WO2013122453A1

WO2013122453A1 - Device and method for detection of nucleic acid(s)

Info

Publication number: WO2013122453A1
Application number: PCT/MY2013/000029
Authority: WO
Inventors: Yean Yean Chan; Geik Yong ANG; Choo Yee YU
Original assignee: Universiti Sains Malaysia
Priority date: 2012-02-15
Filing date: 2013-02-15
Publication date: 2013-08-22

Abstract

There is provided a test strip and methods for detecting nucleic acids that have been molecularly amplified. The test strip may comprise: at least one sample application zone for applying the sample to the test strip; at least one detection zone comprising at least one immobilised probe complementary to the target nucleic acid; and at least one label zone comprising at least one releasably immobilised labelled conjugate for visual detection of the target nucleic acid.

Description

DEVICE AND METHOD FOR DETECTION OF NUCLEIC ACID(S)

FIELD OF THE INVENTION The present invention relates to a device and method for detecting nucleic acid(s). In particular, the invention relates to a test strip for detecting target nucleic acids and a method of using the same.

BACKGROUND TO THE INVENTION

Detection of specific nucleic acid sequence(s) is a widely used technique in various fields from medical and microbiology assays to food and water safety assessment as well as in environmental monitoring and surveillance. For accurate detection of the target nucleic acid, the target is usually first amplified and then detected to confirm that the target nucleic acid is present in the sample.

Conventional methods for the detection of an amplified product for example by PCR, involves agarose gel casting and electrophoresis separation both of which are tedious and equipment dependent. Subsequent visualization of the agarose gel after electrophoretic separation is also hazardous as carcinogenic ethidium bromide (EtBr) and UV light are usually involved. Inappropriate disposal of EtBr contaminated gel, buffers and apparatus will also pose a health risk to human and other living organisms in the environment. Although non-carcinogenic dyes such as SYBR Green, RedSafe and GelRed are available commercially, the cost of these dyes are significantly higher than EtBr and thus, increasing the cost per assay. Rapid and automated DNA analysis can be achieved with capillary electrophoresis which does not involve gel preparation and staining but both the techniques are unable to distinguish between specific and non-specific amplification products of similar/ equal sizes. Accordingly, there is a need in the art for an alternative safer method of detecting amplified target nucleic acid where the method is just as or even more efficient and precise as the conventional methods. Several lateral flow devices available in the art may be used for detection of target double-stranded DNA where the target double-stranded PCR product comprises unique hapten labels at both termini. However, these lateral flow devices are vulnerable to false positive results due to non-specific amplification and detection. Further, multianalyte analysis of double stranded nucleic acid is limited by the number of antibody/hapten pairs which can be incorporated in both PCR and dipstick assays.

Sequence-specific detection of nucleic acid sequence generally involves laborious techniques including restriction enzyme analysis, DNA sequencing and/or detection by DNA probes on southern blot after electrophoretic separation followed by visualization using colorimetric, electrochemiluminescence or radioisotope labelling method. Whilst realtime PCR involving DNA or RNA probes for sequence-specific detection is less tedious and time-consuming, the assay requires expensive equipment, dyes and a skilled personnel to carry it out. Various PCR-amplified nucleic acid detection methods employing a lateral flow or dipstick format in which a hybridisation step is incorporated for sequence-specific detection have been disclosed in the last decade. One such method involves primer extension (PEXT) reaction to generate labelled product following a PCR assay (Vlachou et al., 2010). An oligonucleotide probe is also included in the PEXT reaction mixture which will hybridize to the extended segment of the labelled PEXT primer in the presence of target sequence. The PEXT reaction product is subsequently detected on a dipstick format. However, the method involves addition of various reagents and extra thermal cycling steps after completion of a standard PCR assay for the PEXT reaction to take place.

Accordingly, there is a need in the art for a method of detecting nucleic acid that is fast, accurate and simple to use.

SUMMARY OF THE INVENTION

The present invention is defined in the appended independent claims. Some optional features of the present invention are defined in the appended dependent claims. The present invention is directed towards a device to carry out a simple-to-perform ambient temperature detection of molecularly amplified target nucleic acid. The device may be a dry reagent lateral flow device.

According to a first aspect, the present invention relates to a test strip for detecting at least one molecularly amplified target nucleic acid in a sample at ambient temperature, comprising: at least one sample application zone for applying the sample to the test strip;

at least one detection zone comprising at least one immobilised probe comprising a sequence complementary to the target nucleic acid or a fragment thereof; and at least one label zone comprising at least one releasably immobilised labelled conjugate for visual detection of the target nucleic acid.

According to a further aspect, the present invention provides a method of detecting at least one molecularly amplified target nucleic acid in a sample at ambient temperature using the test strip according to any aspect of the present invention, the method comprising the steps of:

a) exposing the sample to at least one immobilised probe comprising a sequence complementary to the target nucleic acid or a fragment thereof; and

b) exposing the sample bound to the probe from step a) to at least one releasably immobilised labelled conjugate for visual detection of the target nucleic acid.

As will be apparent from the following description, specific embodiments of the present invention allow an optimal use of these test strips in a method of amplifying nucleic acids to take advantage of the specificity, sensitivity and simplicity of the method. This and other related advantages will be apparent to skilled persons from the description below.

BRIEF DESCRIPTION OF THE FIGURES

Specific embodiments of a test strip of the present invention will now be described by way of examples with reference to the accompanying figures in which:

Figure 1 is a schematic top view of a test strip for a lateral flow binding assay in an embodiment of the present invention.

Figure 2 is a schematic top view of a test strip for a lateral flow binding assay in an embodiment of the present invention when in use with a sample applied to the sample application zone.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS Bibliographic references mentioned in the present specification are for convenience listed in the form of a list of references and added at the end of the examples. The whole content of such bibliographic references is herein incorporated by reference. Various embodiments of support members and methods of their use are disclosed herein. The following description is exemplary in nature and is not intended to limit the scope, applicability, or configuration of the invention in any way. Various changes to the described embodiment may be made in the function and arrangement of the elements described herein without departing from the scope of the invention.

According to a first aspect, the present invention provides a test strip 1 for detecting at least one molecularly amplified target nucleic acid 16 in a sample at ambient temperature, comprising at least one sample application zone 4 for applying the sample to the test strip 1 , at least one detection zone 5 comprising at least one immobilised probe 20 comprising a sequence complementary to the target nucleic acid 16 or fragment thereof; and at least one label zone 3 comprising at least one releaseably immobilised labelled conjugate 13 for visual detection of the target nucleic acid 16.

Figures 1 and 2 illustrate a test strip 1 comprising a running buffer zone 2, a label zone 3, at least one sample application zone 4, a detection zone 5 and a reservoir zone 6.

The test strip 1 may be used for screening and identification of unique genes and/or pathogens which have undergone molecular amplification. This method of detection at ambient temperature may be considered to be simple to use and specific to a target nucleic acid 16 because of the presence of an immobilised probe 20 complementary to the target nucleic acid 16 sequence or fragment thereof. This test strip 1 may allow the amplification product to be directly applied to the strip 1 for detection without additional multiple incubation and washing steps. The test strip 1 may also not require additional equipments for assay performance and result interpretation. This test strip 1 may be capable of generating less waste in comparison to other conventional methods of detection. Therefore, this test strip 1 may be considered to be a useful means for detecting nucleic acids and may be a forefront candidate and a promising diagnostic tool which is both user-friendly and cost effective for nucleic acid analysis. The running buffer zone 2 provides for a zone for the application of a running buffer. The running buffer zone 2 may be provided at the proximal end of the test strip 1. The label zone 3 may be placed between the running buffer zone 2 and the detection zone 5. The labelled conjugate 13 may be a mouse anti-FITC conjugated gold nanoparticle. The label zone 3 may comprise at least one releasably immobilised labelled conjugate 13. The labelled conjugate 13 may be a polyclonal, monoclonal antibody or hapten binding pair, conjugated with a signaling label selected from the group comprising, consisting of or consisting substantially of coloured latex microparticles, colloidal carbon particles and metallic colloidal particles.

Examples of suitable capture or detection ligands that may be found on the immobilised probe 20, amplified target nucleic acid 16 and/or labelled conjugate 13 used in the test strip 1 may include but are not limited to biotin (captured or detected for example by an anti- biotin antibody, avidin, streptavidin or a derivative thereof), fluorescein (captured or detected for example by an anti-fluorescein antibody) and 2,4-dinitrophenol (DNP) (captured or detected for example by an anti-DNP antibody).

As used herein, the term "antibody" refers to any immunoglobulin or intact molecule as well as to fragments thereof that bind to a specific epitope. Such antibodies include, but are not limited to polyclonal, monoclonal, chimeric, humanised, single chain, Fab, Fab', F(ab)' fragments and/or F(v) portions of the whole antibody. For example, in the method of detection according to any aspect of the present invention, an antibody on the label conjugate 3 may be capable of binding to the epitope on the nucleic acid probe.

The term "antibody fragment" as used herein refers to an incomplete or isolated portion of the full sequence of the antibody which retains the antigen binding function of the parent antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. Fragments of the antibodies according to any aspect of the present invention are encompassed by the invention so long as they retain the desired affinity of the full-length antibody. In particular, it may be shorter by at least one amino acid. The application zone 4 provides for a zone for the application of the sample.

The sample application zone 4 may be positioned such that the sample does not pass through the label zone 3 prior to contact with the detection zone 5 when the test strip 1 is in use. In particular, the application zone 4 may be placed between the detection zone 5 and the label zone 3. The detection zone 5 may comprise at least one test region 7, an amplification control region 8 and a chromatography control region 9. In particular, the detection zone 5 may comprise a porous material laminated on a rigid or semi-rigid polymer backing. This advantageously allows the flow of buffered sample, labelled conjugates 13 and running buffer towards the reservoir zone 6 by capillary migration.

The test region 7 may comprise at least one probe 20 complementary to the target nucleic acid 16. The probe 20 complementary to the target nucleic acid 16 may be immobilised to the detection zone 5 by coupling the probe 20 complementary to the target nucleic acid 16 to a high molecular weight molecule 11 , such as but not limited to antibodies and hapten binding pair.

The probe 20 may be immobilised to the detection zone 5. In particular, the probe 20 may partially or completely be immobilised to the test strip 1 at the detection zone 5. The probe 20 may comprise a sequence or fragment of a sequence that may be complementary to the sequence of the target nucleic acid 16 or fragment of the sequence of the target nucleic acid 16. In one embodiment, the target nucleic acid 16 comprises a sequence that may be complementary to the full sequence or fragment thereof of the sequence of the probe 20. Manual application of the probe 20 may not be necessary as the probe may be conveniently immobilised to the test strip 1.

The term "fragment' as used herein, refers to an incomplete or isolated portion of the full sequence of a target nucleic acid. For example, a fragment of a target nucleic acid may not comprise the full sequence but comprises a short enough sequence that is sufficient to recognise the target nucleic acid. In particular, it may be shorter by at least one nucleotide or amino acid and may be an immunogenic fragment. The fragment may at least be 10, 15, 20, 21 , 22, 23, 24, 25 or the like nucleic acids in length.

There may be a plurality of detection probes 20 immobilised at the detection zone 5 of the strip 1. The number of probes 20 immobilised may be a reasonable number such that the accuracy of detection of each target nucleic acid 16 may not be affected by the increase in number of probes 20. The test strips 1 with more than one immobilised probe 20 may be used to detect more than one target nucleic acid 16 that may be found in the sample. For example, there may be 2, 3, 5, 10 or 15 probes 20 immobilised on the strip. Each detection probe 20 may be capable of hybridising to different target nucleic acid 16 and/or a different region of the target nucleic acid 16 thereby allowing detection of the target nucleic acid 16 utilising the detection probes 20.

The amplification control region 8 provides a validation to the amplification scheme. The amplification control region 8 may be located between the test region 7 and chromatography control region 9. The amplification control region 8 may comprise a DNA capture probe 15 that hybridizes to a part of the complementary amplification control nucleic acid 17 which may be included in the amplification scheme to rule out false negative results in the amplification process. The DNA capture probe 15 may be immobilised on the amplification control region 8 by coupling the DNA capture probe 15 to a high molecular weight molecule 11 , such as but not limited to antibodies and hapten binding pair.

The DNA capture probe 15 and/or probe 20 complementary to the target nucleic acid 16 may be a short oligonucleotide in the length of 5-50 nucleotides, 10-45 nucleotides or 15-30 nucleotides. In particular, the probe 20 may be 16, 20, 22, 25, 28 or 30 nucleotides in length.

The chromatography control region 9 provides a validation to the test strip 1. The chromatography control region 9 may be located at the distal end of detection zone 5, in particular after the test region 7 and amplification control region 8. The chromatography control region 9 may comprise means for capturing 10 the label on the labelled conjugate 13. The chromatography control region 9 may appear in every test result. A negative test result for the chromatography control region 9 indicates the test result is invalid.

In particular, the chromatography control region 9 may comprise a goat anti-mouse antibody 10 that binds to the mouse anti-FITC on gold nanoparticles. The chromatography control region 9 may comprise any species-specific antibody as the means for capturing that binds to the label on the labelled conjugate 13.

The reservoir zone 6 may provide a collection zone for any excess liquid, unwanted product, excess labelled conjugates, sample, hybridisation buffer and/or running buffer.

The test strip 1 may be substantially made from nitrocellulose. In particular, the detection zone 5, and/or sample application zone 4 may be made from nitrocellulose membrane. The nitrocellulose may be treated with a mild surfactant during the blocking step prior to its use in the strip 1 to improve the rewettability of the nitrocellulose when the assay is performed as nitrocellulose is hydrophobic in nature and therefore usually resists rewetting and uptake of the sample. The reservoir zone 6 may be made of cellulose fiber.

Figure 2 illustrates the test strip 1 when in use. In particular, as illustrated, the sample is taken from a molecularly amplified reaction mixture to amplify the target nucleic acid 16.

The target nucleic acid 16 may be amplified by Linear-After-The-Exponential PCR (LATE- PCR).

LATE-PCR assay is an advanced form of asymmetric PCR where one of the PCR primer pairs may be present in excess (i.e. excess primer) while the other primer of the pair (i.e. limiting primer) may be present in lower concentration than the excess primer. After the limiting primer has been exhausted, labelled single stranded DNA may be generated from the excess primer. The LATE-PCR mix comprising primers, dNTPs, PCR buffer salts, Taq polymerase enzyme and the like may be prepared by adding each individual components into a single reaction tube and/or prepared in a ready-to-use dry-reagent format by adding additional stabilizers followed by lyophilisation. After amplification, the result may thus be a sample comprising amplified target nucleic acid, excess labelled primers (for example fluorescein label), unlabelled primers, dNTPs, PCR buffer salts, Taq polymerase enzyme and the like. This sample may directly be applied to the test strip 1 after adding the hybridization buffer without any further steps, unlike other conventional detection steps which require incubation at elevated temperature-and/or the sample to be purified and/or hybridised with a probe before it can be used for detection.

The target nucleic acid 16 may be any nucleic acid including, but not limited to, DNA, an oligonucleotide, messenger RNA, or any other type of RNA. The target nucleic acid 16 may be a single stranded nucleic acid. The target nucleic acid 16 may be molecularly amplified by any other method known in the art. In particular, molecular amplification methods include but are not limited to polymerase chain reaction (PCR), ligase chain reaction and the like. More in particular, the target nucleic acid may be amplified by standard PCR, asymmetric PCR or isothermal amplification method using a labelled primer and an unlabelled primer. The sample may be taken from an amplification reaction mixture after carrying out the PCR to amplify the target nucleic acid. In particular, the sample may be taken from a PCR amplification reaction mixture after carrying out the PCR to amplify the target nucleic acid.

The amplification process may use a labelled primer and/or unlabelled primer including but not limited to a hapten such as FITC, digoxigenin (DIG) and biotin. The labelled primer may be designed in such a way that part of the target nucleic acid to be amplified is complement to the capture probe. In particular, the amplification of the target nucleic acid may result in the generation of single-stranded nucleic acid that may be labelled at one end. The target nucleic acid may be labelled at the 5' termini with a reporter moiety capable of binding the labelled conjugate or fragment thereof. The reporter moiety may be at least one antibody or hapten binding pair. In another embodiment, the probe may comprise a sequence that may be complementary to the target nucleic acid or fragment thereof.

An amplification control nucleic acid may then be added to the amplification mixture. The labelled primers for amplification control nucleic acid and target nucleic acid amplification may comprise the same label 18 and 19 which enables both amplification products to be recognised by the same labelled conjugate 13.

Upon molecular amplification by PCR, the sample is mixed with hybridisation buffer followed by application of the buffered product to sample application zone 4 of the test strip 1 which allows the labelled single strand of target nucleic acid 16 and labelled amplification control nucleic acid 17 to hybridize with their immobilised complementary capture probes 14, 15 respectively at ambient temperature. There may be no incubation time necessary for hybridisation before sample application on the test strip 1. In particular, the hybridisation buffer may be gently mixed to the amplification product followed by immediate loading on the sample application zone 4 for detection of target nucleic acid 16. This allows the labelled single strand of target nucleic acid 16 and labelled amplification control nucleic acid 17 to hybridize with their complement capture probe DNA 14, 15 immobilised on the test strip 1 at ambient temperature. The probe may be immobilised to the detection zone by at least one antibody or hapten binding pair.

The test strip 1 has been optimised such that the non-specific amplification product, various PCR primers and/or other constituents of the PCR mixture do not inhibit or contribute to false positive results especially since the reaction is to take place at ambient temperatures. In particular, the sample may comprise fluorescein-labelled single-stranded target nucleic acid 16. Although competitive binding of the fluorescein label on both target nucleic acid 16 and the excess primer may occur, this problem may be overcome by the specific design of the test strip 1 for detection thus only resulting in true positive results.

Running buffer may then be applied to the running buffer zone 2 of the test strip. The application of the running buffer rehydrates the dried labelled conjugate 13 on the label zone 3 causing the labelled conjugate 13 to move 22 towards the distal end of the lateral flow device and bind with the labels 19, 18 on target nucleic acid 16, 17 during the migration.

A positive test result may be indicated by the formation of a colored line at the test region 7 by labelled conjugate 13 (released from the label zone 3) which binds to the label 18 on target nucleic acid 16.

A positive amplification control result is indicated by the formation of a colored line at the amplification control region 8 by labelled conjugate 13 (released from the label zone 3), which binds to the label 19 on amplification control nucleic acid 17. A negative result on test region 7 may be validated by a positive test result on the amplification control region 8. However, a positive result on test region 7 may not be accompanied by the appearance of a positive result on the amplification control region 8 as the presence of very high amount of target nucleic acid 16 from the sample may hinder the amplification of amplification control nucleic acid 17.

According to another aspect of the invention, there is provided a method of detecting at least one molecularly amplified target nucleic acid in a sample at ambient temperature using the test strip according to any aspect of the present invention, the method comprising the steps of:

b) exposing the sample bound to the probe from step a) to at least one reieasabiy immobilised labelled conjugate for visual detection of the target nucleic acid. The sample on which the method is used may be amplified by PCR, asymmetric PCR or isothermal amplification. The sample may be amplified by linear-after-the exponential PCR. The sample may be amplified by dry-reagent linear-after-the exponential PCR. The sample may be taken from an amplification reaction mixture after carrying out amplification on the target nucleic acid. The sample may be taken from a PCR reaction mixture after carrying out the PCR to amplify the target nucleic acid. The sample may be contacted with at least one hybridisation buffer before applying the sample to the test strip. After the sample is applied to the test strip, a running buffer may be applied to the test strip to rehydrate the immobilised labelled conjugate.

Having now generally described the invention, the same will be more readily understood through reference to the following examples which are provided by way of illustration, and are not intended to be limiting of the present invention.

A person skilled in the art will appreciate that the present invention may be practised without undue experimentation according to the method given herein. The methods, techniques and chemicals are as described in the references given or from protocols in standard biotechnology and molecular biology text books.

EXAMPLES

Standard molecular biology techniques known in the art and not specifically described were generally followed as described in Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (2001).

The example disclosed below uses the test strip 1 as disclosed above and illustrated in Figures 1 and 2.

EXAMPLE 1 Detection of Linear-After-The-Exponential (LATE)-PCR amplified cholera toxin (cfxA) gene using labelled primer sequences

Sample

Genomic DNA was isolated from bacteria Vibrio cholerae 569B using NucleoSpin Tissue Kit (Macherey-Nagel) according to the manufacturer's instructions. The cfxA gene was selected as a target for amplification as it is the key virulent factor responsible for the manifestation of profuse secretory diarrhea disease which is also known as cholera. A specific segment of the ctxA gene target DNA sequence [SEQ ID NO.:1] (shown below) was amplified according to the LATE-PCR protocol described below using primers 1 [SEQ ID NO.:2] and 2 [SEQ ID NO.:3] shown below V. cholerae ctxA target sequence :

5'-

GGGAATGCTCCAAGATCATCGATGAGTAATACTTGCGATGAAAAAACCCAAAGTCTAG GTGTAAAATTCCTTGACGAATACCAATCTAAAG-3' [SEQ ID NO:1]

Primer 1 : 5'-GGG AAT GCT CCA AGA TCA TCG A -3' [SEQ ID NO:2]

Primer 2 : 5'-fluorescein-CTT TAG ATT GGT ATT CGT CAA GGA-3' [SEQ ID NO:3]

A specific segment of the thrombospondin-related adhesive protein (TRAP) gene from Plasmodium falciparum [SEQ ID NO:4] inserted in a pCR 2.1-TOPO vector was included to serve as an internal amplification control and was amplified according to the LATE-PCR protocol described below using primers 3 [SEQ ID NO:5] and 4 [SEQ ID NO:6] shown below:

TRAP gene sequence:

5'-

TGTAGGTTGTCATCCATCAGATGGTAAATGTAACTTGTATGCTGATTCTGCATGGGAAA ATGTAAAAAATGTTATCGGACCCTTTATGAAGGCTGTTTGTGTTGAAGTAGAA-3' [SEQ ID N0..4]

Primer 3 : 5'-fluorescein-TGT AGG TTG TCA TCC ATC AG-3' [SEQ ID NO:5]

Primer 4 : 5'-TTC TAC TTC AAC ACA AAC AGC CTT C-3' [SEQ ID NO:6]

Primers 1 , 2, 3 and 4 consists of 22 bases, 24 bases, 20 bases and 25 bases respectively. PCR amplification with primers 1 and 2 produce an amplicon of 91 nucleotides whilst primers 3 and 4 generated an amplicon of 1 12 nucleotides. All primers were synthesized by Integrated DNA Technologies.

LATE-PCR Reaction Mixture

1 μΙ of sample was added into 20 μΙ of PCR mix (comprising a final concentration of 1X PCR buffer with KCI, 2.5 mM gCI₂, 160 μΜ of dNTP mix, 0.5 μΜ of primer 1 , 0.1 μΜ of primer 2, 0.5 μΜ of primer 3 and 0.1 μΜ of primer 4, 0.75 U of recombinant Taq polymerase and 10 pg of amplification control template.

All PCR reagents were purchased from Fermentas.

LATE-PCR Amplification Amplification of ctxA and internal amplification control was performed using a standard thermal cycler PCR machine with heated lid.

The PCR reactions parameters are outlined below:

Initial denaturation step, 95°C for 5 minutes

35 cycles of:- i. denaturation step, 95°C for 30 seconds

ii. annealing step, 61 °C for 30 seconds

iii. extension step, 72°C for 30 seconds

Final extension at 72°C for 5 minutes

An optional thermocycling step of denaturation at 95°C for 5 minutes was added to increase yield of single-stranded target analyte. The denatured PCR product was then snap coolled on ice for 30 seconds.

A negative control sample in which genomic DNA template was substituted with water was processed identically in parallel.

Preparation of Capture Probes

Capture probe 1 was a biotinylated oligonucleotide [SEQ ID NO:7] which was complementary to a specific segment of the target ctxA amplicon and was used to hybridize and capture the target analyte at the test region.

Capture probe 2 was a biotinylated oligonucleotide [SEQ ID NO:8] which was complementary to a specific segment of the internal amplification control amplicon and was used to hybridize and capture the internal control amplicon at the amplification control region.

Capture probe 1 : S'-biotin- AAAAAACCCAAAGTCTAGGTGTAAA -3' [SEQ ID NO:7] Capture probe 2 : S'-biotin- GGTCCGATAACATTTTTTACATTTT -3' [SEQ ID NO:8]

Capture probes 1 and 2 consists of 25 bases, respectively. Both capture probes were synthesized by First Base, Malaysia.

In order to maintain entrapment of the capture probe within the detection region, 1530 pmole of each capture probe was allowed to react with 2040 pg of Neutravidin (Pierce) for 1 hour at room temperature. The reaction mixture was transferred to centrifugal device (Amicon 30K, Milipore) and centrifuged at 14 OOOxg for 15 minutes. The retentate was washed twice with 10 mM phosphate buffer, pH 7.4 with the same centrifugation force and duration. The centrifugal column was reverse spun to collect the retentate and after centrifugation for 2 minutes at 10OOxg, the filtrate was topped up with 10 mM phosphate buffer supplemented with 1 % bovine serum albumin (BSA) to 500 μΙ. Colloidal Gold Conjugate Preparation

The pH of 10 ml colloidal gold nanoparticles (OD=1) was adjusted to pH 8 with 0.2 M K₂C0₃ before adding 22 pg of mouse anti-FITC followed by gentle shaking at room temperature for 1 hour. The colloidal gold nanoparticles were supplemented with 1% BSA in 10mM phosphate buffer, pH 8 followed by gentle shaking at room temperature for another 1 hour. The colloidal gold was collected by centrifugation at 10 OOOxg for 30 minutes at 4°C. The pellet was resuspended with 10 mM phosphate suspension buffer (comprising 1 % BSA and 0.05% sodium azide). The prepared colloidal gold was used at OD=4 and supplemented with 0.01 % Tween-20, 0.01 % polyvinyl alcohol, 20% sucrose in a 15 μΙ volume per test strip.

Test Strip

The test strip was prepared using Hi-Flow Plus 135 nitrocellulose membrane on an adhesive back card of 60 mm x 301 mm dimensions. A running buffer application zone was applied to the strip to allow uptake of running buffer. At the distal end of the device, a reservoir zone comprising cellulose fibre was adhered to draw the flow of the buffered assay sample across the membrane. A test region, an amplification control region and a chromatography control region were made on the membrane.

Lining of the capture probes on test region, amplification control region and goat anti- mouse antibody on chromatographic control region was performed using the XYZ dispensing platform from BioDot. The test line was prepared by lining 1 μΙ/cm of capture probe 1 bound to Neutravidin, the amplification control region was prepared by lining 1 μΙ/cm of capture probe 2 bound to Neutravidin and the chromatographic control region was prepared by lining 1 μΙ/cm of 0.25 mg/ml goat anti-mouse antibody across the width of the membrane. The chromatographic control line was placed at the distal end of the device after the amplification control region and the test region. The membrane card was allowed to dry in a dessicator for overnight before blocking with 1% western blocking reagent (Roche) and 0.1% Triton X-100 in 2 mM phosphate buffer, pH 7.4. The membrane card was allowed to dry overnight in a dessicator before the entire lateral flow device was constructed by applying running buffer application zone, labelled conjugate zone and reservoir zone onto the membrane card with 2 mm overlapping between each membrane component. After the membrane card has been assembled, an automatic cutter (Kinematic Automation) was used to generate 4 mm width lateral flow device. Test Strip Assay

Following PCR, the sample was mixed with equal volume of hybridisation buffer (10% w/v polyethylene glycol MW 3350 in 1.5 M MgCI₂) just prior to application to the lateral flow device. The lateral flow device is allowed to contact with 200 μΙ of running buffer (0.01 % v/v Triton X-100 in 2 mM phosphate buffer, pH 7.4).

Results

For the sample V. cholerae 569B, red lines appeared at the test region, amplification control region and chromatography control region indicating the presence of ctxA gene. For the negative control sample, red lines only appeared at the amplification control region and chromatography control region indicating the absence of ctxA gene. The assay time starting from PCR reaction to the appearance of red lines on the test strip took about 120 to 150 minutes (depending on the maximum ramping time of the PCR thermocycler used). The foregoing describes preferred embodiments, which, as will be understood by those skilled in the art, may be subject to variations or modifications in design, construction or operation without departing from the scope of the claims. These variations, for instance, are intended to be covered by the scope of the claims. EXAMPLE 2

Detection of dry-reagent based Linear-After-The-Exponential (LATE)-PCR amplified cholera toxin (c/xA) gene using labelled primer sequences

The procedure of Example 1 was generally followed, but in this case, a dry-reagent PCR mix was prepared and detected using the lateral flow device

Preparation of dry-reagent LATE-PCR Reaction Mixture

The PCR mixture containing a final concentration of 1X PCR buffer with KCI, 2.5 mM MgCI₂, 160 μΜ of dNTP mix, 0.5 μΜ of primer 1 , 0.1 μΜ of primer 2, 0.5 μΜ of primer 3 and 0.1 μΜ of primer 4, 1.5 U of deglycerised recombinant Taq polymerase, 6.25% ficoll 400, 5% raffinose, 0.25 mg/ml bovine serum albumin and 10 pg of amplification control template in a 20 μΙ reaction volume was converted into dry-reagent format via lyophilisation. Prior to amplification, the dry-reagent PCR mix was reconstituted with 18 μΙ deionized water followed by 2 μΙ of DNA template.

Test Strip Assay Following PCR, the sample was mixed with equal volume of hybridisation buffer (1.5 M MgCI₂) just prior to application to the lateral flow device. The lateral flow device is allowed to contact with 200 μΙ of running buffer (0.01 % v/v Triton X-100 in 2 mM phosphate buffer, pH 7.4). The result was interpreted as described above in Example 1.

REFERENCES

1. Sambrook and Russel, Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (200 ).

2. Vlachou, M. A., Glynou, K. M., loannou, P. C, Christopoulos, T. K. & Vartholomatos, G. (2010). Development of a three-biosensor panel for the visual detection of thrombophilia-associated mutations. Biosens Bioelectron, 26 (1), 228- 34.

Claims

1. A test strip for detecting at least one molecularly amplified target nucleic acid in a sample at ambient temperature, comprising:

at least one sample application zone for applying the sample to the test strip;

at least one detection zone comprising at least one immobilised probe comprising a sequence complementary to the target nucleic acid or fragment thereof; and at least one label zone comprising at least one releasably immobilised labelled conjugate for visual detection of the target nucleic acid.

2. The test strip according to claim 1 , further comprising a running buffer zone for application of a running buffer.

3. The test strip according to claim 2, wherein the label zone is between the running buffer zone and the detection zone.

4. The test strip according to any one of the preceding claims, further comprising a reservoir zone for collecting excess liquids.

5. The test strip according to any one of the preceding claims, wherein the detection zone and sample application zone are nitrocellulose membranes.

6. The test strip according to claim 4, wherein the reservoir zone is made from cellulose fibre.

7. The test strip according to any one of the preceding claims, wherein the target nucleic acid is a single stranded nucleic acid.

8. The test strip according to any one of the preceding claims, wherein the molecularly amplified target nucleic acid is amplified by PCR, asymmetric PCR or isothermal amplification.

9. The test strip according any one of the preceding claims, wherein the molecularly amplified target nucleic acid is amplified by Linear-After-The Exponential PCR.

10. The test strip according to either claim 8 or 9, wherein the sample is taken from a PCR reaction mixture after carrying out the PCR to amplify the target nucleic acid.

11. The test strip according to any one of the preceding claims, wherein the target nucleic acid is labelled at the 5' termini with a reporter moiety capable of binding the labelled conjugate or fragment thereof.

12. The test strip according to claim 11 , wherein the reporter moiety is at least one antibody or hapten binding pair.

13. The test strip according to any one of the preceding claims, wherein the sample is contacted with at least one hybridisation buffer prior to application to the test strip.

14. The test strip according to any one of the preceding claims, wherein the probe is immobilised to the detection zone by at least one antibody or hapten binding pair.

15. The test strip according to any one of the preceding claims, wherein the labelled conjugate is a polyclonal, monoclonal antibody or hapten binding pair, conjugated with a signaling label selected from the group consisting of coloured latex microparticles, colloidal carbon particles and metallic colloidal particles.

A method of detecting at least one molecularly amplified target nucleic acid in a sample at ambient temperature using the test strip according to any one of claims 1 to 17, the method comprising the steps of:

17. The method according to claim 16, wherein the sample is amplified by PCR, asymmetric PCR or isothermal amplification.

18. The method according to claim 16, wherein the sample is amplified by linear-after- the exponential PCR.

19. The method according to claim 16 or 18, wherein the sample is amplified by dry- reagent linear-after-the exponential PCR.

The method according to any one of claims 16 to 19, wherein the sample is taken from a PCR reaction mixture after carrying out the PCR to amplify the target nucleic acid.

The method according to any one of claims 16 to 20, wherein the sample is contacted with at least one hybridisation buffer before applying the sample to the test strip.

22. The method according to any one of claims 16 to 21 , wherein a running buffer is applied to the test strip to rehydrate the immobilised labelled conjugate after the sample is applied to the test strip.