WO2013141816A1 - A method of diagnosing and/or treating corneal fibrosis - Google Patents

A method of diagnosing and/or treating corneal fibrosis Download PDF

Info

Publication number
WO2013141816A1
WO2013141816A1 PCT/SG2013/000113 SG2013000113W WO2013141816A1 WO 2013141816 A1 WO2013141816 A1 WO 2013141816A1 SG 2013000113 W SG2013000113 W SG 2013000113W WO 2013141816 A1 WO2013141816 A1 WO 2013141816A1
Authority
WO
WIPO (PCT)
Prior art keywords
moesin
compound
corneal
polynucleotide sequence
fibrosis
Prior art date
Application number
PCT/SG2013/000113
Other languages
French (fr)
Inventor
Roger Wilmer BEUERMAN
Hong Yuan ZHU
Original Assignee
Singapore Health Services Pte Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Singapore Health Services Pte Ltd filed Critical Singapore Health Services Pte Ltd
Publication of WO2013141816A1 publication Critical patent/WO2013141816A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/16—Ophthalmology

Definitions

  • This invention relates generally to a method of diagnosis and/or treatment of corneal fibrosis. Background of the invention
  • the avascular cornea accounts for about two-thirds of the total refractive power of the eye, therefore maintenance of corneal transparency is critical for focusing light onto the retina.
  • the cornea is organized into 5 layers: epithelium, Bowman's membrane, stroma, Descemet's membrane and endothelium.
  • the stroma comprising about 90% of human corneal thickness, is largely composed of collagen and extra-cellular matrix with resident fibroblasts, referred to as keratocytes. 2"8
  • keratocytes normally have a very low level of biosynthetic activity, the injury response can lead to their differentiation into myofibroblasts with the conspicuous appearance of smooth muscle actin, resulting in fibrosis and a loss of corneal transparency.
  • Corneal fibrosis may develop as a sequelae to infections, corneal ulcers and a wide spectrum of corneal stroma injuries including ocular trauma, large epithelial debridement, alkali burns, and surgery including refractive laser surgery.
  • Mitomycin C reduces subepithelial fibrosis after refractive corneal surgery, but several complications are reported with its topical use, such as loss of keratocytes, corneal endothelial damage, limbal/scleral necrosis, and abnormal wound healing.
  • TGF- ⁇ produced by injured corneal epithelial cells can activate corneal stroma keratocytes, initiating the differentiation into a myofibroblast phenotype, 10,23,24 stromal remodeling with extracellular matrix and collagen synthesis forming a fibrotic scar. 15, 25 Therefore, TGF- ⁇ became a major target for therapeutic strategies to prevent fibrosis.
  • TGF-B1 has many essential roles in a variety of developmental and pathological processes, including immune regulation, and wound healing; and therefore, as a focus of efforts to reverse fibrosis, it is non-selective. 26
  • treatment for corneal fibrosis relies principally on the use of various types of corneal transplants.
  • a method of diagnosing corneal fibrosis in a subject comprising measuring the expression level of moesin in an isolated sample from the subject, and comparing the expression level of moesin with a reference value; wherein an increase in the expression level of moesin in the sample compared to the reference value indicates the presence of corneal fibrosis in the subject.
  • the method may further comprise selecting a patient at risk of corneal fibrosis as a subject.
  • the reference value is determined from at least one subject not exhibiting signs or, or experiencing symptoms of corneal fibrosis. More in particular, the reference value is determined from a statistically significant number of subjects not exhibiting signs or, or experiencing symptoms of corneal fibrosis.
  • the isolated sample may be a fluid sample or a tissue sample.
  • the isolated sample may be a cornea tissue sample or a tear sample.
  • a kit for diagnosing corneal fibrosis in a subject comprising a compound capable of detecting the presence of moesin.
  • the kit may comprise a compound capable of detecting the presence of moesin.
  • the compound may comprise a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise a polynucleotide sequence selected from SEQ ID NOs: 3-10 presented in Table , or a complementary sequence thereof.
  • the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound comprises a monoclonal or polyclonal antibody.
  • a method for treating corneal fibrosis in a subject comprising administering to the subject an effective amount of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin.
  • the compound may comprise a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise a RNA interference (RNAi) molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. Even more in particular, the compound comprises a small interfering RNA (siRNA) molecule or an small hairpin RNA (shRNA) molecule. Even more in particular, the compound comprises a polynucleotide sequence selected from SEQ ID NOs: 3-10 presented in Table 1 , or a complementary sequence thereof.
  • RNAi RNA interference
  • shRNA small hairpin RNA
  • the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound may comprise a monoclonal or a polyclonal antibody.
  • the administering comprises administering in vivo.
  • the administering may comprise topical, oral, and/or parenteral administration. More in particular, the administering is by iontophoresis.
  • the administering comprises administering a viral vector comprising a polynucleotide sequence selected from SEQ ID NOs.3-10.
  • the administering comprises administering a viral vector comprising at least two polynucleotide sequences selected from SEQ ID NOs.3 and 4, and/or SEQ ID NOs. 5 and 6, and/or SEQ ID NOs. 7 and 8.
  • the virus vector may be adeno-associated virus (AAV) vector.
  • AAV adeno-associated virus
  • the compound for use in the treatment of corneal fibrosis, wherein the compound is capable of inhibiting and/or reducing the expression and/or activity of moesin.
  • the compound comprises a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
  • the compound may comprise a RNAi molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
  • the compound may comprise an siRNA molecule or an shRNA molecule.
  • the compound may comprise a polynucleotide sequence selected from SEQ ID NOs: 3-10, or a complementary sequence thereof.
  • the compound may comprising an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound may comprise a monoclonal or polyclonal antibody.
  • the present invention provides the use of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin in the preparation of a medicament for treating corneal fibrosis.
  • the present invention provides a pharmaceutical composition for use in the treatment of corneal fibrosis, comprising a compound capable of inhibiting and/or reducing the expression and/or activity of moesin.
  • Figure 1 shows a Histological Evaluation of corneal wound healing after anterior keratoetomy.
  • Cornea wound was made centrally by light application of a 2 mm trephine, to cut partially through the cornea which permitted a disc of corneal epithelial-stroma tissue within the wound to be removed with a #5 Dumont forceps.
  • Hematoxylin and Eosin-stained tissue sections showed various corneal wound healing phases after the anterior keratectomy. Wound area was shown in the box.
  • Image time points are (A) normal cornea, (B) cornea at postoperative (PO) day 1 , (C) cornea at PO day 3, and (D) cornea at PO day 5. 10X.
  • Figure 2 shows Up-regulation of moesin and a-SMA in mouse cornea induced by topical application of TGF- ⁇ .
  • Red spots represent the up-regulated cytoskeleton regulators (>4 fold, p ⁇ 0.05, Group 3-AKT compared to Group 1- NC). Msn: moesin.
  • the fold change of each transcript in the corneal stroma was obtained by setting the value for group 1-NC to 1. Bars represent mean ⁇ S.D. *P ⁇ 0.05, Results represent three independent experiments.
  • FIG. 4 Dual immunofluorescence staining demonstrated that moesin co- localized with a-SMA within corneal stroma keratocytes in the corneal fibrosis.
  • Green moesin; Red: a-SMA; Blue: DAPI staining of cellular nuclei. Results represent three independent experiments.
  • Figure 5 Quantification of moesin- and a-SMA-positive cells. The percentage of cells expressing both moesin and a-SMA versus cells expressing only moesin is 30.5% at PO day 1 , 52.4% at PO day 3, and 96.7% at PO day 5.
  • FIG. 6 Distribution of fluorescein-labeled moesin siRNA in the group 4-AKSi (anterior keratectomy and moesin siRNA) at 24 hours after in vivo delivery of moesin siRNA by iontophoresis into the cornea.
  • corneal stroma keratocytes (yellow arrow) positive for fluorescein-labeled moesin siRNA.
  • Green moesin siRNA
  • Blue DAPI staining of cellular nuclei. Results represent three independent experiments.
  • Moesin targeting siRNA or control siRNA was delivered into the cornea in vivo by iontophoresis.
  • TGF- ⁇ + represents "TGF- ⁇ was topically applied at the day of surgery”
  • TGF- ⁇ + represents "TGF- ⁇ was topically applied at the day of surgery”
  • TGF- ⁇ + represents "TGF- ⁇ was topically applied at the day of surgery and PO day 3”.
  • Results represent three independent experiments. Bars represent mean ⁇ S.D.
  • Figure 8 In vivo slit lamp macroscopic observation of the cornea in group 2-AK and group 5-AKTSi. At PO day 5, group 5-AKTSi CTRL showed more prominent opacification than group 5-AKTSi MSN.
  • AKTSi MSN represents “anterior keratectomy, topical application of TGF- ⁇ and moesin siRNA”
  • AKTSi CTRL represents “anterior keratectomy, topical application of TGF- ⁇ and control siRNA”.
  • normal represents "group 1-NC”.
  • a method of diagnosing corneal fibrosis in a subject comprising measuring the expression level of moesin in an isolated sample from the subject, and comparing the expression level of moesin with a reference value, wherein an increase in the expression level of moesin in the sample compared to the reference value indicates the presence of corneal fibrosis in the subject.
  • the method may further comprise selecting a patient at risk of corneal fibrosis as a subject.
  • the expression level of moesin may be measured by any means known in the art.
  • the expression level of moesin may be measured by western blotting. More in particular, the expression level of moesin may be measured by real-time PCR using the primer pairs represented by SEQ ID No. 1 (GTTTCCAGCCAAACTTCACC) and SEQ ID No. 2 (GTGACACGCACACTGATCG).
  • the reference value is determined from at least one subject not exhibiting signs or, or experiencing symptoms of corneal fibrosis. More in particular, the reference value is determined from a statistically significant number of subjects not exhibiting signs or, or experiencing symptoms of corneal fibrosis. Examples of signs or symptoms of corneal fibrosis include cloudy or opaque cornea in the absence or presence of edema. In particular, a 1.5- to 2-fold increase in the expression level of moesin compared to the reference value indicates the presence of corneal fibrosis in the subject.
  • the isolated sample may be a fluid sample or a tissue sample. More in particular, the isolated sample may be a cornea tissue sample. The cornea tissue sample may be obtained from biopsy. More in particular, the isolated sample may be a tear sample.
  • kits for diagnosing corneal fibrosis in a subject comprising a compound capable of detecting the presence of moesin.
  • the kit may comprise a compound capable of detecting the presence of moesin.
  • the compound may comprise a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise at least one polynucleotide sequence selected from SEQ ID NOs: 3-10 presented in Table 1 , or a complementary sequence thereof.
  • the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound comprises a monoclonal or polyclonal antibody.
  • the antibody may be produced by any means commonly known in the art.
  • a method for treating corneal fibrosis in a subject comprising administering to the subject an effective amount of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin.
  • the compound may comprise a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
  • the compound may comprise a RNA interference (RNAi) molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
  • RNAi RNA interference
  • the compound comprises a small interfering RNA (siRNA) molecule or an small hairpin RNA (shRNA) molecule.
  • shRNA small hairpin RNA
  • the compound comprises at least one polynucleotide sequence selected from SEQ ID NOs: 3- 10 presented in Table 1 , or a complementary sequence thereof.
  • the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound may comprise a monoclonal or a polyclonal antibody.
  • the administering may comprise administering in vivo.
  • the administering may comprise topical, oral, or intra-venous administration.
  • the administering is by iontophoresis.
  • the administrering may comprise administering a viral vector comprising a polynucleotide sequence selected from SEQ ID Nos. 3-10.
  • the administering may comprise topical administration of the viral vector.
  • the administering may comprise administering a viral vector comprising at least two polynucleotide sequences selected from SEQ ID Nos. 3 and 4 and/or SEQ ID Nos. 5 and 6, and/or SEQ ID Nos. 7 and 8.
  • the viral vector may be an adeno-associated virus (AAV) vector.
  • AAV adeno-associated virus
  • the compound comprises a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
  • the compound may comprise a RNAi molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
  • the compound may comprise an siRNA molecule or an shRNA molecule.
  • the compound may comprise at least one polynucleotide sequence selected from SEQ ID NOs: 3-10 presented in Table 1 , or a complementary sequence thereof.
  • the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound may comprise a monoclonal or polyclonal antibody.
  • the present invention provides the use of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin in the preparation of a medicament for treating corneal fibrosis.
  • the present invention provides a pharmaceutical composition for use in the treatment of corneal fibrosis, comprising a compound capable of inhibiting and/or reducing the expression and/or activity of moesin.
  • the damaged corneal epithelium did not heal completely at PO day 3.. Although healing proceeded uniformily, it required longer times as the reconstituting the epithelium after a keratectomy wound is somewhat slower than for an abrasion which leaves the basal lamina intact. Keratocyte-to-myofibroblast transformation stimulated by TGF-B1
  • TGF- ⁇ induces the differentiation of corneal stroma keratocytes to a myofibroblastic state as typical in corneal fibrosis. 27 ' 49"51
  • the expression of a-SMA has been used extensively to monitor this cellular change. 51, 52
  • Our results corroborated those findings and also noted that in the normal corneal stroma, a-SMA expression was not detectable.
  • 3-AKT anterior keratectomy and TGF- ⁇
  • topical application of TGF- ⁇ induced a time-dependent increase in a-SMA expression at PO days 1 , 3 and 5 (Fig.
  • the RT 2 Profiler PCR-array which included 84 cytoskeleton regulator genes was used for screening cytoskeleton regulators using RNA isolated from the corneal stroma in Group 1-NC (no procedure) and Group 3 (anterior keratectomy and topical application of TGF- ⁇ ).
  • RNA isolated from the corneal stroma in Group 1-NC no procedure
  • Group 3 anterior keratectomy and topical application of TGF- ⁇ .
  • moesin was identified as the most highly induced gene in stroma tissue from Group 3 (20.96-fold increase compared to Group 1 at PO day 1 , Fig. 3A).
  • a-SMA is the phenotypic hallmark of the transition of fibroblasts-to- myofibroblasts
  • moesin and a-SMA were found within the same cell.
  • Group 3 anterior keratectomy and topical application of TGF- ⁇
  • dual immuofluorescence staining showed co-localization of moesin and a-SMA within corneal stroma keratocytes in the area of the injury (Fig. 4).
  • the percentage of cells expressing both moesin and a-SMA versus cells expressing only moesin is 30.5% at PO day 1 , 52.4% at PO day 3, and 96.7% at PO day 5.
  • TGF- ⁇ The relationship between TGF- ⁇ and moesin expression required further analysis for verification.
  • Group 1-NC no procedure
  • Group 3-AKT anterior keratectomy and topical application of TGF-fi1
  • TGF- ⁇ elevated the expression of moesin in the corneal stroma 1.64-fold increase over control at PO day 1 , 1.85-fold at PO day 3 and 2.10-fold at PO day 5 (Fig. 2D).
  • TGF- ⁇ was associated with the up-regulated expression of moesin in the corneal stroma further implicating moesin as an important link in the pathway to a-SMA regulation.
  • moesin siRNA was detected at 24 hours after iontophoresis, appearing as aggregates in corneal stroma keratocytes, as shown in Fig 6A verifying delivery to the appropraite cellular site.
  • moesin siRNA reduced the synthesis of moesin in the corneal stroma by -0.69, -0.77, and - 0.80 fold when compared with Group 4-AKSi CTRL (anterior keratectomy and control siRNA, used as a control) at PO days 1 , 3 and 5 respectively (Fig. 7C).
  • TGF- ⁇ -induced up-regulation of moesin in the corneal stroma was significantly decreased by moesin siRNA.
  • Moesin siRNA diminished the up-regulation of moesin by 0.41-, 0.29-, and 0.18-fold ocompared to Group 5-AKTSi CTRL (anterior keratectomy, topical application of TGF- ⁇ and control siRNA, used as a control) at PO day 1 , 3 and 5 respectively (Fig. 7E).
  • Keratocyte-to-myofibroblast differentiation is moesin-dependent
  • moesin siRNA on the differentiation of the corneal stroma keratocyte-to-myofibroblast in the development of corneal fibrosis, as defined by expression of the myofibroblast marker, a-SMA, was examined.
  • Group 4-AKSi MSN anterior keratectomy and moesin siRNA
  • application of moesin siRNA reduced the expression of a-SMA in the corneal stroma to 0.76-, 0.59-, and 0.89- fold of the group 4-AKSi CTRL (anterior keratectomy and control siRNA, used as a control) at PO day 1 , 3 and 5 respectively (Fig. 7D).
  • moesin siRNA reduced the ability of TGF- ⁇ to induce a-SMA up-regulation following an anterior keratectomy.
  • cytoskeleton regulators 28"36 a class of proteins which links the intracellular cytoskeleton with the extracellular environment and regulation of smooth muscle actin; however, as this is a large group of proteins evidence for involvement of specific members of this class of proteins in the development of corneal fibrosis has not been developed.
  • the cytoskeleton is a dynamic cell organelle which tranduces external microenvironmental events to initiate changes in cell motility, proliferation, migration and phenotype. 37"45 In response to injury, differentiation and rearrangement of the cytoskeleton architecture of the fibroblast results in increased expression of cytoskeleton regulators, changing smooth muscle actin and subsequent appearance as a myofibroblast. 30 ' 46 Recently, interest in the ERM (ezrin/radixin/moesin) family of cytoskeleton regulators has shown that these proteins can organize membrane domains and act as links to the cytoskeleton as well as signaling pathways involved in many cellular processes. 47 Cytoskeleton disruption agents have been shown to prevent the formation of fibrosis further suggesting the involvement of this family of proteins.
  • Exogenous TGF-&1 can induce myofibroblast formation.
  • 49 ' 66 TGF- ⁇ induced keratocytes to develop myofibroblast characteristics in cultured rabbit and human 67 corneal keratocytes which then resembled human corneal fibrotic processes.
  • 27 In an organ culture study using bovine corneas with central wounds created with a circular trephine, myofibroblasts developed in the stroma after treatment with 100ng/ml of TGF- ⁇ .
  • 51 In other studies, it was found that a neutralizing antibody to inactivate TGF- ⁇ decreased the formation of fibrosis during corneal wound healing. 16 In the rabbit eye, fibrosis developed after photorefractive keratectomy followed by topical application of TGF- ⁇ (1 g/ml).
  • a-SMA is the phenotypic marker of the myofibroblast and is not detected in normal corneal stromal keratocytes.
  • the up-regulation of a- SMA in stromal keratocytes indicates their transformation to a myofibroblast which can occur, as in this study, as part of the response to injury.
  • moesin may be a required protein for the corneal stroma keratocyte-to-myofibroblast differentiation in the development of corneal fibrosis.
  • Wilson SE Mohan RR, Ambrosio R Jr, Hong J, Lee J.
  • the corneal wound healing response cytokine-mediated interaction of the epithelium, stroma, and inflammatory cells. Progress in Retinal and Eye Research 2001 : 20: 625-637.
  • LeRoy EC Increased collagen synthesis by scleroderma skin fibroblasts in vitro: a possible defect in the regulation or activation of the scleroderma fibroblast. J Clin Invest 974:54:880-9.
  • Maciver SK Hussey PJ.
  • the ADF/cofilin family actin-remodeling proteins. Genome Biol 2002:3:reviews3007.
  • Tandon A Tovey JC, Sharma A, Gupta R, Mohan RR. Role of transforming growth factor Beta in corneal function, biology and pathology. Curr Mol Med 2010:10:565-78.
  • Cowin AJ Hatzirodos N, Teusner JT, Belford DA. Differential effect of wounding on actin and its associated proteins, paxiilin and geisolin, in fetal skin explants. J Invest Dermatol 2003: 120: 1 1 18-29.
  • Van Beurden HE Snoek PA, Von den Hoff JW, Torensma R, Maltha JC, Kuijpers-Jagtman AM. Dynamic protein expression patterns during intraoral wound healing in the rat. Eur J Oral Sci 2005: 1 13: 153-8.
  • TGF beta induced myofibroblast differentiation of rabbit keratocytes requires synergistic TGF beta, PDGF and integrin signaling. Exp. Eye Res 2002:75:645-657.

Abstract

There is provided a method of diagnosing corneal fibrosis in a subject, comprising measuring the expression level of moesin in an isolated sample from the subject, and comparing the expression level of moesin with a reference value, wherein an increase in the expression level of moesin in the sample compared to the reference value indicates the presence of corneal fibrosis in the subject. There is also provided a compound for use in treatment of corneal fibrosis.

Description

A METHOD OF DIAGNOSING AND/OR TREATING CORNEAL FIBROSIS Field of the invention
This invention relates generally to a method of diagnosis and/or treatment of corneal fibrosis. Background of the invention
The avascular cornea accounts for about two-thirds of the total refractive power of the eye, therefore maintenance of corneal transparency is critical for focusing light onto the retina.1 The cornea is organized into 5 layers: epithelium, Bowman's membrane, stroma, Descemet's membrane and endothelium.2 The stroma, comprising about 90% of human corneal thickness, is largely composed of collagen and extra-cellular matrix with resident fibroblasts, referred to as keratocytes.2"8 Although, keratocytes normally have a very low level of biosynthetic activity, the injury response can lead to their differentiation into myofibroblasts with the conspicuous appearance of smooth muscle actin, resulting in fibrosis and a loss of corneal transparency.9"11 The impact on vision is highlighted by the finding that corneal fibrosis as a contributor to "corneal blindness" is considered to be the third leading cause of blindness world-wide.12 Corneal fibrosis may develop as a sequelae to infections, corneal ulcers and a wide spectrum of corneal stroma injuries including ocular trauma, large epithelial debridement, alkali burns, and surgery including refractive laser surgery.13"18 Mitomycin C reduces subepithelial fibrosis after refractive corneal surgery, but several complications are reported with its topical use, such as loss of keratocytes, corneal endothelial damage, limbal/scleral necrosis, and abnormal wound healing.19"22 < As part of the response to injury, TGF-βΙ produced by injured corneal epithelial cells can activate corneal stroma keratocytes, initiating the differentiation into a myofibroblast phenotype, 10,23,24 stromal remodeling with extracellular matrix and collagen synthesis forming a fibrotic scar.15, 25 Therefore, TGF-βΙ became a major target for therapeutic strategies to prevent fibrosis. However, as TGF-B1 has many essential roles in a variety of developmental and pathological processes, including immune regulation, and wound healing; and therefore, as a focus of efforts to reverse fibrosis, it is non-selective.26 Currently, treatment for corneal fibrosis relies principally on the use of various types of corneal transplants.27 Although the success rate of corneal transplant is reasonable, this operation is associated with certain drawbacks, such as shortages of corneal donor and the risk of tissue rejection. Therefore a method of diagnosing and treating corneal fibrosis where the aforementioned drawbacks are mitigated would be desirable.
Summary of the invention
According to an aspect of the invention, there is provided a method of diagnosing corneal fibrosis in a subject, the method comprising measuring the expression level of moesin in an isolated sample from the subject, and comparing the expression level of moesin with a reference value; wherein an increase in the expression level of moesin in the sample compared to the reference value indicates the presence of corneal fibrosis in the subject. The method may further comprise selecting a patient at risk of corneal fibrosis as a subject. In particular, the reference value is determined from at least one subject not exhibiting signs or, or experiencing symptoms of corneal fibrosis. More in particular, the reference value is determined from a statistically significant number of subjects not exhibiting signs or, or experiencing symptoms of corneal fibrosis. The isolated sample may be a fluid sample or a tissue sample. For example, the isolated sample may be a cornea tissue sample or a tear sample. According to another aspect, there is provided a kit for diagnosing corneal fibrosis in a subject, the kit comprising a compound capable of detecting the presence of moesin. In particular, the kit may comprise a compound capable of detecting the presence of moesin. In particular, the compound may comprise a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise a polynucleotide sequence selected from SEQ ID NOs: 3-10 presented in Table , or a complementary sequence thereof.
According to an alternative aspect, the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound comprises a monoclonal or polyclonal antibody.
According to another aspect of the invention, there is provided a method for treating corneal fibrosis in a subject, the method comprising administering to the subject an effective amount of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin.
In particular, the compound may comprise a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise a RNA interference (RNAi) molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. Even more in particular, the compound comprises a small interfering RNA (siRNA) molecule or an small hairpin RNA (shRNA) molecule. Even more in particular, the compound comprises a polynucleotide sequence selected from SEQ ID NOs: 3-10 presented in Table 1 , or a complementary sequence thereof.
According to an alternative aspect, the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound may comprise a monoclonal or a polyclonal antibody.
In particular, the administering comprises administering in vivo. Alternatively, the administering may comprise topical, oral, and/or parenteral administration. More in particular, the administering is by iontophoresis. Even more in particular, the administering comprises administering a viral vector comprising a polynucleotide sequence selected from SEQ ID NOs.3-10. Even more in particular, the the administering comprises administering a viral vector comprising at least two polynucleotide sequences selected from SEQ ID NOs.3 and 4, and/or SEQ ID NOs. 5 and 6, and/or SEQ ID NOs. 7 and 8. In particular, the virus vector may be adeno-associated virus (AAV) vector. According to another aspect of the invention, there is provided a compound for use in the treatment of corneal fibrosis, wherein the compound is capable of inhibiting and/or reducing the expression and/or activity of moesin. In particular, the compound comprises a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise a RNAi molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. Even more in particular, the compound may comprise an siRNA molecule or an shRNA molecule. Even more in particular, the compound may comprise a polynucleotide sequence selected from SEQ ID NOs: 3-10, or a complementary sequence thereof.
In particular, the compound may comprising an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound may comprise a monoclonal or polyclonal antibody.
According to another aspect, the present invention provides the use of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin in the preparation of a medicament for treating corneal fibrosis. According to a further aspect, the present invention provides a pharmaceutical composition for use in the treatment of corneal fibrosis, comprising a compound capable of inhibiting and/or reducing the expression and/or activity of moesin.
Brief description of the figures Figure 1 shows a Histological Evaluation of corneal wound healing after anterior keratoetomy. Cornea wound was made centrally by light application of a 2 mm trephine, to cut partially through the cornea which permitted a disc of corneal epithelial-stroma tissue within the wound to be removed with a #5 Dumont forceps. Hematoxylin and Eosin-stained tissue sections showed various corneal wound healing phases after the anterior keratectomy. Wound area was shown in the box. Image time points are (A) normal cornea, (B) cornea at postoperative (PO) day 1 , (C) cornea at PO day 3, and (D) cornea at PO day 5. 10X.
Figure 2 shows Up-regulation of moesin and a-SMA in mouse cornea induced by topical application of TGF-βΙ . (A, B) images of western blots; Bar graphs showing the densitometric analysis of a-SMA (C) and moesin (D) corrected for the housekeeping gene GAPDH in the corneal stroma from the group 2-AK (anterior keratectomy, n=90 corneas) and group 3-AKT (anterior keratectomy and topical application of TGF-βΙ , n=90 corneas) at PO day 1 , 3, and 5. Bars represent mean ± S.D. Results represent three independent experiments. Figure 3. The response of cytoskeleton regulators to topical application of TGF- β1 after an anterior keratectomy. (A) Results for the response of cytoskeleton regulators to topical application of TGF-βΙ after an anterior keratectomy at PO day 1 analyzed by Cytoskeleton Regulators RT2 Profiler PCR-array. The relative expression level for each gene in the corneal stroma is seen in the scatter plot. Group -NC (no procedure, n=30 corneas) served as a control group, fold change was set as 1 ; "group 1" shown in the figure represents experimental group 3-AKT (anterior keratectomy and topical application of TGF-βΙ , n=30 corneas). Fold-change boundary is 4. Red spots represent the up-regulated cytoskeleton regulators (>4 fold, p<0.05, Group 3-AKT compared to Group 1- NC). Msn: moesin. (B,C) RT-PCR quantification of mRNA levels for cytoskeleton regulators induced by topical application of TGF-β following an anterior keratectomy. Fold mRNA expression of selected cytoskeleton regulators in cornea stroma from Group 1-NC (no procedure, n=36 corneas), Group 3-AKT (anterior keratectomy and topical application of TGF-βΙ , n=36 corneas), Group 2-AK (anterior keratectomy, n=36 corneas) at PO day 1 (B) and at PO day 5 (C). Group 1-NC (no procedure, n=36 corneas) was used as a control. The fold change of each transcript in the corneal stroma was obtained by setting the value for group 1-NC to 1. Bars represent mean ± S.D. *P<0.05, Results represent three independent experiments.
Figure 4. Dual immunofluorescence staining demonstrated that moesin co- localized with a-SMA within corneal stroma keratocytes in the corneal fibrosis. (A) normal cornea (n=3 eyes); (B) cornea at PO day 1 (n=3 eyes) ; (C) cornea at PO day 3 (n=3 eyes); (D) cornea at PO day 5 (n=3 eyes). Note the co- localization of moesin and a-SMA within the corneal stroma keratocytes (white arrow). Green: moesin; Red: a-SMA; Blue: DAPI staining of cellular nuclei. Results represent three independent experiments.
Figure 5. Quantification of moesin- and a-SMA-positive cells. The percentage of cells expressing both moesin and a-SMA versus cells expressing only moesin is 30.5% at PO day 1 , 52.4% at PO day 3, and 96.7% at PO day 5.
Figure 6. Distribution of fluorescein-labeled moesin siRNA in the group 4-AKSi (anterior keratectomy and moesin siRNA) at 24 hours after in vivo delivery of moesin siRNA by iontophoresis into the cornea. Note corneal stroma keratocytes (yellow arrow) positive for fluorescein-labeled moesin siRNA. Green: moesin siRNA; Blue: DAPI staining of cellular nuclei. Results represent three independent experiments. Figure 7. Effect of moesin siRNA on the expression of moesin and a-SMA in the corneal fibrosis. Moesin targeting siRNA or control siRNA (ctrl siRNA) was delivered into the cornea in vivo by iontophoresis. (Α,Β)· Images of western blots; the first lane in each image represents group 1-NC (no procedure, n=90 corneas); Densitometric analysis of moesin (C) and a-SMA (D) corrected for the housekeeping gene GAPDH in the corneal stroma from the group 4-AKSi MSN(anterior keratectomy and moesin siRNA, n=90 corneas) and group 4-AKSi CTRL(anterior keratectomy and control siRNA, n=90 corneas, used as a control) at PO day 1 , 3, and 5. * p<0.05 (group 4-AKSi MSN compared to group 4-AKSi CTRL); Densitometric analysis of moesin (E) and a-SMA (F) corrected for the housekeeping gene GAPDH in the corneal stroma from the group 5-AKTSi MSN(anterior keratectomy, topical application of TGF-fi>1 and moesin siRNA, n=90 corneas) and group 5-AKTSi CTRL (anterior keratectomy, topical application of TGF-βΙ and control siRNA, n=90 corneas, used as a control) at PO day 1 , 3, and 5. * p<0.05 (group 5-AKTSi MSN compared to group 5-AKTSi CTRL). At PO day 1 , "TGF-βΙ +" represents "TGF-βΙ was topically applied at the day of surgery"; At PO day 3, "TGF-βΙ +" represents "TGF-βΙ was topically applied at the day of surgery"; At PO day 5, "TGF-βΙ +" represents "TGF-β was topically applied at the day of surgery and PO day 3". Results represent three independent experiments. Bars represent mean ± S.D.
Figure 8. In vivo slit lamp macroscopic observation of the cornea in group 2-AK and group 5-AKTSi. At PO day 5, group 5-AKTSi CTRL showed more prominent opacification than group 5-AKTSi MSN.
Figure 9. Effect of moesin on Smad 2 and Smad 3 activation. (A, B) Images of western blots of group 1-NC (no procedure, n=30 eyes) and group 5-AKTSi (anterior keratectomy, topical application of TGF-βΙ and moesin siRNA or control siRNA, n=180 corneas); Densitometric analysis of phospho-Smad 2 (C) and phospho-Smad 3 (D) corrected for the housekeeping gene GAPDH in the corneal stroma from the group 5-AKTSi at PO day 1 , 3, and 5. Bars represent mean ± S.D. Group 5-AKTSi CTRL was used as a control. *p<0.05 (Group 5- AKTSi MSN compared to Group 5-AKTSi CTRL). Results represent three independent experiments. "AKTSi MSN" represents "anterior keratectomy, topical application of TGF-βΙ and moesin siRNA"; "AKTSi CTRL" represents "anterior keratectomy, topical application of TGF-βΙ and control siRNA". "normal" represents "group 1-NC".
Detailed description of the invention
According to an aspect of the invention, there is provided a method of diagnosing corneal fibrosis in a subject, the method comprising measuring the expression level of moesin in an isolated sample from the subject, and comparing the expression level of moesin with a reference value, wherein an increase in the expression level of moesin in the sample compared to the reference value indicates the presence of corneal fibrosis in the subject. The method may further comprise selecting a patient at risk of corneal fibrosis as a subject.
The expression level of moesin may be measured by any means known in the art. In particular, the expression level of moesin may be measured by western blotting. More in particular, the expression level of moesin may be measured by real-time PCR using the primer pairs represented by SEQ ID No. 1 (GTTTCCAGCCAAACTTCACC) and SEQ ID No. 2 (GTGACACGCACACTGATCG).
In particular, the reference value is determined from at least one subject not exhibiting signs or, or experiencing symptoms of corneal fibrosis. More in particular, the reference value is determined from a statistically significant number of subjects not exhibiting signs or, or experiencing symptoms of corneal fibrosis. Examples of signs or symptoms of corneal fibrosis include cloudy or opaque cornea in the absence or presence of edema. In particular, a 1.5- to 2-fold increase in the expression level of moesin compared to the reference value indicates the presence of corneal fibrosis in the subject.
In particular, the isolated sample may be a fluid sample or a tissue sample. More in particular, the isolated sample may be a cornea tissue sample. The cornea tissue sample may be obtained from biopsy. More in particular, the isolated sample may be a tear sample.
According to another aspect, there is provided a kit for diagnosing corneal fibrosis in a subject, the kit comprising a compound capable of detecting the presence of moesin. In particular, the kit may comprise a compound capable of detecting the presence of moesin. In particular, the compound may comprise a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise at least one polynucleotide sequence selected from SEQ ID NOs: 3-10 presented in Table 1 , or a complementary sequence thereof.
Table 1. Moesin siRNA sequences
Figure imgf000010_0001
In particular, the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound comprises a monoclonal or polyclonal antibody. The antibody may be produced by any means commonly known in the art. According to another aspect of the invention, there is provided a method for treating corneal fibrosis in a subject, the method comprising administering to the subject an effective amount of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin. In particular, the compound may comprise a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise a RNA interference (RNAi) molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. Even more in particular, the compound comprises a small interfering RNA (siRNA) molecule or an small hairpin RNA (shRNA) molecule. Even more in particular, the compound comprises at least one polynucleotide sequence selected from SEQ ID NOs: 3- 10 presented in Table 1 , or a complementary sequence thereof.
According to an alternative aspect, the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound may comprise a monoclonal or a polyclonal antibody.
In particular, the administering may comprise administering in vivo. Alternatively, the administering may comprise topical, oral, or intra-venous administration. More in particular, the administering is by iontophoresis. More in particular, the administrering may comprise administering a viral vector comprising a polynucleotide sequence selected from SEQ ID Nos. 3-10. Even more in particular, the administering may comprise topical administration of the viral vector. Even more in particular, the administering may comprise administering a viral vector comprising at least two polynucleotide sequences selected from SEQ ID Nos. 3 and 4 and/or SEQ ID Nos. 5 and 6, and/or SEQ ID Nos. 7 and 8. In particular, the viral vector may be an adeno-associated virus (AAV) vector. According to another aspect of the invention, there is provided a compound for use in the treatment of corneal fibrosis, wherein the compound is capable of inhibiting and/or reducing the expression and/or activity of moesin. In particular, the compound comprises a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. More in particular, the compound may comprise a RNAi molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin. Even more in particular, the compound may comprise an siRNA molecule or an shRNA molecule. Even more in particular, the compound may comprise at least one polynucleotide sequence selected from SEQ ID NOs: 3-10 presented in Table 1 , or a complementary sequence thereof.
In particular, the compound may comprise an antibody. More in particular, the compound may comprise an antibody specific for moesin. Even more in particular, the compound may comprise a monoclonal or polyclonal antibody.
According to another aspect, the present invention provides the use of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin in the preparation of a medicament for treating corneal fibrosis.
According to a further aspect, the present invention provides a pharmaceutical composition for use in the treatment of corneal fibrosis, comprising a compound capable of inhibiting and/or reducing the expression and/or activity of moesin.
Example 1
Histological evaluation of corneal wound healing after the anterior keratectomy
As shown in Figure 1 , the damaged corneal epithelium did not heal completely at PO day 3.. Although healing proceeded uniformily, it required longer times as the reconstituting the epithelium after a keratectomy wound is somewhat slower than for an abrasion which leaves the basal lamina intact. Keratocyte-to-myofibroblast transformation stimulated by TGF-B1
As previuousiy shown, application of TGF-βΙ induces the differentiation of corneal stroma keratocytes to a myofibroblastic state as typical in corneal fibrosis.27'49"51 The expression of a-SMA has been used extensively to monitor this cellular change.51, 52 Our results corroborated those findings and also noted that in the normal corneal stroma, a-SMA expression was not detectable. In group, 3-AKT (anterior keratectomy and TGF-βΙ ), topical application of TGF-βΙ induced a time-dependent increase in a-SMA expression at PO days 1 , 3 and 5 (Fig. 2A), increasing levels of a-SMA to 2.26-, 2.34-, 2.38 -fold (p<0.05) versus control, respectively (Fig. 2C). Because the presence of a-SMA is a phenotypic hallmark of myofibroblasts, these results were used to determine how the cytoskeleton regulators participated in the TGF-βΙ -induced transformation of corneal keratocyte-to-myofibroblast in the development of corneal fibrosis. Expression of cytoskeleton regulators stimulated by topical application of TGF-R1
To determine which cytoskeleton regulators were active in the development of corneal fibrosis, the RT2 Profiler PCR-array which included 84 cytoskeleton regulator genes was used for screening cytoskeleton regulators using RNA isolated from the corneal stroma in Group 1-NC (no procedure) and Group 3 (anterior keratectomy and topical application of TGF-βΙ ). Among the 86 cytoskeleton regulator genes analyzed, moesin was identified as the most highly induced gene in stroma tissue from Group 3 (20.96-fold increase compared to Group 1 at PO day 1 , Fig. 3A).
Several core cytoskeleton regulators (paxilin, vinculin, talin, FAK, cofilin, gelsolin, profilin, moesin) that had been previously suggested to be involved in fibrosis in other tissues53"57 and homologs of moesin (ezrin and radixin)47 were selected for real time PCR to validate PCR-array data. The expression of moesin increased about 7-fold in Group 2, about 55 fold in Group 3 at PO day 1 (Fig. 3B), 18 fold in Group 2 and 76 fold in Group 3 at PO day 5 (Fig. 3C). These data suggested that the enhanced expression of moesin is involved in the progression of corneal fibrosis.
As a-SMA is the phenotypic hallmark of the transition of fibroblasts-to- myofibroblasts, it was shown that moesin and a-SMA were found within the same cell. In Group 3 (anterior keratectomy and topical application of TGF-β ), dual immuofluorescence staining showed co-localization of moesin and a-SMA within corneal stroma keratocytes in the area of the injury (Fig. 4). In Fig 5, the percentage of cells expressing both moesin and a-SMA versus cells expressing only moesin is 30.5% at PO day 1 , 52.4% at PO day 3, and 96.7% at PO day 5.
Moesin expression stimulated by topical application of TGF-B1
The relationship between TGF-βΙ and moesin expression required further analysis for verification. Group 1-NC (no procedure) was used as a control. In the Group 3-AKT (anterior keratectomy and topical application of TGF-fi1 ), TGF-βΙ elevated the expression of moesin in the corneal stroma 1.64-fold increase over control at PO day 1 , 1.85-fold at PO day 3 and 2.10-fold at PO day 5 (Fig. 2D). Why so low compared to the ARRAY??These findings further suggested that TGF-β was associated with the up-regulated expression of moesin in the corneal stroma further implicating moesin as an important link in the pathway to a-SMA regulation.
In vivo delivery of moesin siRNA following an anterior keratectomy
The relationship between moesin and the development of corneal fibrosis was examined by using siRNA to selectivly suppress moesin expression. ,ln this experiment in vivo delivery of moesin siRNA was carried out by iontophoresis. Fluorescently labeled moesin siRNA was detected at 24 hours after iontophoresis, appearing as aggregates in corneal stroma keratocytes, as shown in Fig 6A verifying delivery to the appropraite cellular site.
In Group 4-AKSi MSN (anterior keratectomy and moesin siRNA), moesin siRNA reduced the synthesis of moesin in the corneal stroma by -0.69, -0.77, and - 0.80 fold when compared with Group 4-AKSi CTRL (anterior keratectomy and control siRNA, used as a control) at PO days 1 , 3 and 5 respectively (Fig. 7C).
In Group 5-AKTSi MSN (anterior keratectomy, moesin siRNA and topical application of TGF-βΙ ), TGF-βΙ -induced up-regulation of moesin in the corneal stroma was significantly decreased by moesin siRNA. Moesin siRNA diminished the up-regulation of moesin by 0.41-, 0.29-, and 0.18-fold ocompared to Group 5-AKTSi CTRL (anterior keratectomy, topical application of TGF-βΙ and control siRNA, used as a control) at PO day 1 , 3 and 5 respectively (Fig. 7E).
Keratocyte-to-myofibroblast differentiation is moesin-dependent
The action of moesin siRNA on the differentiation of the corneal stroma keratocyte-to-myofibroblast in the development of corneal fibrosis, as defined by expression of the myofibroblast marker, a-SMA, was examined.
In Group 4-AKSi MSN (anterior keratectomy and moesin siRNA), application of moesin siRNA, reduced the expression of a-SMA in the corneal stroma to 0.76-, 0.59-, and 0.89- fold of the group 4-AKSi CTRL (anterior keratectomy and control siRNA, used as a control) at PO day 1 , 3 and 5 respectively (Fig. 7D).
The effect of moesin siRNA was also tested in Group 5-AKTSi MSN (corneal stroma with anterior keratectomy, moesin siRNA and topical application of TGF-βΙ ). After stromal delivery of moesin siRNA, the expression of a-SMA in the corneal stroma was reduced to 0.22-, 0.52-, and 0.31- fold compared to Group 5-AKTSi CTRL (anterior keratectomy, topical application of TGF-βΙ and control siRNA, used as a control) at PO day 1 , 3 and 5 respectively (Fig. 7F).
Of note, these data demonstrated that moesin siRNA reduced the ability of TGF-βΙ to induce a-SMA up-regulation following an anterior keratectomy.
Corneal haze development in the injured cornea At PO day 5, Group 5-AKTSi CTRL (anterior keratectomy, TGF-βΙ and negative control siRNA) exhibited increased opacification when compared with group 5-AKTSi MSN (anterior keratectomy, TGF-βΙ and moesin siRNA) (Fig. 8). Moesin siRNA reduced TGF-β -stimulated activation of Smad 2 and Smad 3 in the development of corneal fibrosis
In Group 5-AKTSi (anterior keratectomy, TGF-βΙ and moesin siRNA or control siRNA), the corneal stroma with transfection of control siRNA was used as control. After in vivo delivery of moesin siRNA by iontophoresis, the expression of phospho-Smad 2 in the corneal stroma was reduced to 0.59-, 0.56-, and 0.31 -fold of control at PO day 1 , 3 and 5 respectively (Fig. 9C). Similarly, after the in vivo delivery of moesin siRNA by iontophoresis, the expression of phospho-Smad 3 in the corneal stroma was reduced to 0.58-, 0.53-, and 0.47- fold of control at PO day 1 , 3 and 5 respectively (Fig. 9D).
These data demonstrated that moesin siRNA reduced phosphorylation of Smad 2 and Smad 3 induced by topical application of TGF-βΙ following the anterior keratectomy, suggesting that moesin siRNA reduced expression of important pathway components activated in the development of corneal fibrosis.
Data from molecular biology studies have suggested an association of fibrosis with "cytoskeleton regulators",28"36 a class of proteins which links the intracellular cytoskeleton with the extracellular environment and regulation of smooth muscle actin; however, as this is a large group of proteins evidence for involvement of specific members of this class of proteins in the development of corneal fibrosis has not been developed.
The cytoskeleton is a dynamic cell organelle which tranduces external microenvironmental events to initiate changes in cell motility, proliferation, migration and phenotype.37"45 In response to injury, differentiation and rearrangement of the cytoskeleton architecture of the fibroblast results in increased expression of cytoskeleton regulators, changing smooth muscle actin and subsequent appearance as a myofibroblast.30'46 Recently, interest in the ERM (ezrin/radixin/moesin) family of cytoskeleton regulators has shown that these proteins can organize membrane domains and act as links to the cytoskeleton as well as signaling pathways involved in many cellular processes.47 Cytoskeleton disruption agents have been shown to prevent the formation of fibrosis further suggesting the involvement of this family of proteins.48 In an earlier study, it was found in the monkey cornea that myofibroblasts were observed beneath the treatment zone after excimer laser photorefractive keratectomy.63 Jester and colleagues16'64 also found that a-SMA-positive cells were exclusively expressed within the corneal stroma wound and not in adjacent stromal tissue. In the present study, immunofluorescence results for a- SMA localization was limited to the tissue volume within the area denoted by the keratectomy wound (Fig. 4). These data are consistent with the widely held idea that corneal myofibroblasts develop from within the stroma wound site rather than migrating into the wound from surrounding tissues.24'62,65
Exogenous TGF-&1 can induce myofibroblast formation.49'66 TGF-βΙ induced keratocytes to develop myofibroblast characteristics in cultured rabbit and human67 corneal keratocytes which then resembled human corneal fibrotic processes.27 In an organ culture study using bovine corneas with central wounds created with a circular trephine, myofibroblasts developed in the stroma after treatment with 100ng/ml of TGF-βΙ .51 In other studies, it was found that a neutralizing antibody to inactivate TGF-βΙ decreased the formation of fibrosis during corneal wound healing.16 In the rabbit eye, fibrosis developed after photorefractive keratectomy followed by topical application of TGF-βΙ (1 g/ml).68 The effects of TGF-βΙ on the transformation of keratocyte-to- myofibroblast (as revealed by the expression of the key phenotypic myofibroblast marker- a-SMA) in our study concur with the previous findings of other investigators. The expression of a-SMA was significantly up-regulated by topical application of TGF-βΙ (1 pg/ml) following an anterior keratectomy (Fig. 2C). Revealing key regulatory molecules involved in corneal fibrosis is crucial for developing novel interventions. Moesin was found to be a critical cytoskeleton regulator involved in the development of corneal fibrosis. It was the most highly up-regulated gene among 86 cytoskeleton regulator genes in the corneal stroma after an anterior keratectomy and topical application of TGF-βΙ (Fig. 3A). Up-regulation of moesin was induced by topical application of TGF-βΙ (Fig. 2D ), and in vivo transfection of moesin siRNA into the cornea reveals that moesin is capable of reducing keratocyte differentiation to a myofibroblast even in the presence of the topical application of TGF-βΙ .
The results further indicates that moesin siRNA introduced into the wounded stroma decreased ΤΰΡβΙ -induced differentiation of corneal stroma keratocytes- to-myofibroblasts, thereby averting the development of corneal fibrosis, as defined by the expression of a-SMA, through the reduction of activated forms of Smad 2 and Smad 3. a-SMA is the phenotypic marker of the myofibroblast and is not detected in normal corneal stromal keratocytes. The up-regulation of a- SMA in stromal keratocytes indicates their transformation to a myofibroblast which can occur, as in this study, as part of the response to injury.11'52,62 Consistent with previous studies, a-SMA was not detected in keratocytes in the normal stroma; however, western blot results showed up-regulation of a-SMA in response to AK wound, (Fig. 2C). Using immunofluorescence staining, the present application shows co- localization of a-SMA and moesin in corneal stroma keratocytes after an anterior keratectomy and topical application of TGF-βΙ (Fig. 4).
Since the defining criterion for myofibroblasts is the formation of SMA-stress fibers30 and moesin appears to have a role in stress fiber formation,70 it does suggest that moesin may be a required protein for the corneal stroma keratocyte-to-myofibroblast differentiation in the development of corneal fibrosis.
The conclusion that moesin is involved in the development of corneal fibrosis is supported by (1 ) RT-PCR and western blot confirmed that the topical application of TGF-βΙ led to a profound induction of moesin expression (Fig. 2D, 3A,B,C); (2) ΤΘΡβΙ -induced a-SMA expression was reduced to a much lower level by moesin siRNA (Fig. 7F); (3) immunofluorescence staining showed moesin co-localized with a-SMA in corneal stroma keratocytes after AK and topical application of TGF-βΙ (Fig. 4). TGF-βΙ stimulates transformation of fibroblasts into myofibroblasts through Smad 2 or Smad 3 signalling.58"60'61'71'72 The present application suggests that the phosphorylation of Smad 2 or Smad 3 induced by TGF^ was reduced by moesin siRNA (Fig. 9). This implies that moesin siRNA protects against corneal fibrosis through interfering with downstream Smad 2 or Smad 3 signaling from TGF-βΙ . Together, these findings indicate that moesin is a key factor in the development of corneal fibrosis. As moesin knock-out mice are viable,87 modulation of moesin expression should be considered without disrupting the cellular homeostasis.
References 1. Klyce SD, Beuerman RW: Structure and function of the cornea. In: The Cornea. 2nd edition. HE Kaufman, BA Barron, MB McDonald (eds). Butterworth-Heinemann, Boston, 1998: Chapter 1 : 3-50. 2. Beuerman RW, Pedroza L. Ultrastructure of the human cornea. Microsc Res Tech 1996:33:320-35.
3. Meek KM, Fullwood NJ. Corneal and scleral collagens-a microscopist's perspective. Micron 2001 :32:261-272.
4. Meek KM, Boote C. The organization of collagen in the corneal stroma. Exp Eye Res 2004:78:503-512.
5. Funderburgh JL. Keratan sulfate: structure, biosynthesis, and function. Glycobiology 2000: 10:951-958.
6. Chakravarti S. Functions of lumican and fibromodulin: lessons from knockout mice. Glycoconj J 2002: 19:287-293.
7. Dunlevy JR, Beales MP, Berryhill BL. Expression of the keratan sulfate proteoglycans lumican, keratocan and osteoglycin/mimecan during chick corneal development. Exp Eye Res 2000:70:349-362.
8. Kao WW, Liu CY. Roles of lumican and keratocan on corneal transparency. Glycoconj J 2002: 19:275-285.
9. Wilson SE, Mohan RR, Ambrosio R Jr, Hong J, Lee J. The corneal wound healing response: cytokine-mediated interaction of the epithelium, stroma, and inflammatory cells. Progress in Retinal and Eye Research 2001 : 20: 625-637.
10. Jester JV, Petroll WM, Cavanagh HD. Corneal stromal wound healing in refractive surgery: the role of myofibroblasts. Prog Retin Eye Res 1999:18:31 1 -56.
1 1. Mohan RR, Hutcheon AE, Choi R. Apoptosis, necrosis, proliferation, and myofibroblast generation in the stroma following LASIK and PRK. Exp Eye Res 2003: 76:71-87.
12. Foster A, Resnikoff S. The impact of Vision 2020 on global blindness. Eye (Lond) 2005:19:1 133-5. 13. Chen JJ, Tseng SC. Corneal epithelial wound healing in partial limbal deficiency. Invest Ophthalmol Vis Sci 1990: 31 :1301-14.
14. Chen JJ, Tseng SC. Abnormal corneal epithelial wound healing in partial- thickness removal of limbal epithelium. Invest Ophthalmol Vis Sci 1991 : 32:2219-33. 15. Jester JV, Petroll WM, Barry PA, Cavanagh HD. Expression of alpha-smooth muscle (alpha-SM) actin during corneal stromal wound healing. Invest Ophthalmol Vis Sci 1995: 36:809-819.
16. Jester JV, Barry-Lane PA, Petroll WM, Olsen DR, Cavanagh HD. Inhibition of corneal fibrosis by topical application of blocking antibodies to TGF beta in the rabbit. Cornea 997: 6: 77-87.
17. Chew SJ, Beuerman RW, Kaufman HE, McDonald MB. In vivo confocal microscopy of corneal wound healing after excimer laser photorefractive keratectomy. CLAO J 1995: 21 :273-80.
18. Funderburgh JL, Chandler JW. Proteoglycans of rabbit corneas with nonperforating wounds. Invest Ophthalmol Vis Sci 1989: 30:435-42.
19. Dougherty PJ, Hardten DR, Lindstrom RL. Corneoscleral melt after pterygium surgery using a single intraoperative application of mitomycin-C. Cornea 1996:15:537-540.
20. Safianik B, Ben-Zion I, Garzozi HJ. Serious corneoscleral complications after pterygium excision with mitomycin C. Br J Ophthalmol 2002:86:357-358.
21. Rubinfeld RS, Pfister RR, Stein RM. Serious complications of topical mitomycin- C after pterygium surgery. Ophthalmology 1992:99:1647-1654.
22. Wu KY, Hong SJ, Huang HT, Lin CP, Chen CW. Toxic effects of mitomycin-C on cultured corneal keratocytes and endothelial cells. J Ocul Pharmacol Ther 1999:15:401-41 1. 23. Jester JV, Barry-Lane PA, Cavanagh HD, Petroll WM. Induction of alpha-smooth muscle actin expression and myofibroblast transformation in cultured corneal keratocytes. Cornea 1996:15:505-516.
24. Imanishi J, Kamiyama K, Iguchi I, Sotozono C, Kinoshita S. Growth factors: importance in wound healing and maintenance of transparency of the cornea. Prog.
Retin. Eye Res 2000:19:1 13-129.
25. Saika S, Yamanaka O, Sumioka T, et al. Fibrotic disorders in the eye: targets of gene therapy. Prog Retin Eye Res 2008:27:177-96.
26. Massague J. TGF-beta signal transduction. Annu Rev Biochem 1998: 67: 753- 91.
27. Karamichos D, Guo XQ, Hutcheon AE, Zieske JD. Human corneal fibrosis: an in vitro model. Invest Ophthalmol Vis Sci 2010: 51 : 1382-8.
28. Blaauboer ME, Smit TH, Hanemaaijer R, Stoop R, Everts V. Cyclic mechanical stretch reduces myofibroblast differentiation of primary lung fibroblasts. Biochem Biophys Res Commun 201 1 : 404:23-7.
29. Hinz B, Gabbiani G. Mechanisms of force generation and transmission by myofibroblasts. Curr Opi Biotechnol 2003: 14:538-546.
30. Dugina V, Fontao L, Chaponnier C, Vasilliev J, Gabbiani G. Focal adhesion features during myofibroblastic differentiation are controlled by intracellular and extracellular factors. J Cell Sci 2001 :1 14:3285-3296.
31. Malmstrom J, Lindberg H, Lindberg C, et al. Transforming growth factor-beta 1 specifically induce proteins involved in the myofibroblast contractile apparatus. Mol Cell Proteomics 2004:3:466-77. 32. Geiger B, Bershadsky A, Pankov R, Yamada KM. Transmembrane crosstalk between the extracellular matrix and the cytoskeleton. Nat Rev Mol Cell Biol 2001 :2:793-805.
33. Thannickal VJ, Lee DY, White ES, et al. Myofibroblast differentiation by transforming growth factor-betal is dependent on cell adhesion and integrin signaling via focal adhesion kinase. J Biol Chem 2003:278:12384-12389.
34. Fukuda Y, Basset F, Ferrans VJ, Yamanaka N. Significance of early intra- alveolar fibrotic lesions and integrin expression in lung biopsy specimens from patients with idiopathic pulmonary fibrosis. Hum Pathol 1995:26: 53-61.
35. LeRoy EC. Increased collagen synthesis by scleroderma skin fibroblasts in vitro: a possible defect in the regulation or activation of the scleroderma fibroblast. J Clin Invest 974:54:880-9.
36. Shi-Wen X, Chen Y, Denton CP, et al. Endothelin-1 promotes myofibroblast induction through the ETA receptor via a rac/phosphoinositide 3-kinase/Akt- dependent pathway and is essential for the enhanced contractile phenotype of fibrotic fibroblasts. Mol Biol Cell 2004:15: 2707-2719.
37. Brown BK, Song W. The actin cytoskeleton is required for the trafficking of the B cell antigen receptor to the late endosomes. Traffic 2001 :2:414-27.
38. Pollard TD, Borisy GG. Cellular motility driven by assembly and disassembly of actin filaments. Cell 2003:1 2:453-65.
39. Ono S. Mechanism of depolymerization and severing of actin filaments and its significance in cytoskeletal dynamics. Int Rev Cytol 2007: 258:1-82.
40. Silacci P, Mazzolai L, Gauci C, Stergiopulos N, Yin HL, Hayoz D. Gelsolin superfamily proteins: key regulators of cellular functions. Cell Mol Life Sci 2004:61 :2614-23. 41. Dos Remedios CG, Chhabra D, Kekic , et al. Actin binding proteins: regulation of cytoskeletal microfilaments. Physiol Rev 2003:83:433-73.
42. Maciver SK, Hussey PJ. The ADF/cofilin family: actin-remodeling proteins. Genome Biol 2002:3:reviews3007.
43. Cooper JA, Schafer DA. Control of actin assembly and disassembly at filament ends. Curr Opin Cell Biol 2000:12:97-103.
44. Sun HQ, Yamamoto M, Mejillano M, Yin HL. Gelsolin, a multifunctional actin regulatory protein. J Biol Chem 1999:274:33179-33182.
45. Weeds AG, Gooch J, Hawkins , Pope B, Way M. Role of actin-binding proteins in cytoskeletal dynamics. Biochem Soc Trans 1991 :19:1016-20.
46. Chaurasia SS, Kaur H, de Medeiros FW, Smith SD, Wilson SE. Reprint of "Dynamics of the expression of intermediate filaments vimentin and desmin during myofibroblast differentiation after corneal injury". Exp Eye Res 2009:89:590-6.
47. Louver-Vallee S. ERM proteins: from cellular architecture to cell signaling. Biol Cell 2000:92:305-16.
48. Hordichok AJ, Steyger PS. Closure of supporting cell scar formations requires dynamic actin mechanisms. Hear Res 2007:232:1-19.
49. Tandon A, Tovey JC, Sharma A, Gupta R, Mohan RR. Role of transforming growth factor Beta in corneal function, biology and pathology. Curr Mol Med 2010:10:565-78.
50. Kaur H, Chaurasia SS, Agrawal V, Suto C, Wilson SE. Corneal myofibroblast viability: opposing effects of IL-1 and TGF betal . Exp Eye Res 2009:89:152-8.
51. Carrington LM, Albon J, Anderson I, Kamma C, Boulton M. Differential regulation of key stages in early corneal wound healing by TGF-beta isoforms and their inhibitors. Invest Ophthalmol Vis Sci 2006:47: 1886-94. 52. Darby I, Skalli O, Gabbiani G. Alpha-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab Invest 1990:63:21-29.
53. Tomasek JJ, Gabbiani G, Hinz B, Chaponnier C, Brown RA. Myofibroblasts and mechano-regulation of connective tissue remodelling. Nat Rev Mol Cell Biol
2002:3:349-363.
54. Cowin AJ, Hatzirodos N, Teusner JT, Belford DA. Differential effect of wounding on actin and its associated proteins, paxiilin and geisolin, in fetal skin explants. J Invest Dermatol 2003: 120: 1 1 18-29.
55. Van Beurden HE, Snoek PA, Von den Hoff JW, Torensma R, Maltha JC, Kuijpers-Jagtman AM. Dynamic protein expression patterns during intraoral wound healing in the rat. Eur J Oral Sci 2005: 1 13: 153-8.
56. Ishizaki M, Wakamatsu K, Matsunami T, et al. Dynamics of the expression of cytoskeleton components and adherens molecules by fibroblastic cells in alkali- burned and lacerated corneas. Exp Eye Res 1994:59:537-49.
57. Whyte M. Geisolin in idiopathic pulmonary fibrosis: a new target supports a central role for epithelial injury in disease pathogenesis. Thorax 2009:64:461-2.
58. Massague J. How cells read TGF-beta signals. Nat Rev Mol Cell Biol 2000:1 :169-78.
59. Evans RA, Tian YC, Steadman R. TGF- P 1 -mediated fibroblast-myofibroblast terminal differentiation— the role of Smad proteins. Exp Cell Res 2003:282:90-100. 60. Roberts AB, Russo A, Felici A. Smad3: a key player in pathogenetic mechanisms dependent on TGF-£. Ann NY Acad Sci 2003:995: 1-10. 61. Flanders KC, Major CD, Arabshahi A, et al. Interference with transforming growth factor- £/Smad3 signaling results in accelerated healing of wounds in previously irradiated skin. Am J Pathol 2003:163:2247-2257.
62. Fini ME. Keratocyte and fibroblast phenotypes in the repairing cornea. Prog Retin Eye Res 1999: 18;529-551.
63. Beuerman RW, McDonald MB, Shofner RS, et al. Quantitative histological studies of primate corneas after excimer laser photorefractive keratectomy. Arch Ophthalmol 1994: 12:1 103-10.
64. Jester JV, Rodrigues MM, Herman IM. Characterization of avascular corneal wound healing fibroblasts: new insights into the myofibroblast. Am J Pathol
1987:127:140-148.
65. Jester JV, Huang J, Petroll WM, Cavanagh HD. TGF beta induced myofibroblast differentiation of rabbit keratocytes requires synergistic TGF beta, PDGF and integrin signaling. Exp. Eye Res 2002:75:645-657.
66. Saika S, Yamanaka O, Okada Y, Tanaka S, et al. TGF beta in fibroproliferative diseases in the eye. Front Biosci (Schol Ed) 2009:1 :376-90.
67. Ohji M, Sundar Rai N, Thoft RA. Transforming growth factor-β stimulate collagen and fibronectin synthesis by human corneal stroma fibroblasts in vitro. Curr Eye Research 1993:12:703-9.
68. Myers JS, Gomes JA, Siepser SB, Rapuano CJ, Eagle RC Jr, Thorn SB. Effect of transforming growth factor beta 1 on stromal haze following excimer laser photorefractive keratectomy in rabbits. J Refract Surg 1997:13:356-61.
69. Chen YX, Li Y, Wang WM, et al. Phosphoproteomic study of human tubular epithelial cell in response to transforming growth factor-beta-1 -induced epithelial-to- mesenchymal transition. Am J Nephrol 2010:31 :24-35. 70. Mackay DJ, Esch F, Furthmayr H, Hall A. Rho- and rac-dependent assembly of focal adhesion complexes and actin filaments in permeabilized fibroblasts: an essential role for ezrin/radixin/moesin proteins. J Cell Biol 1997:138:927-38.
71. Biernacka A, Dobaczewski M, Frangogiannis NG. TGF-β signaling in fibrosis. Growth Factors 2011. [Epub ahead of print]
72. Heeg MH, Kozioiek MJ, Vasko R, et al. The antifibrotic effects of relaxin in human renal fibroblasts are mediated in part by inhibition of the Smad2 pathway. Kidney Int 2005:68:96-109.

Claims

Claims . A method of diagnosing corneal fibrosis in a subject, the method comprising: measuring the expression level of moesin in an isolated sample from the subject, and comparing the expression level of moesin with a reference value; wherein an increase in the expression level of moesin in the sample compared to the reference value indicates the presence of corneal fibrosis in the subject.
2. The method according to claim 1 , further comprising selecting a patient at risk of corneal fibrosis as the subject.
3. The method according to claim 1 , wherein the reference value is determined from at least one subject not exhibiting signs of, or experiencing symptoms of corneal fibrosis.
4. The method according to claim 1 , wherein the reference value is determined from a statistically significant number of subjects not exhibiting signs of, or experiencing symptoms of corneal fibrosis.
5. The method according to any one of the preceding claims, wherein the sample comprises a fluid sample or a tissue sample.
6. The method according to claim 5, wherein the fluid sample comprises a tear sample.
7. The method according to claim 5, wherein the tissue sample comprises a cornea tissue sample.
8. A kit for diagnosing corneal fibrosis in a subject, the kit comprising a compound capable of detecting the presence of moesin.
9. The kit according to claim 8, wherein the compound comprises a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
10. The kit according to claim 8 or 9, wherein the compound comprises a polynucleotide sequence selected from SEQ ID NOs: 3-10, or a complementary sequence thereof.
11. The kit according to claim 8, wherein the compound comprises an antibody.
12. The kit according to claim 8 or 11 , wherein the compound comprises an antibody specific for moesin.
13. The kit according to claim 8 or 11 , wherein the compound comprises a monoclonal or polyclonal antibody.
14. A method for treating corneal fibrosis in a subject, the method comprising: administering to the subject an effective amount of a compound capable of inhibiting and/or reducing the expression and/or activity of moesin.
15. The method according to claim 14, wherein the compound comprises a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
16. The method according to claim 14, wherein the compound comprises a RNA interference (RNAi) molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
17. The method according to any one of claims 14-16, wherein the compound comprises a small interfering RNA (siRNA) molecule or a small hairpin RNA (shRNA) molecule.
18. The method according to claim 14, wherein the compound comprises a polynucleotide sequence selected from SEQ ID NOs: 3-10, or a complementary sequence thereof.
19. The method according to claim 14, wherein the compound comprises an antibody.
20. The method according to claim 14 or 19, wherein the compound comprises an antibody specific for moesin.
21. The method according to any one of claims 14, 19, or 20, wherein the compound comprises a monoclonal or a polyclonal antibody.
22. The method according to any one of claims 14-21 , wherein the administering comprises administering in vivo.
23. The method according to any one of claims 14-21 , wherein the administering comprises topical, oral, and/or parenteral administration.
24. The method according to any one of claims 14-22, wherein the administering is by iontophoresis.
25. The method according to any one of claims 14-24, wherein the administration comprises administering a viral vector comprising a polynucleotide sequence selected from SEQ ID Nos. 3-10.
26. The method according to any one of claims 14-25, wherein the administering may comprise administering a viral vector comprising at least two polynucleotide sequences selected from SEQ ID Nos. 3 and 4, and/or SEQ ID Nos. 5 and 6, and/or SEQ ID Nos. 7 and 8.
27. The method according either claim 25 or 26, wherein the viral vector is an adeno-associated virus (AW) vector.
28. A compound for use in the treatment of corneal fibrosis, wherein the compound is capable of inhibiting and/or reducing the expression and/or activity of moesin.
29. The compound of claim 28 comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
30. The compound of claim 28 or 29, comprising a RNAi molecule comprising a polynucleotide sequence substantially complementary to a polynucleotide sequence encoding moesin.
31. The compound according to claim 28 or 29, comprising an siRNA molecule or an shRNA molecule.
32. The compound according to claim 28 or 29, comprising a polynucleotide sequence selected from SEQ ID NOs: 3-10, or a complementary sequence thereof.
33. The compound according to claim 28, comprising an antibody.
34. The compound according to claim 28 or claim 33, comprising an antibody specific for moesin.
35. The compound according to claim 28 or 33, comprising a monoclonal or polyclonal antibody.
36. Use of a compound according to any one of claims 28-35 in the preparation of a medicament for treating corneal fibrosis.
37. A pharmaceutical composition for use in the treatment of corneal fibrosis, comprising the compound according to claim 28.
38. A pharmaceutical composition for use in the treatment of corneal fibrosis, comprising the compound according to any one of claims 28-35.
PCT/SG2013/000113 2012-03-21 2013-03-21 A method of diagnosing and/or treating corneal fibrosis WO2013141816A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201261613633P 2012-03-21 2012-03-21
US61/613,633 2012-03-21

Publications (1)

Publication Number Publication Date
WO2013141816A1 true WO2013141816A1 (en) 2013-09-26

Family

ID=49223101

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2013/000113 WO2013141816A1 (en) 2012-03-21 2013-03-21 A method of diagnosing and/or treating corneal fibrosis

Country Status (1)

Country Link
WO (1) WO2013141816A1 (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000073450A2 (en) * 1999-05-27 2000-12-07 Incyte Genomics, Inc. Cytoskeleton-associated proteins
US20090170866A1 (en) * 2005-11-10 2009-07-02 Bristol-Myers Squibb Pharma Company Moesin, caveolin 1 and yes associated protein 1 as predictive markers of response to dasatinib in breast cancers
US20090202520A1 (en) * 2007-07-06 2009-08-13 Promedior, Inc. Treatment and diagnostic methods for fibrosis related disorders
US20090297523A1 (en) * 2004-07-27 2009-12-03 Yale University Erm family binding agents and their use in diagnosis and treatment of proliferative conditions

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000073450A2 (en) * 1999-05-27 2000-12-07 Incyte Genomics, Inc. Cytoskeleton-associated proteins
US20090297523A1 (en) * 2004-07-27 2009-12-03 Yale University Erm family binding agents and their use in diagnosis and treatment of proliferative conditions
US20090170866A1 (en) * 2005-11-10 2009-07-02 Bristol-Myers Squibb Pharma Company Moesin, caveolin 1 and yes associated protein 1 as predictive markers of response to dasatinib in breast cancers
US20090202520A1 (en) * 2007-07-06 2009-08-13 Promedior, Inc. Treatment and diagnostic methods for fibrosis related disorders

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ZHU ET AL.: "Cytoskeleton regulators in the control of corneal fibrosis", PROCEEDINGS OF SINGAPORE HEALTHCARE, vol. 20, no. 1, 2011, pages 33 *
ZHU ET AL.: "Moesin as a key cytoskeleton regulator in corneal fibrosis", THE OCULAR SURFACE, V, vol. 11, no. 2, 24 January 2013 (2013-01-24), pages 119 - 132 *

Similar Documents

Publication Publication Date Title
Torricelli et al. The corneal fibrosis response to epithelial–stromal injury
Mohan et al. Decorin transfection suppresses profibrogenic genes and myofibroblast formation in human corneal fibroblasts
Hung et al. Role of IGF-1 pathway in lung fibroblast activation
Jester et al. TGFβ induced myofibroblast differentiation of rabbit keratocytes requires synergistic TGFβ, PDGF and integrin signaling
El-Asrar et al. Myofibroblasts in proliferative diabetic retinopathy can originate from infiltrating fibrocytes and through endothelial-to-mesenchymal transition (EndoMT)
ES2657696T3 (en) Method to reduce healing during wound healing using antisense compounds targeting CTGF
Burt et al. The monocyte chemoattractant protein-1/cognate CC chemokine receptor 2 system affects cell motility in cultured human podocytes
Díaz-Moreno et al. Aβ increases neural stem cell activity in senescence-accelerated SAMP8 mice
CN115192719A (en) Use of GLS1 inhibiting compositions for the treatment of pulmonary vascular disease
Zgheib et al. Mechanisms of mesenchymal stem cell correction of the impaired biomechanical properties of diabetic skin: The role of miR‐29a
Ma et al. Microphthalmia-associated transcription factor acts through PEDF to regulate RPE cell migration
Spurlin et al. Wounded embryonic corneas exhibit nonfibrotic regeneration and complete innervation
Wu et al. Recombinant adiponectin peptide promotes neuronal survival after intracerebral haemorrhage by suppressing mitochondrial and ATF4‐CHOP apoptosis pathways in diabetic mice via Smad3 signalling inhibition
Zhang et al. Sema3A inhibits axonal regeneration of retinal ganglion cells via ROCK2
Zhou et al. KGF-2 regulates stap-2–mediated signal transducer and activator of transcription 3 signaling and reduces skin scar formation
WO2013141816A1 (en) A method of diagnosing and/or treating corneal fibrosis
Zhu et al. Moesin as a key cytoskeleton regulator in corneal fibrosis
Yang et al. YAP is critical to inflammation, endothelial-mesenchymal transition and subretinal fibrosis in experimental choroidal neovascularization
KR20150108351A (en) Protein slurp-1 for use in the treatment of ocular diseases
WO2017218284A1 (en) Local orbital therapy for thyroid eye disease
US9050301B2 (en) Pharmaceutical composition for treatment of corneal endothelial wounds containing angiogenin
Androschuk et al. Methacrylic acid-based biomaterials promote peripheral innervation in the subcutaneous space of mice
Alenchery et al. PAI‐1 mediates TGF‐β1‐induced myofibroblast activation in tenocytes via mTOR signaling
US8999928B2 (en) Methods for treating diseases using a bone morphogenetic protein
Pietraszkiewicz et al. Desmin deficiency is not sufficient to prevent corneal fibrosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 13764552

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 13764552

Country of ref document: EP

Kind code of ref document: A1