WO2013121042A1

WO2013121042A1 - PP2A SUBUNITS IN DNA REPAIR, THE PP2A B55α SUBUNIT AS NOVEL PHD2 INTERACTING PROTEIN, AND IMPLICATIONS FOR CANCER

Info

Publication number: WO2013121042A1
Application number: PCT/EP2013/053186
Authority: WO
Inventors: Anna SABLINA; Massimiliano Mazzone; Giusy DI CONZA
Original assignee: Vib Vzw; Katholieke Universiteit Leuven, K.U.Leuven R&D; Life Sciences Research Partners Vzw
Priority date: 2012-02-16
Filing date: 2013-02-18
Publication date: 2013-08-22

Abstract

The present application relates to the field of cancer treatment. In a first aspect, it particularly relates to treatment of cancers by using the concept of synthetic lethality. It is shown that suppression or loss of function of particular subunits of the heterotrimeric serine/threonine phosphatases 2A (PP2A) sensitizes cells to inhibition of DNA base excision repair, such as e.g. PARP inhibition. These findings can be used to screen for patients sensitive to therapies based on DNA base excision repair inhibition, as well as used therapeutically by administering inhibitors of PP2A subunits, particular in combination with inhibitors of DNA base excision repair, such as PARP inhibitors. Interestingly, it is also shown that a particular PP2A subunit, B55α, is a novel interacting protein of the oxygen sensor PHD2. Both proteins are negative regulators of each other, and it is shown herein that B55α in tumor cells leads to apoptosis of these cells and thus to smaller tumors. Thus, inhibitors of the PP2A B55α subunit as such can also be used therapeutically in the treatment of cancer.

Description

PP2A SUBUNITS IN DNA REPAIR, THE PP2A B55ALPHA SUBUNIT AS NOVEL PHD2 INTERACTING PROTEIN, AND IMPLICATIONS FOR CANCER

Field of the invention The present application relates to the field of cancer treatment. In a first aspect, it particularly relates to treatment of cancers by using the concept of synthetic lethality. It is shown that suppression or loss of function of particular subunits of the heterotrimeric serine/threonine phosphatases 2A (PP2A) sensitizes cells to inhibition of DNA base excision repair, such as e.g. PARP inhibition. These findings can be used to screen for patients sensitive to therapies based on DNA base excision repair inhibition, as well as used therapeutically by administering inhibitors of PP2A subunits, particular in combination with inhibitors of DNA base excision repair, such as PARP inhibitors. Interestingly, it is also shown that a particular PP2A subunit, B55a, is a novel interacting protein of the oxygen sensor PHD2. Both proteins are negative regulators of each other, and it is shown herein that B55a in tumor cells leads to apoptosis of these cells and thus to smaller tumors. Thus, inhibitors of the PP2A B55a subunit as such can also be used therapeutically in the treatment of cancer.

Background

In tumors, 0₂ pressure is strongly reduced, leading to excess release of pro-angiogenic factors, such as vascular endothelial growth factor (VEGF), which results in abnormal vessels and impaired tumor perfusion. Due to the chaotic architecture of tumor vessels and the intense proliferation of cancer cells becoming more distant to blood vessels, tumors become more hypoxic, hence, inducing a vicious cycle, aggravating tumor hypoxia and further increasing tumor malignancy [Semenza, 2009]. The main executors of hypoxia signaling are the hypoxia-inducible factors HIF-1 and HIF-2, whose stability is regulated by prolyl hydroxylase domain proteins PHD1, PHD2, and PHD3. In line with the important contribution of hypoxia to cancer progression, the expression and function of PHDs have been correlated to disease outcome.

Particularly, Phd2 inactivation in cancer cells is accompanied by both pro- and anti-tumoral effects depending on the cellular context.

Tumor xenografts from Phd2 silenced human cancer cell lines showed induction of angiogenesis, thus enhancing blood supply and allowing a more efficient tumor growth [Chan and Giaccia, 2010]. The phenotype described is due to a HI F-independent function of PHD2. In fact, cells with both Phd2 and Hif-la disrupted exhibited increased tumor growth compared to cells that only had HIF-Ια silenced. The authors showed that the observed phenotype is ascribed to the ability of PHD2 to negatively regulate NFKB-pathway [Chan et al., 2009] and IL-8 production.

Further evidence for a tumor suppressive function of PHD2 was recently found in a hormone- dependent mammary carcinoma mouse model [Bordoli et al., 2011]. However, analysis obtained of a cohort of several human cancers showed that there are more tumor types that overexpress Phd2 compared to their normal histological counterpart, than tumor types that underexpress this gene, thus indicating Phd2 as an oncogene more than an oncosuppressor [Ameln et al., 2011]. In line with this, silencing of Phd2 in syngeneic murine cancer cells resulted in a reduction of tumor growth due to the anti-proliferative activity of TGF-β (transforming growth factor β) [Ameln et al., 2011].

Another study adds an extra level of complexity to the understanding of PHD2 in tumors, since PHD2 dosages might account for the discrepancies in different studies. Lee et al. reported that small decreases in PHD2 levels led to malignant transformation of nontumorigenic fibroblasts, whereas severe decreases did not. Consistent with these results, overexpression of Phd2 in malignant fibroblast resulted in loss of the tumorigenic phenotype [Lee et al., 2008].

Besides the role of PHD2 in tumor cells, Mazzone et al. have also investigated the role of PHD2 in the tumor stroma [Mazzone et al., 2009]. Heterozygous deficiency of Phd2 in tumor endothelial cells (ECs) did not affect vessel density, however induced normalization of the endothelial lining in a HIF-2a- dependent manner, thereby improving tumor perfusion and oxygenation, and increasing the release and the efficiency of chemotherapeutics [Leite de Oliveira et al., 2012].

All these data suggest that the role of PHD2 in the tumor progression is related to the expression levels, to the cellular context, but also to additional functions that are independent of HIF, but most probably dependent on other potential interactors. Such interactors would offer new possibilities as targets for therapeutic intervention in cancer.

Further, genome stability is essential for prevention of undue cellular death and neoplasia. DNA damage caused by internal or external damaging agents is a major threat to the integrity of the cellular genome. To maintain genome integrity, cells have evolved multiple pathways that coordinate DNA repair with cell cycle events in response to DNA damage. Defects in DNA damage response (DDR) result in genetic instability and increased susceptibility to cancer development (Ciccia and Elledge, 2010). One of the most powerful activators of the DNA damage response are the DNA double-strand breaks (DSB). This cytotoxic lesion is induced by ionizing radiation (IR), radiomimetic chemicals, and reactive oxygen species that accompany normal metabolism. Eukaryotic cells repair DSBs via error-prone non homologous end-joining (NHEJ) or high-fidelity homologous recombination (HR) repair, which is preceded by DNA end resection (Holthausen et al., 2010; Lieber, 2010). Initiation of DSB repair is controlled by the members of phosphatidylinositol 3 kinase-like kinase (PI KK) family: Ataxia telangiectasia mutated (ATM) and ad3-related (ATR) proteins. ATR is primarily activated in response to replicative stress or after exposure to UV radiation. Unlike ATR, ATM is critical for the cellular response to DSBs induced by ionizing radiation (I R). A wave of phosphorylation events radiating from PI KKs is progressively amplified to convey the signal to a large number of substrates in the cell. Although this cascade of events has been studied in great detail, the biological relevance of many of these phosphorylated events is still unknown. In addition, little is known about the mechanisms that control their down-regulation once they are generated (Freeman and Monteiro, 2010).

It is conceiva ble that Ser/Thr protein phosphatases could be responsible for keeping proteins involved in DNA repair response in an inactive state under normal conditions or for inactivating the signaling once DNA has been repaired. However, the phosphorylation of a number of PI KKs, including ATM, ATR, and CH K2, oscillates during the DNA repair process (Batchelor et al., 2011; Batchelor et al., 2008). These data suggest that protein phosphatases serve not only as negative regulators but also as active modulators (or inducers) of the DNA repair signaling or DDR.

Protein phosphatase 2A (PP2A) is a pivotal protein phosphatase. In fact, the name PP2A refers to a large family of heterotrimeric Ser/Thr phosphatases that constitutes about 1% of all cellular proteins and accounts for the majority of Ser/Thr activity in eukaryotic cells. The PP2A core enzyme consists of a catalytic C subunit and a structural A subunit. In mammals, two distinct genes encode closely related versions of both the PP2A A (Act and Αβ) and C (Cot and C ) subunits. The AC dimer recruits a third regulatory B subunit, which is responsible for the substrate specificity and function of the PP2A heterotrimeric complex. Four unrelated families of B subunits have been identified to date: B/B55/PPP2R2A, B'/56/PR61/PPP2R5, B"/PR72/PPP2R3, and Striatin/STRN. Thus, PP2A represents a family of holoenzyme complexes with different activities and diverse substrate specificities. Approximately 100 distinct complexes can be formed through combinatorial association of these subunits and it is believed that specific PP2A complexes mediate particular physiological functions (Eichhorn et al., 2008; Janssens and Goris, 2001).

PP2A has been directly implicated in the negative regulation of several proteins crucial for DSB DNA repair, including γΗ2ΑΧ, ATM, CHK1, and CH K2 (Freeman and Monteiro, 2010). Furthermore, PP2A directly dephosphorylates Ku70 and Ku86 as well as the DNA-PK catalytic subunit (DNA-PKcs) that, in turn, enhances the formation of a functional Ku/DNA-PKcs complex (Wang et al., 2009). However, consistent with the idea that protein phosphatases are not just negative regulators of the DNA repair signaling, selective inhibition of PP2A catalytic activity by chemical inhibitors or suppression of PP2A catalytic subunit impairs DNA repair, resulting in chromosomal instability and increased sensitivity to DNA damage (Chowdhury et al., 2005; Lankoff et al., 2006; Lu et al., 2009). PP2A is also essential for activation of cell cycle checkpoints in response to IR (Jang et al., 2007; Yan et al., 2010). One potential explanation for this apparent discrepancy is that several distinct PP2A complexes may modulate different steps of DNA repair.

Apart from double strand break repair, eukaryotic cells also have a base excision repair (BER) pathway. The BER pathway is involved in reparation of DNA single strand breaks (SSB) and regulated by Poly ADP-Ribose Polymerases or PARPs, a family of nuclear enzymes. Among the 17 members of PARP, PARP-1 and PARP-2 are the only members known to be activated by DNA damage and may compensate for each other. PARP-1 is best characterized and responsible for most if not all the DNA- damage-dependent poly (ADP-ribose) synthesis. Knockout of either PARP-1 or PARP-2 results in increased genomic instability by accumulation of DNA SSBs, and causes hypersensitivity to ionizing radiation and alkylating agents. The persistence of single-strand DNA lesions by blocking of PARP-1 may cause the DNA nicks to degenerate to form double-strand breaks during DNA replication. Normally, these DSBs are repaired via the HR mechanism. However, in cells with defective HR activity, this may lead to unsustainable genetic damage and cell death.

This led to the identification of PARP inhibitors as a tool to induce synthetic lethality. Synthetic lethality is a cellular condition in which simultaneous loss of two nonessential mutations results in cell death, which does not occur if either gene products is present and functional. Tumors with DNA repair defects, such as those arising from patients with BRCA mutations were found to be more sensitive to PARP inhibition due to synthetic lethality. The BRCA1 and BRCA2 gene encodes large proteins that coordinate the HR repair pathway. Since BRCAl/2-mutated tumors cannot utilize HR to repair DSBs, exposing these cells to PARP inhibitor, which shuts down BER rescue pathway, will lead to accumulation of DNA damage, genomic instability, and cell death (a synthetic lethal effect). In addition, normal tissue, which contains at least one functional allele of BRCA1 or BRCA2 with which to repair its DNA, should be spared when exposed to a PARP inhibitor. Up till now, however, PARP inhibitors have only shown clear activity in BRCA-associated cancers such as breast and ovarian cancer (including triple negative breast cancer, which has been described as cancer with "BRCAness" (Turner et al., Nat Rev Cancer. 2004;4:814-19)).

As BRCA1 and BRCA2 mutation carriers comprise less than 5% of breast cancer cases, there is a pressing need to identify biomarkers (other than BRCA1 and BRCA2 deficiency) that would predict responsiveness to PARP inhibitors. Moreover, there are several cancers, such as lung cancer, in which underlying homologous recombination defects such as BRCA mutations are much less common. It would be desirable to have biomarkers indicating which of these cancers, if any, can be treated with PARP inhibitors. Alternatively, new therapies targeting tumor DNA repair, possibly in combination with PARP inhibitors, are highly sought. Summary

In a mass spectrometric approach a novel interacting protein of PHD2 was identified, i.e. B55a, the B subunit of the phosphatase PP2A. Reversible phosphorylation of proteins is an important regulatory mechanism that occurs in both prokaryotic and eukaryotic organisms, and PP2A is a pivotal phosphatase. PP2A plays an integral role in the regulation of a number of major signaling pathways whose deregulation can contribute to cancer.

The regulatory B55a subunit of PP2A positively regulates TGF signaling, promoting the activation of Smad proteins, but it is also involved in the control of proliferation, mitotic exit, and survival pathways. Here we show that PHD2 binds B55a, inducing its proteasomal degradation. We demonstrate that this degradation is rescued in a dose dependent manner by increasing doses of DMOG (a chemical inhibitor of prolyl hydroxylases). These data indicate that the degradation of B55a is dependent on PHD2 mediated hydroxylation. On the other hand, B55a is able to decrease the prolyl hydroxylation activity of PHD2. In fact, in vitro silencing of B55a in several tumor cell lines reduces HIF-Ια protein levels and activity in a PHD2 dependent-manner. Accordingly, B55a silencing in DLD1 colon carcinoma cells inhibited tumor growth in athymic mice. This oncosuppressive effect was completely abolished by combined silencing of B55a and PHD2. Since DLD1 colon carcinoma cells are resistant to TGF stimulation, our findings can be mainly ascribed to negative regulation of PHD2 activity by B55a. This study shows an unprecedented regulation of the prolyl hydroxylase PHD2 through phosphorylation/dephosphorylation pathways, and thus highlights hypoxia-independent mechanisms of control of HIF-Ια levels. Overall, B55a represents a new hub to understand the complex role of PHD2 in cancer, and offers a new target for therapeutic intervention.

Further, reversible phosphorylation plays a critical role in the regulation of DNA repair processes. Although kinases are well-known drivers of the DNA repair process, much less is known regarding the role of protein phosphatases in the DNA damage response. Herein, it is confirmed that the PP2A family of heterotrimeric serine/threonine phosphatases facilitates double-strand break (DSB) DNA repair.

Using a loss-of-function screen, four different PP2A regulatory B subunits (Β55α, Β55δ, B56a, and

G5PR) were identified that affect DSB repair.

Particularly the PP2A B55a (PPP2R2A) regulatory subunit directly modulates ataxia telangiectasia mutated (ATM) phosphorylation and thus acts as critical effector of the HR DNA repair pathway.

Suppression of the PP2A B55a subunit switches the balance toward NHEJ DNA repair by ATM activation. ATM up-regulation triggered by loss of B55a induces CHK2 activity that results in Gl/S cell cycle arrest and down-regulation of BRCA1 and RAD51. Suppression of H DNA repair in B55a-depleted cells dramatically increased the sensitivity of these cells to poly(ADP-ribose) polymerase enzyme inhibition. Because B55a is commonly down-regulated in cancers (e.g. in non-small cell lung carcinomas (NSCLC)), B55a status could be used as a predictive marker for sensitivity to e.g. PARP inhibition.

According to a first aspect, it is an object of the invention to provide methods of diagnosing sensitivity of cells to treatment with an inhibitor of a DNA base excision repair enzyme, comprising determining the presence or amount of a gene encoding a PP2A subunit or its gene product in said cells.

According to specific embodiments, lower amounts of such a PP2A subunit, or even its absence, correlate with increased sensitivity of cells to treatment with an inhibitor of a DNA base excision repair enzyme (such as e.g. a PARP inhibitor).

According to particular envisaged embodiments, the cells in which the presence or amount of a gene encoding a PP2A subunit is assessed are tumor cells. According to further particular embodiments, the tumor cells are from an epithelial tumor.

Although the present methods can be applied on many cells or even many types of tumor cells, it is particularly envisaged that the tumor cells are from a tumor or cancer selected from the group of lung cancer, breast cancer, colorectal cancer, renal cancer, hepatocellular cancer, prostate cancer, ovarian cancer and thyroid gland cancer. As will be shown in the Examples section, these are cancers that are particularly associated with decreased presence or amount of PP2A subunits (e.g. through LOH or decreased mRNA levels).

According to particular embodiments, the gene encoding the PP2A subunit of which the presence or amount is detected is a gene encoding a PP2A subunit selected from the Β55α, Β55δ, B56a, G5PR and Cot subunits. According to further particular embodiments, the subunit is selected from the B55a, Β55δ, B56a, and G5PR subunits. According to even further particular embodiments, the subunit is selected from B55a and Β55δ. According to yet even further particular embodiments, the gene encoding a PP2A subunit encodes the B55a subunit.

As mentioned, according to specific embodiments the absence of, or a decrease in the amount of, a gene encoding a PP2A subunit or its gene product is indicative for increased sensitivity to the treatment with an inhibitor of a DNA base excision repair enzyme. Particularly, the inhibitor of a DNA base excision repair enzyme is a PARP inhibitor. For these inhibitors, the concept of synthetic lethality is well known, and it is known that some cells are sensitive to inhibition with such inhibitors and others are not.

According to particular embodiments, the cells in which the presence or amount of a gene encoding a PP2A subunit is determined are cells obtained from a subject. This is particularly also the case for tumor cells, obtained from a patient with cancer. According to these particular embodiments, the diagnosis of sensitivity of the cells to treatment with an inhibitor of a DNA base excision repair enzyme is equivalent to diagnosing the sensitivity of the subject to treatment with an inhibitor of a DNA base excision repair enzyme (e.g. as a cancer treatment).

According to further particular embodiments, the sensitivity of the subject to treatment with an inhibitor of a DNA base excision repair enzyme is used in guiding treatment of the subject, or in stratifying or classifying the subject for a clinical trial. The latter can be done beforehand, but also afterwards, e.g. to discriminate responders and non-responders post facto. According to another aspect, inhibitors of a PP2A subunit are provided for use as a medicament. More particularly, the inhibitors of a PP2A subunit are provided for use in the treatment of cancer. It is particularly envisaged to provide inhibitors of the PP2A B55a subunit for use as a medicament. According to specific embodiments, the inhibitors of the PP2A B55a subunit are provided for use in treatment of cancer.

According to particular embodiments (particularly those where B55a inhibition is incomplete or another subunit than B55a is inhibited), the cancer to be treated is DNA base excision repair-deficient cancer. For instance, the cancer can be characterized by lower PA P expression levels. However, in cases where inhibition of B55a is more than 50% (particularly even more than 75%), it is explicitly envisaged that other cancers can be treated as well. Without being bound to a particular mechanism, in these cases a therapeutic effect is likely achieved through the PHD2 interaction rather than the PARP pathway. Inhibition is particularly measured at the protein level (e.g. by measuring expression of protein, or by measuring enzymatic activity).

In a specific embodiment, the inhibitor of the PP2A B55a subunit is inhibitory RNA directed against the PP2A B55a subunit.

In another specific embodiment the inhibitor of the PP2A B55a subunit reduces enzyme activity (or, alternatively, protein levels) with at least 75%.

In yet another specific embodiment the inhibitor selectively induces apoptosis and/or cell growth arrest in cancer cells. According to particular embodiments, combinations of an inhibitor of a DNA base excision repair enzyme with an inhibitor of a PP2A subunit are provided for the treatment of cancer. This is envisaged to induce synthetic lethality in cells.

According to specific embodiments, the inhibitor of a PP2A subunit that is provided for cancer treatment is inhibitory NA directed against the PP2A subunit to be inhibited. According to other particular embodiments, the inhibitor of a DNA base excision repair enzyme is a PARP inhibitor. In yet another aspect, the invention provides a method of treating cancer, comprising administering an inhibitor of the PP2A B55a subunit to a subject in need thereof. In a specific aspect the inhibitor is administered to, or is targeted to, cancer cells.

According to a similar aspect, methods of treating cancer are provided, comprising administering an inhibitor of a PP2A subunit to a subject in need thereof. These methods may, in particular embodiments, further entail administering an inhibitor of a DNA base excision repair enzyme. This can be done as a combination treatment (i.e. concomitant or simultaneous administration) or can be done by separate administration of the compounds, but particularly by subsequent administration (i.e. within a limited time frame of each other, so that both inhibitors are simultaneously active in the subject).

In yet another aspect the invention provides a method of screening for an inhibitor of the PP2A B55a subunit, comprising: i) providing a cell based assay or an in vitro assay wherein a biological substrate of PP2A B55 alpha is present, ii) applying compounds to said cell based assay or said in vitro assay wherein a compound is identified as an inhibitor if it modifies the phosphorylation of said PP2A B55alpha biological substrate in said cell based assay or in said in vitro assay wherein the same compound does not interfere with the hydroxylation activity of PHD2.

According to a further aspect, methods of diagnosing sensitivity of a subject with cancer to treatment with an inhibitor of a DNA base excision repair enzyme are provided. Typically, these methods encompass the following steps:

Optionally obtaining a sample of cancer cells from the subject;

determining the presence or amount of a gene encoding a PP2A subunit or its gene product in a sample of cancer cells obtained from the subject; and correlating the presence or amount of the gene encoding a PP2A subunit or its gene product to sensitivity to treatment with an inhibitor of a DNA base excision repair enzyme, wherein the absence of or a decrease in the amount of the gene encoding a PP2A subunit or its gene product is indicative for increased sensitivity to the treatment.

The 'optionally' in these methods means that this may be the first step of the method, and that all steps are completed as one procedure. Alternatively, the sample has been obtained beforehand and only the determining and correlating steps are done as part of the method. Possibly, the sample has been obtained beforehand and has undergone pretreatment.

According to specific embodiments, the methods may further include a step of treating the patient with an inhibitor of a DNA base excision repair enzyme if the patient is sensitive to such treatment.

Brief description of the Figures Figure 1. shRNA screen to identify PP2A subunits involved in control of the DNA damage response. A,

Immunoblot analysis of PP2A C (Cot and C ) expression in HeLa cells expressing shRNAs against GFP or PP2A Cot. B, Immunoblot analysis of PP2AC and γΗ2ΑΧ in nuclear (N) and cytoplasmic (C) fractions in HeLa cells expressing shRNAs against GFP or PP2A Cot 8 hours after 2 Gy of I R. C, Automated image analysis of γΗ2ΑΧ immunostaining of HeLa cells expressing shRNAs specific for GFP or PP2A Cot at different time points after 2 Gy of I R. D, Automated image analysis of γΗ2ΑΧ immunostaining of HeLa cells expressing shRNAs targeting PP2A B subunits 8 hours after 2 Gy of I R. Results are shown as meansiSEM of 3 independent experiments. Suppression of PP2A subunits was assessed by qRT-PCR.

Figure 2. B55a switches the balance toward NHEJ repair pathway by inducing Gl/S cell cycle arrest.

A, Effect of B55aexpression on γΗ2ΑΧ levels as detected by automated image analysis. shB55a- resistant (rB55a) form of B55a was overexpressed in HeLa-shB55a-2 cells and B55a expression was confirmed by immunoblotting (shown in top panel). B, Comet assay of H EK TER cells expressing shGFP or shB55a after treatment with 2 μΜ of CPT for 1 h. Representative images are shown at 2 h and 12 h after removal of CPT. The comet tail moment from 75 cells (mean ± SEM) was quantified with CometScore software and normalized to untreated cells. *p=0.05 and * *p=0.01, as determined by Student's t-test. C, The efficiency of N H EJ DSB repair in 293T cell after introduction of shRNAs specific to shLuc or B55a. D, The efficiency of l-Sce-induced H RR in 293 DR-GFP expressing the indicated shRNAs. Results are shown as meansiSEM of 3 independent experiments. E, Immunoblot analysis of B55a, RAD51, phospho-BRCAl (Serl524), and BRCA1 expression levels in HeLa cells expressing indicated shRNAs after 2 Gy of IR. F, Cell cycle distribution of Pl-stained HeLa cells expressing the indicated shRNAs 8 hours after 5 Gy of IR. G, Analysis of BrdU incorporation by HeLa cells expressing shRNAs specific to GFP or shB55a 8 hours after 5 Gy of IR. H, Immunoblot analysis of CDC25A, phospho-CHKl (S296), phospho-CHK2 (Thr68), and CHK2 in HeLa cells with suppressed expression of B55a at different time points after 2 Gy of IR.

Figure 3. Β55α- PP2A complexes negatively regulate ATM phosphorylation. A, Immunoblot analysis of phospho-ATM (Serl981) and ATM in HeLa cells with suppressed expression of B55a at different time points after 2 Gy of IR. B, Immunoblot analysis of phospho-ATM (Serl981) and ATM in HeLa-shB55a-2 cells and HeLa-shB55a-2/rB55a cells at different time points after 2 Gy of IR. C, Automated image analysis of γΗ2ΑΧ immunostaining of HeLa and HeLa ATM SilenciX (ATM KD) cells expressing shGFP or shB55a at different time points after 2 Gy of IR. D, Representative images of phospho-ATM foci in HeLa cells expressing shRNAs targeting GFP or B55a 8 hours after 2 Gy of IR. Automated image analysis of phospho-ATM (Serl981) immunostaining. *p=0.0021 and **p=0.0034, as determined by Student's t- test. E, Reciprocal immunoprecipitations of ATM or Flag-tagged B55a expressed in HEK TE cells followed by immunoblotting using antibodies specific for Flag, ATM, PP2A C, and PP2A A. NS refers to a non-specific band. F, Immunoprecipitation of Flag-tagged B55aexpressed in HEK TE cells at different time points after 2 Gy of IR. Immunoblotting was performed with antibodies specific for Flag, ATM, and PP2A C.

Figure 4. Decreased expression of B55a increases sensitivity to PARP inhibition. A, qRT-PCR analysis of B55a expression in a set of 245 tumor samples across 14 cancer types. B, qRT-PCR analysis of B55a expression in a panel of 22 lung NSCLC samples with matched normal tissues. B55a expression was normalized to GAPDH expression. C, Immunoblot analysis of B55a expression in lung carcinoma cell lines with and without LOH in the PPP2R2A (B55a)-containing region. D, Colony assay of HeLa cells expressing shRNAs specific to GFP and B55a after IR, with increasing doses of IR. E, Viability of HeLa cells expressing shGFP or shB55a after treatment with PARP inhibitor ABT-888. F, Cell survival of lung carcinoma cell lines treated with increasing concentrations of ABT-888. (-) and (+) refer to a status of LOH in the PPP2R2A (B55a)-containing region in different lung carcinoma cell lines. G, Ki67 immunohistochemistry of tumor sections of A549 xenografts expressing shGFP or shB55a. H, Growth of subcutaneous A549 xenograft tumors expressing shGFP or shB55a after treatment with ABT-888. ABT-888 was administered at 25 mg/kg/d, orally, twice daily. I, same as H, but showing volume of both untreated tumors and tumors treated with ABT-888. sh573 is shB55a-2 RNA. Figure 5. Suppression of PP2A regulatory subunits by specific shRNAs. A, Suppression of PP2A subunits by specific shRNAs analyzed by qRT-PCR. B, Immunoblot analysis of the expression of PP2A Β55α, B56a, Β56δ, and PR72/130 after introduction of specific shRNAs. Figure 6. The effect of B55ct suppression on DSB DNA repair. A, Automated image analysis of γΗ2ΑΧ immunostaining of HeLa cells expressing shRNAs targeting shGFP and shB55a at different time points after 2 Gy of IR. Results are shown as meansiSEM of 3 independent experiments. Suppression of B55a confirmed by immunoblotting with antibody specific to B55a. B, Analysis of γΗ2ΑΧ immunostaining in HeLa cells transfected with ON-TARGETplus SMART pools targeting GFP, PP2A C, or B55a at different time points after treatment with bleomycin (ΙΟμΜ). Immunoblot analysis of PP2A C and B55a in Hela cells confirmed suppression of PP2A C and B55a.

Figure 7. Effect of B55a suppression on cell cycle distribution after IR.

Cell cycle distribution of Pl-stained HeLa cells expressing shRNAs targeting B55a under control conditions and 8 hours after 5 Gy of IR.

Figure 8. B55ct specifically interacts with PHD2. A, B55a binds PHD2. On the left, B55a immunoprecipitation in HEK-293T transfected with Phd2 and B55a or Phd2 and control plasmid. B55a protein was immunoprecipitated from cell lysates with an anti-B55a Ab. The presence of PHD2 in the immunoprecipitated (IP) samples was analyzed by Western blot with an anti-PHD2 Ab. The levels of B55a and PHD2 in the cell lysates were analyzed as control. HI (high) and LO (low) exposition. On the right, IP anti-V5 from the same protein extracts as negative control. B, B55a specifically interacts with PHD2. On the left, FLAG immunoprecipiation in HEK-293T cells transfected with Phdl, Phd2, Phd3 and B55a or with Phdl-FLAG, Phd2-FLAG, Phd3-FLAG and B55a. The presence of different PHDs, B55a, HIF- la or PP2A/Ca subunit in the IP samples was analyzed as described above. On the right, analysis of the WCE (Whole cell extract).

Figure 9. PHD2 induces proteasomal degradation of exogenous and endogenous B55a in a hydroxylation dependent manner. A, On the left, analysis of B55a protein degradation is shown to be PHD2 dependent. HEK-293T cells were transfected with B55a or Phd2 or both. B55a and PHD2 protein levels in these cells were analyzed by Western blot with an anti-B55a Ab and anti-PHD2 Ab, respectively. Tubulin was used as normalizer. On the right, HEK-293T cells transfected with Phdl-FLAG, Phd2-FLAG, Phd3-FLAG and B55a or B55a alone. The presence of different PHDs and B55a was analyzed by Western blot with an anti-FLAG Ab and anti B55a Ab, respectively. Anti-tubulin antibody was used as an internal control in cell lysates. B, DMOG rescues B55a degradation by PHD2. On the left, HEK-293T cell lines were transfected with B55a and Phd2 or empty vector. After 24h of transfection, cells were treated with ImM and 2mM DMOG (lane 4 and 5, respectively) for 8h. Protein levels were analyzed as described above. On the right, HEK-293T cells transfected with Phd2 or control vector in two different doses, 2 μg (lane 2) or 4 μg (Iane4) in presence (lane 3 and 5) or in absence (lane 2 and 4) of ImM DMOG. Protein levels were analyzed by Western blot. C, MG132 has the same effect of DMOG. On the left, B55a was cotransfected with Phd2 (Iane2 and 3) or empty vector (lane 1 and 5) into HEK-293T cells, in presence (lane 3 and 4) or in absence (lane 1 and 2) of 1 mM MG132. Protein levels were analyzed by western blot. On the right, HEK-293T cells treated with ImM DMOG (lane 2) and with ΙΟμΜ MG132 (lane 3) or with ΙΟμΜ MG132 and ImM DMOG (lane 4). After 8h, cells were harvested to examine protein levels of B55a and tubulin. D, MDA-MB231, DLD1, HEK-293T and MCF-7 cells stably expressing sh NA designed to specifically target Phd2 or unspecific control (shCTR), were harvested to examine protein levels of PHD2, B55a, and tubulin.

Figure 10. Proline mutants of B55a are resistant to the degradation induced by PHD2. A, Western blot of HEK 293 cells which have been transfected with B55 WT or B55 P159A, P236A, P319A mutants, either alone or together with PHD2. B, similar as A, but shown for the double or triple mutants in prolines 159, 236 and 319. 3PA: triple mutation in P159, P236 and P319 C, Quantification of Western blot shown in fig. 10B. Upper graph: shown as % B55a levels, normalized to vinculin levels. Lower graph: shown as % protein degradation. EV, empty vector; PHD2, cotransfected with PHD2. Figure 11. B55a contributes to HIF-la stabilization in a PHD2 dependent manner. A, B55a increases HIF-Ια protein levels. DLD1 cells were transfected with B55a or Phd2 or empty vector and were kept in 21% (normoxia) or in 1% of oxygen (hypoxia) for 16h. Protein levels were analyzed by Western blot. B, B55a positively affects HIF-Ια protein levels and activity. DLD1 cells silenced for B55a or control short hairpin were analyzed for protein levels. On the right, transactivation of the HRE-luciferase reporter measured in DLD1 cells in presence of an unspecific short hairpin as control (shCTR) or a short hairpin targeting Phd2 and B55a, respectively, treated or not treated (NT) with ImM DMOG. C, B55a increase HIF-Ια protein levels and activity in PHD2 dependent manner. On the left, DLD1 cells were stably infected with lentiviruses that express short hairpin RNA (shRNA) targeting B55a, Phd2 and B55a/Phd2, respectively or with unspecific short hairpin (shCTR) as control. Cells were kept in normoxia (N) or 24h in 1% hypoxia (H). Protein levels were analyzed by Western blot with an anti-B55a Ab, anti-PHD2 Ab and anti HIFla Ab, respectively. Tubulin was used as internal control. On the right, the same cells were transfected with an HRE-Luc reporter. Luciferase activity was analyzed and normalized. D, B55a stabilizes HIF-Ια in other tumor cell lines. HT29 (on the left) and A549 (on the right) cells were transfected with small interference targeting B55a (siB55a) and Phd2 (siPhd2) or both and control siRNA (siCTR), respectively, in normoxia (N) and 1% hypoxia (H) conditions. Protein levels were analyzed by Western blot.

Figure 12. B55ct inhibits the hydroxylase activity of PHD2. A, left panel, HEK-293T cells transfected with 0.5 or 1.5 μg Luciferase-ODD domain construct, overexpressing Phd2, Phd2 and B55a, or control vector only, in normoxia (NRX) and 1% hypoxia (HPX). The graph shows the luciferase activity. B, left panel: HEK-293T cells stably expressing a Luc-ODD construct, were transfected with Phd2 or Phd2 and B55a or vector control, in normoxia (NRX) and 1% hypoxia (HPX). Luciferase activity was measured. EV, empty vector; middle panel: ODD activity in HEK-293T cells stably expressing a Luc-ODD construct after silencing of CTR, B55, PHD2 or B55 and PHD2 together with siRNA; right panel: DLD1 cells stably expressing Luc-ODD construct, were transfected with Phd2 or Phd2 and B55a. Luciferase activity was measured. EV, empty vector.

Figure 13. Serine dephosphorylation of PHD2 by B55a contributes to PHD2 enzymatic inhibition. A,

Western blot of HEK293T cells that have been transfected with HIFla alone or in presence of PHD2 WT or alanine or aspartic acid mutants PHD2-S12A, S12D, S14A, S14D, S125A, S125D. B, ODD-luciferase readout as indication of PHD2 activity in HEK293T cells stably expressing a Luc-ODD construct. EV, empty vector; WT, transfected with wild-type PHD2; other abbreviations indicate the respective serine mutations in PHD2. Figure 14. Biological readout from B55a-PHD2-HIF axis indicates that the depletion of B55a reduces tumorigenic potential of cancer cells in a PHD2 dependent manner. A, Focus formation assay from DLD1 cell lines silenced for control, B55a, Phd2 and Phd2/B55a respectively. Representative portions of plates stained and photographed from three independent experiments were taken (not shown). The graph shows the quantification of the focus formation assay after 15 days. B, Colony formation in soft agar was assessed for shctr, shB55a, shPhd2 and shPhd2/B55a DLD1 cell lines by plating 1 χ 10³ cells of each line in 0.5% agar medium over 1% agar medium underlayers. After 2 weeks, the dishes were photographed (not shown) and the colonies quantified.

Figure 15. B55a reduces cell death after stress induced by hypoxia and reoxygenation. DLD1 cells stably expressing shCTR, shB55, shPHD2 or shB55-PHD2 have been stained with propidium iodide (PI) to analyze cell cycle in normoxia (NRX) or after 20h of hypoxia (HPX) or after 20h of hypoxia and 5 h of reoxygenation (ReOX). FACS analysis of PI stained cells showed an increasing of subGl (apoptotic or necrotic cells) in shB55 cells that is rescued by simultaneous depletion of PHD2 (shPHD2-B55). Figure 16. In vivo readout from B55a-PHD2-HIF axis shows that B55a loss reduces tumor growth in a PHD2 dependent manner. Left graph, In vivo growth curve of wild-type or B55a, Phd2 and B55a/Phd2 knockdown DLD1 xenograft tumors in nude mice. The graph on the right shows tumor weight after 5 weeks from tumor injection.

Figure 17. Proliferation curves of MCF10A and MCF7. Panel A shows the proliferation rate of the normal breast epithelial line (MCF10A) which is not affected by the transient transfection of the si NA directed against B55alpha. Panel B panel shows the proliferation rate of the breast cancer line (MCF7) which is clearly affected by the transient transfection of siRNA directed against B55alpha.

Detailed description

Definitions

The present invention will be described with respect to particular embodiments and with reference to certain drawings but the invention is not limited thereto but only by the claims. Any reference signs in the claims shall not be construed as limiting the scope. The drawings described are only schematic and are non-limiting. In the drawings, the size of some of the elements may be exaggerated and not drawn on scale for illustrative purposes. Where the term "comprising" is used in the present description and claims, it does not exclude other elements or steps. Where an indefinite or definite article is used when referring to a singular noun e.g. "a" or "an", "the", this includes a plural of that noun unless something else is specifically stated.

Furthermore, the terms first, second, third and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequential or chronological order. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.

The following terms or definitions are provided solely to aid in the understanding of the invention. Unless specifically defined herein, all terms used herein have the same meaning as they would to one skilled in the art of the present invention. Practitioners are particularly directed to Sambrook et al., Molecular Cloning: A Laboratory Manual, 2^nd ed., Cold Spring Harbor Press, Plainsview, New York (1989); and Ausubel et al., Current Protocols in Molecular Biology (Supplement 47), John Wiley & Sons, New York (1999), for definitions and terms of the art. The definitions provided herein should not be construed to have a scope less than understood by a person of ordinary skill in the art. The term "base excision repair enzyme" as used herein refers to enzymes assisting in the repair of single-strand DNA nicks, the process called base excision repair or BE . These enzymes particularly include PARPs, XRCC1, DNA ligase III, DNA polymerase beta, and PNKP. Also DNA glycosylases such as Oggl, Magi and UNG, AP endonucleases such as APEX1 and APEX2, Flap endonuclease (FEN1), DNA polymerase lambda and DNA ligase I are envisaged within the definition.

"PARP", "Poly (ADP-ribose) polymerase" or "PARPs" as used herein refers to a family of proteins which transfer ADP-ribose units from nicotinamide dinucleotide (NAD) to certain residues in PARPs and onto target proteins, and are involved in cellular processes such as DNA repair and programmed cell death. In humans, the PARP family comprises 17 members: PARP-1, PARP-2, PARP-3, vPARP or PARP4, the tankyrases 1 and 2 (PARP5a and PARP5b), tiPARP (PARP-7), PARP-12, PARP-13, PARP-9, PARP-14, PARP- 15, PARP-10, PARP-11, PARP-6, PARP-8 and PARP-16. PARP-1 and PARP-2 are believed to be most important in DNA base excision repair, most particularly PARP-1.

The term "PP2A subunit" as used in the application refers to subunits of the protein phosphatase 2 (also indicated as protein phosphatase 2A or PP2A). The PP2A subunits encompass scaffold subunits (referred to as A subunits, which has a or β isoforms), catalytic subunits (referred to as C subunits, which has a or β isoforms; in humans also respectively designated with the gene symbols PPP2CA (Gene ID: 5515 in humans) and PPP2CB (Gene ID: 5516 in humans)), and regulatory subunits. The A and C subunits of PP2A are evolutionary conserved and ubiquitously expressed. These two subunits form a catalytic complex (PP2A/AC) which has phosphatase activity, that can interact with the different families of regulatory subunits (B, B', B", B'") and also tumor antigens (e.g. SV40 small tumor antigen). The B subunits can recruit PP2A/C to distinct subcellular locations and determine the substrate specificity of PP2A (Cegielska et al., Mol Cell Biol. 1994;14:4616-4623). The regulatory or B subunits are further subdivided in 4 classes: B, B', B", and B'".

The first class encompasses the B55 subunits or isozymes, indicated as Β55α, β, γ, and δ or with the respective gene symbols PPP2R2A (Gene ID: 5520 in humans), PPP2R2B (Gene ID: 5521 in humans), PPP2R2C (Gene ID: 5522 in humans) and PPP2R2D (Gene ID: 55844 in humans). The term "PP2A B55a subunit" thus refers to the gene PPP2R2A or its encoded product.

The B' class includes the B56 subunits or isozymes, indicated as Β56α, β, γ, δ and ε or with the respective gene symbols PPP2R5A (Gene ID: 5525 in humans), PPP2R5B (Gene ID: 5526 in humans), PPP2R5C (Gene ID: 5527 in humans), PPP2R5D (Gene ID: 5528 in humans), and PPP2R5E (Gene ID: 5529 in humans). Contained in the B" class are P 130/72, PR48 and G5PR, or with the respective gene symbols PPP2R3A (Gene ID: 5523 in humans), PPP2R3B (Gene ID: 28227 in humans), and PPP2R3C (Gene ID: 55012 in humans).

Finally, the B'" class encompasses STRN (Gene ID: 6801 in humans) and STRN3 (Gene ID: 29966 in humans).

The phrase "determining the presence or amount of a gene or its gene product" as used in the application refers to establishing the presence of a functional gene at the DNA level, and/or detecting expression of the corresponding gene product. A "functional gene" in this context means a gene that encodes and can express a functional gene product, such as a protein. Thus, genes that contain deletions or inactivating mutations in their coding or non-coding (e.g. promoter) regions are not "functional genes" within this definition, as they can no longer give rise to functional protein activity. In case of genes with inactivating (e.g. catalytically dead) mutations, even though DNA is still present and a (inactivated) gene can be expressed, this still leads to a conclusion of absence of the functional gene. Typically however, determining the presence of a gene at the DNA level will involve looking at larger deletions encompassing part or all of the gene under study. Particularly envisaged within the definition is the detection of one or more inactive alleles, such as e.g. in detection of loss of heterozygosity (LOH). "Expression" or "expression of a gene product" as used in the application refers to the process by which inheritable information from a gene, such as the DNA sequence, is made into a functional gene product, such as protein or RNA. This definition thus encompasses, but is not limited to, transcription and/or translation of a gene. "Determining expression" may encompass processes such as detecting or measuring the presence of gene products, or determining the expression levels, i.e. the (relative or absolute) amount of gene product present. Determining expression may be done qualitatively (i.e. whether or not there is expression in a sample) and/or quantitatively (determining the amount of expression, or expression levels). Most typically, expression will be done quantitavely, in order to be able to compare expression levels. Determining expression may involve comparison with a positive control (e.g. to assess whether gene products can be detected in the sample, in particular whether the detection method works), a negative control or a blank (typically to assess whether no false positive signal is being generated), one or more standards (either internal or external standards, typically to allow more accurate quantification), or a combination thereof. The positive control may additionally or alternatively be an internal positive control, typically a gene product known to be present in the sample (e.g. to assess whether gene products can be detected in the sample, in particular whether the detection method works or whether gene products are indeed present in the sample). Detection of expression and/or activity is well known in the art, and a skilled person is capable of choosing appropriate controls and/or standards. A "gene product" as used herein typically refers to what is transcribed or translated from the gene in question, such as m NA and protein. The different isoforms or variants of mRNA and the resulting protein isoforms or variants are envisaged within the term gene product. Fragments of a gene product are also envisaged, as long as they are functionally active.

Note that determining the presence or expression of a gene (typically encoding a PP2A subunit) means determining presence or expression of at least one gene - it is explicitly envisaged to determine presence or expression of more than one PP2A subunit. Accordingly, when mRNA is chosen as the (or one of the) gene product whose levels are determined, this can be the total of all mRNA isoforms for the PP2A subunit(s) under study, or one or more specific mRNAs.

Alternatively or additionally, the gene product of which the levels are determined may be protein. As protein is translated from mRNA, the same considerations apply: all PP2A subunits may be determined, or those of specific isoforms only. Of note, it is envisaged as well that both mRNA and protein are determined. In this case, the subunits to be detected can be identical isoforms (wholly overlapping), or different isoforms (partly or not overlapping), depending on the setup of the experiment. With identical isoforms, it is meant that the mRNA isoform encodes for the corresponding protein isoform. However, for several genes it is known that the number of protein isoforms detected is generally lower than the number of possible mRNA transcripts (and thus of protein isoforms).

Also envisaged is the detection of protein with specific post-translational modifications, either within the whole protein pool or through the selective detection of such modified proteins. Examples of such modified proteins include, but are not limited to, methylated, phosphorylated, ubiquitinylated, glycosylated proteins or any combination thereof.

As mentioned, determining the amount of a gene may involve comparison with one or more controls or standards. Typically this will be done to establish whether the levels of the gene product are altered, most particularly decreased. As used herein, "altered levels" of a gene product may mean either "increased levels" or "decreased levels" of a gene product, which is typically assessed versus a control. The skilled person is capable of picking the most relevant control. This may for instance depend on the particular gene product, the nature of the disease or cancer studied, the sample(s) that is/are available, and so on. Suitable controls include, but are not limited to, expression in cells of a subject that is cancer-free (optionally from the same subject when he/she was still healthy), or a set of clinical data on average gene product levels in healthy volunteers. It may also be an artificially generated expression standard, e.g. as used in "real" quantitative PCR. As is evident from the foregoing, the control may be from the same subject, or from one or more different subjects or derived from clinical data. Optionally, the control is matched for e.g. sex, age etc.

With "decreased" levels of a gene product as mentioned herein, it is meant levels that are lower than are normally present. Typically, this can be assessed by comparing to control. According to particular embodiments, increased levels of a gene product are levels that are 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or even up to 100% lower than those of the control. According to further particular embodiments, it means that the gene product is absent, whereas it normally (or in control) is expressed, particularly expressed at clearly detectable levels. In other words, in these embodiments detecting the absence of a particular gene product is equivalent to detecting decreased levels of the gene product. According to yet further particular embodiments, it means that the gene product is absent, whereas in the majority of cell samples from tumor-free individuals, taken as a control, it is not. The skilled person will appreciate that the exact levels by which a gene product needs to be lower in order to allow a reliable and reproducible diagnosis may depend on the type of tumor tested, of which product (m NA, protein) the levels are assessed and the natural variability of these levels. However, assessing the decrease itself is fairly straightforward, since it only requires routine techniques.

Instead of looking at decreased levels compared to a control with normal levels, the skilled person will appreciate that the reverse, comparing to a control with lower levels, can also be done. Thus, if the gene product levels measured in the cells or cell sample are similar to those of a suitable 'control' obtained from a subject with a tumor sensitive to treatment with inhibitors of DNA base excision repair enzymes (or are e.g. comparable to gene product levels found in a clinical data set of such tumors, e.g. tumors with a particular LOH region), this may be considered equivalent to decreased gene product levels compared to a positive control, and be correlated to sensitivity of the cells to treatment with inhibitors of DNA base excision repair enzymes. In the other case, if gene product levels are significantly higher than those of a control with lower levels, this can be used to establish insensitivity to treatment with inhibitors of DNA base excision repair enzymes.

For 'increased levels' of a gene product compared to a positive or negative control, the considerations about decreased levels of a gene product apply mutatis mutandis. Of course, gene product levels may be compared to both a negative and a positive control in order to increase accuracy of the diagnosis. The term "cells" as used in the application refers to eukaryotic cells, particularly cells from a vertebrate organism, more particularly mammalian cells, most particularly human cells. The cells may be in the form of a cell line (i.e. cultured in vitro), or may be taken from a subject (e.g. for in vitro or ex vivo analysis). Typically, when cells are taken from a subject, they will be provided in the form of a sample such as one obtained from a biopsy. The sample may have been pre-treated (e.g. subjected to purification, homogenization, lysis, separation, centrifugation, sieving, ... or a combination thereof) to make sure it is in suitable form to allow determining the presence or amount of a gene or its gene product. Although it is particularly envisaged that the cells are from a human subject (to determine the best treatment regimen, based on the sensitivity of the cells to inhibitors of DNA base excision repair), determining the presence or amount of a gene or its gene product typically is not done in or on the subject itself, but rather in or on a sample, typically in vitro or ex vivo. As it is particularly envisaged that the cells are cancer cells, the sample of cells may take the form of a biopsy or other sample taken from a tumor present in the subject.

As used herein, the noun "subject" refers to an individual vertebrate, more particularly an individual mammal, most particularly an individual human being. A "subject" as used herein is typically a human, but can also be a mammal, particularly domestic animals such as cats, dogs, rabbits, guinea pigs, ferrets, rats, mice, and the like, or farm animals like horses, cows, pigs, goat, sheep, llamas, and the like. A subject can also be a non-mammalian vertebrate, like a fish, reptile, amphibian or bird; in essence any animal which can develop cancer fulfills the definition.

The term "cancer" as used herein, refers to different diseases involving unregulated cell growth, also referred to as malignant neoplasm. The term "tumor" is used as a synonym in the application. It is envisaged that this term covers all solid tumor types (carcinoma, sarcoma, blastoma), but it also encompasses non-solid cancer types such as leukemia. A particular class of tumors that are envisaged within the definition are epithelial tumors, also referred to as carcinomas. An "inhibitor of a DNA base excision repair enzyme" as used herein refers to a substance that can interfere with the base excision repair function of the gene product, either at the DNA level (by inhibiting the formation of the relevant gene product, i.e. by preventing or interfering with transcription), at the RNA level (by neutralizing or destabilizing mRNA to prevent or interfere with translation) or at the protein level (by neutralizing or inhibiting the protein involved in BER). It is particularly envisaged that the inhibitor is a PARP inhibitor, as such inhibitors are well characterized. Most particularly envisaged are inhibitors of PARP-1 and/or of PARP-2, as these enzymes are the PARPs most actively involved in BER. However, inhibitors of other PARPs may be useful as well. In this regard, recent publications suggest that the PARP inhibitor iniparib, which is explicitly envisaged for use, inhibits other PARPs than PARP-1 and 2, particularly PARP-5 and 6 (Ji J, Lee MP, Kadota M, et al Pharmacodynamic and pathway analysis of three presumed inhibitors of poly (ADP-ribose) polymerase: ABT-888, AZD 2281, and BSI201. Proceedings of the 102nd Annual Meeting of the American Association for Cancer Research; 2011 Apr 2-6; Orlando, Fla. AACR. 2011. Abstract nr 4527; Maegley KA, Bingham P, Tatlock JH, et al. All PARP inhibitors are not equal: an in vitro mechanistic comparison of PF-01367338 to iniparib. J Clin Oncol. 2011;29 (suppl; abstr el3576); Nagourney RA, Kenyon KR, Francisco FR, et al. Functional analysis of PARP inhibitors AZD 2281 and BSI-201 in human tumor primary cultures: a comparison of activity and examination of synergy with cytotoxic drugs. J Clin Oncol. 2011;29 (suppl; abstr el3599)).

Likewise, an "inhibitor of a PP2A subunit" refers to a substance that can interfere with the base excision repair function of the gene product, either at the DNA level (by inhibiting the formation of the relevant gene product, i.e. by preventing or interfering with transcription), at the RNA level (by neutralizing or destabilizing mRNA to prevent or interfere with translation) or at the protein level (by neutralizing or inhibiting the protein subunit). Particularly envisaged as inhibitors at the protein levels are inhibitors of complex formation, i.e. inhibitors that inhibit interaction of the specific subunit (e.g. a B subunit) with the rest of the complex (e.g. the AC dimer). Also particularly envisaged are inhibitors that inhibit interaction of the PP2A subunit (or the PP2A complex containing the subunit) with a specific substrate (e.g. the interaction between the B55a subunit and ATM, or the interaction between the B55a subunit and Foxo 1 (see Yan L. et al (2012) Biochem. J. 444(2): 239-47)). Particularly envisaged herein are "inhibitors of the PP2A B55a subunit", a term used herein to refer to a substance that can interfere with the enzymatic function of the gene product (thus particularly with the phosphatase activity of B55a-containing PP2A enzymes). According to most particular embodiments, these inhibitors interfere with the phosphatase activity these complexes exert on PHD2. As with the other inhibitors, inhibition can be either at the DNA level (by inhibiting the formation of the relevant gene product, i.e. by preventing or interfering with transcription), at the RNA level (by neutralizing or destabilizing mRNA to prevent or interfere with translation) or at the protein level (by neutralizing or inhibiting the protein subunit, or by neutralizing or inhibiting the protein involved in phosphatase activity); and inhibitors that prevent or target interaction of the PP2A B55a subunit (or PP2A complexes containing this unit) with specific substrates are specifically envisaged. According to a first aspect, in the present application, it is shown that the DNA double strand break repair activity of PP2A depends on particular subunits, and that the absence or decreased expression of these subunits in cells impairs the homologous recombination repair pathway to such an extent that the cells become vulnerable to inhibitors of the base excision repair pathway. Indeed, as shown in the examples, suppression of homologous recombination (H ) DNA repair in B55a-depleted cells dramatically increased the sensitivity of these cells to poly(ADP-ribose) polymerase enzyme inhibition. This finding is particularly useful in treatment of cancer, as inhibitors of the BER pathway, most particularly PARP inhibitors, are currently being explored as therapeutic options in treatment of cancer. The data presented herein have relevance for companion diagnostics, as the presence or expression of PP2A subunits may be used to predict responsiveness/sensitivity to inhibitors of the BER pathway. They also open the door for new therapeutic avenues, as inhibition of PP2A subunits may be promising to treat cancers which have deficiencies in the BER pathway, or as combination therapy with inhibitors of the BER pathway.

Thus, according to this aspect, methods are provided of diagnosing sensitivity of cells to treatment with an inhibitor of a DNA base excision repair enzyme, comprising determining the presence or amount of a gene encoding a PP2A subunit or its gene product in said cells.

As will be demonstrated in the Examples section, the absence of or a decrease in the amount of a gene encoding a PP2A subunit or its gene product is indicative for increased sensitivity to the treatment with such inhibitor. Increased sensitivity means that the cells are more likely to die. Thus, absence or decreased levels of PP2A subunits can be correlated to the likelihood that cells will be killed when contacted with an inhibitor of a DNA base excision repair enzyme.

It is particularly envisaged that the cells are tumor cells. Although cells from any tumor type can be tested for sensitivity, it is particularly envisaged that the tumor cells are epithelial tumor cells (or carcinoma cells). Examples of carcinomas include, but are not limited to, lung carcinoma, breast carcinoma, ovarian carcinoma, prostate carcinoma (e.g. adenocarcinoma), colon or rectal carcinoma (e.g. adenocarcinoma or squamous cell carcinoma), pancreatic carcinoma, hepatocellular carcinoma, and renal cell carcinoma. Most particularly envisaged forms of cancer include lung cancer, breast cancer, or ovarian cancer.

Although it is possible to just analyse cells (e.g. cell lines) for sensitivity to treatment with DNA BER enzyme inhibitors, in most instances this will be linked to therapeutic relevance for a patient. Thus, it is particularly envisaged that the cells in which the PP2A subunit gene or gene expression is assessed, are cells taken from a subject, most particularly tumor cells taken from a subject with cancer. In other words, methods of diagnosing sensitivity of a subject with cancer to treatment with an inhibitor of a DNA base excision repair enzyme are provided herein, comprising the steps of: determining the presence or amount of a gene encoding a PP2A subunit or its gene product in a sample of cancer cells obtained from the subject; and

correlating the presence or amount of the gene encoding a PP2A subunit or its gene product to sensitivity to treatment with an inhibitor of a DNA base excision repair enzyme, wherein the absence of or a decrease in the amount of the gene encoding a PP2A subunit or its gene product is indicative for increased sensitivity to the treatment.

Optionally, the methods comprise an additional first step of obtaining a sample of cancer cells from the subject.

However, the sample of cells can have been obtained from the patient separately, e.g. during an earlier investigation. Note that the sample of cancer cells may have undergone a pre-treatment to make it more suitable for analysis. For instance, for gene expression analysis, it is possible that cells have undergone one or more of the following procedures: they may have been isolated from the patient, the cells may have been sorted to separate tumor from non-tumor cells (e.g. using FACS), the cells may have undergone lysis to free the m NA, a cDNA library may have been made from the mRNA. In such case, the amount of PP2A subunit gene expression will be measured on the cDNA. However, as the cDNA is derived from a sample of cancer cells, this is still within the definition of "determining the presence or amount of a gene encoding a PP2A subunit or its gene product in a sample of cells", as the result tells something about the expression in the cells.

It is explicitly envisaged that, based on the results of the presence of particular PP2A subunits, and thus of the correlated sensitivity to inhibitors of DNA base excision repair enzymes, the treatment of the subject with cancer can be adapted. This typically involves treating the patient with an inhibitor of a DNA base excision repair enzyme if the patient is sensitive to such treatment (or indeed, if the patient is not sensitive to inhibitors of DNA BER enzymes, starting another treatment). Also envisaged as adapting the treatment of the patient is, in clinical trial settings, to stratify patient groups based on the levels of expression of PP2A subunits (e.g. in likely responders and non-responders to a particular therapy). This can be done upfront, or can be used to interpret data from earlier clinical trials (e.g. to check why a particular patient did or did not respond to a particular DNA BER enzyme inhibitor therapy). The PP2A subunit whose presence or expression levels are determined is most particularly a PP2A regulatory or catalytical (B or C) subunit, particularly one selected from Β55α, Β55δ, B56a, PR72/PR130, G5PR and Cot. Even more particularly, the PP2A subunit is a regulatory subunit, particularly one selected from the B, B' and B" families, more particularly one selected from B55a, Β55δ, Β56α, P 72/P 130 and G5PR, even more particularly selected from Β55α, Β55δ, B56a, and G5PR. According to further particular embodiments, the PP2A subunit is a regulatory subunit selected from the B and B' families. According to even further particular embodiments, the PP2A subunit is selected from the B family, more particularly from B55a and Β55δ. Most particularly, the PP2A subunit whose presence or expression levels are determined is B55a.

Importantly, whenever reference is made to a PP2A subunit in the present application, unless otherwise indicated, it is explicitly envisaged that this can be more than one. Thus, the presence or expression levels of more than one PP2A subunit may be determined in a sample of cells, either simultaneously, concomitantly or separately.

It is most particularly envisaged that the inhibitor of a DNA base excision repair enzyme is a PARP inhibitor. PARP inhibitors are well known to the skilled person and include, but are not limited to, iniparib, olaparib, veliparib, rucaparib, AG014699 (Pfizer), and MK4827 (Merck). These are under development in different companies and are sometimes indicated under a different name. For instance, BSI-201 (BiPar, Sanofi) refers to iniparib, ABT-888 (Enzo) refers to veliparib.

Other non-limiting examples of PARP inhibitors include nicotinamide; NU1025; 3-aminobenzamide; 4- amino-l,8-naphthalimide; 1,5-isoquinolinediol; 6(5H)-phenanthriddinone;l,3,4,5,- tetrahydrobenzo(c)(l,6)- and (c)(l,7)-naphthyridin-6-ones; adenosine substituted 2,3-dihydro-lH- isoindol-l-ones; AG14361; AG014699; 2-(4-chlorophenyl)-5-quinoxalinecarboxamide; 5-chloro-2-[3-(4- phenyl-3,6-dihydro- l(2H)-pyridinyl) propyl]-4(3H)-quinazolinone; isoindolinone derivative INO-1001; 4-hydroxyquinazoline; 2-[3-[4-(4-chlorophenyl)-l-piperazinyl]propyl]-4-3(4)-quinazolinone; 1,5- dihydroxyisoquinoline (DHIQ); 3,4-dihydro-5 [4-(l-piperidinyl)(butoxy)-l(2H)-isoquinolone; CEP-6800; GB-15427; PJ34; DPQ; BS-201; AZD2281; BS401; CHP101; CHP102; INH2BP; BSI1201; BSI401; TIQ-A; and imidazobenzodiazepines. Other PARP inhibitors are envisaged as well, as will be detailed in the passage about inhibitors below.

According to a further aspect, in the present application, it is shown that PHD2 binds B55a, inducing its proteasomal degradation. We demonstrate that this degradation is rescued in a dose dependent manner by increasing doses of DMOG (a chemical inhibitor of prolyl hydroxylases). These data indicate that the degradation of B55a is dependent on PHD2 mediated hydroxylation. On the other hand, B55a is able to decrease the prolyl hydroxylation activity of PHD2. In fact, in vitro silencing of B55a in several tumor cell lines reduces HIF-la protein levels and activity in a PHD2 dependent-manner. Accordingly, B55a silencing in DLD1 colon carcinoma cells inhibited tumor growth in athymic mice. This oncosuppressive effect was completely abolished by combined silencing of B55a and PHD2. Since DLD1 colon carcinoma cells are resistant to TGF stimulation, our findings can be mainly ascribed to negative regulation of PHD2 activity by B55a. This study shows an unprecedented regulation of the prolyl hydroxylase PHD2 through phosphorylation/dephosphorylation pathways, and thus highlights hypoxia- independent mechanisms of control of HIF-Ια levels. Overall, B55a represents a new hub to understand the complex role of PHD2 in cancer, and offers a new target for therapeutic intervention. This finding is particularly useful in treatment of cancer, as inhibitors of the phosphatase activity that B55a-containing PP2A complexes exert on PHD2 are shown to slow down tumor growth, by inducing apoptosis of cancer cells.

According to yet a further aspect, an inhibitor of a PP2A subunit is provided for use as a medicament. More particularly, an inhibitor of a regulatory PP2A subunit is provided for use as a medicament. Even more particularly, an inhibitor of a regulatory PP2A subunit of the B family is provided for use as a medicament, most particularly an inhibitor of the PP2A B55a subunit is envisaged for use as a medicament.

It is also particularly envisaged that the inhibitor for use as a medicament is a si NA against PP2A subunit mRNA, most particularly that inhibitors of the PP2A B55a subunit are siRNA against the B55a subunit mRNA.

According to further embodiments, inhibitors of a PP2A subunit are provided for the treatment of cancer. Particularly, inhibitors of the PP2A B55a subunit are provided for use in the treatment of cancer.

According to specific embodiments, it is envisaged that the cancer is deficient in the DNA base excision repair pathway, e.g. by absence or inhibition of a DNA base excision repair enzyme.

Accordingly, it is also envisaged that a combination of an inhibitor of a DNA base excision repair enzyme with an inhibitor of a PP2A subunit is provided for the treatment of cancer.

This is equivalent as saying that an inhibitor of a PP2A subunit is provided for the manufacture of a medicament for the treatment of cancer; more particularly, that an inhibitor of the PP2A B55a subunit is provided for the manufacture of a medicament for the treatment of cancer.

According to specific embodiments, it is equivalent to a combination of an inhibitor of a DNA base excision repair enzyme with an inhibitor of a PP2A subunit is provided for the manufacture of a medicament for the treatment of cancer. It is also equivalent to stating that methods of treating cancer are provided, comprising administering an inhibitor of a PP2A subunit to a subject in need thereof, particularly a subject with cancer. Particularly, methods of treating cancer are provided, comprising administering an inhibitor of the PP2A B55a subunit to a subject in need thereof, particularly a subject with cancer. These methods may further comprise administering an inhibitor of a DNA base excision repair enzyme (either simultaneously, concomitantly or sequentially).

Also provided is a pharmaceutical composition comprising an effective amount of at least one inhibitor of a PP2A subunit, particularly an inhibitor of the PP2A B55a subunit. Typically, the pharmaceutical composition will additionally comprise at least one pharmaceutically acceptable excipient. According to particular embodiments, the pharmaceutical composition additionally comprises an effective amount of at least one DNA base excision repair enzyme, particularly a PA P inhibitor.

With regard to both PP2A subunit and DNA base excision repair enzyme inhibitors, the nature of the inhibitor is not vital to the invention, as long as they result in decreasing or abolishing functional expression (and/or activity) of their relevant target. With "functional expression" of the target gene, it is meant the transcription and/or translation of functional gene product. "Inhibition of functional expression" can be achieved at three levels. First, at the DNA level, e.g. by removing or disrupting the gene, or preventing transcription to take place (in both instances preventing synthesis of the relevant gene product). Second, at the RNA level, e.g. by preventing efficient translation to take place - this can be through destabilization of the mRNA so that it is degraded before translation occurs from the transcript, or by hybridizing to the mRNA. Third, at the protein level, e.g. by binding to the protein, inhibiting its function or activity (e.g. enzymatic activity, such as phosphatase activity), and/or marking the protein for degradation.

If inhibition is to be achieved at the DNA level, this may be done using gene therapy to knock-out or disrupt the target gene (typically a gene encoding a DNA base excision repair enzyme, such as PARP, or a gene encoding a PP2A subunit, such as the B55a subunit). As used herein, a "knock-out" can be a gene knockdown or the gene can be knocked out by a mutation such as, a point mutation, an insertion, a deletion, a frameshift, or a missense mutation by techniques known in the art, including, but not limited to, retroviral gene transfer. Another way in which genes can be knocked out is by the use of zinc finger nucleases. Zinc-finger nucleases (ZFNs) are artificial restriction enzymes generated by fusing a zinc finger DNA-binding domain to a DNA-cleavage domain. Zinc finger domains can be engineered to target desired DNA sequences, which enable zinc-finger nucleases to target unique sequence within a complex genome. By taking advantage of endogenous DNA repair machinery, these reagents can be used to precisely alter the genomes of higher organisms. Other technologies for genome customization that can be used to knock out genes are meganucleases and TAL effector nucleases (TALENs, Cellectis bioresearch). A TALEN^® is composed of a TALE DNA binding domain for sequence-specific recognition fused to the catalytic domain of an endonuclease that introduces double strand breaks (DSB). The DNA binding domain of a TALEN^® is capable of targeting with high precision a large recognition site (for instance 17bp). Meganucleases are sequence-specific endonucleases, naturally occurring "DNA scissors", originating from a variety of single-celled organisms such as bacteria, yeast, algae and some plant organelles. Meganucleases have long recognition sites of between 12 and 30 base pairs. The recognition site of natural meganucleases can be modified in order to target native genomic DNA sequences (such as endogenous genes).

Particularly, the knock-out of the gene is limited to the tissue where the solid tumour is located, most particularly, the knock-out is limited to the tumour itself, and the gene is not inhibited in the host subject.

Apart from tissue-specific inhibition of gene product function, the inhibition may also be temporary (or temporally regulated).

Temporally and tissue-specific gene inactivation may for instance also be achieved through the creation of transgenic organisms expressing antisense RNA, or by administering antisense RNA to the subject. An antisense construct can be delivered, for example, as an expression plasmid, which, when transcribed in the cell, produces RNA that is complementary to at least a unique portion of the cellular mRNA.

A more rapid method for the inhibition of gene expression is based on the use of shorter antisense oligomers consisting of DNA, or other synthetic structural types such as phosphorothiates, 2'-0- alkylribonucleotide chimeras, locked nucleic acid (LNA), peptide nucleic acid (PNA), or morpholinos. With the exception of RNA oligomers, PNAs and morpholinos, all other antisense oligomers act in eukaryotic cells through the mechanism of RNase H-mediated target cleavage. PNAs and morpholinos bind complementary DNA and RNA targets with high affinity and specificity, and thus act through a simple steric blockade of the RNA translational machinery, and appear to be completely resistant to nuclease attack. An "antisense oligomer" refers to an antisense molecule or anti-gene agent that comprises an oligomer of at least about 10 nucleotides in length. In embodiments an antisense oligomer comprises at least 15, 18 20, 25, 30, 35, 40, or 50 nucleotides. Antisense approaches involve the design of oligonucleotides (either DNA or RNA, or derivatives thereof) that are complementary to an mRNA encoded by polynucleotide sequences of the target gene. Antisense RNA may be introduced into a cell to inhibit translation of a complementary mRNA by base pairing to it and physically obstructing the translation machinery. This effect is therefore stoichiometric. Absolute complementarity, although preferred, is not required. A sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense polynucleotide sequences, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense polynucleotide sequence. Generally, the longer the hybridizing polynucleotide sequence, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex. Oligomers that are complementary to the 5' end of the message, e.g., the 5' untranslated region (UTR) up to and including the AUG translation initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' UTR of mRNAs have recently been shown to be effective at inhibiting translation of mRNAs as well (Wagner, R. (1994) Nature 372, 333-335). Therefore, oligomers complementary to either the 5', 3' UTRs, or non-coding regions of a gene could be used in an antisense approach to inhibit translation of said endogenous mRNA encoded by target gene polynucleotides. Oligomers complementary to the 5' UTR of said mRNA should include the complement of the AUG start codon. Antisense oligomers complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5', 3' or non-coding region of a said mRNA, antisense oligomers should be at least 10 nucleotides in length, and are preferably oligomers ranging from 15 to about 50 nucleotides in length. In certain embodiments, the oligomer is at least 15 nucleotides, at least 18 nucleotides, at least 20 nucleotides, at least 25 nucleotides, at least 30 nucleotides, at least 35 nucleotides, at least 40 nucleotides, or at least 50 nucleotides in length. A related method uses ribozymes instead of antisense RNA. Ribozymes are catalytic RNA molecules with enzyme-like cleavage properties that can be designed to target specific RNA sequences. Successful target gene inactivation, including temporally and tissue-specific gene inactivation, using ribozymes has been reported in mouse, zebrafish and fruitflies. RNA interference (RNAi) is a form of post-transcriptional gene silencing. The phenomenon of RNA interference was first observed and described in Caenorhabditis elegans where exogenous double- stranded RNA (dsRNA) was shown to specifically and potently disrupt the activity of genes containing homologous sequences through a mechanism that induces rapid degradation of the target RNA. Several reports describe the same catalytic phenomenon in other organisms, including experiments demonstrating spatial and/or temporal control of gene inactivation, including plant (Arabidopsis thaliana), protozoan (Trypanosoma bruceii), invertebrate (Drosophila melanogaster), and vertebrate species (Danio rerio and Xenopus laevis). The mediators of sequence-specific messenger RNA degradation are small interfering RNAs (siRNAs) generated by ribonuclease III cleavage from longer dsRNAs. Generally, the length of siRNAs is between 20-25 nucleotides (Elbashir et al. (2001) Nature 411, 494-498). The siRNA typically comprise a sense RNA strand and a complementary antisense RNA strand annealed together by standard Watson Crick base pairing interactions (hereinafter "base paired"). The sense strand comprises a nucleic acid sequence that is identical to a target sequence contained within the target mRNA. The sense and antisense strands of the present siRNA can comprise two complementary, single stranded RNA molecules or can comprise a single molecule in which two complementary portions are base paired and are covalently linked by a single stranded "hairpin" area (often referred to as shRNA). The term "isolated" means altered or removed from the natural state through human intervention. For example, an siRNA naturally present in a living animal is not "isolated," but a synthetic siRNA, or an siRNA partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated siRNA can exist in substantially purified form, or can exist in a non-native environment such as, for example, a cell into which the siRNA has been delivered.

The siRNAs of the invention can comprise partially purified RNA, substantially pure RNA, synthetic RNA, or recombinantly produced RNA, as well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides. Such alterations can include addition of non-nucleotide material, such as to the end(s) of the siRNA or to one or more internal nucleotides of the siRNA, including modifications that make the siRNA resistant to nuclease digestion.

One or both strands of the siRNA of the invention can also comprise a 3' overhang. A "3' overhang" refers to at least one unpaired nucleotide extending from the 3' end of an RNA strand. Thus, in one embodiment, the siRNA of the invention comprises at least one 3' overhang of from one to about six nucleotides (which includes ribonucleotides or deoxynucleotides) in length, preferably from one to about five nucleotides in length, more preferably from one to about four nucleotides in length, and particularly preferably from about one to about four nucleotides in length.

In the embodiment in which both strands of the siRNA molecule comprise a 3' overhang, the length of the overhangs can be the same or different for each strand. In a most preferred embodiment, the 3' overhang is present on both strands of the siRNA, and is two nucleotides in length. In order to enhance the stability of the present siRNAs, the 3' overhangs can also be stabilized against degradation. In one embodiment, the overhangs are stabilized by including purine nucleotides, such as adenosine or guanosine nucleotides.

Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine nucleotides in the 3' overhangs with 2' deoxythymidine, is tolerated and does not affect the efficiency of RNAi degradation. In particular, the absence of a 2' hydroxyl in the 2' deoxythymidine significantly enhances the nuclease resistance of the 3' overhang in tissue culture medium.

The siRNAs of the invention can be targeted to any stretch of approximately 19 to 25 contiguous nucleotides in any of the target mRNA sequences (the "target sequence"), of which examples are given in the application. Techniques for selecting target sequences for siRNA are well known in the art. Thus, the sense strand of the present siRNA comprises a nucleotide sequence identical to any contiguous stretch of about 19 to about 25 nucleotides in the target mRNA.

The siRNAs of the invention can be obtained using a number of techniques known to those of skill in the art. For example, the siRNAs can be chemically synthesized or recombinantly produced using methods known in the art. Preferably, the siRNA of the invention are chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer. The siRNA can be synthesized as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions. Commercial suppliers of synthetic RNA molecules or synthesis reagents include Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, Colo., USA), Pierce Chemical (part of Perbio Science, Rockford, III., USA), Glen Research (Sterling, Va., USA), ChemGenes (Ashland, Mass., USA) and Cruachem (Glasgow, UK).

Alternatively, siRNA can also be expressed from recombinant circular or linear DNA plasmids using any suitable promoter. Suitable promoters for expressing siRNA of the invention from a plasmid include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant plasmids of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in a particular tissue or in a particular intracellular environment. The siRNA expressed from recombinant plasmids can either be isolated from cultured cell expression systems by standard techniques, or can be expressed intracellularly, e.g. in breast tissue or in neurons.

The siRNAs of the invention can also be expressed intracellularly from recombinant viral vectors. The recombinant viral vectors comprise sequences encoding the siRNAs of the invention and any suitable promoter for expressing the siRNA sequences. Suitable promoters include, for example, the U6 or HI RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the siRNA in the tissue where the tumour is localized.

As used herein, an "effective amount" of the siRNA is an amount sufficient to cause RNAi mediated degradation of the target mRNA, particularly a minimal amount of degradation (which e.g. may be measured by measuring decrease in gene product (mRNA, protein) levels, or by measuring the decrease in enzymatic activity of the protein translated from the mRNA. Particularly, the decrease is expressed as a percentage compared to the amount (or activity) of a control). An "effective amount" may also be an amount sufficient to slow tumor growth in a subject or an amount sufficient to inhibit the progression of metastasis in a subject. RNAi mediated degradation of the target mRNA can be detected by measuring levels of the target mRNA or protein in the cells of a subject, using standard techniques for isolating and quantifying mRNA or protein as described above.

One skilled in the art can readily determine an effective amount of the siRNA of the invention to be administered to a given subject, by taking into account factors such as the size and weight of the subject; the extent of the disease penetration; the age, health and sex of the subject; the route of administration; and whether the administration is regional or systemic. Generally, an effective amount of the siRNA of the invention comprises an intracellular concentration of from about 1 nanomolar (nM) to about 100 nM, preferably from about 2 nM to about 50 nM, more preferably from about 2.5 nM to about 10 nM. It is contemplated that greater or lesser amounts of siRNA can be administered. It has been shown that morpholino antisense oligonucleotides in zebrafish and frogs overcome the limitations of RNase H-competent antisense oligonucleotides, which include numerous non-specific effects due to the non target-specific cleavage of other mRNA molecules caused by the low stringency requirements of RNase H. Morpholino oligomers therefore represent an important new class of antisense molecule. Oligomers of the invention may be synthesized by standard methods known in the art. As examples, phosphorothioate oligomers may be synthesized by the method of Stein et al. (1988) Nucleic Acids Res. 16, 3209-3021), methylphosphonate oligomers can be prepared by use of controlled pore glass polymer supports (Sarin et al. (1988) Proc. Natl. Acad. Sci. USA. 85, 7448-7451). Morpholino oligomers may be synthesized by the method of Summerton and Weller U.S. Patent Nos. 5,217,866 and 5,185,444.

The gene product inhibitor may also be an inhibitor of protein. A typical example thereof is an antibody directed against the target gene. The term 'antibody' or 'antibodies' relates to an antibody characterized as being specifically directed against the target protein (typically a DNA base excision repair enzyme, such as PARP; or a PP2A subunit, such as the PP2A B55a subunit), or any functional derivative thereof, with said antibodies being preferably monoclonal antibodies; or an antigen-binding fragment thereof, of the F(ab')₂, F(ab) or single chain Fv type, or any type of recombinant antibody derived thereof. These antibodies of the invention, including specific polyclonal antisera prepared against the target protein or any functional derivative thereof, have no cross-reactivity to other proteins. The monoclonal antibodies of the invention can for instance be produced by any hybridoma liable to be formed according to classical methods from splenic cells of an animal, particularly of a mouse or rat immunized against the target protein or any functional derivative thereof, and of cells of a myeloma cell line, and to be selected by the ability of the hybridoma to produce the monoclonal antibodies recognizing the target protein or any functional derivative thereof which have been initially used for the immunization of the animals. The monoclonal antibodies according to this embodiment of the invention may be humanized versions of the mouse monoclonal antibodies made by means of recombinant DNA technology, departing from the mouse and/or human genomic DNA sequences coding for H and L chains or from cDNA clones coding for H and L chains. Alternatively the monoclonal antibodies according to this embodiment of the invention may be human monoclonal antibodies. Such human monoclonal antibodies are prepared, for instance, by means of human peripheral blood lymphocytes (PBL) repopulation of severe combined immune deficiency (SCID) mice as described in PCT/EP 99/03605 or by using transgenic non- human animals capable of producing human antibodies as described in US patent 5,545,806. Also fragments derived from these monoclonal antibodies such as Fab, F(ab)'₂ and scFv ("single chain variable fragment"), providing they have retained the original binding properties, form part of the present invention. Such fragments are commonly generated by, for instance, enzymatic digestion of the antibodies with papain, pepsin, or other proteases. It is well known to the person skilled in the art that monoclonal antibodies, or fragments thereof, can be modified for various uses. The antibodies involved in the invention can be labeled by an appropriate label of the enzymatic, fluorescent, or radioactive type. In a particular embodiment said antibodies against FMRP or a functional fragment thereof are derived from camels. Camel antibodies are fully described in W094/25591, WO94/04678 and in WO97/49805. Processes are described in the art which make it possible that antibodies can be used to hit intracellular targets. Since the target proteins are intracellular targets, the antibodies or fragments thereof with a specificity for the target proteins must be delivered into the cells. One such technology uses lipidation of the antibodies. The latter method is fully described in WO94/01131 and these methods are herein incorporated by reference. Another method is by fusing the antibody to cell- penetrating peptides (Chen and Harrison, Biochem Soc Trans. 2007). If the tumour is located in the brain, the inhibitor should be able to pass the blood-brain barrier. Technologies of modifying antibodies to pass the blood-brain barrier are well known to the skilled person.

Other inhibitors of target proteins include, but are not limited to, peptide inhibitors, peptide-aptamer inhibitors (Tomai et al., J Biol Chem. 2006), stapled peptides (Aileron Therapeutics; see e.g. Moellering et al., Nature, 2009. 462, p. 182-188), and protein interferors as described in WO2007/071789, incorporated herein by reference.

Small molecule inhibitors, e.g. small organic molecules, and other drug candidates can be obtained, for example, from combinatorial and natural product libraries. Such molecules can easily be screened for their inhibitory activity in e.g. an assay that measures phosphatase activity of B55a, or particularly of PP2A complexes containing a B55a subunit.

In summary, an "inhibitor" as used herein can be, but is not limited to: a chemical, a small molecule, a drug, an antibody, a peptide, a secreted protein, a nucleic acid (such as DNA, RNA, a polynucleotide, an oligonucleotide or a cDNA) or an antisense RNA molecule, a ribozyme, an RNA interference nucleotide sequence, an antisense oligomer, a zinc finger nuclease, meganuclease, TALEN or a morpholino.

It is particularly envisaged that the inhibitor of a PP2A subunit is inhibitory RNA directed against the PP2A subunit. Most particularly, said inhibitor is a siRNA against a PP2A subunit (the B55a subunit is specifically envisaged for such inhibitors), such as in a most particular embodiment an isolated siRNA comprising a sense RNA strand and an antisense RNA strand, wherein the sense and the antisense RNA strands form an RNA duplex, and wherein the sense RNA strand comprises a nucleotide sequence identical to a target sequence of about 19 to about 25 contiguous nucleotides in the PP2A subunit mRNA.

For PARP inhibitors, it is particularly envisaged that they are small molecules, such as, but not limited to, iniparib, veliparib, olaparib, rucaparib, CEP 9722, MK 4827, BMN-673, and 3-aminobenzamide.

Inhibition of gene product, particularly for inhibitors of a PP2A subunit (although it can apply to inhibitors of DNA base excision repair enzymes as well), does not necessarily mean complete ablation of target gene function, although this is envisaged too. Particularly with antisense RNA and siRNA, but with antibodies as well, it is known that inhibition is often partial inhibition rather than complete inhibition. However, lowering functional gene product levels will have a beneficial effect even when complete inhibition is not achieved - this can e.g. be observed from tumors with LOH that have increased sensitivity to PARP inhibition. Thus, according to particular embodiments, the inhibition will result in a decrease of 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90% or up to 100% of functional gene product. Partial inhibition is particularly envisaged as beneficial in the context of synthetic lethality with defective or inhibited DNA base excision repair, such as e.g. when in combination with PA P inhibition. Nevertheless, in cases where PP2A subunit inhibition is used alone (particularly in case of inhibition of the PP2A B55a subunit), it is particularly envisaged that inhibition of the gene product should result in a decrease of at least 50% of functional gene product, more particularly a decrease of at least 75% of functional gene product. Such higher degree of inhibition is shown to be beneficial for disrupting the PHD2-B55a axis. Accordingly, inhibition of the gene product should result in a decrease of 50%, 60%, 70%, 75%, 80%, 90% or up to 100% of functional gene product. Methods of measuring the levels of functional gene product (e.g. by determining expression) are known to the skilled person, and he can measure these before and after the addition of the inhibitor (or compare to a relevant control) to assess the decrease in levels of functional gene product.

Briefly, "determining expression" may encompass processes such as detecting or measuring the presence of gene products, or determining the expression levels, i.e. comparison with one or more controls or standards will typically be done to establish whether the levels of the gene product are altered, most particularly decreased. According to particular embodiments, decreased levels of a gene product are levels that are 10%, 20%, 25%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 90%, or even up to 100% lower than those of the control. It is particularly envisaged herein that inhibition means that levels of a functional gene product are decreased by at least 75%. Further particular envisaged embodiments is decrease of gene product levels by at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%. The skilled person will appreciate that the exact levels by which a gene product needs to be lower in order to achieve sufficient inhibition of functional expression may depend on the type of tumor tested, of which product (mRNA, protein) the levels are assessed and the natural variability of these levels. However, assessing the decrease itself is fairly straightforward, since it only requires routine techniques. Of note, rather than looking at expression, the amount of inhibition may also be evaluated by considering the decrease in protein activity, particularly enzymatic activity, more particularly phosphatase activity of PP2A containing the B55a subunit. This can be easily quantified by the skilled persons using methods known in the art. By way of non-limiting example, if inhibition is done with an antibody, expression levels will not be influenced, but the activity of the B55a-containing PP2A phosphatase will be reduced. This can be evaluated by checking the dephosphorylation of a relevant PP2A substrate. It is particularly envisaged that inhibition of phosphatase activity is evaluated on PHD2 as a substrate, since this is particularly relevant in the context of cancer, and since the interaction between B55a and PHD2 is specific. Inhibition of phosphatase activity is particularly at least 50%, more particularly at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or even 100%.

It is further shown herein that inhibition of the B55a subunit in cancer cells (when done alone, and to sufficient extent) leads to apoptosis and/or cell growth arrest in cancer cells, while this is not the case in a relevant non-tumor cell control.

As it is an object of the invention to induce apoptosis and/or cell growth arrest in cancer cells, it is also particularly envisaged that administration of the inhibitor is directly to cancer cells. Alternatively, administration is not directly to cancer cells, but the inhibitor is targeted to cancer cells, e.g. by fusion of the inhibitor to a targeting moiety (e.g. an antibody) specific for a cancer cell marker. Although inhibition can be achieved in cells from any tumor type, it is particularly envisaged that the tumor cells are epithelial tumor cells (or carcinoma cells), as these are easier to target. Examples of carcinomas include, but are not limited to, lung carcinoma, breast carcinoma, ovarian carcinoma, prostate carcinoma (e.g. In particular embodiments the invention provides screening methods for the identification of inhibitors of PP2A B55alpha activity comprising providing a cell based assay or an in vitro assay wherein a biological substrate of PP2A B55 alpha is present, applying compounds to said cell based assay or said in vitro assay wherein a compound is identified as an inhibitor if it modifies the phosphorylation of said biological PP2A B55alpha substrate in said cell based assay or in said in vitro assay wherein the same compound does not interfere with the hydroxylation activity of PHD2.

Biological relevant substrates of PP2A B55alpha are known in the art and include for example FOXOl (Yan L et al (2012) Biochem. J. 444(2):239-47) and the retinoblastoma-related protein pl07 (Jayadeva G. et al (2010) J. Biol. Chem. (2010) 285(39): 29863-73).

The term "compound" is used herein in the context of a "test compound" or a "drug candidate compound" described in connection with the methods of the present invention. As such, these compounds comprise organic or inorganic compounds, derived synthetically or from natural resources. The compounds include polynucleotides, lipids or hormone analogs that are characterized by low molecular weights. Other biopolymeric organic test compounds include small peptides or peptide-like molecules (peptidomimetics) comprising from about 2 to about 40 amino acids and larger polypeptides comprising from about 40 to about 500 amino acids, such as antibodies or antibody conjugates. Examples of assay methods for identifying the PHD2 hydroxylation activity, in particular for the identification of compounds which do not affect the normal inhibition of the hydroxylation activity of PHD2 by B55alpha, are described in the Example section, see examples 4, 5 and 6, without the purpose of being limitative. It should be clear to the skilled artisan that the present screening methods might be based on a combination or a series of measurements, particularly when establishing the link with phosphorylation/dephosphorylation measurements or changes. Also, it should be clear that there is no specific order in performing these measurements while practicing the present invention.

For high-throughput purposes, compound libraries may be used. Examples include, but are not limited to, natural compound libraries, allosteric compound libraries, peptide libraries, antibody fragment libraries, synthetic compound libraries, etc.

Determining the modified level of phosphorylation of specific PP2A B55alpha substrates can be done by using specific ELISAs using antibodies specifically recognizing the phosphorylation sites or via mass spectrometric approaches. Assays can be performed in eukaryotic cells, advantageously in mammalian cells, such as human cells. In a particular embodiment appropriate assays can also be performed in prokaryotic cells, reconstituted membranes, and using purified proteins in vitro.

Valuable inhibitors of PP2A B55alpha in the context of the present invention which can be identified with the provided screening methods are i) inhibitors of assembly of B55alpha containing PP2A (i.e. inhibitors of interaction between PP2A and B55alpha subunits), ii) specific inhibitors of phosphatase activity of B55alpha containing PP2As (and not other PP2A complexes), and iii) preferably inhibitors of B55alpha and PHD2 interaction that do not interfere with PHD2 hydroxylation activity.

It is to be understood that although particular embodiments, specific configurations as well as materials and/or molecules, have been discussed herein for cells and methods according to the present invention, various changes or modifications in form and detail may be made without departing from the scope and spirit of this invention. The following examples are provided to better illustrate particular embodiments, and they should not be considered limiting the application. The application is limited only by the claims.

Examples

Materials and methods

Plasm ids, cell lines, infections, transient transfections Lentiviral vector pLA CMV N-Flag was used to generate Flag-tagged B55aand Β55δ. The pLKO.l-puro shGFP, pLKO.l-puro shLuciferase (shLuc), and pLKO.l-puro vectors containing shRNAs targeting specific PP2A subunits were provided by the RNAi Consortium (Moffat et al., 2006). The RNAi experiments were performed using ON-TARGETplus SMARTpool Human PPP2R2A (B55a) and ON- TARGETplus SMARTpool Human PPP2CA (PP2A Cot) (Thermo Scientific, Dharmacon RNAi Technologies, Lafayette, CO).

Cells were cultured in DMEM or RPMI (GIBCO) medium supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin. All transfections were conducted using Turbofect (Fermentas) or DharmaFECT (Thermo Scientific), following the manufacturer's protocol. Retroviral and lentiviral infections were carried out as described (Moffat et al., 2006). To generate stable cell lines, cells were selected using 5 μg/mL puromycin. To induce DSBs, cells were treated with bleomycin (Sigma) or irradiated using the linear accelerator (6 MV photons, Varian Medical Systems, Palo Alto, CA).

Cell cycle analysis

Cells were washed with phosphate-buffered saline (PBS), fixed with 70% ethanol, treated with 100 μg/ml RNase A for 30 minutes at 37°C, and then stained with 50 μg/mL propidium iodide (PI) at room temperature (RT) for 30 minutes. 5-Bromo-2'-deoxyuridine (BrdU) incorporation was analyzed using the In Situ Cell Proliferation Kit FLUOS (Roche) following the manufacturer's protocol. The cell cycle distribution and BrdU immunostaining were assessed by FACSCanto (Becton-Dickinson).

Immunoblotting and immunoprecipitation Cells were suspended in CSK buffer (0.5% Triton X-100, 100 mM NaCI, 3 mM MgCI₂, 300 mM sucrose, 1 mM EGTA, 10 mM PIPES pH 6.8) containing protease inhibitor and phosphatase inhibitor cocktails (Roche). The cell lysates were incubated on ice for 10 minutes and then centrifuged at 500 x g for 5 minutes at 4°C. The supernatant and pellet were designated as cytoplasmic and nuclear fractions, respectively. The cytoplasmic fraction was clarified by additional centrifugation at 15,000 x g for 10 minutes at 4°C. The nuclear fraction was resuspended in buffer A (10 mM NaCI, 5 mM MgCI₂, 250 mM sucrose, 1 mM EGTA, 10 mM Tris-HCI pH 7.6) containing protease and phosphatase inhibitor cocktails and treated with RNase-free DNase I (80 μg/mL; Roche) for 30 minutes at 37°C.

Immunoprecipitation of Flag-tagged B55a was performed 24 hours after transfection with pLA CMV N- Flag B55a. Cells were suspended in lysis buffer containing 50 mM Tris pH 7.4, 1% NP-40, 250 mM NaCI, and proteinase inhibitor cocktail (Roche). Protein lysates were incubated with anti-Flag M2 beads (Sigma) overnight at 4°C. Immunoprecipitated Flag-B55a was eluted using 3xFlag peptide (Sigma). For ATM immunoprecipitation, the protein lysates were pre-cleaned by incubation with sepharose-A beads. The ATM complexes were isolated with anti-ATM antibody (Novus Biologicals, NB100-678) and sepharose-protein A beads (GE Healthcare).

The following antibodies were used: goat polyclonal anti-ATM, (Novus Biologicals; NB100-271), rabbit polyclonal anti-Flag (Cell Signaling; CN:2368), rabbit polyclonal anti-phospho-CHKl (Ser296) (Cell Signaling; CN:2349), rabbit polyclonal anti-phospho-CHK2 (Thr68) (Cell Signaling; CN:2661), rabbit polyclonal anti-phospho B CA1 (Serl524) (Cell Signaling; CN:9009), rabbit polyclonal anti-ATM (Cell Signaling; CN:2873), rabbit polyclonal anti-CDC25A (Cell Signaling; CN:3652), rabbit polyclonal anti- B55a; mouse monoclonal anti-phospho-ATM (Serl981), (Cell Signaling, clone 10H11.E12), mouse monoclonal anti-CHK2 (Cell Signaling clone 1C12), mouse monoclonal anti-PP2AC (BD Biosciences, clone 46), mouse monoclonal anti-PP2A A (Cell Signaling, clone 4G7), and mouse monoclonal anti- BRCA1 (Santa Cruz, clone D-9).

Neutral comet assay

Glass microscope slides were pre-coated with a thin layer of normal melting point agarose (200 μΙ or less). Single cell suspensions were diluted to give a density at 5xl0⁴ cells/ml; an aliquot of resuspended cells (10 μΙ) was placed into a tube containing low melting point agarose (90 μΙ) and this cell suspension transferred to a glass microscope slide. Slides were subsequently placed in a lysis solution (2 M NaCI, 30 mM Na2EDTA, 10 mM Tris-HCI, 1% Triton X-100 and 10% DMSO, pH 8.0) in the dark for 1 h at 4°C. After lysis, the slides were rinsed for 20 min in three changes of an alkaline rinse solution (0.3 M NaOH, ImM EDTA) to remove the remaining NaCI. Next, the slides were placed side-by-side in a horizontal electrophoresis chamber and subjected to electrophoresis at 0.7 V/cm and 50 mA for 20 min. Finally, the slides were rinsed with neutralization buffer (1 M Tris-HCI, pH 7.5) and allowed it to dry with prechilled absolute ethanol. The slides were stained with 5 μΙ PI solution (2μg/m\) right before examination. Comet images were examined at 200x magnification using a fluorescence microscope (Nikon, ECLIPSE Ti) and digitized. The tail moment values (TM) were quantified under microscope and analyzed by CometScore software (freeware vl.5).

Immunofluorescent microscopy

Cells were plated on coverslips or μΟβ3τ-96 well plates (Greiner Bio-One) and fixed with 4% paraformaldehyde for 10 minutes at RT. The cells were then permeabilized with ice-cold methanol for 5 minutes at -20°C and then in 0.5% Triton X-100 in PBS for 5 minutes. The cells were then incubated in blocking solution (3% bovine serum albumin in PBS) for 30 minutes at RT. After blocking, the cells were incubated with the primary antibody diluted with O.lx blocking buffer for 1 hour. After three washes with O.lx blocking buffer, the secondary antibody was added, and the slides were incubated for 1 hour. The following antibodies were used: mouse monoclonal anti-phospho-histone H2AX (Serl39) (Millipore, clone JBW301), mouse monoclonal anti-RAD51 (Abeam, clone 14B4), mouse monoclonal anti-PP2AC (BD Biosciences, clone46), and anti-phospho-histone H2AX (Serl39) FITC-conjugate (Millipore, CN: 16-202A).

Automated Image analysis was performed using IN Cell Analyzer 2000 (GE Healthcare). Two- dimensional digital images were acquired using a 20X objective lens and a 12-bit charged coupled device camera (GE Healthcare) (data not shown). All images were captured with the same conditions so that the background intensities were almost identical throughout the same series of experiments. Images were processed and analyzed by IN Cell Investigator software (GE Healthcare). Nuclear area was determined by the DAPI fluorescence signal. Area (total pixel number) and mean fluorescence intensity per pixel of each phosphorylated-H2AX focus and the number of foci per cell were obtained by IN Cell Investigator software using the original parameters provided by IN Cell Developer software (GE Healthcare). Approximately 20,000 cells for each point were scanned. The total intensity, which was defined as the sum of fluorescence of each focus within one nucleus, was calculated for an individual nucleus by determining the average sum of the area of each focus multiplied by the mean fluorescence intensity per pixel of each focus.

To confirm the accuracy of the γΗ2ΑΧ analysis, we performed the analysis after treatment with different concentrations of bleomycin. We found that treatment of HeLa cells with increasing concentrations of bleomycin resulted in a linear increase in γΗ2ΑΧ signal intensity (data not shown). These results demonstrated the suitability of automated image analysis for the efficient measurement of DSBs.

Quantitative real-time reverse-transcription PCR (qRT-PCR)

For qRT-PCR, total RNA was isolated using RNeasy (Qiagen), and cDNA was synthesized using the Advantage RT-PCR kit (Clontech). A list of primers used for real-time qPCR is presented in Table 1. Realtime PCRs were conducted in a Roche LightCycler-480-96 (Roche), using SYBR Green PCR Master Mix (Roche).

The Lung Cancer cDNA array and Cancer Survey cDNA array were purchased from OriGene, and realtime PCRs were performed in an ABI 7500 (Applied Biosystems) and analyzed with 7000 System SDS software. Table 1. Primers used to assess expression of PP2A regulatory subunits

NHEJ and HR DNA repair assays

293T cells were transfected with shRNAs against luciferase, B55a, and Β55δ and then selected with puromycin for 3 days. Following puromycin selection, cells were co-transfected with pBabe-GFP linearized by Hindi II together with pBabe-HcRed plasmid. The efficiency of N H EJ was assessed by the number of GFP/HcRed-positive cells 48 hours after transfection by flow cytometry analysis using a FACSCanto (Becton-Dickinson).

H R DNA repair efficiency was analyzed using 293 DR-GFP cells, which contain a stably integrated copy of the transgenic reporter DR-GFP. 293 DR-GFP cells were transfected with shRNAs targeting luciferase, B55a, and B55EL After puromycin selection, the cells were transfected with l-Scel expression vector. The number of GFP-positive cells was measured 48 hours later by flow cytometry analysis using a FACSCanto. Clonogenic survival assay and cell viability

To determine colony survival and viability, 10⁴ cells per 6-well plate or 10^s cells per 10 cm dish were plated in triplicate. The cells were then irradiated or treated with ABT-888 (Enzo Life Sciences) and incubated for 12 days. The colonies were then stained with crystal violet (Sigma) and counted using ImageJ software. Cell viability was analyzed by counting cell number with a Vi-Cell XR counter using Trypan blue staining dye 72 hours after treatment with ABT-888.

Human xenograft assays

Xenografts were established in female NMRI-nu (nu/nu)/6 week mice (Janvier) with A549cell line by s.c. injection (2.0x10^s cells per 0.2 mL/mouse). Tumors were staged to a preselected size (weight) using the following formula: volume = (tumorxlength ^χ tumor width²)/2. 25 mg/kg ABT-888 was administered orally (twice daily for 9 days) in a vehicle containing 0.85% NaCI adjusted to pH 4.0 using HCI.

Cells culture, transfections and treatments: DLD1, HEK-293T, A549, HT29, MDA-MB231, MCF-7 cell lines were routinely cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% heat-inactivated fetal bovine serum (FBS; HyClone), 2 mmol/L glutamine (Invitrogen), 100 units/mL penicillin/100 μg/mL streptomycin (Invitrogen). Cells were maintained in a humidified incubator in 5% C02 and 95% air at 37°C.

Transfections were performed with Lipofectamine™ 2000 Transfection Reagent (Invitrogen), according to the manufacturer's instructions. In the overexpression experiments we used the following plasmids: pcDNA3-PHDl, pcDNA3-PHD2, pcDNA3-PHD3, pcDNA3 empty vector, pcDNA3-PHDl-FLAG, pcDNA3- PHD2-FLAG, pcDNA3-PHD3-FLAG, pcDNA3-B55a-HA and pMIG-B55a-FLAG.

Transient RNA interference has been performed by transfecting cells with small interference RNA against Phd2 (siPhd2) and B55a (siB55a) or control vector (siCTR) (Invitrogen) using HiPerfect Lipofectamine (QIAGEN), according to the manufacturer's instructions.

DMOG (Dimethyloxaloylglycine) was used at concentration of 1 and 2 mM in H EK-293T and DLD1 cell lines. MG132 (proteasome inhibitor) was used at concentration of 10μΜ in HEK-293T cells.

Virus production and cell transduction: To generate lentiviral vectors, HEK-293T cell lines were transfected with a plasmid DNA mix containing:

6.25 μg of pENV

12.5 μg of pMDL (Gag-Pol)

25-32 μg of pGENE TRANSFER 6.25 μ§ οί ρΡΙΕν

A working solution of CaCI₂ (125 μΙ of 2.5 M CaCI₂), O.lx TE/dH20 (2:1) solution and 1250 μΙ of 2x HBS solution were added to the plasmid mix.

When the precipitate was formed, it was immediately added to the 293T cells. After 16 hours, the media was replaced with fresh media. The day after, supernatants were collected and frozen in 1.5 ml vials at -80 °C.

To generate stable knockdown cell lines, cells were incubated with virus diluted 1:1 in the Medium. After 48 h, puromycin was added in a concentration of 10 μg/ml. When cells were completely selected, they were frozen or used for experiments up to passages 4-6 in continual presence of puromycin. HEK-293T, DLD1, MCF-7, MDA-MB231, A549 were stably transducted with lentiviral vectors carrying a shRNA against Phd2

(GATCCCCGTACAGCCAGCATACGCCATTCAAGAGATGGCGTATGCGGCTGTACTTTTTA) and a shRNA against B55 (CCGGAGAAACACAAAGCGAGACATACTCGAGTATGTCTCGCTTTGTGTTTCTTTTTT ) or scramble (GATCCCCAGATCTCAAGTTCCTCACATTCAAGAGATGTGAGGAACTTGAGATCTTTTTTAAGCT). Western blot analysis: protein extraction was performed using lysis buffer containing 50 mM Tris HCI, 150 mM NaCI, 1% Triton X-100, 0.1% SDS, supplemented with Complete protease inhibitor mixture (Roche) and phosphatase inhibitor cocktail 16 (Roche). Cells extracts were incubated on ice for 30 minutes before they were centrifuged for 15 minutes at 4°C to remove debris. Supernatants were transferred to fresh tubes. The protein concentration of cell extracts was determined by using bicinchoninic acid (BCA) reagent (Pierce) according to the manufacturer's instructions. Bovine serum albumin (BSA) dilutions ranging from 0.08 mg/ml up to 2 mg/ml were used as standards. 100 μΙ of the standards as well as of a 1:50 dilution of the cell extracts were analysed in a 96well plate by adding 100 μΙ BCA reagent (Pierce). After 15 minutes of incubation at 37°C, the plate was analysed at 595 nm and the extracts were normalized for protein content. Equal quantities of protein sample were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Denaturing polyacrylamide gels of 8-10% acrylamide were cast using a mini-Protean gel caster (BioRad). Gels were overlaid with isopropanol and allowed to set until polymerized. Excess isopropanol was removed and a 5% stacking gel was poured on top of the resolving gel. Protein samples were loaded onto the gel with a prestained protein marker (Kaleidoscope Precision Plus) next to them and run in IX SDS-PAGE running buffer through the stacking gel at 80 V before separating the samples at 130 V.

After electrophoresis proteins were transferred from the gel onto a nitrocellulose membrane using a wet transfer system (BioRad). Afterwards, the membrane was blocked in 5% milk for non-specific binding at room temperature for lh and incubated with the primary antibody for 2h at room temperature or overnight at 4°C. The following primary antibodies were used: rabbit anti-HIFla (Cayman), mouse anti-B55a (Cell Signaling), rabbit anti-PHD2 (Novus) and rabbit anti-tubulin-H P (Abeam), mouse anti-FLAG (SIGMA), mouse anti-HA (SIGMA) and mouse anti-Cot (Cell Signaling).

After 15 minutes of washing in PBS-Tween 0.1% Buffer, the membrane was incubated with the secondary antibody for 50 minutes at room temperature.

The following secondary antibodies were used: goat anti-mouse (Santa Cruz biotechnology) and goat anti-rabbit (Santa Cruz biotechnology).

Finally, the membrane was washed again in PBS-Tween and signal was visualized by Enhanced Chemiluminescent Reagents (ECL, Invitrogen) according to the manufacturer's instructions.

Immunoprecipitation (IP): Cells have been lysed using Extraction Buffer (1% triton, 20mM Tris, 10% glycerol, 5mM EDTA, 150 mM NaCI, pH 7.4) minimizing denaturation of antibody binding sites. Protein extraction and the determining of protein concentration were performed as described in western blot analysis. 1 mg of total protein has been incubated for lh at 4°C with 20ul of protein G-coupled Sepharose beads (Pierce) to permit the aspecific binding of the proteins to this substrate. After incubation, the cell extract has been centrifuged to remove the pellet containing the aspecific complexes. The supernatant obtained has been incubated for 16h with specific antibody (anti-B55a Ab). Afterwards, protein G has been added for 3 hours in incubation at 4°C. Finally, immunoprecipitates have been washed 3 times with EB Buffer and resuspended in 10μΙ of loading buffer (loading buffer 6X: β-mercaptoetanolo 0,6 M; SDS 8%; Tris-HCI 0,25 M pH 6,8; glicerolo 40%; Bromophenol Blue 0,2%). The samples have been denaturated at 95°C for 5 minutes, before to be loaded onto SDS-PAGE acrilammyde gel. Western blot analysis has been performed as described.

For the anti-FLAG IP, it has been used an anti-FLAG M2 affinity gel and the elution of the protein of interest from the FLAG-beads was performed by using a FLAG peptide.

The FLAG peptide was dissolved in 0.5 M Tris HCI, pH 7.5, with 1M NaCI at a concentration of 5 μg/μl. For elution, 3 μΙ of 5 μg/μl of FLAG peptide was added to 100 μΙ of TBS buffer. 100 μΙ of FLAG elution solution was added to each sample for lh in agitation at 4°C. Afterwards, supernatant was collected, 20 μΙ of 6x loading buffer was added and the samples were subjected to SDS page.

Luciferase Assay: HEK-293T and DLD1 cell lines overexpressing PHD2 or PHD2/B55a or vector control and DLDlcells silenced for B55a (shB55a) or empty vector, were stably transfected with a plasmid encoding CMV-Luc-HIF-la ODD.

Medium was replaced every two days with culture medium containing 100 ug/ml G418 for 15 days until homogenous cell selection.

HEK-293T cells were also transiently transfected with 0.5, 1 and 1.5 μg of a plasmid encoding CMV-Luc- HIF-Ια ODD in presence or absence of a plasmid encoding PHD2 or PHD2/B55a. DLDl cells stably silenced for Phd2 or B55a or both, were transiently transfected with a construct encoding CMV-HRE-Luc.

Cells were lysed passively into 50 μΙ of luciferase Lysis Buffer (100 mM Kphosphate pH 7.8, 0.2% Triton X-100, 0.5% DTT) and luminescence from each well was measured by using a luminometer (Microplate Luminometer LB 96 V), in presence of a luciferase Assay Reagent (CoA 500 μΜ, Luciferin 500 μΜ, ATP 1000 μΜ and luciferase Assay Buffer 20mM, (MgC03) 4Mg(HO)2.5H20 1.07 mM, MgS04 2.67 mM, EDTA 0.1 mM, DTT 33.3 mM and H20).

It was used a BioRad assay to determine protein concentrations and these values were used to normalize luciferase values (RLU/ug protein was calculated by dividing luminometer reading by protein concentration).

Soft Agar and Focus formation assay: For soft agar assays, 10³ of the pooled DLDl cells were suspended in 2 ml of 0.5% (wt/vol) agar containing DMEM/10% fetal bovine serum and overlaid onto a 1% (wt/vol) agar solution in 24-well plates. Colonies appeared microscopically after 10 days and became visible to the naked eye after 15-20 days of incubation.

For focus formation, cells were plated at 2.5xl0³ cells/well on a 6-well cell culture plate and cultured for one week. The cultured cells were stained and fixed with 0.5% crystal violet in a fixing solution containing 10% acetic acid and 10% methanol in water.

Xenograft tumors: Colorectal adenocarcinoma (DLDl) adherent growing human cells were harvested and single-cell suspensions of 3x10^s cells in 200 μΙ of phosphate-buffered saline (PBS) were injected subcutaneously into the right flank of nude mice. Tumor volumes were measured three times a week with a caliper and calculated using the formula: V = π x [d2 x D] / 6, where d is the minor tumor axis and D is the major tumor axis. Knockdown of Phd2 and B55a in DLDl cells were achieved by transduction with a lentiviral vector carrying an shRNA against Phd2 (GATCCCCGTACAGCCGCATACGCCATTCAAGAGATGGCGTATGCGGCTGTACTTTTTA) and a shRNA against B55 (CCGGAGAAACACAAAGCGAGACATACTCGAGTATGTCTCGCTTTGTGTTTCTTTTTT ) or scramble (GATCCCCAGATCTCAAGTTCCTCACATTCAAGAGATGTGAGGAACTTGAGATC I I I I I I AAGCT).

Selection with puromycin (5 μg/ml) allowed the generation of a homogenous population of silenced (and scramble control) cancer cells. Mass spectrometry Analysis: to identify B55a hydroxylation sites or PHD2-phosphorylation sites, overexpression of the proteins of interest has been performed in HEK-293T. Cells were lysed in Extraction buffer and 3mg of total protein extracts have been immunoprecipitated with anti-FLAG M2 affinity beads, as been previously described. After SDS-PAGE running, gel has been stained with 0.25% Coomassie brilliant blue solution (SIGMA). The bands have been detected and cut for Mass Spectometry.

As a first step, the disturbing components for the mass spectrometer, such as Coomassie dye, were removed as much as possible. Afterwards, protein digestion with trypsin (sequence-grade modified trypsin, porcine) has been performed. The supernatants containing the peptides were then separated from the gel pieces and acidified with formic acid and the supernatants were concentrated by vacuum drying. The prepared samples were analysed by the LTQ-Orbitrap Velos mass spectrometer in LC- MS/MS mode.

The MS/MS data, obtained by the Orbitrap Velos, are presented against the Swiss-Prot database with a restriction to the human proteins.

To identify the proteins, each peptide was linked to a protein by the Mascot algorithm. The identification was performed with 99% confidence settings.

Statistics: Data represent mean ± standard error of the mean (SEM) of representative experiments unless otherwise stated. Statistical significance was calculated by two-tailed unpaired t-test for two data sets and analysis of variance (ANOVA) followed by Bonferroni post hoc test for multiple data sets using Prism (GraphPad Inc.), with p < 0.05 considered statistically significant.

The images show one representative experiment out of three. Example 1. The role of PP2A in DNA repair

Despite previous findings showing that PP2A negatively regulates PIKK-induced signaling, recent reports have demonstrated that PP2A inhibition impairs DNA repair (Chowdhury et al., 2005; Lankoff et al., 2006). To confirm this observation, we suppressed the more abundant PP2A catalytic subunit, Ca by introducing two different shRNAs. Because cells expressing very low levels of PP2A Ca proliferate poorly (Evans et al., 1999; Gotz et al., 1998), our shRNAs were able to suppress PP2A Ca mRNA expression by only 18% and 36%, respectively (Figure 1A and D; Figure 5A). Surprisingly, even the 18% reduction in PP2A Ca resulted in a dramatic decrease of PP2A C in the nuclear fraction (Figure IB). Consistent with a previous report (Chowdhury et al., 2005), immunoblot analysis of γΗ2ΑΧ revealed that suppression of PP2A Ca resulted in increased γΗ2ΑΧ in response to IR (Figure IB). Automatic imaging analysis of γΗ2ΑΧ immunostaining using the In Cell Analyzer 2000 system (see Material and Methods section) confirmed that even partial depletion of PP2A Ca resulted in inefficient DNA repair (Figure 1C). In addition, immunostaining analysis of PP2A C after IR revealed that the nuclear signal of PP2A C significantly overlapped with yH2AX, suggesting that the PP2A family could be directly involved in the control of DSB repair (data not shown) (Chowdhury et al., 2005).

Example 2. Identification of PP2A specific complexes involved in DSB repair The correlation between levels of PP2A suppression and the efficiency of DNA repair (Figure IB; 1C) suggests that several specific PP2A complexes contribute independently to the DNA repair response. Because it is believed that PP2A B regulatory subunits dictate the localization and substrate specificity of PP2A heterotrimer complexes, we performed a loss-of-function screen to identify specific PP2A B regulatory subunits that affect DSB repair. We introduced a lentiviral shRNA library that targets each of the known PP2A regulatory subunits (Sablina et al., 2010) to HeLa cells. To avoid the possibility of shRNA off-target effects, we used two shRNAs targeting different sequences in the same gene for each of the subunits. Using qRT-PCR, we assessed the knockdown level provided by each shRNA in the generated cell lines. For several PP2A subunits, we also confirmed the suppression levels by immunoblot analysis (Figure 5A; 5B). We irradiated the generated cell lines with 2 Gy and assessed the intensity of γΗ2ΑΧ phosphorylation 8 hours after IR using the In Cell Analyzer 2000 automatic imaging system. We found that in addition to PP2A Ca, suppressing the expression of PP2A B regulatory subunits Β55α, Β55δ, B56a, and G5PR with two different shRNAs resulted in a statistically significant (p<0.05) increase in γΗ2ΑΧ intensity compared to cells expressing shGFP (Figure ID). For PP2A regulatory subunits Β56β and STRN3, expression of one of two hairpins induced elevated γΗ2ΑΧ. However, we did not observe a correlation between the suppression of Β56β and STRN3 subunits and the γΗ2ΑΧ phenotypes, suggesting that elevated γΗ2ΑΧ in these cells was due to off-target effects (Figure 5A; Figure ID). Taken together, these results imply that PP2A B regulatory subunits Β55α, Β55δ, B56a, and G5PR control DSB repair.

We validated the results of the shPP2A screen by analyzing γΗ2ΑΧ immunostaining after suppression of B55a at different time points following IR or treatment with bleomycin (Figure 2A, Figure 6A, 6B). We also found that overexpression of shRNA resistant form of B55a in HeLa cells with suppressed B55a expression rescued the increase of γΗ2ΑΧ levels, excluding possible off-target effect of shRNAs targeting B55a (Figure 2A). To further determine whether B55a affect DNA repair, we measured the persistence of DSB in camptothecin (CPT)-treated cells expressing shGFP or shB55a using single-cell gel electrophoresis (comet assay, Figure 2B). CPT treatment induces DSBs, visible by increased DNA mobility or "comet tails." Based on the comet moments, which quantify the extent of DNA damage, we estimated that unresolved DNA damage significantly increased in B55a-deficient cells compare to control cells. Taken together, our observations support the idea that B55a could contribute to the control of the DNA repair process.

Example 3. B55ct differentially affects HR and NHEJ DNA repair pathways by modulating progression through the cell cycle To assess the possible mechanisms by which B55a is involved in DSB repair, we studied how suppression of these specific subunits affects two major DSB repair mechanisms, HR and NHEJ. To determine the efficiency of NHEJ repair, we analyzed the ability of cells expressing shRNAs against luciferase or B55a, to repair a linearized GFP reporter construct. We found that inhibition of B55a facilitated the NHEJ repair pathway (Figure 2C). In contrast, analysis of l-Scel-induced DSB repair in 293 DR-GFP cells revealed that suppression of B55a inhibited HR DNA repair (Figure 2D). Consistent with this observation, we found that 8 hours after IR, expression of both BRCA1 and RAD51, which are crucial players in HR DNA repair (Holthausen et al., 2010), was significantly decreased in cells with suppressed B55a expression (Figure 2E). Together, these results indicate that loss of B55a impairs the high-fidelity HR repair pathway and switches the DNA repair balance towards error-prone NHEJ. The balance between NHEJ and HR repair pathways depends on cell cycle phase (Goodarzi et al., 2008.; Holthausen et al., 2010). To test whether the observed shift in DNA repair pathways was due to changes in cell cycle, we examined whether B55a affects cell cycle progression after IR. FACScan analysis of untreated cells revealed similar cell cycle distributions of cells expressing either shGFP or shRNAs against B55a. However, 8 hours after IR, cells expressing shGFP accumulated in G2/S phase, whereas cells with suppressed B55a were observed mostly in Gl phase of cell cycle (Figure 2F; Figure 7). We also pulsed control and B55a-depleted cells with BrdU and then irradiated them. Flow cytometry analysis of BrdU-positive cells revealed that 8 hours after IR, cell lines with suppressed B55a demonstrated significantly lower levels of BrdU incorporation (Figure 2G), supporting the idea that B55a suppression results in Gl/S cell cycle arrest. In concordance with these results, we observed dramatically decreased expression of the cell cycle-promoting phosphatase CDC25A (Rudolph, 2007) in B55a-depleted cell lines both 2 and 8 hours after IR (Figure 2H). Taken together, these data suggest that suppression of B55a induces the Gl/S cell cycle arrest, which, in turn, switches the DNA repair balance toward NHEJ repair.

Because accelerated Cdc25A turnover after DNA damage is regulated by the CHK1 and CHK2 checkpoint kinases (Falck et al., 2001; Zeng et al., 1998), we analyzed whether B55a expression affects activation of CHK1 and CHK2. We found that inhibition of B55a did not affect CHK1 phosphorylation at

Ser296 (Figure 2H), nor at serines 217 and 345 (not shown). In contrast, we observed a significant accumulation of CHK2 phosphorylated at Thr68 in cells expressing sh NAs against B55a (Figure 2H), indicating that Gl/S cell cycle arrest induced by loss of B55a could be mediated by prolonged activation of CHK2.

Example 4. B55ct directly regulates ATM phosphorylation CHK2 is a direct target of ATM, which is directly regulated by PP2A. In particular, a previous report (Goodarzi et al., 2004) reveals that okadaic acid (OA) induces autophosphorylation of ATM at Serl981 at concentrations that specifically inhibit PP2A activity. Moreover, the authors demonstrate a direct interaction between ATM and PP2A scaffolding A and catalytic C subunits (Goodarzi et al., 2004). Specific PP2A regulatory subunit(s) involved in the control of ATM phosphorylation were not identified while our data suggest that B55a could activate CHK2 by negatively regulating ATM activity.

Indeed, immunoblot analysis of ATM phosphorylated at Serl981 revealed dramatic increased levels of ATM in cells after suppressed B55a expression both under control conditions and 8 hours after IR (Figure 3A). Restoration of B55a expression rescued the increase of ATM phosphorylation induced by B55a suppression (Figure 3B). Moreover, immunofluorescent analysis of phospho-ATM revealed that depletion of B55a resulted in a significant increase of the size of phospho-ATM foci (Figure 3C). In contrast, the number of phospho-ATM-positive cells was only slightly higher, and the number of phospho-ATM foci per nuclei was approximately the same in cells expressing B55a or shGFP (Figure 3C). These observations indicate that increased phosphorylation of ATM leads to stabilization of ATM localization at the sites of DNA damage, confirming prior findings that phosphorylation of ATM is required for ATM retention at the sites of DSBs (So et al., 2009).

These findings suggest that impaired HR DNA repair in cell with suppressed B55a is due to dysregulation of ATM activity. To test this hypothesis, we analyzed the effect of B55a on DNA repair in HeLa ATM SilenciX (ATM KD) cells (Figure 3D). Indeed analysis of γΗ2ΑΧ immunostaining in ATM- deficient cells revealed that suppression of B55a in these cells did not affect the kinetics of DNA repair. To determine whether B55a directly regulates ATM phosphorylation, we performed a set of reciprocal immunoprecipitations (Figure 3E). We found that PP2A heterotrimeric complexes containing the B55a regulatory subunit constitutively interact with ATM in undamaged cells, suggesting that B55a-specific PP2A heterotrimers are involved in direct dephosphorylation of ATM. In line with this, phosphopeptides corresponding to human ATM pS367, pS1893, and pS1981 were efficiently dephosphorylated by B55a-specific PP2A complexes in in vitro phosphatase assays (not shown). While Wipl phosphatase has also been demonstrated to dephosphorylate ATM (not shown), in contrast to Β55α, Wipl expression is extremely low in undamaged cells (not shown) and depletion of Wipl does not affect the level of phosphorylated ATM under normal conditions (Shreeram et al., 2006a). The interaction of B55a with ATM in unperturbed cells could serve to actively suppress the inherent tendency of ATM molecules to undergo trans-phosphorylation. Consistently with (Goodarzi et al., 2004), the ATM-B55a complex rapidly dissociates after IR, allowing accumulation of phosphorylated ATM (Figure 3F).

Example 5. B55ct is commonly down-regulated during cancer progression

The contribution of PP2A B55a-specific complexes to the DNA repair response suggests that B55a could be involved in control of cancer development and progression. Indeed, the LOH analysis revealed that heterozygous deletions of the PPP2R2A (B55a)-containing region are observed in 43% of all epithelial cancers (q-value=0.0514) (Beroukhim et al.) (www.broadinstitute.org/tumorscape/). To confirm the downregulation of PPP2R2A (B55a) in human cancers, we analyzed the mRNA expression of PPP2R2A (B55a) in 245 samples covering 14 cancer types by qRT-PCR. We found a significant downregulation of B55a mRNA expression in lung and thyroid carcinomas (p-value<0.05) (Table 2; Figure 4A). We also assessed B55 mRNA expression in a panel of 21 NSCLC samples with matched normal tissues. We observed at least a 2-fold decrease in PPP2R2A (B55 ) mRNA in 8 out of 21 cancer samples (Figure 4B).

Table 2. qRT-PCR analysis of B55a expression in human cancer samples

% of samples with decreased B55a

Cancer Number of cases p-value^a

expression ^b prostate 20 0.5844 50.00 ovarian 21 0.7470 57.14 cervical 9 0.8929 44.44 stomach 15 0.8239 53.33 thyroid gland 18 0.0017 94.44 adrenal gland 10 0.6564 50.00 pancreatic 17 0.7053 23.52 testis 20 0.2428 20.00 urinary bladder 23 0.9916 30.43

Note: ^a The significance of B55a expression alterations in cancer samples compared to normal tissue, as determined by Student's t-test. ^b Percentage of cancer samples with at least a two-fold decrease in 655a expression compared to normal tissue. Moreover, we found a significant correlation (p-value=0.0683) between the frequency of B55a LOH and the percentage of samples with down-regulated B55a expression across different cancer types (Table 3), suggesting that decreased B55a expression in human cancers is due to LOH in the B55a- containing region.

To test this idea, we analyzed B55a expression in a set of lung carcinoma cell lines where the status of B55a LOH was known (Supplemental Figure 6B). Immunoblot analysis of B55a expression revealed lower levels of B55a in cell lines harboring LOH in the 655a-containing region compared to cell lines without 655a LOH (Figure 4C). Thus, these results indicate that B55a expression is commonly down- regulated in NSCLCs due to the LOH in the 655a-containing region. Table 3. Gene expression and LOH analysis of B55a in human cancer samples and cancer cell lines.

Shown in the table is the percentage of cancer samples with at least 2-fold decrease of PPP2R2A (B55a) mRNA expression compared to normal tissue and frequency of LOH of PPP2R2A (B55a)- containing region determined by (Beroukhim et al, Nature, 463:899-905, 2010). The cancers shown in Table 3 are particularly envisaged for the methods presented herein, because - as is evident from the table - there is a significant likelihood that these cancers show decreased expression of PP2A subunits, such as B55a. This also applies to the cancers of Table 2, particularly those where more than 50% of samples show decreased expression of the subunit.

Example 6. Loss of B55ct results in increased sensitivity to PARP inhibitors The impaired efficiency of DNA repair in cells with suppressed B55a expression suggests that these cells have higher sensitivity to DNA damage. Indeed, the colony assay revealed that suppression of B55a significantly sensitized cells to I R (Figure 4D).

Cells with defects in the H R repair pathway, such as BRCAl/2-deficient cells, are highly sensitive to blockade of the base excision repair pathway via inhibition of the poly(ADP-ribose) polymerase (PARP) enzyme (Rouleau et al.). We found that the loss of PPP2R2A (B55 ) resulted in the downregulation of RAD51 and BRCA1 and impaired H R repair, suggesting that B55a-depleted cells depend on PARP to maintain genomic integrity. To test the sensitivity of B55a-suppressed cells to PARP inhibition, we analyzed cell survival after treatment with increasing concentrations of ABT-888 (veliparib), which is a potent, orally administered small-molecule inhibitor of PARP-1 and PARP-2. We found that suppression of B55a by specific shRNAs sensitized HeLa cells to ABT-888 treatment (Figure 4E). We also examined the sensitivity of lung carcinoma cell lines with different levels of B55a expression to PARP inhibition. We selected four cell lines harboring LOH of the B55a-containing region and showed lower expression of B55a (H2172, H 1755, HOP62, and HOP92) and three cell lines without LOH in the PPP2R2A (S55a)-containing region and showed higher expression of B55a (A549, H838, and Colo699). Consistent with our previous results, we found that cell lines with lower B55a expression had higher sensitivity to ABT-888 treatment compared to cell lines with higher B55a expression (Figure 4F).

To validate this observation, we analyze the effect of PARP inhibition on tumor growth of A549 xenografts expressing shRNAs specific to GFP or B55a. We found that ABT-888 treatment of xenografts with suppressed B55a expression significantly inhibited tumor growth but not xenografts expressing shGFP (Figure 4H, I). We also evaluated proliferation in these xenograft tumors by Ki-67 immunostaining, a common marker for cell proliferation. Consistently, tumors with suppressed B55a expression from mice treated with ABT-888 showed a marked reduction in Ki-67 positivity (Figure 4G). Taken together, these results suggest that B55a expression or LOH in the S55a-containing region can be used as a predictive marker for sensitivity to PARP inhibitors. Discussion

PP2A is a ubiquitously expressed family of Ser/Thr protein phosphatases, and the diversity of PP2A functions suggests that particular PP2A complexes may affect specific pathways and contribute independently to complex phenotypes, such as the DNA damage response (Eichhorn et al., 2008; Janssens and Goris, 2001). Indeed, it was found that suppression of 4 different PP2A regulatory B subunits, Β55α, Β55δ, B56a, and G5PR impairs the efficiency of DNA repair, suggesting that these specific PP2A complexes are involved in the regulation of DNA repair. In a prior study, we performed a loss-of-function screen using a similar shPP2A library to identify PP2A subunits involved in human cell transformation (Sablina et al., 2010). This screen implicates three PP2A regulatory subunits, B56a, Β56γ, PR72/130, in the control of cell transformation. Suppression of B56a by specific shRNAs mediates cell transformation by up-regulating the Wnt and c-Myc signaling pathways (Sablina et al., 2010 ). Our present results suggest that in addition to modulating c-Myc and Wnt activity, B56a could also contribute to the tumorigenic phenotype by impairing DNA repair efficiency. Consistent with this idea, PP2A holoenzymes containing the B56a regulatory subunit interact and directly dephosphorylate both c-Myc (Arnold and Sears, 2006) and CH K2 kinase (Freeman and Monteiro, 2010). The data presented in the first six examples herein focus inter alia on the mechanisms by which the

PP2A regulatory subunit B55a affects DNA repair responses. We found that PP2A heterotrimeric complexes containing the B55a regulatory subunit constitutively interact with ATM in undamaged cells. The interaction of B55a with ATM in unperturbed cells could serve to actively suppress the inherent tendency of ATM molecules to undergo trans-phosphorylation at Serl981. When cells are exposed to IR, the ATM-PP2A complex rapidly dissociates (Goodarzi et al., 2004), allowing accumulation of ATM phosphorylated at Serl981. ATM autophosphorylation at Serl981 results in the formation of catalytically active monomers, which are recruited to the sites of DNA damage through the interaction with MRN complex (MRE11/RAD50/NBS1). Once localized to sites of DNA damage, ATM phosphorylates multiple substrates present at these sites.

Interestingly, ATM mediates the IR-induced dissociation of the B55a subunit from the PP2A AC core dimer, implicating ATM-mediated phosphorylation in the disruption of functional PP2A B55a- containing complexes (Guo et al., 2002). The present results reveal that B55a facilitates the association of ATM with PP2A A and C subunits, suggesting that the dissociation of B55a from the PP2A core AC dimer induces dissociation of ATM from PP2A in response to IR. Taken together, these data suggest the existence of a negative-feedback loop between B55a and ATM.

The phosphatase Wipl also directly dephosphorylates ATM at Serl981. However, in contrast to PP2A subunit B55a, Wipl expression is low in undamaged cells, and depletion of Wipl does not affect the level of phosphorylated ATM under normal conditions (Shreeram et al., 2006a; Shreeram et al., 2006b). IR induces p53-dependent Wipl upregulation, which reaches a plateau 4-6 hours after IR (Batchelor et al., 2008; Zhang et al., 2009). Moreover, IR does not affect the ability of Wipl to interact with ATM (Shreeram et al., 2006a; Shreeram et al., 2006b). In addition to ATM, Wipl also dephosphorylates and inactivates a number of proteins involved in the DNA damage response, including ATM, CHK1, CHK2, p53, and MDM2 (Le Guezennec and Bulavin, 2009). This suggests that Wipl is responsible for shutting down ATM signaling once DNA has been repaired, whereas the negative-feedback loop between B55a and ATM may be essential not only to keep ATM in inactive state under normal conditions but also to timely regulate ATM activity in response to DNA damage. Dysregulation of B55a expression results in accumulation of ATM phosphorylated at Serl981 and prolonged activation of CHK2 kinase, which induces Gl/S cell arrest and switches the DNA repair balance towards NHEJ. Consistent with our observations, ATM can contribute to DSB rejoining by either NHEJ or HR, depending on cell cycle phase (Beucher et al., 2009). ATM is required for a subset of DNA DSB repair that occurs with slow kinetics by NHEJ in G0/G1 phase and HR in G2 (Beucher et al., 2009). Moreover, the ATM-dependent component of DSB repair accounts only for 15-20% of IR- induced DSBs (Fernandez-Capetillo and Nussenzweig, 2008; Goodarzi et al., 2008), explaining why there was only a minor increase of γΗ2ΑΧ after suppression of B55a. Loss of B55a results in inhibition of the high-fidelity H repair that could lead to increased genomic instability and higher susceptibility to cancer development. In fact, we found that B55a is commonly downregulated in human cancer samples, particularly in NSCLCs, implicating B55a in tumor suppression. Moreover, defects in HR DNA repair in B55a-deficient cells lead to exquisite sensitivity of these cells to PARP inhibition. The synthetic lethality of PARP inhibitors has been validated in clinical studies that show striking activity of PARP inhibitors in BRCA1- or BRCA2-mutant breast cancer and sporadic ovarian tumors (Rouleau et al., 2010). Our data indicate that the PPP2R2A (B55a) LOH or decreased B55a expression that is observed in about 40% of lung carcinomas could serve as a novel predictive marker in BRCA-proficient NSCLCs for the efficiency of treatment with PARP inhibitors. In summary, these results revealed that dysregulation of PP2A B55a-specific complexes induces ATM hyperactivation, which triggers Gl/S cell cycle arrest, switches the DNA repair balance towards NHEJ, and impairs the efficiency of DSB DNA repair. These observations further challenge the view that protein phosphatases serve only as negative regulators of DNA repair. Instead, our data suggest that tight regulation of phosphorylation events during DNA repair by specific protein phosphatases is required for timely DSB DNA repair.

Example 7. B55ct interacts with PHD2

Interestingly, in a parallel project, B55a was also identified as an interactor of PHD2. The complex role of PHD2 in cancer development has been highlighted by several papers describing different functions of PHD2 in different cells or tumor context [Chan and Giaccia, 2010; Bordoli et al., 2011; Lee et al., 2008].

To identify alternative regulators and substrates of PHD2, we have used a mass spectrometric approach. Of the interacting proteins found, B55a was further evaluated in view of its role in cell homeostasis.

First, we validated the interaction between PHD2 and B55a by performing co-immunoprecipitation experiments in HEK-293T cells by introducing plasmids carrying Phd2 and B55a sequence, respectively. When we expressed PHD2 alone or with B55a, we clearly detected the presence of PHD2 in the B55a immunoprecipitates, and we were able to see PHD2 in endogenous B55a immunoprecipitates as well (Fig.8A). Immunoprecipitations with anti-V5 antibodies on the same whole cell extracts have been performed as negative control. The absence of PHD2 in these samples, compared to IP anti-B55a, indicates the specificity of anti-B55a antibody (Fig.8A).

Since PHD2 shares some important functions and structural homology with PHD1 and PHD3, we wondered if B55a was also able to bind the other two members of the PHD family. To answer this question we co-expressed B55a with FLAG-tagged PHD1, PHD2 and PHD3. The result of anti-FLAG immunoprecipitations showed that B55a was able to specifically bind PHD2, whereas, much less B55a protein levels were present in FLAG-tagged PHD1 and PHD3 immunoprecipitates (Fig.8B). Non-tagged PHD1, PHD2 and PHD3 were cotransfected with B55a as negative controls for aspecific binding.

We also observed the presence of the PP2A catalytic subunit (PP2A/Ca) in complex with PHD2 (Fig. 8B), suggesting that B55a forms a bridge between PP2A/Ca and PHD2.

Example 8. PHD2 degrades B55ct through a proteasomal pathway

The main function of PHD2 is the hydroxylation of conserved proline residues present in the alpha subunit of HIF-1 dimer. Therefore, we wondered if PHD2 was able to degrade B55a, since interaction between the two could be demonstrated (Example 7).

For this purpose, HEK-293T cells were transfected with B55a alone or in presence of PHD2. Western blot analysis from protein whole extracts showed a strong degradation of exogenous B55a upon overexpression of PHD2 compared to B55a alone (Fig.9A, left), while PHD1 and PHD3 overexpression did not affect B55a protein levels (Fig. 9A, right). This result interestingly suggests that B55a could represent a new specific substrate of PHD2. To further understand this regulation, we checked if the enzymatic activity of PHD2 is required to induce the B55a degradation.

To address this, we used dimethyloxaloylglycine (DMOG), a pan-hydroxylase inhibitor. The degradation of exogenous B55a was completely rescued by increased doses of DMOG (Fig. 9B, left), indicating that PHD2 hydroxylation activity is required to reduce B55a protein levels. Importantly, we observed that high doses of PHD2 were able to degrade also the endogenous B55a and this effect was again rescued by DMOG treatment (Fig. 9B, right).

Under normoxic conditions, PHDs hydroxylate HIF-a and prolyl hydroxylation leads to the binding of the von Hippel-Lindau protein (VHL), which interacts with Elongin C and thereby recruits an ubiquitin ligase complex promoting the ubiquitination and subsequent proteasomal degradation of HIF-a [Kaelin and atcliffe, 2008].

In accordance with the canonical function of PHDs in the hydroxylation of theirs substrates to target them for proteasomal degradation, we found that in HEK-293T cells overexpressing PHD2, the degradation of exogenous B55a was completely rescued by the proteasome inhibitor MG132 (Fig. 9C, left). MG132 treatment mimicked the effect of DMOG, since in both cases there was a strong rescue of exogenous B55a degradation (Fig. 9B and 9C), suggesting that PHD2 is able to trigger B55a hydroxylation and promotes its degradation via a proteasomal pathway.

Furthermore, we confirmed these results on endogenous B55a where the degradation induced by overexpressed PHD2 was rescued by both DMOG and MG132 treatments (Fig. 9C, right). Importantly, the two drugs did not show a synergic effect in the stabilization of B55a protein levels, providing strong support to the hypothesis that the hydroxylation is required to target for proteasomal degradation (Fig. 9C, right).

In addition, to directly compare the B55a regulation through PHD2 in tumor cells, we silenced Phd2 in three different human tumor cell lines, such as MDA-MB231 (breast cancer cell line), DLD-1 (adenocarcinoma cell line) and MCF-7 (breast cancer cell line). In all of these, we found that knockdown of Phd2 increased B55a protein stabilization, confirming the findings from HEK-293T cells (Fig. 9D).

To further corroborate these findings, mass spectrometry analysis was undertaken to identify whether PHD2 effectively hydroxylates B55a. This analysis revealed that hydroxylation took place on three proline residues in B55a: P159, P236, and P319. To assess their functional role, these proline residues were mutated to alanines, both as single, double and triple mutants. HEK 293 cells have been transfected with B55 WT or B55 P159A, P236A, P319A alone or together with PHD2. As shown in Fig. 10A, in presence of PHD2, B55 WT is still degraded while the proline mutants P159A and P236A are almost completely resistant to the degradation. Mutant P319A on the other hand is still degraded, though with less efficiency than WT B55a.

The same experiment was performed for B55 protein mutants with a combination of double or triple mutations in prolines 159, 236, and 319 (Fig. 10B). As shown in the quantitative graphs (Fig. IOC), the proteins with combination of proline mutations show less protein degradation and higher B55a levels than the WT B55a. The triple proline mutant appears even insensitive to the presence of PHD2. Overall, this result indicates that hydroxylation in prolines drives the PHD2 mediated degradation of B55a.

Taken together, these data indicate that PHD2 downregulates B55a protein levels also in human tumor cells, highlighting a new hub in the PHD2 functional machinery. Example 9. Β55 contributes to HIF-la stabilization

To further validate our preliminary data in other cell lines, we performed an overexpression experiment in both normoxia and hypoxia by transfecting B55a and Phd2, or control plasmid, into the DLD1 cell line. We confirmed that PHD2 can degrade endogenous B55a in both normoxia and hypoxia (Fig. 11A). Surprisingly, this experiment revealed an increase of HIF-la protein levels upon B55a overexpression in hypoxia, compared to control, whereas PHD2 overexpression resulted in decreased HIF-la protein levels (Fig. 11A). Therefore, we hypothesized the existence of a reciprocal regulation between B55a and PHD2. In particular we wondered if B55a could antagonize the degradation of HIF- la (the main substrate of PHD2) by reducing PHD2 activity, but not its protein stability since we did not find any PHD2 protein level alteration by B55a.

To better validate the role of B55a in the HIF-la protein levels regulation, we performed a loss of function (LOF) experiment by using lentiviral vectors carrying a sequence encoding short hairpin RNA (shRNA) targeting B55a (shB55a) or control sequence (shCTT?). The shB55a construct reduced protein levels of B55a by 75% on average (not shown). In these conditions, we detected again the positive correlation between B55a and HIF-la protein levels in hypoxia (Fig. 11B, right). Moreover, we could appreciate the endogenous B55a protein stabilization in hypoxia (Fig. 11B, left), corroborating the results from DMOG experiments.

Since B55a seems to play a role in the regulation of HIF-la protein levels, we assessed if this action was also functionally relevant and thus we analyzed the effect of B55a downregulation on HIF activity. To this purpose, we introduced a plasmid carrying HIF consensus sites, HRE (H IF responsive elements), in front of a luciferase reporter into cells treated with DMOG or vehicle, to measure HIF transcriptional activity.

In presence of DMOG, the activity of this reporter was clearly reduced into cells with shB55a, whereas we saw the opposite effect into cells silenced for Phd2 (shPhd2). (Fig. 11B, right)

These data highlight the influence of B55a on HIF activity, but do not demonstrate if this effect is PHD2 dependent. In order to assess this possibility, we silenced endogenous B55a and Phd2, respectively, or both into DLD1 cell line. The result from this experiment confirmed again the positive regulation of B55a on HIF-la protein levels, but interestingly, the double silencing (shB55a/shPhd2) rescued HIF-la downregulation by shB55a in normoxia, suggesting that B55a induces HIF-la protein stabilization in PHD2 dependent manner (Fig. 11C, left). Furthermore, the luciferase assay showed that PHD2 mediates the linking between B55a and HIF-la activity (Fig. 11C, right).

Finally, we obtained the same findings in others human tumor cell lines, such as HT29 (human colon adenocarcinoma cell line) and A549 (human lung adenocarcinoma cell line). In this case, we used a transient silencing approach by using small interference constructs targeting B55a (siB55a) and Phd2 (siPhd2), respectively, or scramble sequences as control (siCTR).

In both cell lines, we found the decrease of H I F-Ια protein levels upon B55a downregulation and this phenotype was rescued by double silencing (siB55a/siPhd2), further validating the B55a-PH D2-H I F-la axis (Fig. 11D).

Furthermore, we confirmed the endogenous protein stabilization of B55a in hypoxia and the negative PHD2 action on B55a protein levels (Fig. 11D).

Example 10. B55ct inhibits the hydroxylase activity of PHD2

PH D hydroxylation occurs on the fourth position on P402 and P564 in human H I F-Ια (or at similar positions in H I F-2a) within the so-called oxygen-degradation domains (ODDs) [Huang et al., 1998]. The presence of the ODD domain is determining for the function of PH Ds to trigger degradation of their substrates.

Previously, we have shown the negative B55a regulation on PHD2 activity by checking H I F-Ια protein levels. However H I F-la is an important transcriptional factor that could also be regulated in a PH D2 independent manner.

Therefore, to better characterize the functional interaction between B55a and PHD2 activity, we introduced a plasmid carrying a luciferase reporter gene fused to a sequence codifying for the ODD domain (Luc-ODD) into H EK-293T cells. We co-transfected PHD2 with control plasmid or B55a into H EK-293T cells and we assessed the luciferase activity in normoxia and hypoxia.

PH D2 overexpression was a ble to induce a reduction of luciferase activity, strongly rescued upon B55a co-expression (Fig. 12A), independently of the doses of Luc-ODD construct. As control, in hypoxia there was a strong induction of luciferase activity. In these conditions, as expected, PH D2 was less active but still we could appreciate the rescue of its activity by B55a (Fig. 12A).

In addition, we repeated the same experiment in H EK-293T (Fig. 4B, left panel) and DLD1 cell lines (Fig. 4B, right panel) stably expressing a Luc-ODD construct, and we still found the modulation of PH D2 activity in B55a-dependent manner. This result was further corroborated by B55a silencing in DLD1 cell lines, a ble to induce a decrease of Luc-ODD activity (not shown). Interestingly, siRNA inhibition of B55a showed similar downregulation of Luc-ODD activity as observed for PHD2 overexpression (Fig. 12B, middle panel). This downregulation could be reversed by inhibition of PH D2 (Fig. 12B, middle panel). Taken together, these data support our hypothesis, demonstrating a well conserved negative regulation of B55a on PHD2 activity in both normal and tumor cells.

Example 11. Putative regulation sites on PHD2 and B55ct

B55a is a regulatory B subunit of PP2A phosphatase and since B55a seems to inhibit PHD2 activity, we hypothesized that it can antagonize PHD2 phosphorylation. Indeed, since we found a negative B55a regulation on PHD2, we reasoned that this possible phosphorylation keeps PHD2 active whereas it becomes inactive by B55a dephosphorylation. To assess putative phosphorylation sites on PHD2, we used a biochemical approach by setting SDS page and Mass Spectrometry analysis.

To identify the putative hydroxylated residues on B55a, we co-expressed FLAG-B55a with PHD2 or empty vector and in presence of shPhd2 or shCT into HEK-293T cell line. To find phosphorylation sites on PHD2, we introduced a plasmid carrying FLAG-PHD2 with a plasmid expressing B55a or control vector into HEK-293T cells silenced for B55a or for unspecific short hairpin (shCTR). We isolated B55a and PHD2, by immunoprecipitating them with anti-FLAG antibody. Then, we performed a SDS-PAGE and protein bands were visualized by Coomassie blue staining. Each lane was cut and subjected to in-gel digestion with trypsin and the extracted peptides were subjected to mass spectrometry analysis.

This analysis revealed unique residue phosphorylated on PHD2, detectable in presence of shB55a but not in presence of B55a overexpression, such as Serl2, Serl4 and Serl25. (not shown)

Vice versa, we were able to identified hydroxylation sites on B55a as well, and three hydroxylated proline residues (Prol59, Pro236 and Pro319) were detected on B55a in the presence of PHD2 overexpression. (not shown)

Both these analyses were confirmed by mass spectrometry; and mutants in these residues have been generated to demonstrate the role of hydroxylation/phosphorylation, as well as to identify which specific residues are involved in this reciprocal post-translational regulation. Results for hydroxylation of B55a are shown in Fig. 10 and have been discussed in Example 8.

The three relevant serine residues in PHD2 (S12, S14 and S125) have been mutated to alanine (A) or aspartic acid (D). Alanine mutations are phosphorylation deficient, while mutation to aspartic acid mimics the phosphorylated serine residue. HEK 293T cells have been transfected with HIFla alone or in presence of WT or serine-mutated PHD2. As shown in Fig. 13 A, the serine to alanine mutants showed decreased ability to degrade HIF1, confirming the relevance of phosphorylation to improve the enzymatic activity of PHD2. This could be confirmed by ODD luciferase read-out (Fig. 13B), although the difference between the S125A and S125D PHD2 mutant appears smaller. The reason for this (if a real effect) is still under investigation.

In summary, the data shown in Figures 10 and 13 validate the reciprocal regulation between PHD2 and B55a.

Example 12. Biological readout from B55 -PHD2-HIF axis

Biochemical and molecular analysis revealed B55a as a possible PHD2 regulator, directly affecting its activity, leading to an increased HIF-Ια protein levels and activity.

HIF-Ια protein levels are upregulated in many tumor cell lines and it has been shown that PHD2 silencing is able to increase HIF-Ια in many cell lines [Berra et al., 2003].

In line with this, we evaluated the effect of the silencing of phd2 and B55a or both on cellular tumorigenity, by using two biological assays in vitro, such as soft agar assay and focus formation assay. Anchorage independent growth of cells in soft agar is one of the hallmark characteristics of cellular transformation and uncontrolled cell growth, with normal cells typically not capable of growth in semisolid matrices. In this way, using cell growth in 3D, we mimed the in vivo cellular environment.

For this purpose, we assessed the neoplastic growth properties of B55a, Phd2 and Phd2/B55a or control silencing, respectively, in DLDl cell lines. Visible colonies were readily detected in shctr, shPhd2 and shPhd2/B55a, respectively, within 10-15 days, while much less colonies were seen in shB55a cell lines (Fig. 14A). This result suggests that B55a is an oncogenic factor in tumors, promoting a highly unregulated cell growth in a PHD2 dependent manner.

To better characterize the tumorigenic action of the B55a-PHD2 axis in vitro, we used a focus formation assay that is a widely used and well-established biological assay to measure the morphologic and growth transformation, in particular, a loss of density-dependent inhibition of growth.

Therefore, we again compared the effect of the four different phenotypes (shctr, shB55a, shPhd2, shB55a/Phd2) in DLDl cell lines. The foci from control, Phd2 and Phd2/B55a silenced cell lines, respectively, were equivalent in number and size, whereas, we found reduced focus forming activity in DLDl cell lines silenced for B55 (Fig. 14B).

As these experiments showed that the depletion of B55a reduces tumorigenic potential of cancer cells in a PHD2-dependent manner, it was assessed whether B55a has an effect on cell death upon oxygen stress typically observed in tumors. To this end, DLDl cells stably expressing shCTR, shB55, shPHD2 or shB55-PHD2 have been stained with propidium iodide (PI) to analyze cell cycle in normoxia, after 20h of hypoxia (2% 0₂), or after 20h of hypoxia and 5 h of reoxygenation. FACS analysis of PI stained cells showed an increase of apoptotic or necrotic cells in shB55 cells that is rescued by simultaneous depletion of PHD2 (shPHD2-B55), shown in Fig. 15. Thus, by acting on PHD2 activity, B55a reduces cell death after stress induced by hypoxia and reoxygenation. Finally, we checked if the molecular mechanism that we have described in ours ex vivo and in vitro experiments, could affect tumor growth in vivo. To test this, we subcutaneously injected Phd2, B55a and B55a/Phd2 knockdown DLD1 cells or control cells, respectively, into the flank of nude mice. After measuring the tumor growth for 5 weeks, we sacrificed the mice and we assessed the tumor weight. Interestingly, we found that B55a loss decreased tumor growth, compared to control cells whereas tumors expressing sh NA targeting Phd2 or both Phd2 and B55a exhibited wild-type like tumor growth rates (Fig. 16).

These data strongly correlate with the in vitro tumorigenic assays and highlight a new oncogenic role of B55a related to its ability to regulate the PHD2 activity and therefore HIF-Ια protein levels.

Example 13. Selective apoptosis in human breast cancer cells, as opposed to normal human breast epithelial cells, induced by B55alpha knockdown

The human breast epithelial cell line, MCFIOA, and the human breast cancer cell line, MCF7, were plated in 96-well plates at a density of 3000 cells/well. The plates were incubated for 24 hours to allow complete reattachment of the cells. In a next step the cells (MCFIOA and MCF7) were transiently silenced for B55a (siRNA SI02225825 from Qiagen) or scramble (Universal Negative Control 1027280 from Qiagen) using Lipofectamine RnaiMax (invitrogen) according to manifacturer's instructions). Subsequently, proliferation rate was measured at 24hours, 48 hours, 72 hours and 96 hours. After these indicated time points, 50 μΙ of MTT solution (5mg/ml) was added to each well, and the plates were incubated for 1 hour at 37°C. The absorbance of the plates, spectrophotometrically measured at a wavelength of 450 nm, reflects the number of viable cells (or cell proliferation). It is clear from Figure 17 that the proliferation rate of the human breast epithelial cell line (MCFIOA) is not affected by the inhibition of B55alpha in contrast to what is seen with the human breast cancer cell line (MCF7).

References

Ameln AK, Muschter A, Mamlouk S, Kalucka J, Prade I, Franke K, et al. Inhibition of HIF prolyl hydroxylase-2 blocks tumor growth in mice through the antiproliferative activity of TGFbeta. Cancer Res. 2011; 71(9):3306-16.

Arnold, H.K., and Sears, R.C. (2006). Protein phosphatase 2A regulatory subunit B56alpha associates with c-myc and negatively regulates c-myc accumulation. Mol Cell Biol 26, 2832-2844.

Batchelor, E., Loewer, A., Mock, C, and Lahav, G. (2011). Stimulus-dependent dynamics of p53 in single cells. Mol Syst Biol 7, 488.

Batchelor, E., Mock, C.S., Bhan, I., Loewer, A., and Lahav, G. (2008). Recurrent initiation: a mechanism for triggering p53 pulses in response to DNA damage. Mol Cell 30, 277-289. Beroukhim, R., Mermel, C.H., Porter, D., Wei, G., Raychaudhuri, S., Donovan, J., Barretina, J., Boehm, J.S., Dobson, J., Urashima, M et al. (2010). The landscape of somatic copy-number alteration across human cancers. Nature 463, 899-905.

Berra E, Benizri E, Ginouves A. HIF prolyl-hydroxylase 2 is the key oxygen sensor setting low steady- state levels of HIF-lalpha in normoxia. EMBO J. 2003; 22: 4082-90

Beucher, A., Birraux, J., Tchouandong, L., Barton, O., Shibata, A., Conrad, S., Goodarzi, A.A., Krempler, A., Jeggo, P.A., and Lobrich, M. (2009). ATM and Artemis promote homologous recombination of radiation-induced DNA double-strand breaks in G2. EMBO J 28, 3413-3427.

Bordoli MR, Stiehl DP, Borsig L, Kristiansen G, Hausladen S, Schraml P, et al. Prolyl-4-hydroxylase PHD2- and hypoxia-inducible factor 2-dependent regulation of amphiregulin contributes to breast tumorigenesis. Oncogene. 2011; 30(5):548-60. Chan DA, Giaccia AJ. PHD2 in tumour angiogenesis. Br J Cancer. 2010;103(l):l-5.

Chan DA, Kawahara TL, Sutphin PD, Chang HY, Chi JT, Giaccia AJ. Tumor vasculature is regulated by PHD2-mediated angiogenesis and bone marrow-derived cell recruitment. Cancer Cell. 2009,15(6):527- 38.

Chan DA, Sutphin PD, Yen SE, Giaccia AJ. Coordinate regulation of the oxygen-dependent degradation domains of hypoxia-inducible factor 1 a. Mol Cell Biol. 2005;25:6415-26

Chowdhury, D., Keogh, M.C., Ishii, H., Peterson, C.L., Buratowski, S., and Lieberman, J. (2005). gamma- H2AX dephosphorylation by protein phosphatase 2A facilitates DNA double-strand break repair. Mol Cell 20, 801-809.

Ciccia, A., and Elledge, S.J. (2010). The DNA damage response: making it safe to play with knives. Mol Cell 40, 179-204. De Bock K, Mazzone M, Carmeliet P. Antiangiogenic therapy, hypoxia, and metastasis: risky liaisons, or not? Nat Rev Clin Oncol 2011. 8(7): 393-404. Eichhorn PJ., Creyghton MP., Bernards R.. Protein phosphatase 2A regulatory subunits and cancer. Biochim BiophysActa. 2009;1795(1):1-15.

Epstein AC, Gleadle JM, McNeill LA, Hewitson KS, O'Rourke J, Mole DR et al. C. elegans EGL-9 and mammalian homologs define a family of dioxygenases that regulate HIF by prolyl hydroxylation. Cell 2001. 107(1): 43-54.

Evans, D.R., Myles, T., Hofsteenge, J., and Hemmings, B.A. (1999). Functional expression of human PP2Ac in yeast permits the identification of novel C-terminal and dominant-negative mutant forms. J Biol Chem 274, 24038-24046.

Falck, J., Mailand, N., Syljuasen, R.G., Bartek, J., and Lukas, J. (2001). The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis. Nature 410, 842-847.

Fernandez-Capetillo, O., and Nussenzweig, A. (2008). ATM breaks into heterochromatin. Mol Cell 31, 303-304.

Fong GH, Takeda K. Role and regulation of prolyl hydroxylase domain proteins. Cell Death Differ. 2008;15(4):635-41. Freeman, A.K., and Monteiro, A.N. (2010). Phosphatases in the cellular response to DNA damage. Cell Commun Signal 8, 27.

Ginouves A, lie K, Macias N, Pouyssegur J, Berra E. PHDs overactivation during chronic hypoxia "desensitizes" HIFalpha and protects cells from necrosis. Proc Natl Acad Sci U S A. 2008;105 (12):

4745-50.

Goodarzi, A.A., Jonnalagadda, J.C., Douglas, P., Young, D., Ye, R., Moorhead, G.B., Lees-Miller, S.P., and Khanna, K.K. (2004). Autophosphorylation of ataxia-telangiectasia mutated is regulated by protein phosphatase 2A. Embo J 23, 4451-4461.

Goodarzi, A.A., Noon, AT., Deckbar, D., Ziv, Y., Shiloh, Y., Lobrich, M., and Jeggo, P.A. (2008). ATM signaling facilitates repair of DNA double-strand breaks associated with heterochromatin. Mol Cell 31, 167-177. Gotz, J., Probst, A., Ehler, E., Hemmings, B., and Kues, W. (1998). Delayed embryonic lethality in mice lacking protein phosphatase 2A catalytic subunit Calpha. Proc Natl Acad Sci U S A 95, 12370-12375.

Guo, C.Y., Brautigan, D.L., and Larner, J.M. (2002). ATM-dependent dissociation of B55 regulatory subunit from nuclear PP2A in response to ionizing radiation. J Biol Chem 277, 4839-4844. Holthausen, J.T., Wyman, C, and Kanaar, R. (2010). Regulation of DNA strand exchange in homologous recombination. DNA Repair (Amst) 9, 1264-1272.

Huang J, Zhao Q, Mooney SM, Lee FS. Sequence determinants in hypoxia-inducible factor-lalpha for hydroxylation by the prolyl hydroxylases PHD1, PHD2, and PHD3. J Biol Chem. 2002;277(42):39792- 800.

Huang LE, Gu J, Schau M, Bunn HF. Regulation of hypoxia-inducible factor lalpha is mediated by an 02- dependent degradation domain via the ubiquitin-proteasome pathway. Proc Natl Acad Sci U S A. 1998; 95(14):7987-92.

Jang, Y.J., Ji, J.H., Choi, Y.C., Ryu, C.J., and Ko, S.Y. (2007). Regulation of Polo-like kinase 1 by DNA damage in mitosis. Inhibition of mitotic PLK-1 by protein phosphatase 2A. J Biol Chem 282, 2473-2482. Janssens, V., and Goris, J. (2001). Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J 353, 417-439.

Kaelin WG Jr, Ratcliffe PJ. Oxygen sensing by metazoans: the central role of the HIF hydroxylase pathway. Mol Cell. 2008; 30: 393-402.

Lankoff, A., Bialczyk, J., Dziga, D., Carmichael, W.W., Gradzka, I., Lisowska, H., Kuszewski, T., Gozdz, S., Piorun, I., and Wojcik, A. (2006). The repair of gamma-radiation-induced DNA damage is inhibited by microcystin-LR, the PP1 and PP2A phosphatase inhibitor. Mutagenesis 21, 83-90. Le Guezennec, X., and Bulavin, D.V. WIP1 phosphatase at the crossroads of cancer and aging. Trends Biochem Sci 35, 109-114.

Lee KA, Lynd JD, O'Reilly S, Kiupel M, McCormick JJ, LaPres JJ. The biphasic role of the hypoxia-inducible factor prolyl-4-hydroxylase, PHD2, in modulating tumor-forming potential. Mol Cancer Res. 2008; 6(5):829-42.

Leite de Oliveira R., Deschoemaeker S., Henze A., Debackere K., Finisguerra V., Takeda Y., Roncal C, Dettori D., Tack E, Jonsson Y., Veschini L., Peeters A., Anisimov A., Hofmann M., Alitalo K., Baes M., D'hooge J., Carmeliet P. & Mazzone M. Gene targeting of phd2 improves tumor response to chemotherapy and prevents side-toxicity. Cancer Cell. 22(2):263-77.

Lieber, M.R. (2010). The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway. Annu Rev Biochem 79, 181-211. Lu, J., Kovach, J.S., Johnson, F., Chiang, J., Hodes, R., Lonser, R., and Zhuang, Z. (2009). Inhibition of serine/threonine phosphatase PP2A enhances cancer chemotherapy by blocking DNA damage induced defense mechanisms. Proc Natl Acad Sci U S A 106, 11697-11702. Marxsen JH, Stengel P, Doege K, Heikkinen P, Jokilehto T, Wagner T, Jelkmann W, Jaakkola P, Metzen E. Hypoxia-inducible factor-1 (HIF-1) promotes its degradation by induction of HIF-alpha-prolyl-4- hydroxylases. Biochem J. 2004 ;381(Pt 3):761-7. Mazzone M, Dettori D, Leite de Oliveira R, Loges S, Schmidt T, Jonckx B, et al. Heterozygous deficiency of PHD2 restores tumor oxygenation and inhibits metastasis via endothelial normalization. Cell. 2009; 136(5):839-51.

Moffat, J., Grueneberg, D.A., Yang, X., Kim, S.Y., Kloepfer, A.M., Hinkle, G., Piqani, B., Eisenhaure, T.M., Luo, B., Grenier, J.K., et al. (2006). A Lentiviral RNAi Library for Human and Mouse Genes Applied to an Arrayed Viral High-Content Screen. Cell 124, 1283-1298.

Pan Y, Mansfield KD, Bertozzi CC, Rudenko V, Chan DA, Giaccia AJ, Simon MC. Multiple factors affecting cellular redox status and energy metabolism modulate hypoxia-inducible factor prolyl hydroxylase activity in vivo and in vitro. Mol Cell Biol. 2007;27(3):912-25.

Potente M, Gerhardt H, Carmeliet P. Basic and therapeutic aspects of angiogenesis. Cell 2011. 146(6): 873-87. Rouleau, M., Patel, A., Hendzel, M.J., Kaufmann, S.H., and Poirier, G.G. (2010). PARP inhibition: PARP1 and beyond. Nat Rev Cancer 10, 293-301.

Rudolph, J. (2007). Cdc25 phosphatases: structure, specificity, and mechanism. Biochemistry 46, 3595- 3604.

Sablina, A.A., Hector, M., Colpaert, N., and Hahn, W.C. (2010). Identification of PP2A complexes and pathways involved in cell transformation. Cancer Res 70, 10474-10484.

Semenza GL. Regulation of oxygen homeostasis by hypoxia-inducible factor 1.

Physiology (Bethesda). 2009; 24:97-106.

Shreeram, S., Demidov, O.N., Hee, W.K., Yamaguchi, H., Onishi, N., Kek, C, Timofeev, O.N., Dudgeon, C, Fornace, A.J., Anderson, C.W., et al. (2006a). Wipl phosphatase modulates ATM-dependent signaling pathways. Mol Cell 23, 757-764.

Shreeram, S., Hee, W.K., Demidov, O.N., Kek, C, Yamaguchi, H., Fornace, A.J., Jr., Anderson, C.W., Appella, E., and Bulavin, D.V. (2006b). Regulation of ATM/p53-dependent suppression of myc-induced lymphomas by Wipl phosphatase. J Exp Med 203, 2793-2799. So, S., Davis, A.J., and Chen, D.J. (2009). Autophosphorylation at serine 1981 stabilizes ATM at DNA damage sites. J Cell Biol 187, 977-990.

Stoize IP, Tian YM, Appelhoff RJ, Turley H, Wykoff CC, Gleadle JM, Ratcliffe PJ. Genetic analysis of the role of the asparaginyl hydroxylase factor inhibiting hypoxia-inducible factor (FIH) in regulating hypoxia-inducible factor (HIF) transcriptional target genes. J Biol Chem. 2004 ;279(41):42719-25. Wang, Q., Gao, F., Wang, T., Flagg, T., and Deng, X. (2009). A nonhomologous end-joining pathway is required for protein phosphatase 2A promotion of DNA double-strand break repair. Neoplasia 11, 1012-1021.

Yan, Y., Cao, P.T., Greer, P.M., Nagengast, E.S., Kolb, R.H., Mumby, M.C., and Cowan, K.H. (2010). Protein phosphatase 2A has an essential role in the activation of gamma-irradiation-induced G2/M checkpoint response. Oncogene 29, 4317-4329. Zeng, Y., Forbes, K.C., Wu, Z., Moreno, S., Piwnica-Worms, H., and Enoch, T. (1998). Replication checkpoint requires phosphorylation of the phosphatase Cdc25 by Cdsl or Chkl. Nature 395, 507-510.

Zhang, X., Lin, L, Guo, H., Yang, J., Jones, S.N., Jochemsen, A., and Lu, X. (2009). Phosphorylation and degradation of MdmX is inhibited by Wipl phosphatase in the DNA damage response. Cancer Res 69, 7960-7968.

Claims

1. A method of diagnosing sensitivity of cells to treatment with an inhibitor of a DNA base excision repair enzyme, comprising determining the presence or amount of a gene encoding a PP2A subunit or its gene product in said cells.

2. The method according to claim 1, wherein the cells are tumour cells, more particularly cells of an epithelial tumour.

3. The method according to claim 2, wherein the epithelial tumour is selected from the group of lung cancer, breast cancer, colorectal cancer, renal cancer, hepatocellular cancer, prostate cancer, ovarian cancer and thyroid gland cancer .

4. The method according to any one of claims 1 to 3, wherein the inhibitor of a DNA base excision repair enzyme is a PA P inhibitor.

5. The method according to any one of claims 1 to 4, wherein the PP2A subunit is selected from B55a,

Β55δ, B56a, G5PR and Cot, more particularly from Β55α, Β55δ, B56a, and G5PR, even more particularly from B55a and Β55δ, most particularly it is B55a.

6. The method according to any one of claims 1 to 5, wherein the absence of or a decrease in the amount of a gene encoding a PP2A subunit or its gene product is indicative for increased sensitivity to the treatment.

7. The method according to any one of claims 1 to 6, wherein the cells are cells obtained from a subject, and the diagnosis of sensitivity is used in guiding treatment of the subject or in stratifying or classifying the subject for a clinical trial.

8. An inhibitor of the PP2A B55a subunit for use as a medicament.

9. An inhibitor of the PP2A B55a subunit for use in the treatment of cancer.

10. The inhibitor according to claim 8 or 9, wherein the inhibitor of the PP2A B55a subunit reduces enzyme activity with at least 75%.

11. The inhibitor according to any one of claims 8 to 10, which selectively induces apoptosis and/or cell growth arrest in cancer cells.

12. An inhibitor of a PP2A subunit for use in the treatment of cancer, particularly DNA base excision repair-deficient cancer.

13. A combination of an inhibitor of a DNA base excision repair enzyme with an inhibitor of a PP2A subunit for use in the treatment of cancer.

14. The inhibitor of any one of claims 8 to 12 or combination of claim 13, wherein the inhibitor of a PP2A subunit is inhibitory RNA directed against the PP2A subunit.

15. The combination of claim 13 or 14, wherein the inhibitor of a DNA base excision repair enzyme is a PARP inhibitor.

16. A method of treating cancer, comprising administering an inhibitor of a PP2A subunit to a subject in need thereof.

17. The method of claim 16, wherein the inhibitor of a PP2A subunit is an inhibitor of the PP2A B55a subunit.

18. The method of claim 16 or 17, wherein the inhibitor is administered to, or is targeted to, cancer cells.

19. The method of any one of claims 16 to 18, further comprising administering an inhibitor of a DNA base excision repair enzyme.

20. A method of screening for an inhibitor of the PP2A B55a subunit, comprising: i) providing a cell based assay or an in vitro assay wherein a biological substrate of PP2A B55 alpha is present, ii) applying compounds to said cell based assay or said in vitro assay wherein a compound is identified as an inhibitor if it modifies the phosphorylation of said PP2A B55alpha biological substrate in said cell based assay or in said in vitro assay wherein the same compound does not interfere with the hydroxylation activity of PHD2.

21. A method of diagnosing sensitivity of a subject with cancer to treatment with an inhibitor of a DNA base excision repair enzyme, comprising the steps of:

Optionally obtaining a sample of cancer cells from the subject;

determining the presence or amount of a gene encoding a PP2A subunit or its gene product in a sample of cancer cells obtained from the subject; and

22. The method of claim 21, further comprising a step of: treating the patient with an inhibitor of a DNA base excision repair enzyme if the patient is sensitive to such treatment.