluripotent stem cells, artificially derived from a non-pluripotent cell, usually a somatic adult cell.
  • the iPSs have the same capacity for differentiation and tissue formation as embryonic stem cells, in terms of the expression of certain genes and proteins, in the chromatin methylation patterns, in the formation of embryoid bodies, in the formation of teratomas and in the viable formation of chimeras.
  • embryonic stem cell ESC
  • ESC embryonic stem cell
  • HPC hematopoietic progenitor cell
  • hematopoietic progenitors derived from pluripotent or multipotent cells will be used to refer to HPC cells (hematopoietic progenitor cells) obtained by transducing pluripotent cells, as for example, and not limited to , ESCs, iPSs, bone marrow stem cells, umbilical cord blood stem cells, peripheral blood stem cells and / or body fat stem cells, with the vectors described in the present invention and subsequently differentiated in vitro to stem cells of Ethical hematopoy lineage.
  • HPC cells hematopoietic progenitor cells obtained by transducing pluripotent cells, as for example, and not limited to , ESCs, iPSs, bone marrow stem cells, umbilical cord blood stem cells, peripheral blood stem cells and / or body fat stem cells, with the vectors described in the present invention and subsequently differentiated in vitro to stem cells of Ethical hematopoy lineage.
  • hemogenic progenitors in general, which can be differentiated to hematopoietic and endothelial lineage cells, as well as populations of hemato-restricted progenitors, which will specifically differentiate to hematopoietic lineage cells .
  • hematopoietic differentiation or “differentiation towards hematopoietic lineage” refers to the process in which pluripotent or multipotent cells are transformed into a type of hematopoietic cell.
  • the hematopoietic differentiation process is described as a hierarchy of progenitor cells, in which each successive stage is distinguished from the next by a characteristic phenotype. Therefore, the relationships between parents and their progeny, which define the beginning of the irreversible differentiation of said parents towards a specific hematopoietic lineage, is determined primarily by plasma membrane markers. The expression or not of these markers distinguishes the different parents during hematopoietic maturation and differentiation as shown in the examples section of the present invention.
  • the expression profile of surface markers that present the cellular elements belonging to the hematopoietic system and that allows them to be distinguished from each other, can be analyzed by flow cytometry.
  • hemato-restricted used in the present invention refers to a cell population that differs exclusively from hematopoietic lineage cells, for example, they can be any of the precursors of erythrocytes, platelets, granulocytes, monocytes or lymphocytes.
  • embryonic body is understood as those non-embryonic biological structures formed by aggregates of embryonic cells, with the three germ layers (endoderm, mesoderm and ectoderm) and which can reproduce many of the processes that They occur in the early stages of embryonic development.
  • hemangioblast or "hemogenic progenitor” is understood as the precursor embryonic mesodermal cells of the vascular endothelium and hematopoietic cells.
  • vector refers to a nucleic acid molecule that allows the expression of exogenous genetic material in a host cell.
  • the term "host cell” refers to those cells in which a vector has integrated and expressed its genetic material.
  • the cell is eukaryotic
  • the term also includes the entire progeny of the host cell. It is understood that the entire progeny may not be identical to the parental cell since there may be differentiation processes and / or mutations that occur during replication.
  • the term "lentivirus” refers to a group (or scientific genus) of retroviruses that in nature give rise to slowly developing diseases, due to their low ability to incorporate into the genome of the host cell Modified lentiviral genomes are useful as viral vectors for the insertion of a nucleic acid sequence in a cell.
  • transduction with lentiviral vectors is the ability to maintain a sustained expression of or of the transgenes that it incorporates into its genome. Therefore, the present invention employs lentiviral vectors to provide long-term expression of the transgene of interest in the target cell.
  • these vectors have a lentiviral spine.
  • the phrase "has a lentiviral spine" means that the nucleic acid molecule included in the virus particles that make up the vectors is based on a lentiviral genome.
  • the lentivirus vectors of the present invention are vectors in which a nucleic acid molecule contained in virus particles contains a lentiviral genome derived from the signal packaging sequence (non-coding sequence required for encapsidation of lentiviral RNA strands during the formation of viral particles).
  • lentiviruses are: the human immunodeficiency virus (HIV) (for example, HIV-1 or HIV 2); simian immunodeficiency virus (VIS); the feline immunodeficiency virus (IVF); the virus similar to the Maedi-Visna virus (EV1); equine infectious anemia virus (IEA), and caprine encephalitis arthritis virus (CAEV).
  • promoter refers to a set of control nucleic acid sequences that direct the transcription of a nucleic acid.
  • a promoter includes necessary nucleic acid sequences near the transcription initiation site.
  • a promoter may also optionally include an enhancer or repressor element.
  • a "constitutive promoter” is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an "inducible promoter” is regulated by an external signal or a molecule (for example, a transcription factor).
  • the term “medicament”, as used herein, refers to any substance used for prevention, diagnosis, relief, treatment or cure of diseases in man and animals.
  • the term "gene therapy”, as used herein refers to a general method for treating a pathological condition by inserting an exogenous nucleic acid into a suitable cell (s).
  • the nucleic acid is introduced into the cell, so that its functionality is maintained, for example, maintaining the ability to express a particular polypeptide.
  • the insertion of exogenous nucleic acid results is the expression of a therapeutically effective amount of a particular polypeptide.
  • the cells of the invention can be positive for certain phenotypic markers and negative for others.
  • “Positive” means that the cell expresses the marker. To consider that the marker is expressed, it must be present at a “detectable level”. In this report, “detectable level” means that the marker can be detected by one of the standard methodologies, such as PCR, blotting or FACS.
  • a gene is considered to be expressed by a cell of the invention if it can be reasonably detected after 20 cycles, preferably 25 cycles, and more preferably 30 cycles of PCR, which corresponds to a level of expression in the cell of at least 100 copies per cell. It is considered that a marker is not expressed by a cell of the invention, if the expression cannot be detected at a level of about 10-20 copies per cell.
  • the cell may be weakly positive for a given marker.
  • naturally expressed means that the cells have not been manipulated by recombinant technology, in any way. This is, for example, that the cells have not been artificially induced. to express these markers or to modulate the expression of these markers by the introduction into the cells of exogenous material, such as the introduction of heterologous promoters, or other sequences operatively linked to any of the endogenous genes, or by the introduction of exogenous genes.
  • the term "therapeutically effective amount” refers to an amount of a composition that produces a desired therapeutic effect, and either temporary or permanent, to prevent, treat or improve a condition or relieve symptoms or signs related to a pathological condition. Therefore, a therapeutically effective amount of a composition is also sufficient to cause a pharmacological effect. A therapeutically effective amount of a composition does not have to cause permanent improvement or improvement of symptoms or signs. The exact therapeutically effective amount is an amount of the composition at which the most effective results are produced in terms of the efficacy of the treatment of a given pathology.
  • This amount will vary depending on different factors, among others, to the characteristics of the therapeutic compounds themselves (activity, pharmacokinetics, pharmacodynamics and bioavailability), the physiological condition of the subject (age, sex, type of disease and grade, physical condition In general, the response to a given dose, and the type of medication), and the type of cell in which a nucleic acid is inserted, an expert in clinical and pharmacology can determine a therapeutically effective amount through routine experimentation, is that is, by controlling the subject's response to the administration of a compound and adjusting the dose accordingly.
  • the present invention faces the technical problem of providing a method capable of helping to know the existing mechanisms that lead the pluripotent or multipotent cells to differentiate to the different hematopoietic lineages, this method being capable of Identify early hematopoietic progenitors, as well as study the processes that lead these early progenitors to differentiate in different hematopoietic lineages and their use in clinical settings.
  • Figure 1A shows the construction scheme of these lentiviral vectors.
  • the lentiviral vector WE contains a 500 bp fragment of the WAS proximal promoter (SEQ ID No. 1) that directs the expression of the selected transgene in the embodiments described in the present invention, eGFP, as described in Martin , Toscano et al. 2005; Arabic, Frecha et al.
  • the lentiviral vector AWE contains a 387 bp fragment of the alternative WAS promoter immediately "upstream" of the 500 bp proximal promoter present in the WE vector (see SEQ ID No 2 where the sequence of the alternative promoter linked to the sequence of the proximal promoter is shown ), as described in Martin, Toscano et al. 2005; Arabic, Frecha et al. 2008.
  • the CE and pLVTHM vectors which contain the CMV and EFl-a constitutive promoters respectively, were used as positive controls.
  • the hESCs transduced with the WE and AWE lentiviral vectors containing respectively 1.4 and 1.3 g.c / c were differentiated to the hematopoietic lineage.
  • the expression of eGFP, CD45 and CD33 in said cells was determined after 22 days of induced hematopoietic differentiation (Figure 1C).
  • the WE and AWE vectors were only able to express the eGFP transgene in CD45 positive (CD45 +) and CD33 positive (CD33 +) cells.
  • 92.2% (AWE) and 90% (WE) of the hESCs that were eGFP + were also (CD45 + CD33 +), said extreme indicating almost complete specificity of expression in ethical hematopoy cells.
  • the expression of the transgene or eGFP marker present in the AWE lentiviral vector was analyzed, in hESCs cells transduced with said AWE vector and differentiated to other lineages that were not the hematopoietic lineage, for example to the neural lineage.
  • the hESCs were cultured in suspension in low adhesion culture plates in MSC-CM medium.
  • the hESCs aggregates were cultured in a chemically defined neuronal medium for another 3 days.
  • the neuronal precursors were analyzed by flow cytometry.
  • the pLVTHM vector expressing eGFP through the constitutive promoter EFl- ⁇ was used as a positive control.
  • hESCs transduced with the AWE lentiviral vector and differentiated to a neuronal phenotype were unable to express eGFP.
  • Figure 2 shows the correlation between eGFP and CD45 expression levels in different hematopoietic differentiation experiments of hESCs transduced with the WE and AWE lentiviral vectors. As can be seen in this figure, the greater the hematopoietic differentiation (greater expression of CD45), the greater the expression of GFP when the AWE and WE vectors are used.
  • operably or operatively linked we refer to a first nucleic acid sequence that is operably linked to a second nucleic acid sequence when the first nucleic acid sequence has a functional relationship with the second nucleic acid sequence.
  • the promoter is operatively linked to the marker gene if the promoter affects the transcription or expression of said gene.
  • the authors of the present invention analyzed the expression pattern of the WE and AWE vectors described in the present invention at different times of hematopoietic differentiation.
  • the pluripotential cells transduced with said lentiviral vectors as described in the present invention were analyzed on days 5, 10, 15 and 22 during the hematopoietic differentiation process.
  • the expression of the eGFP transgene present in the AWE and WE vectors began to be observed from day 10 ( Figure 4 A and C, central histogram day 10), progressively increasing on successive days of differentiation until days 10-15 ( Figure 4 A and C, central histograms days 10, 15 and 22).
  • the phenotypic analysis, obtained by flow cytometry, of the eGFP + cells derived from the pluripotential / AWE and WE cells at early days of GFP appearance (day 10) showed that these vectors mark a sub-population very specifically (CD45-CD31 + CD34dim) of hemogenic precursors restricted to the hematopoietic lineage (population shown in the lower histogram of Figure 4A day 10), as well as to hematopoietic precursors (CD45 + CD34 +) (population shown in the upper histogram of Figure 4A day 10).
  • the cell populations (CD31-GFP +) were separated and ( CD31-GFP-) using FACS-sorting ( Figure 5A). Once separated, they were incubated in the culture medium that favors hematopoietic differentiation, previously described. Only cells expressing GFP gave rise to cells (CD31 + CD45 +) after 10 days in this differentiation medium ( Figure 5B).
  • a first aspect of the present invention relates to a method for the identification and / or isolation of hematopoietic progenitor cells (hereinafter "method of the invention") comprising the following steps:
  • a pluripotent or multipotent stem cell or a group of pluripotent or multipotent stem cells with a nucleic acid molecule capable of integrating into the genome of said cell comprising a first nucleic acid sequence that is operably linked to a second sequence of nucleic acid, where the first nucleic acid sequence comprises the promoter sequence SEQ ID No 1 (proximal promoter) and where the second nucleic acid sequence comprises a marker gene;
  • the first nucleic acid sequence comprises SEQ ID No 2 (alternative promoter).
  • the nucleic acid molecule capable of integrating into the cell genome is SEQ ID No 3 (WE vector) or alternatively the nucleic acid molecule capable of integrating into the genome of the cell. cell is SEQ ID No 4 (AWE vector).
  • the present invention describes the use of vectors, specifically lentiviral vectors, that are specific to hematopoietic tissue by being under the control of the was gene promoter.
  • hematopoietic cells derived from pluripotent or multipotent cells can be specifically labeled by, as used in the present invention, the use of marker genes, whether surface or internal, such as the green protein marker gene fluorescence (GFP or eGFP), or the nerve growth factor surface marker (NGF) gene, any other gene can be used marker known in the state of the art for the same purpose.
  • GFP green protein marker gene fluorescence
  • NGF nerve growth factor surface marker
  • the expression of the marker gene thanks to the presence of the WAS promoter, begins in the early stages of hematopoietic development, which allows identifying early hematopoietic progenitors and monitoring them "/ ' « v / ' vo "thereof and from its differentiation process, under different conditions, towards the different lineages of ethical hematopoy cells.
  • the present invention provides a method for the identification and / or isolation of HPCs (hematopoietic progenitor cells) derived from pluripotent or multipotent cells.
  • said hematopoietic progenitor cells that are identified and isolated by the WAS gene are obtained from pluripotent stem cells.
  • pluripotent stem cells are undifferentiated, immature and self-renewing cells capable of differentiating into cells that constitute tissues derived from any of the three embryonic layers, the ectoderm, the endoderm and the mesoderm, that will give rise to known tissues and structures in higher animals.
  • the identified or isolated progenitor cells are derived from induced human pluripotent cells (iPS) or embryonic stem cells, preferably non-human embryonic stem cells.
  • pluripotent stem cells can be obtained from non-viable triploid zygotes (WO03 / 075646).
  • pluripotent cells are human cells that are derived from adult tissue.
  • the nucleic acid molecule used in the method of the present invention can proceed from a method comprising the following steps: a) Transfect or transduce packaging cells with plasmids capable of producing viral vectors, preferably, lentivirals; Y
  • packaging cells are understood as those cells that have been modified to express the viral proteins necessary for the formation of the viral particle, since these have previously been removed from the viral genome for the construction of the vector.
  • the packaging cells are preferably 293T cells.
  • a preferred embodiment that in no way limits the present invention relates to a method for the identification and isolation of HPCs from iPS cells, comprising the following steps:
  • Hematopoietic parents must appear between days 10 and 15 identified by the expression of the marker gene and the expression of the following combinations of markers: CD34 + CD45 +, CD34 + CD45- and to a lesser extent CD34-CD45-.
  • the method for the identification and isolation of HPCs, described in the present invention is characterized in that the transduced or transfected pluripotent or multipotent cells are maintained in a specific culture medium supplemented with cell growth factors to induce their differentiation. at hematopoietic lineage for 10, 15 or 22 days depending on the hematopoietic population desired.
  • hematogenic hematogenic precursors restricted to hematopoietic lineage
  • HPCs that are CD45- hematopoietic precursors
  • at days 15-22 are obtained more differentiated hematopoietic lineage cells, preferably (CD31 + CD45 + CD34-), although hematopoietic progenitors (CD31 + CD45 + CD34 +) can also be detected, on the other hand, on day 22 differentiated hematopoietic cells (CD45 +) are obtained.
  • the method for the identification and / or isolation of HPCs, described in the present invention is characterized in that the marker gene is preferably GFP and / or eGFP and the characteristic hematopoietic markers present in said cells are preferably CD45 , CD31, CD33 and CD34 and / or any combination thereof.
  • the techniques used for such identification are preferably flow cytometry and qRT-PCR techniques, although any other technique used in the state of the art can be used for the same purpose.
  • the method for the identification and isolation of HPCs, described in the present invention is characterized in that the expression of the marker defines the population of hemogenic progenitor cells and hematopoietic cells.
  • expression of the marker and CD45 gene identifies the population of hematopoietic total cells (CD45 +); the expression of the marker gene and the absence of expression of CD31 and CD45 (CD31-CD45-) identifies a new hemogenic progenitor population, the expression of the marker gene and CD31 and the absence of expression of the CD45 marker (CD31 + CD45-) identifies to the population of hemogenic progenitors restricted to the hematopoietic lineage (shown in Figure 4 as CD34dim); expression of the marker gene and of the CD34 and CD45 markers (CD34 + CD45 +) identifies the population of hematopoietic precursors and the expression of the marker gene and CD33 and CD45 (CD33 + CD45 +) identifies the population of differentiated hem
  • Another aspect described in the present invention relates to identifiable and isolable HPC cells by the method described previously.
  • the HSCs identified and / or isolated according to the method described in the present invention are characterized in that they are derived from pluripotent cells that are selected from any of the following: iPSs, ESCs, bone marrow cells, blood cells peripheral, umbilical cord blood cells and / or body fat cells.
  • the HSCs come from mammals, preferably from man.
  • the HPCs identified and / or isolated at day 10 of hematopoietic differentiation are characterized in that they can be: a) hemogenic progenitors, of unknown origin so far (CD45-CD31 -CD34-); b) hemato-restricted hemogenic progenitors (CD45-CD34 + dim cells with the ability to give rise to hematopoiesis only); c) hematopoietic progenitors (CD45 + CD34 + cells that only give rise to hematopoietic lineage).
  • HPCs identified and isolated at day 10 and which are (GFP + CD31-) identify, as mentioned above, a new cell population of hemogenic progenitors of unknown origin so far.
  • the hematopoietic cells identified and isolated on differentiation day according to the method described in the present invention are characterized in that they are mostly differentiated hematopoietic cells (CD31 + CD45 + CD34-), although hematopoietic progenitors can still be detected ( CD31 + CD45 + CD34 +).
  • the hematopoietic cells identified and isolated at day 22 of differentiation according to the method described in the present invention are characterized in that they are mostly CD33 + myeloid cells.
  • Another aspect described in the present invention relates to the use of HPCs, identified and isolated according to the method described in the present invention, for the manufacture of a medicament.
  • Another aspect described in the present invention relates to the use of HPCs identified and isolated according to the method described in the present invention, for the preparation of a pharmaceutical composition for the treatment of hematopoietic pathologies, preferably primary immunodeficiencies and autoimmune diseases. .
  • HPCs identified and isolated according to the method described in the present invention, for use as a medicament.
  • HPCs identified and isolated according to the method described in the present invention, for use in the treatment of diseases of a hematopoietic nature.
  • compositions comprising a therapeutically effective amount of the identified and isolated HPCs according to the method described in the present invention.
  • the pharmaceutical composition of the invention may also contain, when necessary, other compounds to increase, control or otherwise direct the desired therapeutic effect of the cells.
  • Said compounds comprise, among others, auxiliary substances or pharmaceutically acceptable substances, such as, excipients, buffering agents, surfactants, co-solvents, preservatives, etc.
  • metal chelators to stabilize the cell suspension.
  • the stability of the cells in the liquid medium of the pharmaceutical composition of the invention can be improved by the addition of additional substances, such as, for example, aspartic acid, glutamic acid, and so on.
  • Such pharmaceutically acceptable substances that can be used in the pharmaceutical composition of the invention are generally known to those skilled in the art and are normally used in the preparation of cellular compositions.
  • suitable pharmaceutical carriers or excipients are described, for example, in "Remington's Pharmaceutical Sciences” by EW Martin. Additional information on these vehicles can be found in any pharmaceutical technology manual (Galenic Pharmacy).
  • Another aspect described in the present invention relates to said pharmaceutical compositions for use in the treatment of pathologies of a hematopoietic nature, preferably primary immunodeficiencies and autoimmune diseases.
  • Another aspect described in the present invention relates to methods of treating pathologies of a hematopoietic nature characterized in that it comprises the administration of a therapeutically effective amount of the HPCs or of the pharmaceutical composition described in the present invention, to a patient.
  • Example 1 Materials and Methods used to carry out the present invention: 1.1 Lines and culture media. 293T cells were grown in Dulbecco's Modified Eagle Medium medium
  • Figure 1A The construction scheme of the lentiviral vectors used in the present invention is shown in Figure 1A.
  • the lentiviral vector WE contains a 500 bp fragment of the proximal was promoter that directs the expression of the selected transgene in the embodiments described in the present invention, eGFP, as described in: Martin, Toscano et al. .
  • the AWE lentiviral vector contains a 387 bp fragment of the alternative was immediately "upstream" promoter of the 500 bp wasal promoter present in the WE vector, as described in: Martin, Toscano et al. . 2005; Samsung, Frecha et al. 2008. All vectors share the self-activating region "self inactivated (SIN) lentiviral backbone" described by (Zufferey, Dull et al. 1998).
  • the eGFP transgene is expressed under the constitutive promoter EFl-ot (htt: / ' www .addgene. Org / 12247) and the EC vector, expresses the eGFP transgene under the control of the cytomegalovirus constituent promoter (CMV) .
  • CMV cytomegalovirus constituent promoter
  • Lentiviral vectors were produced by the co-transfection of 293T cells with three plasmids: (1) vector plasmid (WE, AWE, CE, and pLVTHM), (2) packaging plasmid (pCMVAR 8.91) and (3) plasmid VSV-G envelope (pMD2.G), as described in Toscano, Frecha et al. 2004.
  • the packaging and wrapping plasmids used were obtained from http: // www. addgene org / Didier Throne.
  • 293T cells were plated on amine-treated Petri dishes (Sarstedt, Newton, NC), to ensure exponential growth and 80% confluence.
  • Plasmids pCMVAR 8.91 and pMD2.G were resuspended in 1.5ml of Opti-MEM (Gibco) together with 60 ⁇ of Lipofectamine 2000 (Invitrogen) or 45 ⁇ TransIT 2020 (Mirus Bio LLC Madison, WI, USA) (proportions of plasmid 3 :twenty-one). This mixture was added to the cell culture, previously washed with Opti-MEM. Viral supernatants were collected, filtered through pores with a diameter of 0.45 ⁇ (Nalgene, Rochester, NY), concentrated by ultracentrifugation (Beckman Coulter) and resuspended in MSC-CM culture medium.
  • the hESCs cells were dissociated for 1 minute at room temperature in the presence of collagenase IV. Subsequently, said hESCs were grown in culture plates treated with matrigel, to which the previously concentrated viral particles were added. During the infection procedure, the hESCs adhere to the surface of the culture plate. When the colonies were confluent they expanded. In some cases a second round of infection was necessary until a concentration of 0.6-1 vg / cel was obtained. 1.4. In vitro hematopoietic differentiation and analysis through the formation of embryoid bodies (EBs)
  • EBs embryoid bodies
  • Pluripotent cells differentiated in vitro to cells of the ethical hematopoy lineage Briefly, on day 0, the hESCs were treated with collagenase IV for 1 min and subsequently separated from the culture plate. Subsequently, these cells to culture dishes low adhesion treated with matrigel (Corning, NY) kept in culture overnight in the presence of culture medium KO-Dulbecco 's modified Eagle's medium (Invitrogen, USA) supplemented with 20 transferred % FBS, 1 mmol / L-glutamine, 0.1 mM non-essential amino acids and 0.1 mM ⁇ -mercaptoethanol to obtain embryoid bodies (EBs).
  • EBs embryoid bodies
  • the EBs obtained were centrifuged and maintained in culture in the same medium described above but supplemented with growth factors: bone morphogenic protein 4 (BMP-4) (25ng / ml), fetal tyrosine ligand 3 (Flt -3L) (300ng / ml), stem cell factor (SCF) (300ng / ml), interleukin 3 (IL-3) (10ng / ml), interleukin 6 (IL-6) (10ng / ml) and granulocyte colony stimulating factor (G-CSF) (50ng / ml) (Chadwick, Wang et al. 2003).
  • BMP-4 bone morphogenic protein 4
  • Flt -3L fetal tyrosine ligand 3
  • SCF stem cell factor
  • IL-3 interleukin 3
  • IL-6 interleukin 6
  • G-CSF granulocyte colony stimulating factor
  • EBs were dissociated by adding collagenase B (Roche Diagnostic, Basel, Switzerland) to the culture medium for 2 hours at 37 ° C followed by a 10 minute incubation at 37 ° C with Cell Dissociation Buffer (Gibco) at day 15 to analyze the formation of colony forming units (CFUs) and on days 10, 15 and 22 to perform flow cytometry analysis (FACS).
  • collagenase B Roche Diagnostic, Basel, Switzerland
  • the hESCs were resuspended in a buffer solution containing PBS + FBS + EDTA and subsequently filtered through a 70 ⁇ filter (Becton Dickinson, San Jose, CA). Once disintegrated, they were incubated in the presence of monoclonal antibodies conjugated with different fluorochromes: anti-CD31-phycoerythrin (PE), anti-CD33-PE, anti-CD34-PE-Cy7 (Becton Dickinson Immunocytometry Systems (BDIS), San Jose, CA ) and anti-CD45-APC (allophycocyanin) (Miltenyi). Live cells were identified by exclusion of 7-AAD (7-amino-actinomiacin D).
  • eGFP The expression of eGFP was also analyzed by flow cytometry with the FACS Canto II cytometer equipped with the FACS Diva analysis software (Becton Dickinson).
  • CFUs Colony Forming Units Test 20,000-35,000 cells were plated in H4434 methylcellulose (Stem Cell Technologies, Vancouver, Canada) supplemented with 30 U / ml EPO. The cells were incubated at 37 ° C and 5% C0 2 . Colonies were counted based on their morphological characteristics after 10-14 days.
  • the protocol was slightly modified from that described by Pankratz (Pankratz, M. T., et al. 2007).
  • the pluripotent cells, hESCs were grown in suspension as hEBs in MSC-CM for 4 days.
  • the hEBs were then cultured in a neural medium composed of DMEM / F 12, non-essential amino acids, 2 ⁇ g / ml of heparin, and the neural supplement N2 (Gibco) for an additional 3 days.
  • Early neural differentiation was evaluated on day 8 of culture by dissociation and staining with the anti-human antibody A2B5 (neural embryonic marker antigen) (Miltenyi Biotech) or its corresponding control isotype.
  • A2B5 neural embryonic marker antigen
  • the hESC AND-1 cell line was transduced with the different vectors shown in Figure 1A (AWE, WE, CE and pLVTHM) and according to the previously mentioned procedures.
  • the vectors CE and pLVTHM were used, which contain the constitutive promoters CMV and EF l-ot, respectively.
  • HESCs transduced with lentiviral vectors WE and AWE containing respectively 1.4 and 1.3 gc / c were differentiated into hematopoietic lineage by, as mentioned above, the culture in the presence of KOt Dulbecco 's modified Eagle' s medium (Invitrogen, USA) supplemented with 20% FBS, 1 mmol / L-glutamine, 0.1 mM non-essential amino acids, 0.1 mM ⁇ -mercaptoethanol and a cocktail of growth factors: BMP-4 (25ng / ml), Flt-3L (300ng / ml ), SCF (300ng / ml), IL-3 (10ng / ml), IL-6 (10ng / ml) and G-CSF (50ng / ml).
  • BMP-4 25ng / ml
  • Flt-3L 300ng / ml
  • SCF 300ng / ml
  • IL-3 10ng / m
  • eGFP, CD45 and CD33 The expression of eGFP, CD45 and CD33 in said cells was determined after 22 days of induced hematopoietic differentiation (Figure 1C). At this stage of differentiation (day 22) The WE and AWE vectors were only able to express the eGFP transgene in CD45 positive (CD45 +) and CD33 positive (CD33 +) cells. In total, 92.2% (AWE) and 90% (WE) of the hESCs that were eGFP +, were also (CD45 + CD33 +), said extreme indicating almost complete specificity of expression in ethical hematopoy cells.
  • AWE transgene or eGFP marker present in the lentiviral vector
  • hESCs aggregates were cultured in a chemically defined neuronal medium (NM): DMEM / F12, non-essential amino acids, 2 ⁇ g / ml heparin and the N2 neural supplement (Gibco) for another 3 days.
  • NM neuronal medium
  • the neuronal precursors were analyzed by flow cytometry.
  • pLVTHM that expresses eGFP through the constitutive promoter EF l-ot.
  • hESCs transduced with the AWE lentiviral vector and differentiated to a neuronal phenotype were unable to express eGFP.
  • Figure 2 shows the correlation between the expression levels of eGFP and CD45 in different hematopoietic differentiation experiments of hESCs transduced with the WE and AWE lentiviral vectors, as described in the present invention.
  • the greater hematopoietic differentiation greater expression of CD45
  • the expression is detected even if there are no hematopoietic cells (CD45 +).
  • Example 3 The AWE and WE vectors specifically mark hematopoietic progenitors at 10-15 day of differentiation.
  • the expression pattern of the WE and AWE vectors described in the present invention at different hematopoietic differentiation times was then analyzed.
  • the pluripotential cells transduced with said lentiviral vectors as described in the present invention were analyzed on days 5, 10, 15 and 22 during the hematopoietic differentiation process.
  • the expression of the eGFP transgene present in the AWE and WE vectors began to be observed from day 10 ( Figure 4 A and C, histogram central day 10), progressively increasing on successive days of differentiation until days 10-15 ( Figure 4 A and C, central histograms days 10, 15 and 22).
  • the cell populations (CD31-GFP +) were separated and ( CD31-GFP-) using FACS-sorting ( Figure 5A). Once separated, they were incubated in the culture medium that favors hematopoietic differentiation, previously described. Only cells expressing GFP gave rise to cells (CD31 + CD45 +) after 10 days in this differentiation medium ( Figure 5B).
  • SEQ ID No 1 Proximal 500 base pair promoter of the WAS gene:

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to the use of specific lentiviral vectors of hematopoietic tissue, which, when under the control of the Wiskott-Aldrich syndrome (WAS) gene promoter (AWE and WE), identify novel hematopoietic progenitors (HPCs) and novel sub-populations within said progenitors derived from pluripotent stem cells. The present invention also describes the HPCs isolated using the aforementioned identification method, as well as the use thereof in the treatment of hematopoietic diseases.

Description

VECTORES PARA LA IDENTIFICACIÓN DEL LINAJE HEMATOPOYÉTICO.  VECTORS FOR THE IDENTIFICATION OF THE HEMATOPOYETIC LINEAGE.
CAMPO DE LA INVENCIÓN FIELD OF THE INVENTION
La presente invención se engloba dentro del campo de la biotecnología y más específicamente dentro del campo de la biología celular y la virología. En particular, la presente invención divulga el uso de vectores virales, específicamente, vectores lentivirales (LVs) para la identificación y aislamiento de células hematopoyéticas derivadas de células pluripotentes ó multipotentes. The present invention is encompassed within the field of biotechnology and more specifically within the field of cell biology and virology. In particular, the present invention discloses the use of viral vectors, specifically, lentiviral vectors (LVs) for the identification and isolation of hematopoietic cells derived from pluripotent or multipotent cells.
ESTADO DE LA TÉCNICA STATE OF THE TECHNIQUE
Las células pluripotentes, como por ejemplo las iPSs (células inducidas pluripotentes) ó las ESCs (células madre embrionarias del inglés "Embryonic Stem Cells") son herramientas únicas para el estudio de la organogénesis, para el desarrollo de modelos in vitro de enfermedades genéticas humanas (Cáncer, enfermedades neurodegenerativas, inmunodeficiencias primarias, etc) así como una potencial fuente de células para su uso en terapia. En este sentido, la diferenciación in vitro de dichas células pluripotentes hacia linaje hematopoyético provee una herramienta única para el estudio del desarrollo hematopoyético humano en individuos sanos así como en individuos que presentan enfermedades relacionadas con el sistema inmune. Por otro lado, dichas células, son una plataforma única para realizar ensayos farmacológicos (toxicológicos y/o terapéuticos) en las diferentes líneas hematopoyéticas que se pueden derivar de ellas. Pluripotent cells, such as iPSs (pluripotent induced cells) or ESCs (embryonic stem cells of the English "Embryonic Stem Cells") are unique tools for the study of organogenesis, for the development of in vitro models of human genetic diseases (Cancer, neurodegenerative diseases, primary immunodeficiencies, etc.) as well as a potential source of cells for use in therapy. In this sense, the in vitro differentiation of said pluripotent cells towards hematopoietic lineage provides a unique tool for the study of human hematopoietic development in healthy individuals as well as in individuals presenting diseases related to the immune system. On the other hand, these cells are a unique platform to carry out pharmacological tests (toxicological and / or therapeutic) in the different hematopoietic lines that can be derived from them.
El problema existente en el estado de la técnica radica en el escaso conocimiento existente de los mecanismos que conducen a las células pluripotentes a diferenciarse hasta los diferentes linajes hematopoyéticos. Este desconocimiento hace que existan dudas acerca de la utilidad y/o seguridad de los productos obtenidos a partir de dichas células en su potencial aplicación terapéutica. Además la modificación genética de este tipo de células ha sido, hasta la fecha, muy complicada debido a la baja eficiencia de los métodos desarrollados y al fuerte silenciamiento de los transgenes. The problem existing in the state of the art lies in the limited existing knowledge of the mechanisms that lead pluripotent cells to differentiate to different hematopoietic lineages. This lack of knowledge leads to doubts about the usefulness and / or safety of the products obtained from these cells in their potential therapeutic application. In addition, the genetic modification of this type of cells has been, to date, very complicated due to the low efficiency of the developed methods and the strong silencing of the transgenes.
En este sentido, es necesario un método que ayude a conocer los mecanismos existentes que conducen a las células pluripotentes a diferenciarse hasta los diferentes linajes hematopoyéticos, siendo este método capaz de identificar progenitores hematopoyéticos tempranos, así como a estudiar los procesos que llevan a estos progenitores tempranos a diferenciarse en los diferentes linajes hematopoyéticos y al uso de los mismos en clínica. In this sense, a method is needed that helps to know the existing mechanisms that lead pluripotent cells to differentiate to different Hematopoietic lineages, this method being able to identify early hematopoietic progenitors, as well as to study the processes that lead these early progenitors to differentiate themselves in the different hematopoietic lineages and their use in clinical practice.
DESCRIPCIÓN DE LA INVENCIÓN DESCRIPTION OF THE INVENTION
Breve descripción de la invención Un primer aspecto de la presente invención, se refiere a un método para la identificación y/o aislamiento de células progenitoras hematopoyéticas que comprende los siguientes pasos:  Brief Description of the Invention A first aspect of the present invention relates to a method for the identification and / or isolation of hematopoietic progenitor cells comprising the following steps:
a. Transfectar o transducir una célula madre pluripotente ó multipotente o un grupo de células madre pluripotentes ó multipotentes con una molécula de ácido nucleico capaz de integrarse en el genoma de dicha célula que comprende una primera secuencia de ácido nucleico que se une operativamente a una segunda secuencia de ácido nucleico, donde la primera secuencia de ácido nucleico comprende la secuencia promotora SEQ ID No 1 (promotor proximal) y donde la segunda secuencia de ácido nucleico comprende un gen marcador;  to. Transfect or transduce a pluripotent or multipotent stem cell or a group of pluripotent or multipotent stem cells with a nucleic acid molecule capable of integrating into the genome of said cell comprising a first nucleic acid sequence that is operably linked to a second sequence of nucleic acid, where the first nucleic acid sequence comprises the promoter sequence SEQ ID No 1 (proximal promoter) and where the second nucleic acid sequence comprises a marker gene;
b. Cultivar las células transfectadas o transducidas con la molécula de ácido nucleico del paso previo en un medio de cultivo específico para inducir su diferenciación a linaje hematopoyético suplementado con factores de crecimiento celular; y  b. Cultivate the cells transfected or transduced with the nucleic acid molecule from the previous step in a specific culture medium to induce their differentiation to hematopoietic lineage supplemented with cell growth factors; Y
c. Identificar y/o aislar células progenitoras hematopoyéticas mediante el análisis de la expresión del gen marcador y opcionalmente al menos un marcador hematopoyético presente en las mismas.  C. Identify and / or isolate hematopoietic progenitor cells by analyzing the expression of the marker gene and optionally at least one hematopoietic marker present therein.
En una realización preferida del primer aspecto de la invención, la primera secuencia de ácido nucleico comprende la SEQ ID No 2 (promotor alternativo). En otra realización preferida del primer aspecto de la invención, la molécula de ácido nucleico capaz de integrarse en el genoma de la célula es la SEQ ID No 3 (vector WE) ó la SEQ ID No 4 (vector AWE). En otra realización preferida del primer aspecto de la invención, el gen marcador codifica para al menos una proteína marcadora selecciona de la lista que consiste en GFP y eGFP (enhanced green fluorescence protein). En otra realización preferida del primer aspecto de la invención, las células progenitoras hematopoyéticas identificadas y/o aisladas se caracterizan por ser negativas para los tres siguientes marcadores fenotípicos: CD45, CD31 y CD34. In a preferred embodiment of the first aspect of the invention, the first nucleic acid sequence comprises SEQ ID No. 2 (alternative promoter). In another preferred embodiment of the first aspect of the invention, the nucleic acid molecule capable of integrating into the cell genome is SEQ ID No. 3 (WE vector) or SEQ ID No. 4 (AWE vector). In another preferred embodiment of the first aspect of the invention, the marker gene encodes for at least one marker protein selected from the list consisting of GFP and eGFP (enhanced green fluorescence protein). In another preferred embodiment of the first aspect of the invention, the hematopoietic progenitor cells identified and / or isolated are characterized as being negative for the following three phenotypic markers: CD45, CD31 and CD34.
En otra realización preferida del primer aspecto de la invención, las células progenitoras hematopoyéticas identificadas y/o aisladas se caracterizan por ser positivas para CD34 y negativas para CD45. In another preferred embodiment of the first aspect of the invention, the hematopoietic progenitor cells identified and / or isolated are characterized as being positive for CD34 and negative for CD45.
En otra realización preferida del primer aspecto de la invención, las células progenitoras hematopoyéticas identificadas y/o aisladas se caracterizan por ser positivas para CD34 y CD45. In another preferred embodiment of the first aspect of the invention, the hematopoietic progenitor cells identified and / or isolated are characterized as being positive for CD34 and CD45.
En aún otra realización preferida del primer aspecto de la invención, la célula madre es pluripotente y se selecciona de la lista que consiste en: células pluripotentes inducidas (iPSs), células madre embrionarias no humanas, células madre de médula ósea, células madre de sangre de cordón umbilical, células madre de sangre periférica y células madre de grasa corporal. Preferiblemente, la célula madre pluripotente o el grupo de células madre pluripotentes son células pluripotentes inducidas (iPSs) ó células madre embrionarias no humanas. Un segundo aspecto de la invención, se refiere a células progenitoras hematopoyéticas (HPCs) aisladas obtenibles de acuerdo con el método descrito en el primer aspecto de la invención ó de cualquiera de sus aspectos preferidos. In yet another preferred embodiment of the first aspect of the invention, the stem cell is pluripotent and is selected from the list consisting of: induced pluripotent cells (iPSs), non-human embryonic stem cells, bone marrow stem cells, blood stem cells of umbilical cord, peripheral blood stem cells and body fat stem cells. Preferably, the pluripotent stem cell or group of pluripotent stem cells are induced pluripotent cells (iPSs) or non-human embryonic stem cells. A second aspect of the invention relates to isolated hematopoietic progenitor cells (HPCs) obtainable according to the method described in the first aspect of the invention or any of its preferred aspects.
Un tercer aspecto de la invención, se refiere a una población de células progenitoras hematopoyéticas aisladas obtenibles de acuerdo con el método descrito en el primer aspecto de la invención ó de cualquiera de sus aspectos preferidos. A third aspect of the invention relates to a population of isolated hematopoietic progenitor cells obtainable according to the method described in the first aspect of the invention or any of its preferred aspects.
Un cuarto aspecto de la invención, se refiere a una composición que comprende una célula progenitora hematopoyética aislada ó una población aislada de células progenitoras hematopoyéticas obtenibles de acuerdo con el método descrito en el primer aspecto de la invención ó en cualquiera de sus aspectos preferidos. Preferiblemente, dicha composición es una composición farmacéutica que opcionalmente comprende un vehículo farmacéuticamente aceptable. Más preferiblemente, dicha composición además comprende un segundo principio activo. A fourth aspect of the invention relates to a composition comprising an isolated hematopoietic progenitor cell or an isolated population of hematopoietic progenitor cells obtainable according to the method described in the first aspect of the invention or in any of its preferred aspects. Preferably, said composition is a pharmaceutical composition that optionally comprises a pharmaceutically acceptable carrier. More preferably, said composition further comprises a second active ingredient.
Un quinto aspecto de la invención, se refiere a la composición del cuarto aspecto de la invención para su uso como medicamento. Preferiblemente, para su uso en el tratamiento de enfermedades de naturaleza hematopoyética, preferiblemente seleccionadas entre inmunodeficiencias primarias y/o enfermedades autoinmunes A fifth aspect of the invention refers to the composition of the fourth aspect of the invention for use as a medicament. Preferably, for use in the treatment of diseases of a hematopoietic nature, preferably selected from primary immunodeficiencies and / or autoimmune diseases.
Breve descripción de las figuras Brief description of the figures
Figura 1. Los vectores AWE y WE marcan células del linaje hematopoyético que derivan de la diferenciación de células pluripotentes humanas. Figure 1. AWE and WE vectors mark hematopoietic lineage cells that derive from the differentiation of human pluripotent cells.
A. Esquema de construcción de los vectores lentivirales utilizados en la presente invención a partir del ADN genómico de los mismos (AWE, WE, CE y pLVTHM) utilizados en la presente invención. LTR: secuencia terminal repetida larga, del inglés, Long Terminal Repeat. eGFP: proteína verde fluorescente mejorada, del inglés, Enhanced Green Fluorescent Protein. CMV: promotor del citomegalo virus. EF l-ot: factor de elongación 1-ot, del inglés, Elongation Factor 1-a.  A. Scheme of construction of the lentiviral vectors used in the present invention from the genomic DNA thereof (AWE, WE, CE and pLVTHM) used in the present invention. LTR: Long Repeated Terminal Sequence, from English, Long Terminal Repeat. eGFP: Enhanced Green Fluorescent Protein. CMV: cytomegal virus promoter. EF l-ot: elongation factor 1-ot, from English, Elongation Factor 1-a.
B. Histogramas de citometría de flujo en los que se muestra la expresión de los marcadores GFP (eje X) y CD45 (eje Y) en la línea celular de hESC, AND-1, 40 días después de ser transducidas con los vectores lentivirales CE (1.25 genomas del vector por célula (vg/c)), pLVTHM (0.3vg/c), AWE (1.3vg/c) y WE (1.4 vg/c). El histograma NT corresponde al control del experimento, dónde se muestran células embrionarias AND-1 controles sin incubar con ningún tipo de vector. En la parte superior de los histogramas se indican los vectores utilizados en la transducción.  B. Flow cytometry histograms showing the expression of the GFP (X axis) and CD45 (Y axis) markers in the hESC, AND-1 cell line, 40 days after being transduced with the EC lentiviral vectors (1.25 vector genomes per cell (vg / c)), pLVTHM (0.3vg / c), AWE (1.3vg / c) and WE (1.4 vg / c). The NT histogram corresponds to the control of the experiment, where embryonic cells AND-1 controls are shown without incubation with any type of vector. The vectors used in transduction are indicated at the top of the histograms.
C. Histogramas de citometría de flujo mostrando la especificidad de expresión de los vectores AWE y WE en las células hematopoy éticas. Los histogramas muestran el análisis fenotípico de las células hESC AND-1 transducidas con los vectores AWE, WE y pLVTHM en las poblaciones marcadas, es decir que expresan GFP (GFP+) y no marcadas, es decir que no expresan GFP (GFP-). Los histogramas centrales muestran la morfología de las células arriba mencionadas (eje Y; SSC) frente a la expresión de GFP (eje X).En los histogramas laterales se analiza la expresión de CD45 (eje Y) y CD33 (eje X) de las células GFP negativas (izquierda) y GFP positivas (derecha). Los números que aparecen en cada uno de los histogramas representan el porcentaje de células positivas presentes en cada uno.  C. Flow cytometry histograms showing the specificity of expression of AWE and WE vectors in ethical hematopoy cells. The histograms show the phenotypic analysis of the hESC AND-1 cells transduced with the AWE, WE and pLVTHM vectors in the labeled populations, that is to say they express GFP (GFP +) and unlabeled, that is, they do not express GFP (GFP-). The central histograms show the morphology of the above-mentioned cells (Y axis; SSC) versus GFP expression (X axis). In the lateral histograms the expression of CD45 (Y axis) and CD33 (X axis) of the cells is analyzed. GFP negative (left) and GFP positive (right) cells. The numbers that appear in each of the histograms represent the percentage of positive cells present in each.
D. Histogramas de citometría de flujo mostrando la ausencia de expresión del vector AWE en células embrionarias diferenciadas hacia tejido neural (marcado con el anticuerpo A2B5 en los 3 histogramas de la izquierda). Como control se utilizó células no transducidas (NT) y vectores expresando GFP bajo el promotor constitutivo EF l-ot (pLVTHM). En el histograma de la derecha se muestran las mismas células transducidas con el vector AWE pero diferenciadas hacia el linaje hematopoyético (como indica el mareaje con CD45; Eje Y). Figura 2. La cinética de expresión de GFP dirigida por los vectores AWE y WE mimetiza la cinética de diferenciación hematopoyética. Las gráficas muestran la correlación entre los porcentajes de expresión de GFP (A) y CD45 (B) en células hESCs AND-1 transducidas con los vectores lentivirales AWE, WE y pLVTHM a diferentes días de diferenciación (0, 10, 15 y 22), tal y como se indica en cada gráfica. D. Flow cytometry histograms showing the absence of expression of the AWE vector in differentiated embryonic cells towards neural tissue (labeled with the A2B5 antibody in the 3 histograms on the left). As a control, non-transduced cells (NT) and vectors expressing GFP were used under the constitutive promoter EF l-ot (pLVTHM). The same histogram on the right shows the same cells transduced with the AWE vector but differentiated to the hematopoietic lineage (as indicated by CD45 marking; Y axis). Figure 2. The expression kinetics of GFP directed by the AWE and WE vectors mimic the hematopoietic differentiation kinetics. The graphs show the correlation between the percentages of GFP (A) and CD45 (B) expression in hESCs AND-1 cells transduced with the AWE, WE and pLVTHM lentiviral vectors at different days of differentiation (0, 10, 15 and 22) , as indicated in each graph.
Figura 3. La transducción de células pluripotentes (hESCs) con los vectores AWE y WE permite visualizar progenitores que dan lugar a colonias mieloides. Células pluripotentes (hESCs) transducidas con los vectores AWE y WE se incubaron en medio de cultivo con metilcelulosa H4434 (Stem Cell Tecnologies, USA) durante 15 días. Figure 3. The transduction of pluripotent cells (hESCs) with the AWE and WE vectors allows visualizing progenitors that give rise to myeloid colonies. Pluripotent cells (hESCs) transduced with the AWE and WE vectors were incubated in culture medium with H4434 methylcellulose (Stem Cell Technologies, USA) for 15 days.
A. La gráfica muestra la eficiencia de formación de colonias (CFU) de las células hESCs transducidas con los vectores AWE y WE comparándolas con las células pluripotentes hESCs no transducidas (NT).  A. The graph shows the efficiency of colony formation (CFU) of the transduced hESCs cells with the AWE and WE vectors by comparing them with the non-transduced hESCs pluripotent cells (NT).
B. Fotografías representativas de contraste de fase (paneles superiores) y de fluorescencia (paneles inferiores) en las que se muestran diversos tipos de colonias encontrados en los ensayos realizados.  B. Representative photographs of phase contrast (upper panels) and fluorescence (lower panels) showing various types of colonies found in the tests performed.
C. Análisis fenotípico de las células obtenidas mediante el método de diferenciación descrito. Las colonias fueron disgregadas y se analizó la expresión de GFP mediante citometría de flujo. Las poblaciones GFP- (histogramas de la izquierda) y GFP+ (histogramas de la derecha) fueron analizadas para la expresión de CD45 (eje X), CD33 (eje Y) y CD14 (eje Y). Los números que aparecen en cada uno de los histogramas representan el porcentaje de células positivas presentes en cada uno.  C. Phenotypic analysis of the cells obtained by the differentiation method described. Colonies were disintegrated and GFP expression was analyzed by flow cytometry. The populations GFP- (histograms on the left) and GFP + (histograms on the right) were analyzed for the expression of CD45 (X axis), CD33 (Y axis) and CD14 (Y axis). The numbers that appear in each of the histograms represent the percentage of positive cells present in each.
Figura 4. Los vectores AWE y WE expresan GFP en progenitores hemogénicos y células hematopoyéticas derivadas de células pluripotentes. Figure 4. The AWE and WE vectors express GFP in hemogenic progenitors and hematopoietic cells derived from pluripotent cells.
A. Células pluripotentes H9 transducidas con el vector AWE fueron incubadas con medio diferenciación hematopoyético durante 10 (histogramas superiores), 15 (histogramas centrales) y 22 (histogramas inferiores) días. Las células transducidas a los diferentes días fueron aisladas y se analizó la expresión de los marcadores CD45, CD31 y CD34. Las poblaciones GFP+ (histogramas de la derecha) y las GFP- (histogramas de la izquierda) fueron primero analizadas para la expresión de CD45 (eje Y) y CD31 (eje X). Las células (CD31+CD45+) (flecha gruesa o población en color azul en la copia de figuras en color) y (CD31+CD45-) (flecha delgada o población en color rojo en la copia de figuras en color) fueron analizadas además para la expresión de CD34. Las poblaciones GFP+ (histogramas de la derecha) rodeadas con un círculo se corresponden con un nuevo precursor hematopoyético negativo para CD31, CD34 y CD45 (CD31-CD34-CD45-), que aparece en las fases iniciales de diferenciación hematopoyética y que va desapareciendo progresivamente en las fases tardías de diferenciación (días 15 y 22) A. H9 pluripotent cells transduced with the AWE vector were incubated with hematopoietic half differentiation for 10 (upper histograms), 15 (central histograms) and 22 (lower histograms) days. Cells transduced on different days were isolated and the expression of markers CD45, CD31 and CD34 was analyzed. The GFP + populations (histograms on the right) and the GFP- (histograms on the left) were first analyzed for the expression of CD45 (Y axis) and CD31 (X axis). The cells (CD31 + CD45 +) (thick arrow or population in blue in the copy of color figures) and (CD31 + CD45-) (thin arrow or population in red in the copy of color figures) were also analyzed for CD34 expression. GFP + populations (histograms on the right) surrounded by a circle correspond to a new negative hematopoietic precursor for CD31, CD34 and CD45 (CD31-CD34-CD45-), which appears in the initial stages of hematopoietic differentiation and that gradually disappears in the late stages of differentiation (days 15 and 22)
B. En el panel B se muestra el mismo ensayo experimental realizado en el panel A pero utilizando el vector pLVTHM que expresa GFP a través del promotor constitutivo B. Panel B shows the same experimental test performed in panel A but using the pLVTHM vector that expresses GFP through the constitutive promoter
EF l-ot. EF l-ot.
C. En el panel C se muestra el mismo ensayo experimental realizado en el panel A y B pero utilizando el vector WE. Figura 5. Los vectores AWE identifican una nueva población con capacidad hemogénica y CD31 negativa.  C. Panel C shows the same experimental test performed on panel A and B but using the WE vector. Figure 5. AWE vectors identify a new population with hemogenic capacity and negative CD31.
A. Células pluripotentes (hESCs) transducidas con el vector AWE fueron incubadas en medio de diferenciación hematopopy ético. A día 1 1, dichas células se aislaron y se tiñeron con anticuerpos anti-CD45 y anti-CD31 (histograma superior). Las células negativas para CD31 y CD45 fueron separadas en dos poblaciones; positivas para la expresión de GFP (histograma de la derecha) y negativas para la expresión de GFP (histograma de la izquierda) para la expresión de GFP. Los histogramas de abajo (derecha e izquierda) muestran el enriquecimiento de las poblaciones separadas en células positivas para GFP.  A. Pluripotent cells (hESCs) transduced with the AWE vector were incubated in the middle of ethical hematopopy differentiation. On day 1 1, said cells were isolated and stained with anti-CD45 and anti-CD31 antibodies (upper histogram). Negative cells for CD31 and CD45 were separated into two populations; positive for the expression of GFP (histogram on the right) and negative for the expression of GFP (histogram on the left) for the expression of GFP. The histograms below (right and left) show the enrichment of separate populations in GFP positive cells.
B. Análisis fenotípico (CD31, CD45) de las células separadas por citometría- sorting 10 días después de incubarlas en medio de diferenciación hematopoyético. Solamente las células que expresaban GFP dieron lugar a células (CD31+CD45+) que eran además GFP positivas en un 100%. Definiciones de la invención  B. Phenotypic analysis (CD31, CD45) of cells separated by cytometry - sorting 10 days after incubation in hematopoietic differentiation medium. Only cells expressing GFP resulted in cells (CD31 + CD45 +) that were also 100% positive GFP. Definitions of the Invention
En primer lugar, las secuencias mencionadas a lo largo de la presente invención se encuentran claramente establecidas en el listado de secuencias así como al final de la presente descripción. First, the sequences mentioned throughout the present invention are clearly established in the sequence listing as well as at the end of the present description.
En el contexto de la presente invención, el término "transducción" se refiere a la entrada de un vector viral en una célula y a la expresión (por ejemplo, transcripción y/o traducción) de las secuencias que porta en su genoma. En el contexto de la presente invención, el término "transfección" refiere a la introducción de material genético no viral (plásmidos) y a la expresión de las secuencias que porta. In the context of the present invention, the term "transduction" refers to the entry of a viral vector into a cell and the expression (eg, transcription and / or translation) of the sequences it carries in its genome. In the context of the present invention, the term "transfection" refers to the introduction of non-viral genetic material (plasmids) and the expression of the sequences it carries.
En el contexto de la presente invención, el término "trasgén" se entiende como cualquier secuencia de ácido nucleico que se inserta en el genoma de un organismo y que proviene de un organismo distinto. Por lo tanto, un transgén puede ser una secuencia de codificación, una secuencia no codificante, un ADNc, un gen o un fragmento o parte del mismo, una secuencia genómica, un elemento regulador y similares. Pueden ser secuencias de marcadores (internos o de superficie) o secuencias de genes para reemplazo o complementación para un gen nativo en la célula diana. In the context of the present invention, the term "transgene" is understood as any nucleic acid sequence that is inserted into the genome of an organism and that comes from a different organism. Therefore, a transgene can be a coding sequence, a non-coding sequence, a cDNA, a gene or a fragment or part thereof, a genomic sequence, a regulatory element and the like. They can be marker sequences (internal or surface) or gene sequences for replacement or complementation for a native gene in the target cell.
En el contexto de la presente invención, el término "marcador" o "biomarcador" se entiende como una proteína o un fragmento de la misma, o a la secuencia que codifica a dicha proteína o fragmento, que distingue una célula (o grupo de células) de otra célula (o grupo de células). En la presente invención se ha utilizado como marcador la proteína fluorescente eGFPT In the context of the present invention, the term "marker" or "biomarker" is understood as a protein or a fragment thereof, or the sequence encoding said protein or fragment, which distinguishes a cell (or group of cells) from another cell (or group of cells). The fluorescent protein eGFP T has been used as a marker in the present invention
En el contexto de la presente invención, el término "célula/s madre pluripotente/s o célula/s pluripotente/s" se refiere a aquéllas células que tienen la capacidad de autorrenovarse mediante divisiones mitóticas o bien de continuar la vía de diferenciación para la que está programada y, por lo tanto, producir células de uno o más tejidos maduros, funcionales y plenamente diferenciados. Las células madre pluripotentes no pueden formar un organismo completo, pero sí cualquier otro tipo de célula correspondiente a los tres linajes embrionarios (endodermo. ectodermo y mesodermo). así como el germinal y el saco vite lino. Pueden, por tanto, formar linajes celulares. Fuentes de células madre pluripotentes a efectos de la presente invención se conocen las células inducidas pluripotentes (iPSs), las células madre embrionarias tanto humanas como no humanas, las células madre de médula ósea, célula madre de la sangre del cordón umbilical, células madre de sangre periférica y células madre de grasa corporal. Las células madre pluripotentes descritas en la presente invención no se limitan a las descritas aquí, pudiendo utilizarse cualquiera de las conocidas para el mismo fin. In the context of the present invention, the term "pluripotent stem cell / s / pluripotent cell / s" refers to those cells that have the ability to self-renew by mitotic divisions or to continue the path of differentiation for which It is programmed and, therefore, produce cells of one or more mature, functional and fully differentiated tissues. Pluripotent stem cells cannot form a complete organism, but any other type of cell corresponding to the three embryonic lineages (endoderm, ectoderm and mesoderm). as well as the germinal and sack vite linen. They can therefore form cell lineages. Sources of pluripotent stem cells for the purposes of the present invention are known pluripotent induced cells (iPSs), both human and non-human embryonic stem cells, bone marrow stem cells, umbilical cord blood stem cells, peripheral blood and body fat stem cells. The pluripotent stem cells described in the present invention are not limited to those described herein, any of those known for the same purpose may be used.
En el contexto de la presente invención, el término "células madre multipotentes" son aquellas que sólo pueden generar células de su misma capa o linaje de origen embrionario (por ejemplo: una célula madre mesenquimal de médula ósea, al tener naturaleza mesodérmica, dará origen a células de esa capa como miocitos, adipocitos u osteocitos, entre otras). In the context of the present invention, the term "multipotent stem cells" are those that can only generate cells of their same layer or lineage of embryonic origin (for example: a bone marrow mesenchymal stem cell, having nature mesodermal, will give rise to cells of that layer such as myocytes, adipocytes or osteocytes, among others).
En el contexto de la presente invención, el término "iPSs", a efectos de la presente invención se entiende como un tipo específico de células madre pluripotentes, artificialmente derivadas de una célula no pluripotente, por lo general una célula adulta somática. Las iPSs poseen la misma capacidad de diferenciación y formación de tejidos que las células madre embrionarias, en términos de la expresión de ciertos genes y proteínas, en los patrones de metilación de la cromatina, en la formación de cuerpos embrioides, en la formación de teratomas y en la formación viable de quimeras. In the context of the present invention, the term "iPSs", for the purposes of the present invention is understood as a specific type of pluripotent stem cells, artificially derived from a non-pluripotent cell, usually a somatic adult cell. The iPSs have the same capacity for differentiation and tissue formation as embryonic stem cells, in terms of the expression of certain genes and proteins, in the chromatin methylation patterns, in the formation of embryoid bodies, in the formation of teratomas and in the viable formation of chimeras.
En el contexto de la presente invención, el término "célula madre embrionaria (ESC)" se entiende como aquéllas células que se obtienen de la masa celular interna del blastocisto. Se utilizan preferentemente para el estudio del desarrollo embrionario y para el entendimiento de los mecanismos y las señales que permiten a una célula pluripotente llegar a formar cualquier célula plenamente diferenciada del organismo. Asimismo, están comenzando a ser utilizadas con éxito en terapias biomédicas. Preferiblemente, por "células madre embrionarias (ESC)" se entiende células madre embrionarias no humanas. En el contexto de la presente invención, el término "célula progenitora hematopoyética (HPC)" se entiende como aquélla célula madre adulta capaz de diferenciarse en células de la sangre y del sistema inmunológico. In the context of the present invention, the term "embryonic stem cell (ESC)" is understood as those cells that are obtained from the internal cell mass of the blastocyst. They are preferably used for the study of embryonic development and for the understanding of the mechanisms and signals that allow a pluripotent cell to form any fully differentiated cell in the organism. They are also beginning to be used successfully in biomedical therapies. Preferably, "embryonic stem cells (ESC)" means non-human embryonic stem cells. In the context of the present invention, the term "hematopoietic progenitor cell (HPC)" is understood as that adult stem cell capable of differentiating into blood cells and the immune system.
En el contexto de la presente invención,, se utilizará el término "progenitores hematopoyéticos derivados de células pluripotentes ó multipotentes", para referirse a las células HPCs (células progenitoras hematopoyéticas) obtenidas mediante la transducción de células pluripotentes, como por ejemplo, y sin limitarse, ESCs, iPSs, células madre de médula ósea, células madre de sangre de cordón umbilical, células madre de sangre periférica y/o células madre de grasa corporal, con los vectores descritos en la presente invención y posteriormente diferenciadas in vitro hacia células madre de linaje hematopoy ético. Dentro de las HPCs identificadas y aisladas en la presente invención, se encuentran poblaciones de progenitores hemogénicos en general, que pueden diferenciarse a células de linaje hematopoyético y endotelial, así como poblaciones de progenitores hemato-restringidos, que se diferenciarán específicamente a células de linaje hematopoyético. En el contexto de la presente invención, el término "diferenciación hematopoyética" ó "diferenciación hacia linaje hematopoyético" hace referencia al proceso en el que las células pluripotentes ó multipotentes se transforman en un tipo de célula hematopoyética. El proceso de diferenciación hematopoyética se describe como una jerarquía de células progenitoras, en la que cada estadio sucesivo se distingue del siguiente por un fenotipo característico. Por ello, las relaciones entre progenitores y su progenie, que definen el inicio de la diferenciación irreversible de dichos progenitores hacia un linaje hematopoyético concreto, se determina fundamentalmente por marcadores de la membrana plasmática. La expresión o no de estos marcadores distingue a los distintos progenitores durante la maduración y diferenciación hematopoyéticas tal como se muestra en el apartado de ejemplos de la presente invención. El perfil de expresión de marcadores de superficie que presentan los elementos celulares pertenecientes al sistema hematopoyético y que permite distinguirlos unos de otros, puede ser analizado mediante citometría de flujo. El término "hemato-restringido" utilizado en la presente invención se refiere a una población celular que se diferencia exclusivamente a células de linaje hematopoyético, como por ejemplo, pueden ser cualquiera de los precursores de los eritrocitos, plaquetas, granulocitos, monocitos o linfocitos. En el contexto de la presente invención, el término "cuerpo embrioide" se entiende como aquéllas estructuras biológicas no embrionarias formadas por agregados de células embrionarias, con las tres capas germinales (endodermo, mesodermo y ectodermo) y que pueden reproducir muchos de los procesos que ocurren en las primeras etapas del desarrollo embrionario. In the context of the present invention, the term "hematopoietic progenitors derived from pluripotent or multipotent cells" will be used to refer to HPC cells (hematopoietic progenitor cells) obtained by transducing pluripotent cells, as for example, and not limited to , ESCs, iPSs, bone marrow stem cells, umbilical cord blood stem cells, peripheral blood stem cells and / or body fat stem cells, with the vectors described in the present invention and subsequently differentiated in vitro to stem cells of Ethical hematopoy lineage. Within the HPCs identified and isolated in the present invention, there are populations of hemogenic progenitors in general, which can be differentiated to hematopoietic and endothelial lineage cells, as well as populations of hemato-restricted progenitors, which will specifically differentiate to hematopoietic lineage cells . In the context of the present invention, the term "hematopoietic differentiation" or "differentiation towards hematopoietic lineage" refers to the process in which pluripotent or multipotent cells are transformed into a type of hematopoietic cell. The hematopoietic differentiation process is described as a hierarchy of progenitor cells, in which each successive stage is distinguished from the next by a characteristic phenotype. Therefore, the relationships between parents and their progeny, which define the beginning of the irreversible differentiation of said parents towards a specific hematopoietic lineage, is determined primarily by plasma membrane markers. The expression or not of these markers distinguishes the different parents during hematopoietic maturation and differentiation as shown in the examples section of the present invention. The expression profile of surface markers that present the cellular elements belonging to the hematopoietic system and that allows them to be distinguished from each other, can be analyzed by flow cytometry. The term "hemato-restricted" used in the present invention refers to a cell population that differs exclusively from hematopoietic lineage cells, for example, they can be any of the precursors of erythrocytes, platelets, granulocytes, monocytes or lymphocytes. In the context of the present invention, the term "embryoid body" is understood as those non-embryonic biological structures formed by aggregates of embryonic cells, with the three germ layers (endoderm, mesoderm and ectoderm) and which can reproduce many of the processes that They occur in the early stages of embryonic development.
En el contexto de la presente invención, el término "hemangioblasto" o "progenitor hemogénico" se entiende como las células mesodérmicas embrionarias precursoras del endotelio vascular y de las células hematopoyéticas. En el contexto de la presente invención, el término "vector" se refiere a una molécula de ácido nucleico que permite la expresión de material genético exógeno en una célula huésped. In the context of the present invention, the term "hemangioblast" or "hemogenic progenitor" is understood as the precursor embryonic mesodermal cells of the vascular endothelium and hematopoietic cells. In the context of the present invention, the term "vector" refers to a nucleic acid molecule that allows the expression of exogenous genetic material in a host cell.
En el contexto de la presente invención, el término "célula huésped" se refiere a aquéllas células en las que un vector ha integrado y expresado su material genético. La célula es eucariota. El término también incluye a toda la progenie de la célula huésped. Se entiende que toda la progenie puede no ser idéntica a la célula parental ya que puede haber procesos de diferenciación y/o mutaciones que ocurren durante la replicación. En el contexto de la presente invención, el término "lentivirus" se refiere a un grupo (o género científico) de los retrovirus que en la naturaleza dan lugar a enfermedades de desarrollo lento, debido a su baja capacidad de incorporación en el genoma de la célula huésped. Genomas lentivirales modificados son útiles como vectores virales para la inserción de una secuencia de ácido nucleico en una célula. Otra de las ventajas de la transducción con vectores lentivirales es la capacidad de mantener una expresión sostenida de o de los transgenes que incorpora en su genoma. Por lo tanto, la presente invención emplea los vectores lentivirales para proporcionar la expresión del trasgén de interés en la célula diana, a largo plazo. En concreto, estos vectores tienen una columna vertebral lentiviral. La frase "tiene una columna vertebral lentiviral" significa que la molécula de ácido nucleico incluidos en las partículas del virus que constituyen los vectores se basa en un genoma lentiviral. Por ejemplo, los vectores lentivirus de la presente invención son vectores en los que una molécula de ácido nucleico contenida en partículas de virus contiene un genoma lentiviral derivado de la secuencia señal de empaquetamiento (secuencia no codificante requerida para el encapsidamiento de hebras de ARN lentiviral durante la formación de las partículas víricas). Ejemplos de lentivirus son: el virus de inmunodeficiencia humana (VIH) (por ejemplo, VIH-1 o VIH 2); el virus de inmunodeficiencia simia (VIS); el virus de la inmunodeficiencia felina (FIV); el virus similar al Maedi-Visna virus (EV1); el virus de anemia infecciosa equina (AIE), y el virus de la artritis encefalitis caprina (CAEV). In the context of the present invention, the term "host cell" refers to those cells in which a vector has integrated and expressed its genetic material. The cell is eukaryotic The term also includes the entire progeny of the host cell. It is understood that the entire progeny may not be identical to the parental cell since there may be differentiation processes and / or mutations that occur during replication. In the context of the present invention, the term "lentivirus" refers to a group (or scientific genus) of retroviruses that in nature give rise to slowly developing diseases, due to their low ability to incorporate into the genome of the host cell Modified lentiviral genomes are useful as viral vectors for the insertion of a nucleic acid sequence in a cell. Another advantage of transduction with lentiviral vectors is the ability to maintain a sustained expression of or of the transgenes that it incorporates into its genome. Therefore, the present invention employs lentiviral vectors to provide long-term expression of the transgene of interest in the target cell. Specifically, these vectors have a lentiviral spine. The phrase "has a lentiviral spine" means that the nucleic acid molecule included in the virus particles that make up the vectors is based on a lentiviral genome. For example, the lentivirus vectors of the present invention are vectors in which a nucleic acid molecule contained in virus particles contains a lentiviral genome derived from the signal packaging sequence (non-coding sequence required for encapsidation of lentiviral RNA strands during the formation of viral particles). Examples of lentiviruses are: the human immunodeficiency virus (HIV) (for example, HIV-1 or HIV 2); simian immunodeficiency virus (VIS); the feline immunodeficiency virus (IVF); the virus similar to the Maedi-Visna virus (EV1); equine infectious anemia virus (IEA), and caprine encephalitis arthritis virus (CAEV).
En el contexto de la presente invención, el término "promotor" se refiere a un conjunto de secuencias de ácidos nucleicos de control que dirigen la transcripción de un ácido nucleico. Un promotor incluye secuencias de ácidos nucleicos necesarios cerca del lugar de inicio de la transcripción. Un promotor puede también incluir opcionalmente un elemento potenciador o represor. Un "promotor constitutivo" es un promotor que está continuamente activo y no está sujeto a regulación por señales externas o moléculas. En contraste, la actividad de un "promotor inducible" está regulada por una señal externa o de una molécula (por ejemplo, un factor de transcripción). En el contexto de la presente invención, el término "medicamento", tal y como se usa en esta memoria, hace referencia a cualquier sustancia usada para prevención, diagnóstico, alivio, tratamiento o curación de enfermedades en el hombre y los animales. En el contexto de la presente invención, el término "terapia génica", como se usa aquí se refiere a un método general para el tratamiento de una condición patológica mediante la inserción de un ácido nucleico exógeno en una célula adecuada(s). El ácido nucleico se introduce en la célula, de tal manera que se mantenga su funcionalidad, por ejemplo, mantener la capacidad de expresar un polipéptido particular. En algunos casos, la inserción de los resultados del ácido nucleico exógeno es la expresión de una cantidad terapéuticamente efectiva de un polipéptido particular. In the context of the present invention, the term "promoter" refers to a set of control nucleic acid sequences that direct the transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the transcription initiation site. A promoter may also optionally include an enhancer or repressor element. A "constitutive promoter" is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an "inducible promoter" is regulated by an external signal or a molecule (for example, a transcription factor). In the context of the present invention, the term "medicament", as used herein, refers to any substance used for prevention, diagnosis, relief, treatment or cure of diseases in man and animals. In the context of the present invention, the term "gene therapy", as used herein refers to a general method for treating a pathological condition by inserting an exogenous nucleic acid into a suitable cell (s). The nucleic acid is introduced into the cell, so that its functionality is maintained, for example, maintaining the ability to express a particular polypeptide. In some cases, the insertion of exogenous nucleic acid results is the expression of a therapeutically effective amount of a particular polypeptide.
En el contexto de la presente invención, las células de la invención pueden ser positivas para ciertos marcadores fenotípicos y negativos para otros. "Positivo" significa que la célula expresa el marcador. Para considerar que el marcador es expresado, debe estar presente a un "nivel detectable". En esta memoria, por "nivel detectable" se entiende que el marcador puede detectarse por uno de las metodologías estándar, tales como PCR, blotting o FACS. Se considera que un gen es expresado por una célula de la invención si puede ser razonablemente detectada tras 20 ciclos, preferiblemente 25 ciclos, y más preferiblemente 30 ciclos de PCR, que corresponde a un nivel de expresión en la célula de al menos 100 copias por célula. Se considera que un marcador no es expresado por una célula de la invención, si la expresión no puede ser detectada a un nivel de alrededor de 10 - 20 copias por célula. Entre estos niveles de positivo/negativo, la célula puede ser débilmente positiva para un determinado marcador. In the context of the present invention, the cells of the invention can be positive for certain phenotypic markers and negative for others. "Positive" means that the cell expresses the marker. To consider that the marker is expressed, it must be present at a "detectable level". In this report, "detectable level" means that the marker can be detected by one of the standard methodologies, such as PCR, blotting or FACS. A gene is considered to be expressed by a cell of the invention if it can be reasonably detected after 20 cycles, preferably 25 cycles, and more preferably 30 cycles of PCR, which corresponds to a level of expression in the cell of at least 100 copies per cell. It is considered that a marker is not expressed by a cell of the invention, if the expression cannot be detected at a level of about 10-20 copies per cell. Among these positive / negative levels, the cell may be weakly positive for a given marker.
En el contexto de la presente invención, el término "expresión natural", o "expresa naturalmente" significa que las células no han sido manipuladas por tecnología recombinante, de ninguna forma, Esto es, por ejemplo, que las células no han sido inducidas artificialmente a expresar estos marcadores o a modular la expresión de estos marcadores mediante la introducción en las células de material exógeno, como la introducción de promotores heterólogos, u otras secuencias unidas operativamente a cualquiera de los genes endógenos, o mediante la introducción de genes exógenos. In the context of the present invention, the term "natural expression", or "naturally expressed" means that the cells have not been manipulated by recombinant technology, in any way. This is, for example, that the cells have not been artificially induced. to express these markers or to modulate the expression of these markers by the introduction into the cells of exogenous material, such as the introduction of heterologous promoters, or other sequences operatively linked to any of the endogenous genes, or by the introduction of exogenous genes.
En el contexto de la presente invención, el término "cantidad terapéuticamente efectiva" se refiere a una cantidad de una composición que produce un efecto terapéutico deseado, ya sea temporal o permanente, para prevenir, tratar o mejorar una condición o aliviar síntomas o indicios relacionados con una condición patológica. Por lo tanto, una cantidad terapéuticamente efectiva de una composición también es suficiente para causar un efecto farmacológico. Una cantidad terapéuticamente efectiva de una composición no tiene por qué causar una mejoría permanente o la mejora de los síntomas o indicios. La cantidad exacta terapéuticamente efectiva es una cantidad de la composición a la que se producen los resultados más eficaces en términos de eficacia del tratamiento de una patología determinada. Esta cantidad variará dependiendo de diferentes factores, entre otros, a las características de los propios compuestos terapéuticos (actividad, la farmacocinética, la farmacodinamia y biodisponibilidad), la condición fisiológica del sujeto (edad, sexo, tipo de enfermedad y el grado, condición física general, la respuesta a una dosis determinada, y el tipo de medicamento), y el tipo de célula en que se inserta un ácido nucleico, un experto en clínica y farmacología podrá determinar una cantidad terapéuticamente efectiva a través de una experimentación de rutina, es decir, mediante el control de la respuesta del sujeto a la administración de un compuesto y el ajuste de la dosis en consecuencia. In the context of the present invention, the term "therapeutically effective amount" refers to an amount of a composition that produces a desired therapeutic effect, and either temporary or permanent, to prevent, treat or improve a condition or relieve symptoms or signs related to a pathological condition. Therefore, a therapeutically effective amount of a composition is also sufficient to cause a pharmacological effect. A therapeutically effective amount of a composition does not have to cause permanent improvement or improvement of symptoms or signs. The exact therapeutically effective amount is an amount of the composition at which the most effective results are produced in terms of the efficacy of the treatment of a given pathology. This amount will vary depending on different factors, among others, to the characteristics of the therapeutic compounds themselves (activity, pharmacokinetics, pharmacodynamics and bioavailability), the physiological condition of the subject (age, sex, type of disease and grade, physical condition In general, the response to a given dose, and the type of medication), and the type of cell in which a nucleic acid is inserted, an expert in clinical and pharmacology can determine a therapeutically effective amount through routine experimentation, is that is, by controlling the subject's response to the administration of a compound and adjusting the dose accordingly.
Descripción detallada de la invención. Detailed description of the invention.
Tal y como se ha plasmado anteriormente, la presente invención se enfrenta al problema técnico de proveer de un método capaz de ayudar a conocer los mecanismos existentes que conducen a las células pluripotentes ó multipotentes a diferenciarse hasta los diferentes linajes hematopoyéticos, siendo este método capaz de identificar progenitores hematopoyéticos tempranos, así como a estudiar los procesos que llevan a estos progenitores tempranos a diferenciarse en los diferentes linajes hematopoyéticos y al uso de los mismos en clínica. As set forth above, the present invention faces the technical problem of providing a method capable of helping to know the existing mechanisms that lead the pluripotent or multipotent cells to differentiate to the different hematopoietic lineages, this method being capable of Identify early hematopoietic progenitors, as well as study the processes that lead these early progenitors to differentiate in different hematopoietic lineages and their use in clinical settings.
Con el objeto de encontrar dicho método, los autores de la presente invención procedieron a la transducción de la línea celular hESC AND-1 con los diferentes vectores mostrados en la Figura 1A (AWE (SEQ ID No 4), WE (SEQ ID No 3), CE y pLVTHM) y según los procedimientos descritos en el ejemplo 1. En la Figura 1A se muestra el esquema de construcción de estos vectores lentivirales. Como se observa en dicha figura, el vector lentiviral WE contiene un fragmento de 500 pb del promotor proximal WAS (SEQ ID no 1) que dirige la expresión del trasgén seleccionado en las realizaciones descritas en la presente invención, eGFP, según se describe en Martin, Toscano et al. 2005; Toscano, Frecha et al. 2008; Toscano, Benabdellah et al. 2009. Por otro lado, el vector lentiviral AWE contiene un fragmento de 387 pb del promotor alternativo WAS inmediatamente "aguas arriba" del promotor proximal de was de 500 pb presente en el vector WE (ver SEQ ID No 2 donde se muestra la secuencia del promotor alternativo unido a la secuencia del promotor proximal), según se describe en Martin, Toscano et al. 2005; Toscano, Frecha et al. 2008. Como controles positivos se utilizaron los vectores CE y pLVTHM, los cuales contienen los promotores constitutivos CMV y EFl-a respectivamente. In order to find such a method, the authors of the present invention proceeded to the transduction of the hESC AND-1 cell line with the different vectors shown in Figure 1A (AWE (SEQ ID No 4), WE (SEQ ID No 3 ), CE and pLVTHM) and according to the procedures described in Example 1. Figure 1A shows the construction scheme of these lentiviral vectors. As seen in said figure, the lentiviral vector WE contains a 500 bp fragment of the WAS proximal promoter (SEQ ID No. 1) that directs the expression of the selected transgene in the embodiments described in the present invention, eGFP, as described in Martin , Toscano et al. 2005; Tuscan, Frecha et al. 2008; Tuscan, Benabdellah et al. 2009. On the other hand, the lentiviral vector AWE contains a 387 bp fragment of the alternative WAS promoter immediately "upstream" of the 500 bp proximal promoter present in the WE vector (see SEQ ID No 2 where the sequence of the alternative promoter linked to the sequence of the proximal promoter is shown ), as described in Martin, Toscano et al. 2005; Tuscan, Frecha et al. 2008. The CE and pLVTHM vectors, which contain the CMV and EFl-a constitutive promoters respectively, were used as positive controls.
Como se observa en la Figura IB, mediante análisis de citometría de flujo, todos los vectores CE, pLVTHM, WE y AWE, a las concentraciones de 1.25 g.c/c, 0.3 g.c/c, 1.4 g.c/c y 1.3 g.c/c, respectivamente, se integraron eficientemente en el DNA de las hESCs. Sin embargo, sólo los vectores CE y pLVTHM, que portaban promotores constitutivos, CMV y EFl-α, respectivamente expresaron el transgén eGFP en células hESCs indiferenciadas (Figura IB), en un porcentaje de 18.4% y 20.4% respectivamente. Las hESCs transducidas con los vectores lentivirales WE y AWE que contenían respectivamente 1.4 y 1.3 g.c/c fueron diferenciadas hacia el linaje hematopoyético. La expresión de eGFP, CD45 y CD33 en dichas células fue determinada tras 22 días de diferenciación hematopoyética inducida (Figura 1C). En este estadio de diferenciación (día 22) los vectores WE y AWE sólo fueron capaces de expresar el transgén eGFP en células CD45 positivas (CD45+) y CD33 positivas (CD33+). En total, 92.2% (AWE) y el 90% (WE) de las hESCs que eran eGFP+, eran además (CD45+CD33+), indicando dicho extremo una casi completa especificidad de expresión en células hematopoy éticas. As seen in Figure IB, by flow cytometry analysis, all CE, pLVTHM, WE and AWE vectors, at the concentrations of 1.25 gc / c, 0.3 gc / c, 1.4 gc / c and 1.3 gc / c, respectively , were efficiently integrated into the DNA of the hESCs. However, only the CE and pLVTHM vectors, which carried constitutive promoters, CMV and EFl-α, respectively expressed the eGFP transgene in undifferentiated hESCs cells (Figure IB), at a percentage of 18.4% and 20.4% respectively. The hESCs transduced with the WE and AWE lentiviral vectors containing respectively 1.4 and 1.3 g.c / c were differentiated to the hematopoietic lineage. The expression of eGFP, CD45 and CD33 in said cells was determined after 22 days of induced hematopoietic differentiation (Figure 1C). At this stage of differentiation (day 22), the WE and AWE vectors were only able to express the eGFP transgene in CD45 positive (CD45 +) and CD33 positive (CD33 +) cells. In total, 92.2% (AWE) and 90% (WE) of the hESCs that were eGFP +, were also (CD45 + CD33 +), said extreme indicating almost complete specificity of expression in ethical hematopoy cells.
Para demostrar la especificidad del vector lentiviral en el mareaje de células hESC diferenciadas a linaje hematopoyético, se analizó la expresión del trasgén o marcador eGFP presente en el vector lentiviral AWE, en células hESCs transducidas con dicho vector AWE y diferenciadas a otros linajes que no fueran el linaje hematopoyético, por ejemplo al linaje neural. Brevemente, a día 0, las hESCs fueron cultivadas en suspensión en placas de cultivo de baja adhesión en medio MSC-CM. A día 4 los agregados de hESCs fueron cultivados en un medio neuronal químicamente definido durante otros 3 días. A día 7 los precursores neuronales fueron analizados mediante citometría de flujo. Como control positivo se utilizó el vector pLVTHM que expresa eGFP a través del promotor constitutivo EFl-α. Como se observa en la Figura ID, las hESCs trasducidas con el vector lentiviral AWE y diferenciadas hacia un fenotipo neuronal (indicado por la expresión del marcador de superficie neuronal A2B5) fueron incapaces de expresar eGFP. Adicionalmente, en la Figura 2 se muestra la correlación entre los niveles de expresión de eGFP y CD45 en diferentes experimentos de diferenciación hematopoyética de hESCs transducidas con los vectores lentivirales WE y AWE. Como se puede observar en dicha figura, a mayor diferenciación hematopoyética (mayor expresión de CD45) mayor expresión de GFP cuando se utilizan los vectores AWE y WE. Sin embargo cuando se utiliza un vector control que expresa GFP constitutivamente (pLVTHM), la expresión se detecta aunque no existan células hematopoyéticas (CD45+). Estos resultados demuestran claramente que la utilización de vectores capaces de integrarse en el genoma de un célula madre pluripotente que comprendan una molécula de ácido nucleico que a su vez comprende una primera secuencia de ácido nucleico que se une operativamente a una segunda secuencia de ácido nucleico, donde la primera secuencia de ácido nucleico comprende la secuencia promotora SEQ ID No 1 (promotor proximal) o la secuencia promotora SEQ ID No 2 (promotor proximal y promotor alternativo) y donde la segunda secuencia de ácido nucleico comprende un gen marcador; representa una excelente herramienta para conocer los mecanismos existentes que conducen a las células pluripotentes a diferenciarse hasta los diferentes linajes hematopoyéticos. Se hace notar que por unido de forma operativa u operativamente, nos referimos a una primera secuencia de ácido nucleico que se une operativamente a una segunda secuencia de ácido nucleico cuando la primera secuencia de ácido nucleico presenta una relación funcional con la segunda secuencia de ácido nucleico. En nuestro caso, el promotor está unido operativamente al gen marcador si el promotor afecta a la transcripción o expresión de dicho gen. To demonstrate the specificity of the lentiviral vector in the mapping of hESC cells differentiated to hematopoietic lineage, the expression of the transgene or eGFP marker present in the AWE lentiviral vector was analyzed, in hESCs cells transduced with said AWE vector and differentiated to other lineages that were not the hematopoietic lineage, for example to the neural lineage. Briefly, on day 0, the hESCs were cultured in suspension in low adhesion culture plates in MSC-CM medium. On day 4 the hESCs aggregates were cultured in a chemically defined neuronal medium for another 3 days. On day 7 the neuronal precursors were analyzed by flow cytometry. The pLVTHM vector expressing eGFP through the constitutive promoter EFl-α was used as a positive control. As seen in Figure ID, hESCs transduced with the AWE lentiviral vector and differentiated to a neuronal phenotype (indicated by the expression of the A2B5 neuronal surface marker) were unable to express eGFP. Additionally, Figure 2 shows the correlation between eGFP and CD45 expression levels in different hematopoietic differentiation experiments of hESCs transduced with the WE and AWE lentiviral vectors. As can be seen in this figure, the greater the hematopoietic differentiation (greater expression of CD45), the greater the expression of GFP when the AWE and WE vectors are used. However, when a control vector expressing constitutively GFP (pLVTHM) is used, the expression is detected even if there are no hematopoietic cells (CD45 +). These results clearly demonstrate that the use of vectors capable of integrating into the genome of a pluripotent stem cell comprising a nucleic acid molecule which in turn comprises a first nucleic acid sequence that is operably linked to a second nucleic acid sequence, where the first nucleic acid sequence comprises the promoter sequence SEQ ID No 1 (proximal promoter) or the promoter sequence SEQ ID No 2 (proximal promoter and alternative promoter) and where the second nucleic acid sequence comprises a marker gene; It represents an excellent tool to know the existing mechanisms that lead pluripotent cells to differentiate to different hematopoietic lineages. It is noted that by operably or operatively linked, we refer to a first nucleic acid sequence that is operably linked to a second nucleic acid sequence when the first nucleic acid sequence has a functional relationship with the second nucleic acid sequence. . In our case, the promoter is operatively linked to the marker gene if the promoter affects the transcription or expression of said gene.
Adicionalmente, los autores de la presente invención analizaron el patrón de expresión de los vectores WE y AWE descritos en la presente invención a diferentes tiempos de diferenciación hematopoyética. Para ello, las células pluripotenciales transducidas con dichos vectores lentivirales según se describe en la presente invención, fueron analizadas a los días 5, 10, 15 y 22 durante el proceso de diferenciación hematopoyética. La expresión del trasgén eGFP presente en los vectores AWE y WE se comenzó a observar a partir del día 10 (Figura 4 A y C, histograma central día 10), incrementándose progresivamente en días sucesivos de diferenciación hasta los días 10-15 (Figura 4 A y C, histogramas centrales días 10, 15 y 22). El análisis fenotípico, obtenido mediante citometría de flujo, de las células eGFP+ derivadas de las células pluripotenciales/ AWE y WE a días tempranos de aparición de GFP (día 10) mostró que dichos vectores marcan muy específicamente una sub-población (CD45-CD31+CD34dim) de precursores hemogénicos restringidos al linaje hematopoyético (población mostrada en el histograma inferior de la Figura 4A día 10), así como a precursores hematopoyéticos (CD45+CD34+) (población mostrada en el histograma superior de la Figura 4A día 10). Sorprendentemente, en estos estadios iniciales de expresión del trasgén GFP se detecta una población que, a pesar de expresar GFP, no expresa marcadores característicos de progenitores hemogénicos (CD31, CD45, CD34) (población mostrada en el histograma central de la parte izquierda de la Figura 4A y C rodeada por un círculo). Dicha población, claramente visible a día 10 de diferenciación, desaparecía progresivamente durante los días siguientes (15 y 22), conforme aparecían las células hematopoyéticas CD45+ (población mostrada en el histograma central de la parte izquierda de la Figura 4A y C rodeada por un círculo), indicando que podrían tratarse de progenitores hematopoyéticos. Additionally, the authors of the present invention analyzed the expression pattern of the WE and AWE vectors described in the present invention at different times of hematopoietic differentiation. For this, the pluripotential cells transduced with said lentiviral vectors as described in the present invention were analyzed on days 5, 10, 15 and 22 during the hematopoietic differentiation process. The expression of the eGFP transgene present in the AWE and WE vectors began to be observed from day 10 (Figure 4 A and C, central histogram day 10), progressively increasing on successive days of differentiation until days 10-15 (Figure 4 A and C, central histograms days 10, 15 and 22). The phenotypic analysis, obtained by flow cytometry, of the eGFP + cells derived from the pluripotential / AWE and WE cells at early days of GFP appearance (day 10) showed that these vectors mark a sub-population very specifically (CD45-CD31 + CD34dim) of hemogenic precursors restricted to the hematopoietic lineage (population shown in the lower histogram of Figure 4A day 10), as well as to hematopoietic precursors (CD45 + CD34 +) (population shown in the upper histogram of Figure 4A day 10). Surprisingly, in these initial stages of GFP transgene expression a population is detected that, despite expressing GFP, does not express characteristic markers of hemogenic progenitors (CD31, CD45, CD34) (population shown in the central histogram on the left side of the Figure 4A and C surrounded by a circle). This population, clearly visible on day 10 of differentiation, disappeared progressively during the following days (15 and 22), as the CD45 + hematopoietic cells appeared (population shown in the central histogram of the left part of Figure 4A and C surrounded by a circle ), indicating that they could be hematopoietic progenitors.
Para determinar si los vectores estaban expresando GFP en células que no eran del linaje hematopoyético, debido por ejemplo a una expresión indebida o, por el contrario, dicha población tenía capacidad hemogénica, se procedió a separar las poblaciones celulares (CD31-GFP+) y (CD31-GFP-) mediante FACS-sorting (Figura 5A). Una vez separadas se incubaron en el medio de cultivo que favorece la diferenciación hematopoyética, descrito previamente. Solamente las células que expresaban GFP dieron lugar a células (CD31+CD45+) después de 10 días en este medio de diferenciación (Figura 5B). Estos resultados ponen de manifiesto que los vectores WE y AWE, descritos en la presente invención, permiten identificar a un nuevo precursor hematopoyético negativo para CD31, CD34 y CD45 (CD31-CD34-CD45-), que aparece en las fases muy iniciales de diferenciación hematopoyética (Día 10) y que desaparece progresivamente en las fases tardías (días 15 y 22) (Figura 4A y 4C, población celular rodeada de un círculo). To determine if the vectors were expressing GFP in cells that were not of the hematopoietic lineage, for example due to undue expression or, conversely, said population had hemogenic capacity, the cell populations (CD31-GFP +) were separated and ( CD31-GFP-) using FACS-sorting (Figure 5A). Once separated, they were incubated in the culture medium that favors hematopoietic differentiation, previously described. Only cells expressing GFP gave rise to cells (CD31 + CD45 +) after 10 days in this differentiation medium (Figure 5B). These results show that the WE and AWE vectors, described in the present invention, allow the identification of a new negative hematopoietic precursor for CD31, CD34 and CD45 (CD31-CD34-CD45-), which appears in the very initial stages of differentiation hematopoietic (Day 10) and that disappears progressively in the late phases (days 15 and 22) (Figure 4A and 4C, cell population surrounded by a circle).
Estos resultados demuestran que los vectores de la presente invención permiten identificar progenitores hematopoyéticos muy tempranos, identificar sub-poblaciones dentro de las células CD34+CD45- (CD34dim) e incluso detectar nuevos precursores hematopoyéticos dentro de las células CD34-CD45-CD31-. Por lo tanto, un primer aspecto de la presente invención se refiere a un método para la identificación y/o aislamiento de células progenitoras hematopoyéticas (de aquí en adelante "método de la invención") que comprende los siguientes pasos: These results demonstrate that the vectors of the present invention allow to identify very early hematopoietic progenitors, identify sub-populations within the CD34 + CD45- (CD34dim) cells and even detect new hematopoietic precursors within the CD34-CD45-CD31- cells. Therefore, a first aspect of the present invention relates to a method for the identification and / or isolation of hematopoietic progenitor cells (hereinafter "method of the invention") comprising the following steps:
a. Transfectar o transducir una célula madre pluripotente ó multipotente ó un grupo de células madre pluripotentes ó multipotentes con una molécula de ácido nucleico capaz de integrarse en el genoma de dicha célula que comprende una primera secuencia de ácido nucleico que se une operativamente a una segunda secuencia de ácido nucleico, donde la primera secuencia de ácido nucleico comprende la secuencia promotora SEQ ID No 1 (promotor proximal) y donde la segunda secuencia de ácido nucleico comprende un gen marcador;  to. Transfecting or transducing a pluripotent or multipotent stem cell or a group of pluripotent or multipotent stem cells with a nucleic acid molecule capable of integrating into the genome of said cell comprising a first nucleic acid sequence that is operably linked to a second sequence of nucleic acid, where the first nucleic acid sequence comprises the promoter sequence SEQ ID No 1 (proximal promoter) and where the second nucleic acid sequence comprises a marker gene;
b. Cultivar las células transfectadas o transducidas con la molécula de ácido nucleico del paso previo en un medio de cultivo específico para inducir su diferenciación a linaje hematopoyético suplementado con factores de crecimiento celular; y  b. Cultivate the cells transfected or transduced with the nucleic acid molecule from the previous step in a specific culture medium to induce their differentiation to hematopoietic lineage supplemented with cell growth factors; Y
c. Identificar y/o aislar células progenitoras hematopoyéticas mediante el análisis de la expresión del gen marcador y opcionalmente al menos un marcador hematopoyético presente en las mismas. En una realización preferida de este primer aspecto de la invención, la primera secuencia de ácido nucleico comprende la SEQ ID No 2 (promotor alternativo).  C. Identify and / or isolate hematopoietic progenitor cells by analyzing the expression of the marker gene and optionally at least one hematopoietic marker present therein. In a preferred embodiment of this first aspect of the invention, the first nucleic acid sequence comprises SEQ ID No 2 (alternative promoter).
En otra realización preferida del primer aspecto de la invención, la molécula de ácido nucleico capaz de integrarse en el genoma de la célula es la SEQ ID No 3 (vector WE) ó alternativamente la molécula de ácido nucleico capaz de integrarse en el genoma de la célula es la SEQ ID No 4 (vector AWE). In another preferred embodiment of the first aspect of the invention, the nucleic acid molecule capable of integrating into the cell genome is SEQ ID No 3 (WE vector) or alternatively the nucleic acid molecule capable of integrating into the genome of the cell. cell is SEQ ID No 4 (AWE vector).
Por lo tanto la presente invención describe el uso de vectores, específicamente vectores lentivirales, que son específicos del tejido hematopoyético al estar bajo el control del promotor del gen was. Mediante dichos vectores se consigue marcar específicamente las células hematopoyéticas que derivan de células pluripotentes o multipotentes mediante, como se utiliza en la presente invención, el empleo de genes marcadores, ya sean de superficie o internos, como por ejemplo el gen marcador de la proteína verde de fluorescencia (GFP o eGFP, de sus siglas en inglés "enhanced GFP"), o el gen marcador de superficie del factor de crecimiento nervioso (NGF), pudiendo utilizarse cualquier otro gen marcador conocido en el estado de la técnica para el mismo fin. Es de destacar que la expresión del gen marcador, gracias a la presencia del promotor WAS, comienza en las primeras etapas del desarrollo hematopoyético lo que permite identificar progenitores hematopoyéticos tempranos y hacer un seguimiento "/'« v/'vo" de los mismos y de su proceso de diferenciación, en diferentes condiciones, hacia los distintos linajes de células hematopoy éticas. A través de la utilización de estos vectores la presente invención proporciona un método para la identificación y/o aislamiento de HPCs (células progenitores hematopoyéticos) derivadas de células pluripotentes ó multipotentes. En una realización preferida dichas células progenitoras hematopoyéticas que son identificadas y aisladas mediante el gen WAS se obtienen a partir de células madre pluripotentes. Therefore, the present invention describes the use of vectors, specifically lentiviral vectors, that are specific to hematopoietic tissue by being under the control of the was gene promoter. By means of said vectors, hematopoietic cells derived from pluripotent or multipotent cells can be specifically labeled by, as used in the present invention, the use of marker genes, whether surface or internal, such as the green protein marker gene fluorescence (GFP or eGFP), or the nerve growth factor surface marker (NGF) gene, any other gene can be used marker known in the state of the art for the same purpose. It is noteworthy that the expression of the marker gene, thanks to the presence of the WAS promoter, begins in the early stages of hematopoietic development, which allows identifying early hematopoietic progenitors and monitoring them "/ ' « v / ' vo "thereof and from its differentiation process, under different conditions, towards the different lineages of ethical hematopoy cells. Through the use of these vectors the present invention provides a method for the identification and / or isolation of HPCs (hematopoietic progenitor cells) derived from pluripotent or multipotent cells. In a preferred embodiment said hematopoietic progenitor cells that are identified and isolated by the WAS gene are obtained from pluripotent stem cells.
Así, tal y como se ha definido anteriormente, las células madre pluripotentes son células indiferenciadas, inmaduras y con capacidad de autorrenovación capaces de diferenciarse a células que constituyen tejidos derivados de cualquiera de las tres capas embrionarias, el ectodermo, el endodermo y el mesodermo, que darán lugar a los tejidos y estructuras conocidas en los animales superiores. Estas células se pueden obtener bien de una célula somática adulta sobre la cual se induce la expresión de ciertos genes con la finalidad de generar un tipo de célula madre con características pluripotenciales (CMP inducidas, iPS) o aislándolas de la masa celular interna de un embrión en estado de blastocisto, es decir, de una semana o de 5 días (células madre embrionarias, ESC), para crear líneas celulares cultivadas in vitro, que podrán suministrar grandes cantidades de células. Por lo tanto, en una realización preferida, las células progenitoras identificadas o aisladas derivan de células pluripotentes humanas inducidas (iPS) ó de células madre embrionarias, preferiblemente células madre embrionarias no humanas. En otra realización preferida de la invención, las células madre pluripotentes se pueden obtener a partir de cigotos triploides no viables (WO03/075646). Thus, as defined above, pluripotent stem cells are undifferentiated, immature and self-renewing cells capable of differentiating into cells that constitute tissues derived from any of the three embryonic layers, the ectoderm, the endoderm and the mesoderm, that will give rise to known tissues and structures in higher animals. These cells can be obtained either from an adult somatic cell on which the expression of certain genes is induced in order to generate a type of stem cell with pluripotential characteristics (induced CMP, iPS) or by isolating them from the internal cell mass of an embryo in a state of blastocyst, that is, one week or 5 days (embryonic stem cells, ESC), to create in vitro cultured cell lines, which will be able to deliver large amounts of cells. Therefore, in a preferred embodiment, the identified or isolated progenitor cells are derived from induced human pluripotent cells (iPS) or embryonic stem cells, preferably non-human embryonic stem cells. In another preferred embodiment of the invention, pluripotent stem cells can be obtained from non-viable triploid zygotes (WO03 / 075646).
Recientemente también se han descrito células humanas con características pluripotentes de otros tejidos adultos, como por ejemplo de tejido mamario (Somdutta Roy et al., 2013. Rare somatic ce lis from human breast tissue exhibit extensive lineage plasticity ). Por tanto, en otra realización preferida de la invención las células pluripotentes son células humanas que derivan de tejido adulto. Por otro lado, la molécula de ácido nucleico utilizada en el método de la presente invención puede proceder de un método que comprenda los siguientes pasos: a) Transfectar o transducir células empaquetadoras con plásmidos capaces de producir vectores virales, preferentemente, lentivirales; y Recently, human cells with pluripotent characteristics of other adult tissues have also been described, such as breast tissue (Somdutta Roy et al., 2013. Rare somatic ce lis from human breast tissue exhibit extensive lineage plasticity). Therefore, in another preferred embodiment of the invention pluripotent cells are human cells that are derived from adult tissue. On the other hand, the nucleic acid molecule used in the method of the present invention can proceed from a method comprising the following steps: a) Transfect or transduce packaging cells with plasmids capable of producing viral vectors, preferably, lentivirals; Y
b) Aislar y concentrar los vectores lentivirales obtenidos en el paso a) anterior.  b) Isolate and concentrate the lentiviral vectors obtained in step a) above.
A efectos de la presente invención el término "células empaquetadoras" se entiende como aquéllas células que han sido modificadas para expresar las proteínas virales necesarias para la formación de la partícula viral, ya que estas previamente han sido eliminadas de genoma viral para la construcción del vector. En una realización preferida, las células empaquetadoras son preferentemente las células 293T. For the purposes of the present invention the term "packaging cells" is understood as those cells that have been modified to express the viral proteins necessary for the formation of the viral particle, since these have previously been removed from the viral genome for the construction of the vector. . In a preferred embodiment, the packaging cells are preferably 293T cells.
Una realización preferida que de modo alguno limita la presente invención, se refiere a un método para la identificación y aislamiento de HPCs a partir de células iPS, que comprende los siguientes pasos: A preferred embodiment that in no way limits the present invention, relates to a method for the identification and isolation of HPCs from iPS cells, comprising the following steps:
a) Transfectar células empaquetadoras con plásmidos capaces de producir vectores virales, preferentemente, lentivirales.  a) Transfect packaging cells with plasmids capable of producing viral vectors, preferably, lentivirals.
b) Aislar y concentrar los vectores lentivirales obtenidos en el paso a) anterior;  b) Isolate and concentrate the lentiviral vectors obtained in step a) above;
c) Disgregar las cultivos de las iPS con colagenasa IV hasta células aisladas; d) Incubar las iPS con los vectores lentivirales concentrados;  c) Disintegrate the cultures of the iPS with collagenase IV to isolated cells; d) Incubate iPS with concentrated lentiviral vectors;
e) Dejar por 3-5 horas;  e) Leave for 3-5 hours;
f) Lavar con PBS dos veces e incubar con medio de expansión enriquecido; g) Crecer las iPS modificadas con los vectores descritos en la presente invención en medio de expansión;  f) Wash with PBS twice and incubate with enriched expansion medium; g) Grow the modified iPS with the vectors described in the present invention in expansion medium;
h) Transferir las iPS a placas de cultivo de baja adhesión para la obtención de cuerpos embrioides (EBs);  h) Transfer the iPS to low adhesion culture plates to obtain embryoid bodies (EBs);
i) Añadir factores de diferenciación hematopoyético; y  i) Add hematopoietic differentiation factors; Y
j) Disociar a diferentes días los EBs mediante colagenasa B.  j) Dissociate EBs at different days by collagenase B.
Progenitores hematopoyéticos deberán de aparecer entre los días 10 y 15 identificados por la expresión del gen marcador y la expresión de las siguientes combinaciones de marcadores: CD34+CD45+, CD34+CD45- y en menor medida CD34-CD45-. En otra realización preferida, el método para la identificación y aislamiento de HPCs, descrito en la presente invención se caracteriza por que las células pluripotentes o multipotentes transducidas o transfectadas se mantienen en un medio de cultivo específico suplementado con factores de crecimiento celular para inducir su diferenciación a linaje hematopoyético durante 10, 15 o 22 días en función de la población hematopoyética que se desee obtener. En este sentido y como se demuestra en la presente invención, a día 10-11 se obtienen los precursores hemogénicos hemato-restringidos (restringidos a linaje hematopoyético) y los precursores hematopoyéticos (HPCs que son CD45-), a días 15-22 se obtienen células de linaje hematopoyético más diferenciadas, preferentemente, (CD31+CD45+CD34-), aunque también pueden detectarse progenitores hematopoyéticos (CD31+CD45+CD34+), por otro lado, a día 22 se obtienen células hematopoyéticas diferenciadas (CD45+). En otra realización preferida, el método para la identificación y/o aislamiento de HPCs, descrito en la presente invención se caracteriza por que el gen marcador es preferentemente GFP y/o eGFP y los marcadores hematopoyéticos característicos presentes en dichas células son, preferentemente, CD45, CD31, CD33 y CD34 y/o cualquiera de sus combinaciones. Las técnicas utilizadas para dicha identificación son, preferentemente, las técnicas de citometría de flujo y qRT-PCR, aunque puede ser utilizada cualquier otra técnica utilizada en el estado de la técnica para el mismo fin. Hematopoietic parents must appear between days 10 and 15 identified by the expression of the marker gene and the expression of the following combinations of markers: CD34 + CD45 +, CD34 + CD45- and to a lesser extent CD34-CD45-. In another preferred embodiment, the method for the identification and isolation of HPCs, described in the present invention is characterized in that the transduced or transfected pluripotent or multipotent cells are maintained in a specific culture medium supplemented with cell growth factors to induce their differentiation. at hematopoietic lineage for 10, 15 or 22 days depending on the hematopoietic population desired. In this sense and as demonstrated in the present invention, on day 10-11, hematogenic hematogenic precursors (restricted to hematopoietic lineage) and hematopoietic precursors (HPCs that are CD45-) are obtained, at days 15-22 are obtained more differentiated hematopoietic lineage cells, preferably (CD31 + CD45 + CD34-), although hematopoietic progenitors (CD31 + CD45 + CD34 +) can also be detected, on the other hand, on day 22 differentiated hematopoietic cells (CD45 +) are obtained. In another preferred embodiment, the method for the identification and / or isolation of HPCs, described in the present invention is characterized in that the marker gene is preferably GFP and / or eGFP and the characteristic hematopoietic markers present in said cells are preferably CD45 , CD31, CD33 and CD34 and / or any combination thereof. The techniques used for such identification are preferably flow cytometry and qRT-PCR techniques, although any other technique used in the state of the art can be used for the same purpose.
En otra realización preferida, el método para la identificación y aislamiento de HPCs, descrito en la presente invención se caracteriza por que la expresión del marcador define la población de células progenitoras hemogénicas y de células hematopoyéticas. Además, la expresión del gen marcador y de CD45 identifica la población de células totales hematopoyéticas (CD45+); la expresión del gen marcador y la ausencia de expresión de CD31 y CD45 (CD31-CD45-) identifica a una nueva población progenitora hemogénica, la expresión del gen marcador y CD31 y la ausencia de expresión del marcador CD45 (CD31+CD45-) identifica a la población de progenitores hemogénicos restringidos al linaje hematopoyético (mostrado en la Figura 4 como CD34dim); la expresión del gen marcador y de los marcadores CD34 y CD45 (CD34+CD45+) identifica la población de precursores hematopoyéticos y la expresión del gen marcador y CD33 y CD45 (CD33+CD45+) identifica la población de células hematopoyéticas diferenciadas (mieloides). En otra realización preferida, el método para la identificación y/o aislamiento de HPCs, descrito en la presente invención se caracteriza por que las células pluripotentes y las HPCs, son procedentes de mamífero, preferentemente humanas. In another preferred embodiment, the method for the identification and isolation of HPCs, described in the present invention is characterized in that the expression of the marker defines the population of hemogenic progenitor cells and hematopoietic cells. In addition, expression of the marker and CD45 gene identifies the population of hematopoietic total cells (CD45 +); the expression of the marker gene and the absence of expression of CD31 and CD45 (CD31-CD45-) identifies a new hemogenic progenitor population, the expression of the marker gene and CD31 and the absence of expression of the CD45 marker (CD31 + CD45-) identifies to the population of hemogenic progenitors restricted to the hematopoietic lineage (shown in Figure 4 as CD34dim); expression of the marker gene and of the CD34 and CD45 markers (CD34 + CD45 +) identifies the population of hematopoietic precursors and the expression of the marker gene and CD33 and CD45 (CD33 + CD45 +) identifies the population of differentiated hematopoietic cells (myeloids). In another preferred embodiment, the method for the identification and / or isolation of HPCs, described in the present invention is characterized in that pluripotent cells and HPCs are derived from mammals, preferably human.
Otro de los aspectos descritos en la presente invención se refiere a las células HPCs identificables y aislables mediante el método descrito previamente. Another aspect described in the present invention relates to identifiable and isolable HPC cells by the method described previously.
En una realización preferida, las HSCs identificadas y/o aisladas según el método descrito en la presente invención se caracterizan por que derivan de células pluripotentes que se seleccionan de entre cualquiera de las siguientes: iPSs, ESCs, células de médula ósea, células de sangre periférica, células de sangre de cordón umbilical y/o células de grasa corporal. En otra realización más preferida, las HSCs proceden de mamíferos, preferentemente del hombre. In a preferred embodiment, the HSCs identified and / or isolated according to the method described in the present invention are characterized in that they are derived from pluripotent cells that are selected from any of the following: iPSs, ESCs, bone marrow cells, blood cells peripheral, umbilical cord blood cells and / or body fat cells. In another more preferred embodiment, the HSCs come from mammals, preferably from man.
En otra realización preferida, las HPCs identificadas y/o aisladas a día 10 de diferenciación hematopoyética, según el método descrito en la presente invención, se caracterizan por que pueden ser: a) progenitores hemogénicos, de origen desconocido hasta el momento (CD45- CD31-CD34-); b) progenitores hemogénicos hemato-restringidos (células CD45- CD34+dim con capacidad de dar lugar hematopoyesis únicamente); c) progenitores hematopoyéticos (células CD45+CD34+ que solo dan lugar a linaje hematopoyético). In another preferred embodiment, the HPCs identified and / or isolated at day 10 of hematopoietic differentiation, according to the method described in the present invention, are characterized in that they can be: a) hemogenic progenitors, of unknown origin so far (CD45-CD31 -CD34-); b) hemato-restricted hemogenic progenitors (CD45-CD34 + dim cells with the ability to give rise to hematopoiesis only); c) hematopoietic progenitors (CD45 + CD34 + cells that only give rise to hematopoietic lineage).
En otra realización preferida, las HPCs identificadas y aisladas a día 10 y que son (GFP+CD31-) identifican, como hemos mencionado anteriormente, a una nueva población celular de progenitores hemogénicos de origen desconocido hasta el momento. In another preferred embodiment, the HPCs identified and isolated at day 10 and which are (GFP + CD31-) identify, as mentioned above, a new cell population of hemogenic progenitors of unknown origin so far.
En otra realización preferida, las células hematopoyéticas identificadas y aisladas a día 15 de diferenciación según el método descrito en la presente invención se caracterizan por que son en su mayoría células hematopoyéticas diferenciadas (CD31+ CD45+CD34-), aunque todavía pueden detectarse progenitores hematopoyéticos (CD31+CD45+CD34+). In another preferred embodiment, the hematopoietic cells identified and isolated on differentiation day according to the method described in the present invention are characterized in that they are mostly differentiated hematopoietic cells (CD31 + CD45 + CD34-), although hematopoietic progenitors can still be detected ( CD31 + CD45 + CD34 +).
En otra realización preferida, las células hematopoyéticas identificadas y aisladas a día 22 de diferenciación según el método descrito en la presente invención se caracterizan por que son en su mayoría células mieloides CD33+. Otro de los aspectos descritos en la presente invención se refiere al uso de las HPCs, identificadas y aisladas según el método descrito en la presente invención, para la fabricación de un medicamento. Otro de los aspectos descritos en la presente invención se refiere al uso de las HPCs identificadas y aisladas según el método descrito en la presente invención, para la elaboración de una composición farmacéutica para el tratamiento de patologías de naturaleza hematopoyética, preferentemente inmunodeficiencias primarias y enfermedades autoinmunes. In another preferred embodiment, the hematopoietic cells identified and isolated at day 22 of differentiation according to the method described in the present invention are characterized in that they are mostly CD33 + myeloid cells. Another aspect described in the present invention relates to the use of HPCs, identified and isolated according to the method described in the present invention, for the manufacture of a medicament. Another aspect described in the present invention relates to the use of HPCs identified and isolated according to the method described in the present invention, for the preparation of a pharmaceutical composition for the treatment of hematopoietic pathologies, preferably primary immunodeficiencies and autoimmune diseases. .
Otro de los aspectos descritos en la presente invención se refiere a las HPCs, identificadas y aisladas según el método descrito en la presente invención, para uso como medicamento. Another aspect described in the present invention relates to HPCs, identified and isolated according to the method described in the present invention, for use as a medicament.
Otro de los aspectos descritos en la presente invención se refiere a las HPCs, identificadas y aisladas según el método descrito en la presente invención, para uso en el tratamiento de enfermedades de naturaleza hematopoyética. Another aspect described in the present invention relates to HPCs, identified and isolated according to the method described in the present invention, for use in the treatment of diseases of a hematopoietic nature.
Otro de aspectos descritos en la presente invención se refiere a composiciones farmacéuticas que comprenden una cantidad terapéuticamente efectiva de las HPCs identificadas y aisladas según el método descrito en la presente invención. La composición farmacéutica de la invención, si se desea, puede contener también, cuando sea necesario, otros compuestos para aumentar, controlar o dirigir de otro modo el efecto terapéutico deseado de las células. Dichos compuestos comprenden entre otros, sustancias auxiliares o sustancias farmacéuticamente aceptables, tales como, excipientes, agentes tamponantes, tensioactivos, codisolventes, conservantes, etc. También, para estabilizar la suspensión celular, es posible añadir quelantes de metales. La estabilidad de las células en el medio líquido de la composición farmacéutica de la invención puede mejorarse mediante la adición de sustancias adicionales, tales como, por ejemplo, ácido aspártico, ácido glutámico, etcétera. Dichas sustancias farmacéuticamente aceptables que pueden usarse en la composición farmacéutica de la invención son conocidas, en general, los técnicos en la materia y se usan normalmente en la elaboración de composiciones celulares. Ejemplos de vehículos o excipientes farmacéuticos adecuados se describen, por ejemplo, en "Remington's Pharmaceutical Sciences", de E.W. Martin. Puede encontrarse información adicional sobre dichos vehículos en cualquier manual de tecnología farmacéutica (Farmacia Galénica). Otro de los aspectos descritos en la presente invención se refiere a dichas composiciones farmacéuticas para uso en el tratamiento de patologías de naturaleza hematopoyética, preferentemente inmunodeficiencias primarias y enfermedades autoinmunes. Another aspect described in the present invention relates to pharmaceutical compositions comprising a therapeutically effective amount of the identified and isolated HPCs according to the method described in the present invention. The pharmaceutical composition of the invention, if desired, may also contain, when necessary, other compounds to increase, control or otherwise direct the desired therapeutic effect of the cells. Said compounds comprise, among others, auxiliary substances or pharmaceutically acceptable substances, such as, excipients, buffering agents, surfactants, co-solvents, preservatives, etc. Also, to stabilize the cell suspension, it is possible to add metal chelators. The stability of the cells in the liquid medium of the pharmaceutical composition of the invention can be improved by the addition of additional substances, such as, for example, aspartic acid, glutamic acid, and so on. Such pharmaceutically acceptable substances that can be used in the pharmaceutical composition of the invention are generally known to those skilled in the art and are normally used in the preparation of cellular compositions. Examples of suitable pharmaceutical carriers or excipients are described, for example, in "Remington's Pharmaceutical Sciences" by EW Martin. Additional information on these vehicles can be found in any pharmaceutical technology manual (Galenic Pharmacy). Another aspect described in the present invention relates to said pharmaceutical compositions for use in the treatment of pathologies of a hematopoietic nature, preferably primary immunodeficiencies and autoimmune diseases.
Otro de los aspectos descritos en la presente invención se refiere a métodos de tratamiento de patologías de naturaleza hematopoyética caracterizados por que comprende la administración de una cantidad terapéuticamente efectiva de las HPCs o de la composición farmacéutica descrita en la presente invención, a un paciente. Another aspect described in the present invention relates to methods of treating pathologies of a hematopoietic nature characterized in that it comprises the administration of a therapeutically effective amount of the HPCs or of the pharmaceutical composition described in the present invention, to a patient.
Los ejemplos que se describen a continuación tienen como objetivo ilustrar la presente invención, sin limitar el alcance de la misma. The examples described below are intended to illustrate the present invention, without limiting the scope thereof.
EJEMPLOS EXAMPLES
Ejemplo 1. Materiales y Métodos utilizados para llevar a cabo la presente invención: 1.1 Líneas y medios de cultivo. Las células 293T fueron cultivadas en medio Dulbecco's Modified Eagle MédiumExample 1. Materials and Methods used to carry out the present invention: 1.1 Lines and culture media. 293T cells were grown in Dulbecco's Modified Eagle Medium medium
(D-MEM, Invitrogen) con GlutaMAX™ y suplementado con 10% de suero fetal bovino (FBS) (PAA Laboratories GmbH, Austria) se utilizaron como células productoras de virus, células que son transformadas con los plásmidos específicos para la producción de los vectores lentivirales descritos en la presente invención. Por otro lado, como ejemplo de células humanas pluripotentes se utilizaron las líneas embrionarias humanas AND-1 (Spanish Stem Cell Bank, www.isciii.es) (Cortes, Sánchez et al. 2009) y H9 (Wicell Research Institute Inc. Madison, WI) debido a su elevada capacidad de diferenciación al tejido hematopoy ético. Todas las líneas celulares humanas pluripotentes se mantuvieron en cultivo indiferenciado en placas de 12 pocilios sobre matrigel (BD Biosciences, Bedford, MA) hasta el momento de la infección con los vectores lentivirales y posteriormente se expandieron en frascos de cultivo T25 (Menéndez, Wang et al. 2004; Cortes, Sánchez et al. 2009; Montes, Ligero et al. 2009). El medio de cultivo en el que se mantuvieron hasta la infección fue medio condicionado por células madre mesenquimales humanas (MSC-CM) (80% KO-DMEM suplementado con 20% KO Serum Replacement, 1% aminoácidos no-esenciales, ImM L-glutamina, O. lmM β-mercaptoetanol y 8 ng/ml de factor de crecimiento fibroblástico (FGF) (todo de Invitrogen, USA), suplementado con 8 ng/ml bFGF (Miltenyi, Bergisch Gladbach, Alemania). El medio fue cambiado diariamente y las células fueron expandidas una vez a la semana mediante tratamiento con 200 U/ml colagenasa IV (Invitrogen, Edinburgo, Escocia). (D-MEM, Invitrogen) with GlutaMAX ™ and supplemented with 10% fetal bovine serum (FBS) (PAA Laboratories GmbH, Austria) were used as virus-producing cells, cells that are transformed with specific plasmids for the production of the Lentiviral vectors described in the present invention. On the other hand, as an example of pluripotent human cells, the human embryonic lines AND-1 (Spanish Stem Cell Bank, www.isciii.es) (Cortes, Sánchez et al. 2009) and H9 (Wicell Research Institute Inc. Madison, WI) due to its high capacity for differentiation to ethical hematopoy tissue. All pluripotent human cell lines were maintained in undifferentiated culture in 12-well plates on matrigel (BD Biosciences, Bedford, MA) until the time of infection with the lentiviral vectors and subsequently expanded in T25 culture bottles (Menéndez, Wang et al. 2004; Cortes, Sánchez et al. 2009; Montes, Ligero et al. 2009). The culture medium in which they were maintained until infection was conditioned by human mesenchymal stem cells (MSC-CM) (80% KO-DMEM supplemented with 20% KO Serum Replacement, 1% non-essential amino acids, ImM L-glutamine , O. lmM β-mercaptoethanol and 8 ng / ml fibroblast growth factor (FGF) (all from Invitrogen, USA), supplemented with 8 ng / ml bFGF (Miltenyi, Bergisch Gladbach, Germany). The medium was changed daily and the cells were expanded once a week by treatment with 200 U / ml collagenase IV (Invitrogen, Edinburgh, Scotland).
1.2. Construcción de vectores de expresión eGFP 1.2. Construction of eGFP expression vectors
La expresión del gen was, en células hematopoyéticas, está dirigida a través de dos secuencias con actividad promotora (promotores). Una secuencia de aproximadamente 1600 pb a partir del sitio de inicio de la transcripción, denominador promotor proximal de was y, otra ubicada a 6 kb en dirección 5 ' de la primera, denominado promotor alternativo de was (Figura 1A). En la Figura 1A se muestra el esquema de construcción de los vectores lentivirales utilizados en la presente invención. Como se observa en dicha figura, el vector lentiviral WE contiene un fragmento de 500 pb del promotor proximal de was que dirige la expresión del trasgén seleccionado en las realizaciones descritas en la presente invención, eGFP, según se describe en:Martin, Toscano et al. 2005; Toscano, Frecha et al. 2008; Toscano, Benabdellah et al. 2009. Por otro lado, el vector lentiviral AWE contiene un fragmento de 387 pb del promotor alternativo de was inmediatamente "aguas arriba" del promotor proximal de was de 500 pb presente en el vector WE, según se describe en: Martin, Toscano et al. 2005; Toscano, Frecha et al. 2008. Todos los vectores comparten la región autoinactivable "self inactivated (SIN) lentiviral backbone" descrita por (Zufferey, Dull et al. 1998). En el vector pLVTHM, el trasgén eGFP se expresa bajo el promotor constitutivo EFl-ot (htt : /'www .addgene . org/ 12247) y el vector CE, expresa el trasgén eGFP bajo el control del promotor constitutivo del citomegalovirus (CMV). The expression of the was gene, in hematopoietic cells, is directed through two sequences with promoter activity (promoters). A sequence of approximately 1600 bp from the transcription start site, denominator was proximal promoter of was and, another located 6 kb in the 5 ' direction of the first, called alternative was promoter (Figure 1A). The construction scheme of the lentiviral vectors used in the present invention is shown in Figure 1A. As seen in said figure, the lentiviral vector WE contains a 500 bp fragment of the proximal was promoter that directs the expression of the selected transgene in the embodiments described in the present invention, eGFP, as described in: Martin, Toscano et al. . 2005; Tuscan, Frecha et al. 2008; Tuscan, Benabdellah et al. 2009. On the other hand, the AWE lentiviral vector contains a 387 bp fragment of the alternative was immediately "upstream" promoter of the 500 bp wasal promoter present in the WE vector, as described in: Martin, Toscano et al. . 2005; Tuscan, Frecha et al. 2008. All vectors share the self-activating region "self inactivated (SIN) lentiviral backbone" described by (Zufferey, Dull et al. 1998). In the pLVTHM vector, the eGFP transgene is expressed under the constitutive promoter EFl-ot (htt: / ' www .addgene. Org / 12247) and the EC vector, expresses the eGFP transgene under the control of the cytomegalovirus constituent promoter (CMV) .
1.3. Producción de vectores y transducción de células pluripotentes. 1.3. Vector production and transduction of pluripotent cells.
Los vectores lentivirales fueros producidos por la co-transfección de las células 293T con tres plásmidos: (1) plásmido vector (WE, AWE, CE, y pLVTHM), (2) plásmido de empaquetamiento (pCMVAR 8.91) y (3) plásmido de envuelta VSV-G (pMD2.G), según se describe en Toscano, Frecha et al. 2004. Los plásmidos de empaquetamiento y envuelta utilizados se obtuvieron de http : //www . addgene . org/Didier Trono . El día antes de la transfección, se plaquearon células 293T en placas Petri tratadas con amina (Sarstedt, Newton, NC), para asegurar el crecimiento exponencial y el 80% de confluencia. Los plásmidos pCMVAR 8.91 y pMD2.G fueron resuspendidos en 1.5ml de Opti-MEM (Gibco) junto con 60 μΐ de Lipofectamine 2000 (Invitrogen) o 45 μΐ TransIT 2020 (Mirus Bio LLC Madison, WI, USA) (proporciones de plásmido 3:2: 1). Esta mezcla fue añadida al cultivo celular, previamente lavado con Opti-MEM. Los sobrenadantes virales fueron recogidos, filtrados mediante poros con un diámetro de 0.45 μιη (Nalgene, Rochester, NY), concentrados mediante ultracentrifugación (Beckman Coulter) y resuspendido en medio de cultivo MSC-CM. Lentiviral vectors were produced by the co-transfection of 293T cells with three plasmids: (1) vector plasmid (WE, AWE, CE, and pLVTHM), (2) packaging plasmid (pCMVAR 8.91) and (3) plasmid VSV-G envelope (pMD2.G), as described in Toscano, Frecha et al. 2004. The packaging and wrapping plasmids used were obtained from http: // www. addgene org / Didier Throne. The day before transfection, 293T cells were plated on amine-treated Petri dishes (Sarstedt, Newton, NC), to ensure exponential growth and 80% confluence. Plasmids pCMVAR 8.91 and pMD2.G were resuspended in 1.5ml of Opti-MEM (Gibco) together with 60 μΐ of Lipofectamine 2000 (Invitrogen) or 45 μΐ TransIT 2020 (Mirus Bio LLC Madison, WI, USA) (proportions of plasmid 3 :twenty-one). This mixture was added to the cell culture, previously washed with Opti-MEM. Viral supernatants were collected, filtered through pores with a diameter of 0.45 μιη (Nalgene, Rochester, NY), concentrated by ultracentrifugation (Beckman Coulter) and resuspended in MSC-CM culture medium.
Las células hESCs, fueron disociadas durante 1 minuto a temperatura ambiente en presencia de colagenasa IV. Posteriormente, dichas hESCs se cultivaron en placas de cultivo tratadas con matrigel, a las que se les añadió las partículas virales concentradas previamente. Durante el procedimiento de infección, las hESCs se adhieren a la superficie de la placa de cultivo. Cuando las colonias estuvieron confluentes se expandieron. En algunos casos fue necesaria una segunda ronda de infección hasta obtener una concentración de 0.6-1 vg/cel. 1.4. Diferenciación hematopoyética in vitro y análisis a través de la formación de cuerpos embrioides (EBs) The hESCs cells were dissociated for 1 minute at room temperature in the presence of collagenase IV. Subsequently, said hESCs were grown in culture plates treated with matrigel, to which the previously concentrated viral particles were added. During the infection procedure, the hESCs adhere to the surface of the culture plate. When the colonies were confluent they expanded. In some cases a second round of infection was necessary until a concentration of 0.6-1 vg / cel was obtained. 1.4. In vitro hematopoietic differentiation and analysis through the formation of embryoid bodies (EBs)
Las células pluripotentes se diferenciaron in vitro a células del linaje hematopoy ético. Brevemente, a día 0, las hESCs fueron tratadas con colagenasa IV durante 1 min y posteriormente separadas de la placa de cultivo. Posteriormente, dichas células se transfirieron a placas de cultivo de baja adhesión, tratadas con matrigel (Corning, NY) manteniéndose en cultivo toda la noche en presencia de medio de cultivo KO-Dulbecco's modified Eagle's médium (Invitrogen, USA) suplementado con 20% FBS, 1 mmol/L- glutamina, 0.1 mM aminoácidos no esenciales y 0.1 mM β-mercaptoetanol para la obtención de cuerpos embrioides (EBs). Pluripotent cells differentiated in vitro to cells of the ethical hematopoy lineage. Briefly, on day 0, the hESCs were treated with collagenase IV for 1 min and subsequently separated from the culture plate. Subsequently, these cells to culture dishes low adhesion treated with matrigel (Corning, NY) kept in culture overnight in the presence of culture medium KO-Dulbecco 's modified Eagle's medium (Invitrogen, USA) supplemented with 20 transferred % FBS, 1 mmol / L-glutamine, 0.1 mM non-essential amino acids and 0.1 mM β-mercaptoethanol to obtain embryoid bodies (EBs).
Al día siguiente, los EBs obtenidos se centrifugaron y se mantuvieron en cultivo en el mismo medio descrito anteriormente pero suplementado con factores de crecimiento: proteína morfogénica ósea 4 (BMP-4) (25ng/ml), ligando de la tirosina fetal 3 (Flt-3L) (300ng/ml), factor de células madre (SCF) (300ng/ml), interleuquina 3 (IL-3) (10ng/ml), interleuquina 6 (IL-6) (10ng/ml) y el factor estimulante de colonias de granulocitos (G- CSF) (50ng/ml) (Chadwick, Wang et al. 2003). Los EBs obtenidos se fueron recogiendo a diferentes tiempos, específicamente a los días 0, 1, 3, 5, 7, 1 1, 15 y 22, y a continuación se procedió al aislamiento del mARN mediante métodos convencionales. The following day, the EBs obtained were centrifuged and maintained in culture in the same medium described above but supplemented with growth factors: bone morphogenic protein 4 (BMP-4) (25ng / ml), fetal tyrosine ligand 3 (Flt -3L) (300ng / ml), stem cell factor (SCF) (300ng / ml), interleukin 3 (IL-3) (10ng / ml), interleukin 6 (IL-6) (10ng / ml) and granulocyte colony stimulating factor (G-CSF) (50ng / ml) (Chadwick, Wang et al. 2003). The EBs obtained were collected at different times, specifically on days 0, 1, 3, 5, 7, 1, 15 and 22, and then the mRNA was isolated by conventional methods.
Los EBs se disociaron añadiendo al medio de cultivo colagenasa B (Roche Diagnostic, Basel, Suiza) durante 2 horas a 37°C seguido de una incubación de 10 minutos a 37° C con Cell Dissociation Buffer (Gibco) a día 15 para analizar la formación de unidades formadoras de colonias (CFUs) y a los días 10, 15 y 22 para realizar los análisis de citometría de flujo (FACS). EBs were dissociated by adding collagenase B (Roche Diagnostic, Basel, Switzerland) to the culture medium for 2 hours at 37 ° C followed by a 10 minute incubation at 37 ° C with Cell Dissociation Buffer (Gibco) at day 15 to analyze the formation of colony forming units (CFUs) and on days 10, 15 and 22 to perform flow cytometry analysis (FACS).
1.5. Análisis de citometría de flujo - FACS y SORTING. 1.5. Flow cytometry analysis - FACS and SORTING.
Las hESCs se resuspendieron en una solución tamponante que contenía PBS+FBS+EDTA y posteriormente se filtraron a través de un filtro de 70 μπι (Becton Dickinson, San José, CA). Una vez disgregadas se incubaron en presencia de anticuerpos monoclonales conjugados con diferentes fluorocromos: anti-CD31-ficoeritrina (PE), anti- CD33-PE, anti-CD34-PE-Cy7 (Becton Dickinson Immunocytometry Systems (BDIS), San José, CA) y anti-CD45-APC (aloficocianina) (Miltenyi). Las células vivas fueron identificadas mediante la exclusión de 7-AAD (7-amino-actinomiacina D). La expresión de eGFP fue también analizada mediante citometría de flujo con el citómetro FACS Canto II equipado con el software de análisis FACS Diva (Becton Dickinson). Las poblaciones analizadas fueron: (1) progenitores hemogénicos (CD31+CD45-), (2) células hematopoyéticas primitivas (CD34+CD45+), (3) células mieloides (CD33+CD45+) y células totales hematopoyéticas (CD45+). The hESCs were resuspended in a buffer solution containing PBS + FBS + EDTA and subsequently filtered through a 70 μπι filter (Becton Dickinson, San José, CA). Once disintegrated, they were incubated in the presence of monoclonal antibodies conjugated with different fluorochromes: anti-CD31-phycoerythrin (PE), anti-CD33-PE, anti-CD34-PE-Cy7 (Becton Dickinson Immunocytometry Systems (BDIS), San José, CA ) and anti-CD45-APC (allophycocyanin) (Miltenyi). Live cells were identified by exclusion of 7-AAD (7-amino-actinomiacin D). The expression of eGFP was also analyzed by flow cytometry with the FACS Canto II cytometer equipped with the FACS Diva analysis software (Becton Dickinson). The populations analyzed were: (1) hemogenic progenitors (CD31 + CD45-), (2) primitive hematopoietic cells (CD34 + CD45 +), (3) myeloid cells (CD33 + CD45 +) and total hematopoietic cells (CD45 +).
Además aislamos las poblaciones (CD45-CD31-GFP+) y (CD45-CD31-GFP-) mediante sorting (FACSAria) a día 11 de diferenciación hematopoyética mediante formación de EBs. Dichas células, ya separadas, fueron diferenciadas hacia hematopoyesis mediante su cultivo en medio StemSpam (Stem Cell) suplementado con los factores de crecimiento mencionados previamente para la formación de los EBs. We also isolated the populations (CD45-CD31-GFP +) and (CD45-CD31-GFP-) by sorting (FACSAria) on day 11 of hematopoietic differentiation through EB formation. Said cells, already separated, were differentiated towards hematopoiesis by means of their culture in StemSpam medium (Stem Cell) supplemented with the growth factors mentioned previously for the formation of EBs.
1.6. Ensayo de Unidades Formadoras de Colonias (CFUs) 20.000-35.000 células fueron plaqueadas en metilcelulosa H4434 (Stem Cell Technologies, Vancouver, Canadá) suplementada con 30 U/ml de EPO. Las células fueron incubadas a 37° C y 5% C02. Las colonias fueron contadas en base a sus características morfológicas tras 10-14 días. 1.6. Colony Forming Units Test (CFUs) 20,000-35,000 cells were plated in H4434 methylcellulose (Stem Cell Technologies, Vancouver, Canada) supplemented with 30 U / ml EPO. The cells were incubated at 37 ° C and 5% C0 2 . Colonies were counted based on their morphological characteristics after 10-14 days.
1.7. Diferenciación neural de células pluripotentes 1.7. Neural differentiation of pluripotent cells
El protocolo fue ligeramente modificado del descrito por Pankratz (Pankratz, M. T., et al. 2007). Las células pluripotentes, hESCs, fueron crecidas en suspensión como hEBs en MSC-CM durante 4 días. Los hEBs fueron entonces cultivados en medio neural compuesto por DMEM/F 12, aminoácidos no esenciales, 2 μg/ml de heparina, y el suplemento neural N2 (Gibco) durante 3 días más. La diferenciación neural temprana fue evaluada a día 8 de cultivo mediante disociación y tinción con el anticuerpo anti-human A2B5 (antígeno marcador embrionario neural) (Miltenyi Biotech) o su correspondiente isotipo control. The protocol was slightly modified from that described by Pankratz (Pankratz, M. T., et al. 2007). The pluripotent cells, hESCs, were grown in suspension as hEBs in MSC-CM for 4 days. The hEBs were then cultured in a neural medium composed of DMEM / F 12, non-essential amino acids, 2 μg / ml of heparin, and the neural supplement N2 (Gibco) for an additional 3 days. Early neural differentiation was evaluated on day 8 of culture by dissociation and staining with the anti-human antibody A2B5 (neural embryonic marker antigen) (Miltenyi Biotech) or its corresponding control isotype.
1.8. Análisis estadístico. 1.8. Statistic analysis.
Todos los datos están expresados como media±SEM. Las comparaciones estadísticas fueron realizadas mediante el programa GraphPad Prism (GraphPad Software, Inc. US A) mediante test no-paramétrico (Mann-Whitney test) y valor de p de dos colas (95% de intervalo de confianza). La significancia estadística fue definida como valor de p<0.05. Ejemplo 2. La expresión de los vectores lentivirales WE y AWE está restringida al linaje hematopovético derivado de las células pluripotentes. All data are expressed as mean ± SEM. Statistical comparisons were made using the GraphPad Prism program (GraphPad Software, Inc. US A) using a non-parametric test (Mann-Whitney test) and two-tailed p-value (95% confidence interval). Statistical significance was defined as a value of p <0.05. Example 2. The expression of the WE and AWE lentiviral vectors is restricted to the hematopovetic lineage derived from pluripotent cells.
Para determinar la capacidad de los vectores lentivirales WE y AWE para modificar genéticamente las células pluripotentes, se procedió a la transducción de la línea celular hESC AND-1 con los diferentes vectores mostrados en la Figura 1A (AWE, WE, CE y pLVTHM) y según los procedimientos mencionados previamente. Como controles positivos se utilizaron los vectores CE y pLVTHM, los cuales contienen los promotores constitutivos CMV y EF l-ot, respectivamente. Como se observa en la Figura IB, mediante análisis de citometría de flujo, todos los vectores CE, pLVTHM, WE y AWE, a las concentraciones de 1.25 g.c/c, 0.3 g.c/c, 1.4 g.c/c y 1.3 g.c/c, respectivamente, se integraron eficientemente en el DNA de las hESCs. Sin embargo, sólo los vectores CE y pLVTHM, que portaban promotores constitutivos, CMV y EF l-ot, respectivamente expresaron el transgén eGFP en células hESCs indiferenciadas (Figura IB), en un porcentaje de 18.4% y 20.4% respectivamente. To determine the ability of the WE and AWE lentiviral vectors to genetically modify the pluripotent cells, the hESC AND-1 cell line was transduced with the different vectors shown in Figure 1A (AWE, WE, CE and pLVTHM) and according to the previously mentioned procedures. As positive controls, the vectors CE and pLVTHM were used, which contain the constitutive promoters CMV and EF l-ot, respectively. As seen in Figure IB, by flow cytometry analysis, all CE, pLVTHM, WE and AWE vectors, at the concentrations of 1.25 gc / c, 0.3 gc / c, 1.4 gc / c and 1.3 gc / c, respectively , were efficiently integrated into the DNA of the hESCs. However, only the CE and pLVTHM vectors, which carried constitutive promoters, CMV and EF l-ot, respectively expressed the eGFP transgene in undifferentiated hESCs cells (Figure IB), at a percentage of 18.4% and 20.4% respectively.
Las hESCs transducidas con los vectores lentivirales WE y AWE que contenían respectivamente 1.4 y 1.3 g.c/c fueron diferenciadas hacia el linaje hematopoyético mediante, como hemos mencionado anteriormente, el cultivo en presencia de KO- Dulbecco's modified Eagle's médium (Invitrogen, USA) suplementado con 20% FBS, 1 mmol/L-glutamina, 0.1 mM aminoácidos no esenciales, 0.1 mM β-mercaptoetanol y un cóctel de factores de crecimiento: BMP-4 (25ng/ml), Flt-3L (300ng/ml), SCF (300ng/ml), IL-3 (10ng/ml), IL-6 (10ng/ml) y G-CSF (50ng/ml). La expresión de eGFP, CD45 y CD33 en dichas células fue determinada tras 22 días de diferenciación hematopoyética inducida (Figura 1C). En este estadio de diferenciación (día 22) Los vectores WE y AWE sólo fueron capaces de expresar el transgén eGFP en células CD45 positivas (CD45+) y CD33 positivas (CD33+). En total, 92.2% (AWE) y el 90% (WE) de las hESCs que eran eGFP+, eran además (CD45+CD33+), indicando dicho extremo una casi completa especificidad de expresión en células hematopoy éticas. HESCs transduced with lentiviral vectors WE and AWE containing respectively 1.4 and 1.3 gc / c were differentiated into hematopoietic lineage by, as mentioned above, the culture in the presence of KOt Dulbecco 's modified Eagle' s medium (Invitrogen, USA) supplemented with 20% FBS, 1 mmol / L-glutamine, 0.1 mM non-essential amino acids, 0.1 mM β-mercaptoethanol and a cocktail of growth factors: BMP-4 (25ng / ml), Flt-3L (300ng / ml ), SCF (300ng / ml), IL-3 (10ng / ml), IL-6 (10ng / ml) and G-CSF (50ng / ml). The expression of eGFP, CD45 and CD33 in said cells was determined after 22 days of induced hematopoietic differentiation (Figure 1C). At this stage of differentiation (day 22) The WE and AWE vectors were only able to express the eGFP transgene in CD45 positive (CD45 +) and CD33 positive (CD33 +) cells. In total, 92.2% (AWE) and 90% (WE) of the hESCs that were eGFP +, were also (CD45 + CD33 +), said extreme indicating almost complete specificity of expression in ethical hematopoy cells.
Para demostrar la especificidad del vector lentiviral en el mareaje de células hESC diferenciadas a linaje hematopoyético, se analizó la expresión del trasgén o marcador eGFP presente en el vector lentiviral, AWE, en células hESCs transducidas con dicho vector AWE y diferenciadas a otros linajes que no fueran el linaje hematopoyético, por ejemplo el linaje neural. Brevemente, a día 0, las hESCs fueron cultivadas en suspensión en placas de cultivo de baja adhesión en medio MSC-CM. A día 4 los agregados de hESCs fueron cultivados en un medio neuronal químicamente definido (NM): DMEM/F12, aminoácidos no-esenciales, 2 μg/ml heparina y el suplemento neural N2 (Gibco) durante otros 3 días. A día 7 los precursores neuronales fueron analizados mediante citometría de flujo. Como control positivo utilizamos el vector pLVTHM que expresa eGFP a través del promotor constitutivo EF l-ot. Como se observa en la Figura ID, las hESCs trasducidas con el vector lentiviral AWE y diferenciadas hacia un fenotipo neuronal (indicado por la expresión del marcador de superficie neuronal A2B5) fueron incapaces de expresar eGFP. Únicamente cuando estas células son diferenciadas hacia linaje hematopoyético durante 22 días es cuando se expresa el trasgén eGFP y además, sólo en células que son células hematopoyéticas, es decir, son células CD45+ (Figura ID, histograma de la derecha). To demonstrate the specificity of the lentiviral vector in the mapping of hESC cells differentiated to hematopoietic lineage, the expression of the transgene or eGFP marker present in the lentiviral vector, AWE, in hESCs cells transduced with said AWE vector and differentiated to other lineages that were not analyzed they were the hematopoietic lineage, for example the neural lineage. Briefly, on day 0, the hESCs were cultured in suspension in low adhesion culture plates in MSC-CM medium. On day 4 the hESCs aggregates were cultured in a chemically defined neuronal medium (NM): DMEM / F12, non-essential amino acids, 2 μg / ml heparin and the N2 neural supplement (Gibco) for another 3 days. On day 7 the neuronal precursors were analyzed by flow cytometry. As a positive control we use the vector pLVTHM that expresses eGFP through the constitutive promoter EF l-ot. As seen in Figure ID, hESCs transduced with the AWE lentiviral vector and differentiated to a neuronal phenotype (indicated by the expression of the A2B5 neuronal surface marker) were unable to express eGFP. Only when these cells are differentiated to hematopoietic lineage for 22 days is when the eGFP transgene is expressed and also, only in cells that are hematopoietic cells, that is, they are CD45 + cells (Figure ID, right histogram).
En la Figura 2 se muestra la correlación entre los niveles de expresión de eGFP y CD45 en diferentes experimentos de diferenciación hematopoyética de hESCs transducidas con los vectores lentivirales WE y AWE, según se describe en la presente invención. Como se puede observar en dicha Figura 2, a mayor diferenciación hematopoyética (mayor expresión de CD45) mayor expresión de GFP cuando se utilizan los vectores AWE y WE. Sin embargo cuando se utiliza un vector control que expresa GFP constitutivamente (pLVTHM), la expresión se detecta aunque no existan células hematopoyéticas (CD45+). Figure 2 shows the correlation between the expression levels of eGFP and CD45 in different hematopoietic differentiation experiments of hESCs transduced with the WE and AWE lentiviral vectors, as described in the present invention. As can be seen in said Figure 2, the greater hematopoietic differentiation (greater expression of CD45), greater expression of GFP when the AWE and WE vectors are used. However, when a control vector expressing constitutively GFP (pLVTHM) is used, the expression is detected even if there are no hematopoietic cells (CD45 +).
Para caracterizar con mayor detalle el patrón de expresión de los vectores WE y AWE descritos en la presente invención y, el efecto que la transducción podría tener en la capacidad de las células pluripotenciales para dar lugar a progenitores mieloides, se procedió a analizar la capacidad de formación de colonias mieloides (CFU) en medio de cultivo en presencia de metilcelulosa. Las colonias formadas fueron clasificadas, contadas y además se analizó la expresión de GFP y de diferentes marcadores mieloides (Figura 3). Los resultados mostraron que la traducción con los vectores no afectaba a la capacidad de las células embrionarias para su diferenciación a progenitores mieloides (Figura 3A). Además, se observó que los vectores WE y AWE expresaban el trasgén GFP en varios tipos de células de progenitores mieloides, representados por los diferentes tipos de colonias obtenidas expresando GFP (Figura 3B). Dicha expresión se mantuvo estable después de que las células expresaran marcadores de células mieloides maduras (CD33 y CD14) (Figure 3 C). To characterize in greater detail the expression pattern of the WE and AWE vectors described in the present invention and, the effect that transduction could have on the ability of pluripotential cells to give rise to myeloid progenitors, the ability to analyze formation of myeloid colonies (CFU) in culture medium in the presence of methylcellulose. The colonies formed were classified, counted and the expression of GFP and different myeloid markers was also analyzed (Figure 3). The results showed that translation with vectors did not affect the ability of embryonic cells for differentiation to myeloid progenitors (Figure 3A). In addition, it was observed that the WE and AWE vectors expressed the GFP transgene in several types of myeloid progenitor cells, represented by the different types of colonies obtained by expressing GFP (Figure 3B). This expression remained stable after the cells expressed markers of mature myeloid cells (CD33 and CD14) (Figure 3 C).
Ejemplo 3. Los vectores AWE y WE marcan específicamente progenitores hematopoyéticos a día 10-15 de diferenciación. Example 3. The AWE and WE vectors specifically mark hematopoietic progenitors at 10-15 day of differentiation.
A continuación se analizó el patrón de expresión de los vectores WE y AWE descritos en la presente invención a diferentes tiempos de diferenciación hematopoyética. Para ello, las células pluripotenciales transducidas con dichos vectores lentivirales según se describe en la presente invención, fueron analizadas a los días 5, 10, 15 y 22 durante el proceso de diferenciación hematopoyética. La expresión del trasgén eGFP presente en los vectores AWE y WE se comenzó a observar a partir del día 10 (Figura 4 A y C, histograma central día 10), incrementándose progresivamente en días sucesivos de diferenciación hasta los días 10-15 (Figura 4 A y C, histogramas centrales días 10, 15 y 22). The expression pattern of the WE and AWE vectors described in the present invention at different hematopoietic differentiation times was then analyzed. For this, the pluripotential cells transduced with said lentiviral vectors as described in the present invention were analyzed on days 5, 10, 15 and 22 during the hematopoietic differentiation process. The expression of the eGFP transgene present in the AWE and WE vectors began to be observed from day 10 (Figure 4 A and C, histogram central day 10), progressively increasing on successive days of differentiation until days 10-15 (Figure 4 A and C, central histograms days 10, 15 and 22).
El análisis fenotípico, obtenido mediante citometría de flujo, de las células eGFP+ derivadas de las células pluripotenciales/ AWE y WE a días tempranos de aparición de GFP (día 10) mostró que dichos vectores marcan muy específicamente precursores hemogénicos restringidos al linaje hematopoyético (CD45-CD31+CD34dim) (población mostrada en el histograma inferior de la Figura 4A día 10, en el archivo de figuras en color se refiere a la población de color rojo) y precursores hematopoyéticos (CD45+CD34+) (población mostrada en el histograma superior de la Figura 4A día 10). Sorprendentemente, en estos estadios iniciales de expresión del trasgén GFP se detecta una población que, a pesar de expresar GFP, no expresa marcadores característicos de progenitores hemogénicos (CD31, CD45, CD34) (población mostrada en el histograma central de la parte izquierda de la Figura 4A y C rodeada por un círculo). Dicha población, claramente visible a día 10 de diferenciación, desaparecía progresivamente durante los días siguientes (15 y 22), conforme aparecían las células hematopoyéticas CD45+ (población mostrada en el histograma central de la parte izquierda de la Figura 4A y C rodeada por un círculo), indicándo que podrían tratarse de progenitores hematopoyéticos. Para determinar si los vectores estaban expresando GFP en células que no eran del linaje hematopoyético, debido por ejemplo a una expresión indebida o, por el contrario, dicha población tenía capacidad hemogénica, se procedió a separar las poblaciones celulares (CD31-GFP+) y (CD31-GFP-) mediante FACS-sorting (Figura 5A). Una vez separadas se incubaron en el medio de cultivo que favorece la diferenciación hematopoyética, descrito previamente. Solamente las células que expresaban GFP dieron lugar a células (CD31+CD45+) después de 10 días en este medio de diferenciación (Figura 5B). Estos resultados ponen de manifiesto que los vectores WE y AWE, descritos en la presente invención, permiten identificar a un nuevo precursor hematopoyético negativo para CD31, CD34 y CD45 (CD31-CD34-CD45-), que aparece en las fases iniciales de diferenciación hematopoyética (Día 10) y que desaparece progresivamente en las fases tardías (días 15 y 22) (Figura 4A y 4C, población celular rodeada de un círculo). The phenotypic analysis, obtained by flow cytometry, of the eGFP + cells derived from the pluripotential / AWE and WE cells at the early days of the appearance of GFP (day 10) showed that these vectors mark very specifically hemogenic precursors restricted to the hematopoietic lineage (CD45- CD31 + CD34dim) (population shown in the lower histogram of Figure 4A day 10, in the file of color figures refers to the red population) and hematopoietic precursors (CD45 + CD34 +) (population shown in the upper histogram of Figure 4A day 10). Surprisingly, in these initial stages of GFP transgene expression a population is detected that, despite expressing GFP, does not express characteristic markers of hemogenic progenitors (CD31, CD45, CD34) (population shown in the central histogram on the left side of the Figure 4A and C surrounded by a circle). This population, clearly visible on day 10 of differentiation, disappeared progressively during the following days (15 and 22), as the CD45 + hematopoietic cells appeared (population shown in the central histogram of the left part of Figure 4A and C surrounded by a circle ), indicating that they could be hematopoietic progenitors. To determine if the vectors were expressing GFP in cells that were not of the hematopoietic lineage, for example due to undue expression or, conversely, said population had hemogenic capacity, the cell populations (CD31-GFP +) were separated and ( CD31-GFP-) using FACS-sorting (Figure 5A). Once separated, they were incubated in the culture medium that favors hematopoietic differentiation, previously described. Only cells expressing GFP gave rise to cells (CD31 + CD45 +) after 10 days in this differentiation medium (Figure 5B). These results show that the WE and AWE vectors, described in the present invention, allow to identify a new negative hematopoietic precursor for CD31, CD34 and CD45 (CD31-CD34-CD45-), which appears in the initial stages of hematopoietic differentiation (Day 10) and that disappears progressively in the late phases (days 15 and 22) (Figure 4A and 4C, cell population surrounded by a circle).
Otra de las ventajas de los vectores WE y AWE descritos en la presente invención para su uso en la identificación y aislamiento de HPCs derivadas de células pluripotenciales es su capacidad para discriminar entre poblaciones CD34dim (expresión media/baja de CD34) y CD34bright (expresión alta de CD34). Ambos vectores, AWE y WE, evitan la expresión en las poblaciones CD34 bright como puede observarse en las Figuras 4A y 4C. Existen evidencias que indican que las (CD31+CD34dim) son progenitores con capacidad restringida hematopoyética, mientras que los (CD31+CD34bight) tienen capacidad endotelial y hematopoyética (Woll PS. et al 2008; Dravid G. et al 2011). Este mareaje diferencial (exclusivo de la población hemogénica CD34dim) podría abrir las puertas a una mejor caracterización de estas poblaciones y a establecer un modelo de desarrollo hematopoy ético. Another advantage of the WE and AWE vectors described in the present invention for use in the identification and isolation of HPCs derived from pluripotential cells is their ability to discriminate between CD34dim populations (expression medium / low CD34) and CD34bright (high expression of CD34). Both vectors, AWE and WE, avoid expression in CD34 bright populations as can be seen in Figures 4A and 4C. There is evidence to indicate that (CD31 + CD34dim) are parents with restricted hematopoietic capacity, while those (CD31 + CD34bight) have endothelial and hematopoietic capacity (Woll PS. Et al 2008; Dravid G. et al 2011). This differential mareaje (exclusive of the hemogenic population CD34dim) could open the doors to a better characterization of these populations and to establish a model of ethical hematopoy development.
Listado de secuencias Sequence listing
SEQ ID No 1 : Promotor proximal de 500 pares de bases del gen WAS:  SEQ ID No 1: Proximal 500 base pair promoter of the WAS gene:
aattcgggattacaggtgtgagctattgtccccagccaaaaggaaaagttttactgtagtaacccttccggactagggacctcg g g cctca g cctca g g cta ceta g g tg cttta gaaaggaggccacccaggcccatgacta etcettg ccacagggagccctgca cacagatgtgctaagctctcgctgccagccagagggaggaggtctgagccagtcagaaggagatgggccccagagagtaa gaaagggggaggaggacccaagctgatccaaaaggtgggtctaagcagtcaagtggaggagggttccaatctgatggcgg agggcccaagctcagcctaacgaggaggccaggcccaccaaggggcccctggagga cttg tttcccttg tecettg tg g ttttt tg ca tttcctg ttcccttg ctg etca ttg cg g a a g ttcctcttctta cectg ca ccca g a g ecteg ccagagaagacaagggcaga aag aattcgggattacaggtgtgagctattgtccccagccaaaaggaaaagttttactgtagtaacccttccggactagggacctcg g g g g cctca g cctca cta ceta g g tg cttta gaaaggaggccacccaggcccatgacta etcettg ccacagggagccctgca cacagatgtgctaagctctcgctgccagccagagggaggaggtctgagccagtcagaaggagatgggccccagagagtaa gaaagggggaggaggacccaagctgatccaaaaggtgggtctaagcagtcaagtggaggagggttccaatctgatggcgg agggcccaagctcagcctaacgaggaggccaggcccaccaaggggcccctggagga CTTG tttcccttg tecettg tg tg g ttttt ca tttcctg ttcccttg ctg ttg cg g ETCA as ttcctcttctta cectg g ccca ca g a g ecteg ccagagaagacaagggcaga aag
SEQ ID No 2: Promotor alternativo de 387 pares de bases unido al promotor proximal: taagtcaaaggaggagagggcaacgcggtgggcaggagagaggccaacggccgcccggggcgaggggagccggtagg acgggaccaggactggccgacccggccccgcgcggggaagggggcgccttcctcccacaacacaaaacggtgcgcccggg ttg g ccg cccctcccca gtggtgcggccccgggtggacg cttccg tg cg cg cg teca tg ccca g cca ttg cg g g ctg cg g g ctc caagggtcgcacacgctggagagtgcaggttgccgggtccacccacagggctgtagacacccctagggtcacacagacaag gctctggacacccacaggggcacacacattggggagtgggcactcctgggctcacaaagactgagaattcgggattacaggt g tg a g cta ttg tcccca g cca a a a g g a a a a g tttta ctg ta g ta a cccttccg g a cta g g g a ecteg g g cctca g cctca g g ct acctaggtgctttagaaaggaggccacccaggcccatgactactccttgccacagggagccctgcacacagatgtgctaagct ctcgctgccagccagagggaggaggtctgagccagtcagaaggagatgggccccagagagtaagaaagggggaggagg acccaagctgatccaaaaggtgggtctaagcagtcaagtggaggagggttccaatctgatggcggagggcccaagctcagc ctaacgaggaggccaggcccaccaaggggcccctggagga cttg tttcccttg tecettg tg g ttttttg ca tttcctg ttcccttg ctg etca ttg cg g a a g ttcctcttctta ccctgcacccagagcctcgccagagaagacaagggcagaaag  SEQ ID No 2: Alternative promoter 387 base pairs attached to the proximal promoter: taagtcaaaggaggagagggcaacgcggtgggcaggagagaggccaacggccgcccggggcgaggggagccggtagg acgggaccaggactggccgacccggccccgcgcggggaagggggcgccttcctcccacaacacaaaacggtgcgcccggg ttg g ccg cccctcccca gtggtgcggccccgggtggacg cttccg tg cg cg cg tg teak ccca g cca ttg cg gg ctg cg gg ctc caagggtcgcacacgctggagagtgcaggttgccgggtccacccacagggctgtagacacccctagggtcacacagacaag gctctggacacccacaggggcacacacattggggagtgggcactcctgggctcacaaagactgagaattcgggattacaggt g tg ag cta ttg tcccca g cca ctg ta g aaaggaaaag tttta ta cccttccg ga cta GGGA ecteg gg gg cctca g cctca ct acctaggtgctttagaaaggaggccacccaggcccatgactactccttgccacagggagccctgcacacagatgtgctaagct ctcgctgccagccagagggaggaggtctgagccagtcagaaggagatgggccccagagagtaagaaagggggaggagg acccaagctgatccaaaaggtgggtctaagcagtcaagtggaggagggttccaatctgatggcggagggcccaagctcagc ctaacgaggaggccaggcccaccaaggggcccctggagga CTTG tttcccttg tecettg tg g ttttttg ca tttcctg ttcccttg ctg ttg cg ETCA g a a g ttcctcttctta ccctgcacccagagcctcgccagagaagacaagggcagaaag
SEO ID No 3 : Vector WE SEO ID No 3: Vector WE
tggaagggctaattcactcccaaagaagacaagatatccttgatctgtggatctaccacacacaaggctacttccctgattagc agaactacacaccagggccaggggtcagatatccactgacctttggatggtgctacaagctagtaccagttgagccagataa ggtagaagaggccaataaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccggagagag aagtgttagagtggaggtttgacagccgcctagcatttcatcacgtggcccgagagctgcatccggagtacttcaagaactgct gatatcgagcttgctacaagggactttccgctggggactttccagggaggcgtggcctgggcgggactggggagtggcgagc cctca g a tectg ca ta ta a g ca g ctg ctttttg ectg ta ctg g g tetetetg gttagaccaga tetg a g ectg g g a g etetetg g ct a a cta g g g a a ccca ctg ctta a g cctca a ta a a g cttg cettg a g tg ettea a g ta g tg tg tg cccg tetg ttg tg tg a etetg g t aactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagg gaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtga gtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaatt agatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcag ggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaacca tcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagata aaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgctg atcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccat taggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttcctt gggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggta tagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcag ctccaggcaagaatcctggctgtggaaaga ta ceta aaggatcaacag etectg g g g a tttg g g g ttg etetg g a a a a etca t ttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtg ggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaaca agaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcata atgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccatt atcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagac agagacagatccattcgattagtgaacggatctcgacggtcgccaaatggcagtattcatccacaattttaaaagaaaagggg ggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaa attacaaaaattcaaaattttcgggtttattacagggacagcagagatccagtttggatcgataagcttgatatcgaattcggga ttacaggtgtgagctattgtccccagccaaaaggaaaagttttactgtagtaacccttccggactagggacctcgggcctcagc ctca g g cta ceta g g tg cttta gaaaggaggccacccaggcccatgacta ctccttg ccacagggagccctgcacacagatgt gctaagctctcgctgccagccagagggaggaggtctgagccagtcagaaggagatgggccccagagagtaagaaagggg gaggaggacccaagctgatccaaaaggtgggtctaagcagtcaagtggaggagggttccaatctgatggcggagggccca agctcagcctaacgaggaggccaggcccaccaaggggcccctggaggacttg tttcccttg tcccttg tg g ttttttg ca tttcct g ttcccttg ctg ctca ttg cg g a a g ttcctcttctta ccctgcacccagagcctcgccagagaagacaagggcagaaagcaccg gatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggc gacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatct gcaccaccggcaagctgcccgtgccctggccca ccctcg tgaccaccctgacctacggcgtgcagtg cttca g ccg cta ccccg accacatgaagcagcacga cttcttca agtccgccatgcccgaaggctacgtccaggagcgcacca tcttcttca a g g a cg a c ggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttc aaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcag aagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagacccca acgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagta aagcggccgcgactctagagtcgacctgcaggcatgcaagcttgatatcaagcttatcgataccgtcgacctcgaggcaattc gagctcggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaag g g cta a ttca ctccca a cg a a g a ca a g a tctg ctttttg cttg ta ctg g g tctctctg g tta g a cea g a tetg a g ectg g g a g etc tetg g cta a cta g g g a a ecca ctg ctta a g cetca a ta a a g cttg cettg a g tg cttca a g ta g tg tg tg cccg tctg ttg tg tg a etetg g ta a cta g a g a tccctca g a ccctttta gtcagtgtggaaaa teteta g ca g ca t tggaagggctaattcactcccaaagaagacaagatatccttgatctgtggatctaccacacacaaggctacttccctgattagc agaactacacaccagggccaggggtcagatatccactgacctttggatggtgctacaagctagtaccagttgagccagataa ggtagaagaggccaataaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccggagagag aagtgttagagtggaggtttgacagccgcctagcatttcatcacgtggcccgagagctgcatccggagtacttcaagaactgct gatatcgagcttgctacaagggactttccgctggggactttccagggaggcgtggcctgggcgggactggggagtggcgagc cctca ga tectg ca ta ta ag ca g ctg ctttttg ectg ta ctg gg tetetetg gttagaccaga tetg ag ectg GGAG etetetg g ct aa cta gggaa ccca ctg CTTA ag cctca at rt aag CTTG cettg ag tg ettea ag ta g tg tg tg tg tg ttg CCCG tetg to etetg gt aactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagg gaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtga gtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaatt agatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcag ggagctagaacgattcgcagttaatcctgg cctgttagaaacatcagaaggctgtagacaaatactgggacagctacaacca tcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagata aaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgctg atcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccat taggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttcctt gggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggta tagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcag ctccaggcaagaatcctggctgtggaaaga ta ceta aaggatcaacag etectg GGGA TTTG ggg ttg etetg GAAAA ETCA t ttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtg ggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaaca atgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccatt agaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcata atcgtttcagaccca cctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagac agagacagatccattcgattagtgaacggatctcgacggtcgccaaatggcagtattcatccacaattttaaaagaaaagggg ggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaa attacaaaaattcaaaattttcgggtttattacagggacagcagagatccagtttggatcgataagcttgatatcgaattcggga ttacaggtgtgagctattgtccccagccaaaaggaaaagttttactgtagtaacccttccggactagggacctcgggcctcagc CTCA gg gg tg cta ceta cttta gaaaggaggccacccaggcccatgacta ctccttg ccacagggagccctgcacacagatgt gctaagctctcgctgccagccagagggaggaggtctgagccagtcagaaggagatgggccccagagagtaagaaagggg gaggaggacccaagctgatccaaaaggtgggtctaagcagtcaagtggaggagggttccaatctgatggcggagggccca agctcagcctaacgaggaggccaggcccaccaaggggcccctggaggacttg tttcccttg tcccttg tg g ttttttg ca tttcct g ttcccttg ctg ttg cg CTCA Gaag ttcctcttctta ccctgcacccagagcctcgccagagaagacaagggcagaaagcaccg gatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggc gacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatct gcaccaccggcaagctgcccgtgccctggccca ccctcg tgaccaccctgacctac ggcgtgcagtg cttca g ccg cta ccccg cttcttca accacatgaagcagcacga tcttcttca agtccgccatgcccgaaggctacgtccaggagcgcacca agga cg ac ggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttc aaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcag aagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcag aacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagacccca acgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagta aagcggccgcgactctagagtcgacctgcaggcatgcaagcttgatatcaagcttatcgataccgtcgacctcgaggcaattc gagctcggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaag gg cta to TTCA ctccca to cg AAGA ca aga GTCT ctttttg CTTG ta ctg gg tctctctg g tta ga cea ga tetg ag ectg GGAG etc tetg g cta a cta gggaa ecca ctg ctta ag cetca a ta aag cttg cettg ag tg cttca ag ta g tg tg tg cccg tctg ttg tg tg a etetg g ta a cta gaga tccctca ga ccctttta gtcagtgtggaaaa teteta g ca g ca t
SEO ID No 4: Vector AWE SEO ID No 4: AWE Vector
tggaagggctaattcactcccaaagaagacaagatatccttgatctgtggatctaccacacacaaggctacttccctgattagc agaactacacaccagggccaggggtcagatatccactgacctttggatggtgctacaagctagtaccagttgagccagataa ggtagaagaggccaataaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccggagagag aagtgttagagtggaggtttgacagccgcctagcatttcatcacgtggcccgagagctgcatccggagtacttcaagaactgct gatatcgagcttgctacaagggactttccgctggggactttccagggaggcgtggcctgggcgggactggggagtggcgagc cetca g a tectg ca ta ta a g ca g ctg ctttttg ectg ta ctg g g tctctctg g tta g a cea g a tctg a g ectg g g a g etetetg g ct aactagggaacccactg ctta a g cetca a ta a a g cttg cettg a g tg cttca agtagtgtgtgcccg tctg ttg tg tg a etetg g t aactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagg gaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtga gtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaatt agatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcag ggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaacca tcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagata aaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgctg atcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccat taggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttcctt gggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggta tagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcag ctccaggcaagaa tcctggctgtggaaaga ta ceta a a g g a tea a ca g etectg g g g a tttg g g g ttg etetg g a a a a ctca t ttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtg ggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaaca agaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcata atgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccatt atcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagac agagacagatccattcgattagtgaacggatctcgacggtcgccaaatggcagtattcatccacaattttaaaagaaaagggg ggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaa attacaaaaattcaaaattttcgggtttattacagggacagcagagatccagtttggatcgataagcttgatatcgaattcggat taagtcaaaggaggagagggcaacgcggtgggcaggagagaggccaacggccgcccggggcgaggggagccggtagg acgggaccaggactggccgacccggccccgcgcggggaagggggcgccttcctcccacaacacaaaacggtgcgcccggg ttg g ccg cccctcccca gtggtgcggccccgggtggacg cttccg tg cg cg cg teca tg ccca g cca ttg cg g g ctg cg g g ctc caagggtcgcacacgctggagagtgcaggttgccgggtccacccacagggctgtagacacccctagggtcacacagacaag gctctggacacccacaggggcacacacattggggagtgggcactcctgggctcacaaagactgagaatcactagtgaattcg ggattacaggtgtgagctattgtccccagccaaaaggaaaagttttactgtagtaacccttccggactagggacctcgggcctc a g cetca g g cta ceta g g tg cttta gaaaggaggccacccaggcccatgacta etcettg ccacagggagccctgcacacag atgtgctaagctctcgctgccagccagagggaggaggtctgagccagtcagaaggagatgggccccagagagtaagaaag ggggaggaggacccaagctgatccaaaaggtgggtctaagcagtcaagtggaggagggttccaatctgatggcggagggc ccaagctcagcctaacgaggaggccaggcccaccaagggg cccctg g a g g a cttg tttcccttg tcccttg tg g ttttttg ca ttt ectg ttcccttg ctg etca ttg cg g a a g ttcctcttctta ccctgcacccagagcctcgccagagaagacaagggcagaaagca ccggatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacg gcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttca tetg ca cca ccg g ca a g ctg cccg tg cectg g ccca ccctcg tg a cca cectg a ceta cg g cg tg ca g tg ettea g ccg cta ce ccgaccacatgaagcagcacga ettettea agtccgccatgcccgaaggctacgtccaggagcgcacca tettettea a g g a c gacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcga cttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaa gcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactacca gcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccacta ectg agcacccagtccgccctgagcaaagac cccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtaca agtaaagcggccgcgactctagagtcgacctgcaggcatgcaagcttgatatcaagcttatcgataccgtcgacctcgaggca attcgagctcggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactgg aagggctaattcactcccaacgaagacaaga tetg ctttttg cttg ta ctg g g tetetetg gttagaccaga tetg a g ectg g g a g etetetg g cta a cta g g g a a ccca ctg ctta a g cetca a ta a a g cttg cettg a g tg ettea agtagtgtgtgcccg tetg ttg t g tg a etetg g ta a cta g a g a tccctca g a ccctttta gtcagtgtggaaaa teteta g ca g ca t tggaagggctaattcactcccaaagaagacaagatatccttgatctgtggatctaccacacacaaggctacttccctgattagc agaactacacaccagggccaggggtcagatatccactgacctttggatggtgctacaagctagtaccagttgagccagataa ggtagaagaggccaataaaggagagaacaccagcttgttacaccctgtgagcctgcatgggatggatgacccggagagag aagtgttagagtggaggtttgacagccgcctagcatttcatcacgtggcccgagagctgcatccggagtacttcaagaactgct gatatcgagcttgctacaagggactttccgctggggactttccagggaggcgtggcctgggcgggactggggagtggcgagc CETCA ga tectg ca ta ta ag ca g ctg ctttttg ectg ta ctg gg tctctctg g tta ga cea ga GTCT ag ectg GGAG etetetg g ct aactagggaacccactg CTTA ag CETCA at rt aag CTTG cettg ag tg cttca agtagtgtgtgcccg GTCT ttg tg tg to etetg gt aactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacttgaaagcgaaagg gaaaccagaggagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtga gtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaatt agatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcag ggagctagaacgattcgcagttaatcctggcctgtt agaaacatcagaaggctgtagacaaatactgggacagctacaacca tcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagata aaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccgctg atcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccat taggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttcctt gggttcttgggagcagcaggaagcactatgggcgcagcgtcaatgacgctgacggtacaggccagacaattattgtctggta tagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcag ctccaggcaagaa tcctggctgtggaaaga ceta aagga to ca ta tea g etectg GGGA TTTG ggg ttg etetg GAAAA CTCA t ttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagatttggaatcacacgacctggatggagtg ggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaaca agaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcata atgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccatt atcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagac agagacagatccattcgattagtgaacggatctcgacggtcgccaaatggcagtattcatccacaattttaaaagaaaagggg ggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaa attacaaaaattcaaaattttcgggtttattacagggacagcagagatccagtttggatcgataagcttgatatcgaattcggat taagtcaaaggaggagagggcaacgcggtgggcaggagagaggccaacggccgcccggggcgaggggagccggtagg acgggaccaggactggccgacccggccccgcgcggggaagggggcgccttcctcccacaacacaaaacggtgcgcccggg ttg ccg g cccctcccca gtggtgcggccccgggtggacg cttccg tg tg cg cg cg teak cca ttg cg ccca g gg gg ctg ctc cg caagggtcgcacacgctggagagtgcaggttgccgggtccacccacagggctgtagacacccctagggtcacacagacaag gctctggacacccacaggggcacacacattggggagtgggcactcctgggctcacaaagactgagaatcactagtgaattcg ggattacaggtgtgagctattgtccccagccaaaaggaaaagttttactgtagtaacccttccggactagggacctcgggcctc CETCA ag gg gg tg cta ceta cttta gaaaggaggccacccaggcccatgacta etcettg ccacagggagccctgcacacag atgtgctaagctctcgctgccagccagagggaggaggtctgagccagtcagaaggagatgg gccccagagagtaagaaag ggggaggaggacccaagctgatccaaaaggtgggtctaagcagtcaagtggaggagggttccaatctgatggcggagggc ccaagctcagcctaacgaggaggccaggcccaccaagggg cccctg gagga CTTG tttcccttg tcccttg tg g ttttttg ca ttt ectg ttcccttg ctg ETCA ttg cg Gaag ttcctcttctta ccctgcacccagagcctcgccagagaagacaagggcagaaagca ccggatccaccggtcgccaccatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacg gcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttca tetg cca ca ccg g ca ag ctg CCCG tg cectg g ccca ccctcg tg cca cectg to ceta cg g cg tg ca g tg ettea g ccg cta ce ccgaccacatgaagcagcacga ettettea agtccgccatgcccgaaggctacgtccaggagcgcacca tettettea gacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcga aggac cttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaa gcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactacca gcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccacta ectg agcacccagtccgccctgagcaaagac cccaacgaga agcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtaca agtaaagcggccgcgactctagagtcgacctgcaggcatgcaagcttgatatcaagcttatcgataccgtcgacctcgaggca attcgagctcggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactgg aagggctaattcactcccaacgaagacaaga tetg ctttttg CTTG ta ctg gg tetetetg gttagaccaga tetg ag ectg GGAG etetetg g cta to cta ccca gggaa ctg CTTA ag CETCA at rt aag CTTG cettg ag tg ettea agtagtgtgtgcccg tetg ttg tg tg etetg g ta cta gaga tccctca ccctttta ga gtcagtgtggaaaa teteta g ca g ca t

Claims

REIVINDICACIONES
1.- Método para la identificación y/o aislamiento de células progenitoras hematopoyéticas que comprende los siguientes pasos: 1.- Method for the identification and / or isolation of hematopoietic progenitor cells comprising the following steps:
a. Transfectar o transducir una célula madre pluripotente ó multipotente ó un grupo de células madre pluripotentes ó multipotentes con una molécula de ácido nucleico capaz de integrarse en el genoma de dicha célula que comprende una primera secuencia de ácido nucleico que se une operativamente a una segunda secuencia de ácido nucleico, donde la primera secuencia de ácido nucleico comprende la secuencia promotora SEQ ID No 1 (promotor proximal) y donde la segunda secuencia de ácido nucleico comprende un gen marcador;  to. Transfecting or transducing a pluripotent or multipotent stem cell or a group of pluripotent or multipotent stem cells with a nucleic acid molecule capable of integrating into the genome of said cell comprising a first nucleic acid sequence that is operably linked to a second sequence of nucleic acid, where the first nucleic acid sequence comprises the promoter sequence SEQ ID No 1 (proximal promoter) and where the second nucleic acid sequence comprises a marker gene;
b. Cultivar las células transfectadas o transducidas con la molécula de ácido nucleico del paso previo en un medio de cultivo específico para inducir su diferenciación a linaje hematopoyético suplementado con factores de crecimiento celular; y  b. Cultivate the cells transfected or transduced with the nucleic acid molecule from the previous step in a specific culture medium to induce their differentiation to hematopoietic lineage supplemented with cell growth factors; Y
c. Identificar y/o aislar células progenitoras hematopoyéticas mediante el análisis de la expresión del gen marcador y opcionalmente al menos un marcador hematopoyético presente en las mismas.  C. Identify and / or isolate hematopoietic progenitor cells by analyzing the expression of the marker gene and optionally at least one hematopoietic marker present therein.
2. El método de la reivindicación 1, donde la primera secuencia de ácido nucleico comprende la SEQ ID No 2 (promotor alternativo). 2. The method of claim 1, wherein the first nucleic acid sequence comprises SEQ ID No 2 (alternative promoter).
3. El método de la reivindicación 1, donde la molécula de ácido nucleico capaz de integrarse en el genoma de la célula es la SEQ ID No 3 (vector WE). 3. The method of claim 1, wherein the nucleic acid molecule capable of integrating into the genome of the cell is SEQ ID No 3 (WE vector).
4. El método de la reivindicación 1, donde la molécula de ácido nucleico capaz de integrarse en el genoma de la célula es la SEQ ID No 4 (vector AWE). 4. The method of claim 1, wherein the nucleic acid molecule capable of integrating into the genome of the cell is SEQ ID No 4 (AWE vector).
5. El método según cualquiera de las reivindicaciones anteriores, donde el gen marcador codifica para al menos una proteína marcadora selecciona de la lista que consiste en GFP y eGFP. 5. The method according to any of the preceding claims, wherein the marker gene encodes for at least one marker protein selected from the list consisting of GFP and eGFP.
6. - El método según cualquiera de las reivindicaciones 1-5, donde las células progenitoras hematopoyéticas identificadas y/o aisladas se caracterizan por ser negativas para los tres siguientes marcadores fenotípicos: CD45, CD31 y CD34. 6. - The method according to any of claims 1-5, wherein the identified and / or isolated hematopoietic progenitor cells are characterized by being negative for the following three phenotypic markers: CD45, CD31 and CD34.
HOJA DE REEMPLAZO (Regla 26) REPLACEMENT SHEET (Rule 26)
7. - El método según cualquiera de las reivindicaciones 1-5, donde las células progenitoras hematopoyéticas identificadas y/o aisladas se caracterizan por ser positivas para CD34 y negativas para CD45. 7. - The method according to any of claims 1-5, wherein the identified and / or isolated hematopoietic progenitor cells are characterized by being positive for CD34 and negative for CD45.
8. - El método según cualquiera de las reivindicaciones 1-5, donde las células progenitoras hematopoyéticas identificadas y/o aisladas se caracterizan por ser positivas para CD34 y CD45. 8. - The method according to any of claims 1-5, wherein the hematopoietic progenitor cells identified and / or isolated are characterized as being positive for CD34 and CD45.
9. El método según cualquiera de las reivindicaciones anteriores, donde la célula madre pluripotente o el grupo de células madre pluripotentes se seleccionan de la lista que consiste en: células pluripotentes inducidas (iPSs), células madre embrionarias no humanas, células madre de médula ósea, células madre de sangre de cordón umbilical, células madre de sangre periférica y células madre de grasa corporal. 9. The method according to any of the preceding claims, wherein the pluripotent stem cell or the group of pluripotent stem cells is selected from the list consisting of: induced pluripotent cells (iPSs), non-human embryonic stem cells, bone marrow stem cells , umbilical cord blood stem cells, peripheral blood stem cells and body fat stem cells.
10. El método según la reivindicación 9, donde la célula madre pluripotente o el grupo de células madre pluripotentes son células pluripotentes inducidas (iPSs). 10. The method according to claim 9, wherein the pluripotent stem cell or the group of pluripotent stem cells are induced pluripotent cells (iPSs).
11. Células progenitoras hematopoyéticas (HPCs) aisladas obtenibles de acuerdo con el método descrito en cualquiera de las reivindicaciones 1 a 10. 11. Isolated hematopoietic progenitor cells (HPCs) obtainable according to the method described in any one of claims 1 to 10.
12. Población de células progenitoras hematopoyéticas aisladas obtenibles de acuerdo con el método descrito en cualquiera de las reivindicaciones 1 a 10. 12. Population of isolated hematopoietic progenitor cells obtainable according to the method described in any one of claims 1 to 10.
13. Composición que comprende una célula progenitora hematopoyética aislada ó una población aislada de células progenitoras hematopoyéticas según cualquiera de las reivindicaciones 11 o 12. 13. Composition comprising an isolated hematopoietic progenitor cell or an isolated population of hematopoietic progenitor cells according to any of claims 11 or 12.
14. Composición según la reivindicación anterior, donde dicha composición es una composición farmacéutica que opcionalmente comprende un vehículo farmacéuticamente aceptable. 14. Composition according to the preceding claim, wherein said composition is a pharmaceutical composition that optionally comprises a pharmaceutically acceptable carrier.
15. La composición farmacéutica de la reivindicación 14 que además comprende un segundo principio activo. 15. The pharmaceutical composition of claim 14 further comprising a second active ingredient.
HOJA DE REEMPLAZO (Regla 26) REPLACEMENT SHEET (Rule 26)
16. Composición que comprende una célula progenitora hematopoyética aislada ó una población aislada de células progenitoras hematopoyéticas según cualquiera de las reivindicaciones 11 o 12 para su uso como medicamento. 16. Composition comprising an isolated hematopoietic progenitor cell or an isolated population of hematopoietic progenitor cells according to any of claims 11 or 12 for use as a medicament.
17. Composición que comprende una célula progenitora hematopoyética aislada ó una población aislada de células progenitoras hematopoyéticas según cualquiera de las reivindicaciones 11 o 12 para su uso en el tratamiento de enfermedades de naturaleza hematopoyética. 17. Composition comprising an isolated hematopoietic progenitor cell or an isolated population of hematopoietic progenitor cells according to any of claims 11 or 12 for use in the treatment of diseases of a hematopoietic nature.
18. Composición de acuerdo con la reivindicación 17, donde las enfermedades de naturaleza hematopoyética se seleccionan entre inmunodeficiencias primarias y/o enfermedades autoinmunes. 18. Composition according to claim 17, wherein hematopoietic diseases are selected from primary immunodeficiencies and / or autoimmune diseases.
HOJA DE REEMPLAZO (Regla 26) REPLACEMENT SHEET (Rule 26)
PCT/ES2013/070200 2012-03-26 2013-03-26 Vectors for identifying hematopoietic lineage WO2013144409A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
ESP201230449 2012-03-26
ES201230449 2012-03-26

Publications (2)

Publication Number Publication Date
WO2013144409A2 true WO2013144409A2 (en) 2013-10-03
WO2013144409A3 WO2013144409A3 (en) 2014-01-16

Family

ID=48613662

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/ES2013/070200 WO2013144409A2 (en) 2012-03-26 2013-03-26 Vectors for identifying hematopoietic lineage

Country Status (1)

Country Link
WO (1) WO2013144409A2 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020099572A1 (en) * 2018-11-14 2020-05-22 Fundación Pública Andaluza Progreso Y Salud Polynucleotide for safer and more effective immunotherapies

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090028836A1 (en) * 2005-06-01 2009-01-29 Kalle Christof Von Stem and progenitor cell expansion by evi, evi-like genes and setbp1

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020099572A1 (en) * 2018-11-14 2020-05-22 Fundación Pública Andaluza Progreso Y Salud Polynucleotide for safer and more effective immunotherapies

Also Published As

Publication number Publication date
WO2013144409A3 (en) 2014-01-16

Similar Documents

Publication Publication Date Title
Song et al. Improved hematopoietic differentiation efficiency of gene-corrected beta-thalassemia induced pluripotent stem cells by CRISPR/Cas9 system
JP6005666B2 (en) Production of hematopoietic progenitor cells by programming
JP2017079749A (en) Method for cellular RNA expression
WO2016077273A1 (en) Engineering mesenchymal stem cells using homologous recombination
US20220401491A1 (en) Mesenchymal stem cell expressing trail and cd, and use thereof
WO2007082963A1 (en) Human embryo stem-cell lines and methods for using same
US20220401518A1 (en) Mesenchymal stem cell expressing hepatocyte growth factor, and use thereof
KR20160075676A (en) Method
JP6275646B2 (en) MAIT-like cell and method for producing the same
WO2019089826A1 (en) Compositions and methods for the expansion of hematopoietic stem and progenitor cells
Cui et al. Human umbilical cord and dental pulp-derived mesenchymal stem cells: Biological characteristics and potential roles in vitro and in vivo
EP3216868A1 (en) Virus vector, cell, and construct
IL292004A (en) Composition for reprogramming cells into plasmacytoid dendritic cells or interferon type i-producing cells, methods and uses thereof
WO2013144409A2 (en) Vectors for identifying hematopoietic lineage
US20210340495A1 (en) Method for inducing and differentiating pluripotent stem cells and uses thereof
ES2536605B1 (en) Method of obtaining megakaryocytes and platelets
WO2008136656A1 (en) Improved methods and means for lentiviral gene delivery
JP2008545408A (en) Methods for delivering nucleic acid molecules to embryonic stem cells using baculovirus vectors
JP2013009742A (en) Composition and method for suppressing growth of pluripotent stem cell
WO2018077278A1 (en) Medical uses of notch4 or inhibitor thereof
WO2023286832A1 (en) Pericyte-like cells expressing vascular endothelial growth factor (vegf) at high level
WO2023286834A1 (en) Pericyte-like cell expressing vascular endothelial growth factor (vegf) at high level
WO2023140349A1 (en) Cell sheet
WO2024125592A1 (en) Universal cell and preparation method therefor
He et al. Protective effects of bone marrow mesenchymal stem cells with stable expression of Bcl-2 on ischemia-hypoxia of hippocampal neurons

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13728434

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 13728434

Country of ref document: EP

Kind code of ref document: A2