WO2013118857A1 - Antisense oligonucleotide for acsl1 - Google Patents

Abstract

It is found that an antisense oligonucleotide comprising a sequence complementary to a sequence lying between position-95 and position-109, position-176 and position-192, position-467 and position-484, position-940 and position-954, position-1017 and position-1032, position-1102 and position-1116, position-1176 and position-1197, position-1222 and position-1236, position-1727 and position-1743, position-1858 and position-1873, position-1946 and position-1960, position-2294 and position-2308, position-2360 and position-2377, position-2449 and position-2469, position-2605 and position-2624, position-2689 and position-2703, position-2950 and position-2964, position-3424 and position-3438 or position-3591 and position-3605 in the sequence represented by SEQ ID NO: 2 has an excellent inhibitory activity on the expression of ACSL1. A pharmaceutical composition containing the antisense oligonucleotide for ACSL1 according to the present invention as an active ingredient is useful for the prevention or treatment of obesity or type-II diabetes.

Description

Antisense oligonucleotide to ACSL1

The present invention relates to an antisense oligonucleotide to ACSL1 (acyl-CoA synthetase long-chain family member 1). More specifically, the present invention relates to an antisense oligonucleotide against ACSL1 useful as a preventive or therapeutic agent (including a pharmaceutical composition for weight management) for obesity or diabetes (particularly type II diabetes).

Obesity is a systemic increase in adipose tissue and occurs when the amount of energy consumed over a long period is greater than the amount of energy consumed. Obesity can be classified into visceral fat obesity and the subcutaneous fat type obesity. Visceral fat-type obesity is obesity in which the accumulation of intra-abdominal fat existing around the omentum and mesentery increases, and diabetes (particularly type II diabetes with insulin resistance), arteriosclerosis, liver disease, heart It is one of the culprit that causes the disease, etc., has become a major problem in modern society.

Diabetes mellitus is a disease accompanied by a persistent hyperglycemic state, and is considered to result from the action of many environmental factors and genetic factors. The main regulator of blood sugar in the body is insulin, and hyperglycemia is caused by insulin deficiency or excessive factors that inhibit its action (eg, genetic predisposition, lack of exercise, obesity, stress, etc.) . There are mainly two types of diabetes, which are caused by type I diabetes caused by a decrease in pancreatic insulin secretion function due to autoimmune diseases and the like and a decrease in pancreatic insulin secretion function due to pancreatic exhaustion associated with continuous high insulin secretion II Classified as type 2 diabetes. More than 95% of Japanese diabetic patients are said to have type II diabetes, and today, the increase in the number of patients accompanying lifestyle changes is a problem.

Enzymes belonging to the acyl-CoA synthase family (hereinafter abbreviated as ACS) are enzymes that convert long-chain fatty acids into acyl CoA. Since acyl-CoA is a substrate in intracellular lipid synthesis and fatty acid degradation or elongation reactions, ACS plays a central role in intracellular lipid metabolism as well as intracellular signaling by lipids. The ACS is also involved in the uptake of fat outside fatty acids (see Non-Patent Document 1).

As for ACS, five isozymes (ACS1, 3, 4, 5, 6) having different substrate selectivity and subcellular localization have been identified so far (see Non-Patent Document 2). ACSL1 (GenBank: NM_001995), one of the enzymes belonging to this family, is mainly expressed in the liver and adipose tissue and catalyzes the synthesis of triglyceride (TG). It is known that ACSL4 and ACSL5 are mainly expressed in the liver, and ACSL3 and ACSL6 are mainly expressed in the brain.

Triacsin C is known as an inhibitor of ACS, and this compound has been reported to inhibit 1, 3 and 4 of 5 isozymes (see Non-Patent Document 3). In addition to this compound, in addition to inhibiting TG accumulation in HuH7 cells, which are human hepatoma cell lines (see Non-Patent Document 4), and diacylglycerol, cholesterol esters, phospholipids in CCD cells, which are human normal dermal fibroblasts. It has been reported to inhibit synthesis (see Non-Patent Document 5).

ACSL1 has been reported to be associated with various cancers (see, for example, Patent Documents 1 to 3), and as a biomarker for cirrhosis, liver fibrosis (see Patent Document 4), and bronchial asthma (see Patent Document 5). It has also been reported.

Patent Document 6 discloses that suppression of hepatic ACSL1 expression by siRNA suppresses increase in body weight and lowers blood glucose level, and ACSL1 expression inhibitor is used for obesity or type II diabetes. It has been suggested that it can be used for treatment or prevention.

Patent Document 7 discloses an antisense compound targeting ACSL1. In the specification, 3615 antisense oligonucleotides are described, but only predictive values regarding affinity with a target region are described, and data regarding suppression of ACSL1 expression is not described.

International Publication No. 07/010628 International Publication No. 07/117038 International Publication No. 03/3004989 JP 2007-252366 A JP 2004-121218 A International Publication No. 2010/0779819 International Publication No. 04/016749

An object of the present invention is to provide a novel antisense oligonucleotide having excellent ACSL1 expression suppression activity.

As a result of intensive studies, the present inventors have succeeded in synthesizing a novel antisense oligonucleotide having excellent ACSL1 expression suppression activity (knockdown activity). Furthermore, the present inventors have found a target region related to the knockdown activity of an antisense oligonucleotide, particularly in the mRNA of ACSL1. Patent Document 7 describes an antisense oligonucleotide for ACSL1 of 3,615, but only describes a predicted value for affinity with a target region, and does not describe data regarding suppression of ACSL1 expression. It is common knowledge that antisense with high affinity does not necessarily have a high inhibitory action on target gene expression (Antisense Drug Technology Principles, Strategies, and Applications, CRC Press; 2nd edition, 2007-122, p. , FIG. 5.3a). Therefore, from the description in Patent Document 7, it cannot be predicted which region of ACSL1 mRNA is useful as the target region of the antisense oligonucleotide. The antisense oligonucleotide of the present invention binds to a specific target region found by the present inventors and exhibits excellent ACSL1 expression suppression activity.
Further, the present inventors have found that the antisense oligonucleotide of the present invention does not have an expression suppressing action on other isozymes (ACSL3 and ACSL5) but has an ACSL1-specific expression suppressing action. Thus, an antisense oligonucleotide with high specificity for a target sequence is useful as a medicine.
Moreover, the antisense oligonucleotide of the present invention has good metabolic stability and water solubility, low toxicity, and is sufficiently safe for use as a medicine.

That is, the present invention relates to the following.
(1) 95 to 109, 176 to 192, 467 to 484, 940 to 954, 1017 to 1032, 1102 to 1116, 1176 of SEQ ID NO: 1 under stringent conditions # 1-1197, 1222-1236, 1727-1743, 1858-1873, 1946-1960, 2294-2308, 2360-2377, 2449-2469, 2605- An antisense oligonucleotide comprising a sequence capable of hybridizing to the sequence consisting of positions 2624, 2689 to 2703, 2950 to 2964, 3424 to 3438, or 3591 to 3605.
(2) The antisense oligonucleotide according to (1), which suppresses the expression of ACSL1.
(3) The antisense oligonucleotide according to (1) or (2), which is 13 to 19 bases in length.
(4) The antisense oligonucleotide according to any one of (1) to (3), which contains at least one sugar-modified nucleoside having a cross-linked structure between the 4′-position and the 2′-position.
(5) The antisense oligonucleotide according to (4), wherein the crosslinked structure is —CH ₂ —O— or —CO—NR ¹ — (R ¹ is a hydrogen atom or alkyl).
(6) Sequence number 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70, or ,
1 or number in the sequences of SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70 The antisense oligonucleotide according to any one of (1) to (5), comprising a sequence in which one base is deleted, inserted or substituted.
(7) SEQ ID NO: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70, or ,
1 or number in the sequences of SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70 The antisense oligonucleotide according to (6), comprising a sequence in which one base is deleted, substituted, inserted or added.
(8) A pharmaceutical composition comprising the antisense oligonucleotide according to any one of (1) to (7).
(9) The pharmaceutical composition according to (8), which is used for prevention or treatment of a disease associated with ACSL1.
(10) The pharmaceutical composition according to (9), wherein the disease is obesity or type II diabetes.
(11) A method for preventing or treating a disease associated with ACSL1, which comprises administering the antisense oligonucleotide according to any one of (1) to (7).
(12) The prevention or treatment method according to (11), wherein the disease is obesity or type II diabetes.
(13) Use of the antisense oligonucleotide according to any one of (1) to (7) for producing a preventive or therapeutic agent for a disease associated with ACSL1.
(14) Use of the antisense oligonucleotide according to (13), wherein the disease is obesity or type II diabetes.
(15) The antisense oligonucleotide according to any one of (1) to (7), for preventing or treating a disease associated with ACSL1.
(16) The antisense oligonucleotide according to (15), wherein the disease is obesity or type II diabetes.

The antisense oligonucleotide of the present invention exhibits excellent ACSL1 expression-suppressing activity, and is associated with drugs, particularly diseases involving ACSL1, such as obesity, obesity-related diseases, diabetes (particularly type II diabetes), syndrome X, cardiovascular disorders Or it is very useful as a medicine (including a weight management medicine) for preventing or treating cancer (breast cancer, colon cancer, colon cancer, ovarian cancer, lung cancer, etc.).

Knockdown efficiency of antisense oligonucleotides (5 nM and 20 nM) introduced into cells using LipofectamineｍｉｎLTX reagent in HepG2 cells of the antisense oligonucleotide of the present invention Knockdown effect on ACSL1 proteins in HepG2 cells of the antisense oligonucleotides of the present invention Results of evaluation of cross-reactivity to ACSL3 and ACSL5 in HepG2 cells of the antisense oligonucleotide of the present invention Knockdown effect on ACSL1 protein after single administration of the antisense oligonucleotide of the present invention (AON numbers 197 and 203) in vivo Knockdown effect on ACSL1 protein when the antisense oligonucleotide of the present invention (AON numbers 196 and 203) is administered once in vivo Knockdown effect on ACSL1 protein when the antisense oligonucleotide of the present invention (AON No. 203) is repeatedly administered in vivo Changes in body weight when the antisense oligonucleotide of the present invention (AON No. 203) is repeatedly administered in vivo

The terms used in the present specification are used in the meaning normally used in the art unless otherwise specified.
In the present invention, a genetic manipulation method known in the art can be used. For example, Molecular Cloning, A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press (2001), Current Protocols in Molecular Biology, Jon.
The present invention is described in detail below.

An “antisense oligonucleotide” (AON) is an oligonucleotide complementary to a target gene mRNA, mRNA precursor or ncRNA, and is composed of single-stranded DNA, RNA and / or analogs thereof. The The function of mRNA, mRNA precursor or ncRNA is suppressed by forming a double strand with the mRNA, mRNA precursor or ncRNA targeted by the antisense oligonucleotide. “Antisense oligonucleotides” include not only those that are completely complementary to the target mRNA, mRNA precursor or ncRNA, but also those that can hybridize to the mRNA, mRNA precursor or ncRNA under stringent conditions. Or it includes those with several mismatches.
An oligonucleotide means a nucleotide in which a plurality of identical or different nucleosides are bound. “Nucleoside” means a compound in which a nucleobase and a sugar form an N-glycoside bond. “Nucleotide” means a compound in which a phosphate group is bonded to a nucleoside sugar.
An analog of DNA or RNA means a molecule having a structure similar to DNA or RNA. For example, peptide nucleic acid (PNA) etc. are mentioned.
ncRNA (non-coding RNA) is a general term for RNA that functions without being translated into protein. For example, ribosomal RNA, transfer RNA, miRNA and the like can be mentioned.
One or several mismatches means 1 to 5, preferably 1 to 3, more preferably 1 or 2 mismatches.

ACSL1 is mentioned as a target gene of the antisense oligonucleotide of the present invention. For example, human ACSL1, although mouse ACSL1 like, without limitation.

“ACSL1” is a known protein. The DNA sequence of human ACSL1 (GenBank: NM — 001995) is described in SEQ ID NO: 1 in the sequence listing, and the amino acid sequence is described in SEQ ID NO: 2. The DNA sequence of mouse ACSL1 (GenBank: NM — 007981) is described in SEQ ID NO: 3 in the sequence listing, and the amino acid sequence is described in SEQ ID NO: 4. “ACSL1” in the present invention is not limited to these sequences, and as long as the function of the protein of SEQ ID NO: 2 or 4 is maintained, the number of amino acid and DNA mutations and mutation sites are not limited. .

The length of the antisense oligonucleotide of the present invention is 6 to 50 bases. For example, 6 to 30 bases, 6 to 19 bases, 8 to 19 bases, 10 to 19 bases, 13 to 19 bases, 13 bases, 14 bases, 15 bases, 16 bases, 17 bases, 18 bases and 19 bases.

As the “antisense oligonucleotide” of the present invention,
(A) 95 to 109, 176 to 192, 467 to 484, 940 to 954, 1017 to 1032, 1102 to 1116 in the sequence of SEQ ID NO: 1 under stringent conditions 1176th to 1197th, 1222 to 1236th, 1727th to 1743th, 1858th to 1873th, 1946th to 1960th, 2294th to 2308th, 2360th to 2377th, 2449th to 2469th, 2605 An antisense oligonucleotide comprising a sequence capable of hybridizing to the sequence from position 2624, 2689-2703, 2950-2964, 3424-3438 or 3591-3605, or (b) stringent Under the conditions, 183 to 197, 219 to 235, 442 of the sequence of SEQ ID NO: 3. ~ 456, 513 ~ 530, 593 ~ 607, 641 ~ 655, 919 ~ 933, 941 ~ 955, 959 ~ 973, 978 ~ 993, 998 ~ 1013 , 1222 to 1243, 1268 to 1282, 1625 to 1639, 1993 to 2007, 2066 to 2081, 2409 to 2423, 2497 to 2525, 2651 to 2670, An antisense oligonucleotide comprising a sequence capable of hybridizing to the sequence of positions 2585 to 2700, 2738 to 2756, 2764 to 2788, 3331 to 3347, 3503 to 3517, or 3663 to 3684 Is mentioned. Each of the target regions in (a) is a region associated with the knockdown activity of the antisense oligonucleotide, particularly in human ACSL1 mRNA. Each of the target regions in (b) is a region associated with the knockdown activity of the antisense oligonucleotide, particularly in mouse ACSL1 mRNA. Any sequence capable of hybridizing to the target region under stringent conditions is included in the antisense oligonucleotide of the present invention regardless of the length or the presence or absence of nucleotide modification.

ACSL1 expression inhibitory activity (knockdown activity) can be measured by a known method. For example, it can be measured by the method described in Example 5 (1) or (3), Example 6 or Example 7 described later.

As the antisense oligonucleotide of the present invention, more preferably,
(C) Under stringent conditions, it can hybridize to the sequence of SEQ ID NO: 1 at positions 176 to 192, 467 to 484, 1176 to 1197, 2449 to 2469, or 2605 to 2624 An antisense oligonucleotide comprising the sequence: or (d) under the stringent conditions, the sequence of SEQ ID NO: 3 at positions 219 to 235, 513 to 530, 1222 to 1243, 2497 to 2525, Examples include antisense oligonucleotides that include sequences that can hybridize to the sequences of positions 2651 to 2670, 2685 to 2700, 2738 to 2756, 2764 to 2788, or 3663 to 3684.
As the antisense oligonucleotide of the present invention, specifically,
(A) 95 to 109, 176 to 192, 467 to 484, 940 to 954, 1017 to 1032, 1102 to 1116, 1176 to 1197 in the sequence of SEQ ID NO: 1. , 1222 to 1236, 1727 to 1743, 1858 to 1873, 1946 to 1960, 2294 to 2308, 2360 to 2377, 2449 to 2469, 2605 to 2624, 2687 Position-2703, 2950-2964, 3424-3438, or 3591-3605, or (b) the sequence of SEQ ID NO: 3, positions 183-197, 219-235, 442- 456th, 513th to 530th, 593th to 607th, 641st to 655th, 919th to 933th, 941st to 955th, 9th 9th to 973rd, 978th to 993th, 998th to 1013th, 1222 to 1243, 1268th to 1282, 1625th to 1639th, 1993th to 2007th, 2066th to 2081th, 2409th ~ 2423, 2497 ~ 2525, 2651 ~ 2670, 2685 ~ 2700, 2738 ~ 2756, 2764 ~ 2788, 3331 ~ 3347, 3503 ~ 3517, or 3663 ~ 3684 An antisense oligonucleotide having a homology of at least 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95% or more with a complementary sequence of the position sequence. Here, the homology is indicated in the score by using the search program BLAST that uses an algorithm developed by Altschul et al. (The Journal of Molecular Biology, 215, 403-410 (1990)), for example. .
“Stringent conditions” means that only antisense oligonucleotides
(A) 95 to 109, 176 to 192, 467 to 484, 940 to 954, 1017 to 1032, 1102 to 1116, 1176 to 1197 in the sequence of SEQ ID NO: 1. , 1222 to 1236, 1727 to 1743, 1858 to 1873, 1946 to 1960, 2294 to 2308, 2360 to 2377, 2449 to 2469, 2605 to 2624, 2687 Position-2703, 2950-2964, 3424-3438, or 3591-3605, or (b) the sequence of SEQ ID NO: 3, positions 183-197, 219-235, 442- 456th, 513th to 530th, 593th to 607th, 641st to 655th, 919th to 933th, 941st to 955th, 9th 9th to 973rd, 978th to 993th, 998th to 1013th, 1222 to 1243, 1268th to 1282, 1625th to 1639th, 1993th to 2007th, 2066th to 2081th, 2409th ~ 2423, 2497 ~ 2525, 2651 ~ 2670, 2685 ~ 2700, 2738 ~ 2756, 2764 ~ 2788, 3331 ~ 3347, 3503 ~ 3517, or 3663 ~ 3684 A base sequence that forms a hybrid (so-called specific hybrid) with a sequence at a position and does not have an equivalent function means a condition that does not form a hybrid (so-called non-specific hybrid) with the specific sequence. Those skilled in the art can easily select such conditions by changing the temperature during the hybridization reaction and washing, the salt concentration of the hybridization reaction solution and the washing solution, and the like. Specifically, it is 42 ° C. in 6 × SSC (0.9 M NaCl, 0.09 M trisodium citrate) or 6 × SSPE (3 M NaCl, 0, ₂ M NaH ₂ PO ₄ , 20 mM EDTA · 2Na, pH 7.4). Examples of the stringent conditions of the present invention include, but are not limited to, the conditions of hybridization with the above and further washing with 0.5 × SSC at 42 ° C. As a hybridization method, a well-known and commonly used method in this field, for example, a Southern blot hybridization method or the like can be used. Specifically, Molecular Cloning: A Laboratory Manual, Second Edition (1989) (Cold Spring Harbor Laboratory Press), Current Protocol in Amplification in Coal (1994) (Ten-Proc. It can be carried out according to the method described in Second Edition (1995) (Oxford University Press).

As the antisense oligonucleotide of the present invention, for example,
SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70, or
1 or number in the sequences of SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70 An antisense oligonucleotide containing a sequence in which one base has been deleted, substituted or inserted is mentioned. Each of these has human ACSL1 expression inhibitory activity. As long as the sequence is included, it is included in the antisense oligonucleotide of the present invention regardless of the length or nucleotide modification.
Furthermore, as the antisense oligonucleotide of the present invention, for example,
SEQ ID NOs: 6 to 13, 30, 72 to 75, 77 to 80, 82 to 93, 95, 100 to 104, 109, 110, 113, 114, 116 to 127, 129, 131 to 141, 143 to 147, 151, The sequence of 153 to 155 or 156, or SEQ ID NOs: 6 to 13, 30, 72 to 75, 77 to 80, 82 to 93, 95, 100 to 104, 109, 110, 113, 114, 116 to 127, 129, 131 Examples include antisense oligonucleotides containing a sequence in which one or several bases are deleted, substituted, or inserted in the sequence of ˜141, 143 to 147, 151, 153 to 155, or 156. Each of these has mouse ACSL1 expression suppression activity. As long as the sequence is included, it is included in the antisense oligonucleotide of the present invention regardless of the length or nucleotide modification.

As the antisense oligonucleotide of the present invention, specifically,
SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70, or
1 or number in the sequences of SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70 Examples include antisense oligonucleotides consisting of sequences in which one base is deleted, substituted, inserted or added. More preferably,
SEQ ID NOs: 6-11 or 24-28, or
Examples thereof include antisense oligonucleotides consisting of a sequence in which one or several bases are deleted, substituted, inserted or added in the sequences of SEQ ID NOs: 6-11 or 24-28. Each of these has human ACSL1 expression inhibitory activity. As long as it consists of this sequence, it is included in the antisense oligonucleotide of the present invention regardless of the presence or absence of nucleotide modification.
Furthermore, as the antisense oligonucleotide of the present invention, specifically,
SEQ ID NOs: 6 to 13, 30, 72 to 75, 77 to 80, 82 to 93, 95, 100 to 104, 109, 110, 113, 114, 116 to 127, 129, 131 to 141, 143 to 147, 151, A sequence of 153-155 or 156, or
1 or number in the sequences of SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70 Examples include antisense oligonucleotides composed of sequences in which one base is deleted, substituted, inserted or added. Each of these has mouse ACSL1 expression suppression activity. As long as it consists of this sequence, it is included in the antisense oligonucleotide of the present invention regardless of the presence or absence of nucleotide modification.

Note that “one or several bases” means 1 to 5, preferably 1 to 3, and more preferably 1 or 2 bases. Deletion, substitution, insertion or addition is also included in the antisense oligonucleotide of the present invention as long as it has an action of suppressing the expression of the target gene (for example, ACSL1).

The antisense oligonucleotide of the present invention has not only ACSL1 expression-suppressing activity but also usefulness as a medicine, and has any or all of the following excellent features.
a) The inhibitory effect on CYP enzymes (eg, CYP1A2, CYP2C9, CYP2C19, CYP2D6, CYP3A4, etc.) is weak.
b) Good pharmacokinetics such as high bioavailability and moderate clearance.
c) High metabolic stability.
d) Not mutagenic.
e) Low cardiovascular risk.
f) High solubility.
g) Shows ACSL1 specificity.
h) Does not show liver toxicity.

In the antisense oligonucleotide of the present invention, the nucleotide may be modified. Antisense oligonucleotides with appropriate modifications have any or all of the following characteristics compared to unmodified antisense oligonucleotides.
a) High affinity with the target gene.
b) High resistance to nucleases.
c) Improved pharmacokinetics.
d) Increases organizational transferability.
Therefore, the modified antisense oligonucleotide is less likely to be degraded in vivo than the unmodified antisense oligonucleotide, and can inhibit the expression of the target gene more stably.

Any nucleotide modification known in the art can be used for the antisense oligonucleotide of the present invention. Known modifications of nucleotides include phosphate modification, nucleobase modification, and sugar modification.
Examples of phosphoric acid modifications include phosphodiester bonds, S-oligos (phosphorothioates), D-oligos (phosphodiesters), M-oligos (methyl phosphonates), boranophosphates, etc. possessed by natural nucleic acids. .
Examples of the nucleobase modification include 5-methylcytosine, 5-hydroxymethylcytosine, 5-propynylcytosine and the like.
Examples of the sugar modification include 2′-O—CH ₂ —CH ₂ —O—CH ₃ (2′MOE), LNA (Locked Nucleic Acid), amide BNA (Bridged Nucleic Acid, AmNA) and the like.

Nucleotide modification and modification methods known in the art are also disclosed in, for example, the following patent documents.
International Publication No. 98/39352, International Publication No. 99/014226, International Publication No. 2000/056748, International Publication No. 2005/021570, International Publication No. 2003/066875, International Publication No. 2011/052436, International Publication No. 2004. / 016749, International Publication No. 2005/083124, International Publication No. 2007/143315, International Publication No. 2009/071680, Japanese Patent Application No. 2013-004735, and the like.

Hereinafter, modifications that can be used for the antisense oligonucleotide of the present invention are specifically exemplified, but the modifications are not limited thereto.
(1) S-oligo (phosphorothioate)
The oxygen atom of the phosphate group of the phosphodiester bond between nucleosides is replaced with a sulfur atom. The modification is incorporated into the oligonucleotide according to known methods. An antisense oligonucleotide having one or more such modifications in the oligonucleotide is referred to as S-oligo type (phosphorothioate type).
(2) LNA (Locked Nucleic Acid)
A 2'-hydroxyl group is attached from the 4 'carbon atom of the sugar ring of the nucleotide via an appropriate bridge to form a bicyclic sugar moiety. A preferred bond is a methylene (—CH ₂ —) group that bridges the _{2 ′} oxygen atom and the 4 ′ carbon atom. Specific examples of LNA and preparation methods thereof are described in International Publication No. 98/39352, International Publication No. 2003/068795, International Publication No. 2005/021570, and the like.
(3) Amide BNA (Bridged nucleic acid, AmNA)
An amide bond is formed between the 2 'amino group of the sugar ring of the nucleotide and the carbonyl group extended from 4', thereby forming a bicyclic sugar moiety. Specific examples of amide BNA and the preparation method thereof are described in WO2011 / 052436.
(4) Modification of the 2′-position of the nucleotide sugar The OH at the 2′-position of the nucleotide sugar is changed to —O-alkyl (eg, —O-methyl, —O-ethyl, —O-methoxyethyl, etc.), or —F Replace with. The modification is incorporated into the oligonucleotide according to known methods.

The antisense oligonucleotide of the present invention is preferably a gapmer. A gapmer includes a central region (“gap”), regions on both sides of the central region, wings (“5 ′ wing” on the 5 ′ side or “3 ′ wing” on the 3 ′ side), and at least each wing It means an oligonucleotide containing one modified nucleotide. The modification of the modified nucleotide may be any of phosphate modification, base modification, and sugar modification. The type, number, and position of the modification in one wing may be the same as or different from the type, number, and position of the modification in the other wing.

Preferably, the antisense of the present invention contains “one or more sugar-modified nucleosides having a cross-linked structure between the 4′-position and the 2′-position”. Gapmer is preferable. “5 ′ wing” and / or “3 ′ wing” have one or more, preferably 1 to 5, more preferably 2 to 1, sugar-modified nucleosides having a crosslinking structure between the 4′-position and the 2′-position. 3 contained. Furthermore, phosphate modification, base modification, and other sugar modifications may be included.

The “sugar modified nucleoside having a cross-linked structure between the 4′-position and the 2′-position” is a known nucleoside containing a modification having a cross-linked structure between the 4′-position and the 2′-position of the sugar Either is acceptable. Furthermore, base modification and other sugar modifications may be included.

Specific examples of the crosslinked structure include the following.
— (CR ² R ³ ) _m —O—, — (CR ² R ³ ) _m —NR ¹ —O—, — (CR ² R ³ ) _n —CO—NR ¹ — or — (CR ² R ³ ) _n -CO-NR ¹ -X-,
here,
X is an oxygen atom, a sulfur atom, amino or CR ² R ³ ,
R ¹ is a hydrogen atom, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, substituted or unsubstituted aromatic carbocyclic group, substituted or unsubstituted non-aromatic carbocycle Group, substituted or unsubstituted aromatic heterocyclic group, substituted or unsubstituted non-aromatic heterocyclic group, substituted or unsubstituted aromatic carbocyclic alkyl, substituted or unsubstituted non-aromatic carbocyclic alkyl Substituted or unsubstituted aromatic heterocyclic alkyl or substituted or unsubstituted non-aromatic heterocyclic alkyl,
Each R ² is independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl;
Each R ³ is independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl;
m is 1 to 3,
n is 0-3.

R ¹ is preferably a hydrogen atom, alkyl, alkenyl, alkynyl, aromatic carbocyclic group, non-aromatic carbocyclic group, aromatic heterocyclic group, non-aromatic heterocyclic group, aromatic carbocycle It is alkyl, non-aromatic carbocyclic alkyl, aromatic heterocyclic alkyl or non-aromatic heterocyclic alkyl, and may have one or more arbitrary substituents selected from the α group.
The α group is a hydroxyl group, alkyl, alkyloxy, mercapto, alkylthio, amino, alkylamino or halogen.

R ² and R ³ are preferably a hydrogen atom.
m is preferably 1 or 2.
n is preferably 0 or 1.

The cross-linked structure is preferably — (CR ² R ³ ) _m —O— or — (CR ² R ³ ) _n —CO—NR ¹ —
here,
R ¹ is a hydrogen atom, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl,
Each R ² is independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl;
Each R ³ is independently a hydrogen atom, halogen, cyano, substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl or substituted or unsubstituted alkynyl;
m is 1 to 3,
n is 0-3.

The cross-linked structure is particularly preferably —CH ₂ —O— or —CO—NR ¹ — (R ¹ is a hydrogen atom or alkyl).

The term "halogen" encompasses fluorine atom, a chlorine atom, a bromine atom, and iodine atom. In particular, a fluorine atom and a chlorine atom are preferable.

“Alkyl” includes straight or branched hydrocarbon groups having 1 to 15 carbon atoms, preferably 1 to 10 carbon atoms, more preferably 1 to 6 carbon atoms, and still more preferably 1 to 4 carbon atoms. To do. For example, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, neopentyl, n-hexyl, isohexyl, n-heptyl, isoheptyl, n-octyl , Isooctyl, n-nonyl, n-decyl and the like.
Preferred embodiments of “alkyl” include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl and n-pentyl. Further preferred examples include methyl, ethyl, n-propyl, isopropyl and tert-butyl.

“Alkenyl” has 2 to 15 carbon atoms, preferably 2 to 10 carbon atoms, more preferably 2 to 6 carbon atoms, and further preferably 2 to 4 carbon atoms, having one or more double bonds at any position. These linear or branched hydrocarbon groups are included. For example, vinyl, aromatic heterocyclic group, propenyl, isopropenyl, butenyl, isobutenyl, prenyl, butadienyl, pentenyl, isopentenyl, pentadienyl, hexenyl, isohexenyl, hexadienyl, heptenyl, octenyl, nonenyl, decenyl, undecenyl, dodecenyl, Examples include tridecenyl, tetradecenyl, pentadecenyl and the like.
Preferred embodiments of “alkenyl” include vinyl, aromatic heterocyclic group, propenyl, isopropenyl and butenyl.

“Alkynyl” has 2 to 10 carbon atoms, preferably 2 to 8 carbon atoms, more preferably 2 to 6 carbon atoms, and more preferably 2 to 4 carbon atoms, having one or more triple bonds at any position. Includes straight chain or branched hydrocarbon groups. Examples include ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, decynyl and the like. These may further have a double bond at an arbitrary position.
Preferred embodiments of “alkynyl” include ethynyl, propynyl, butynyl and pentynyl.

The “aromatic carbocyclic group” means a cyclic aromatic hydrocarbon group having one or more rings. For example, phenyl, naphthyl, anthryl, phenanthryl and the like can be mentioned.
A preferred embodiment of the “aromatic carbocyclic group” includes phenyl.

The “non-aromatic carbocyclic group” means a cyclic saturated hydrocarbon group or a cyclic non-aromatic unsaturated hydrocarbon group having one or more rings. The non-aromatic carbocyclic group having 2 or more rings also includes those in which the ring in the above “aromatic carbocyclic group” is condensed with a monocyclic or 2 or more non-aromatic carbocyclic groups.
Furthermore, the “non-aromatic carbocyclic group” includes a group that forms a bridge or a spiro ring as described below.

The monocyclic non-aromatic carbocyclic group preferably has 3 to 16 carbon atoms, more preferably 3 to 12 carbon atoms, and still more preferably 4 to 8 carbon atoms. Examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclononyl, cyclodecyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclohexadienyl, and the like.
Examples of the two or more non-aromatic carbocyclic groups include indanyl, indenyl, acenaphthyl, tetrahydronaphthyl, fluorenyl and the like.

“Aromatic heterocyclic group” means a monocyclic or bicyclic or more aromatic cyclic group having one or more heteroatoms arbitrarily selected from O, S and N in the ring To do.
The aromatic heterocyclic group having two or more rings includes those obtained by condensing a ring in the above “aromatic carbocyclic group” to a monocyclic or two or more aromatic heterocyclic group.
The monocyclic aromatic heterocyclic group is preferably 5 to 8 members, more preferably 5 or 6 members. Examples include pyrrolyl, imidazolyl, pyrazolyl, pyridyl, pyridazinyl, pyrimidinyl, pyrazinyl, triazolyl, triazinyl, tetrazolyl, furyl, thienyl, isoxazolyl, oxazolyl, oxadiazolyl, isothiazolyl, thiazolyl, thiadiazolyl, and the like.
Examples of the bicyclic aromatic heterocyclic group include indolyl, isoindolyl, indazolyl, indolizinyl, quinolinyl, isoquinolinyl, cinnolinyl, phthalazinyl, quinazolinyl, naphthyridinyl, quinoxalinyl, purinyl, pteridinyl, benzimidazolyl, benzisoxazolyl, benzisoxazolyl, Oxazolyl, benzoxiazolyl, benzisothiazolyl, benzothiazolyl, benzothiadiazolyl, benzofuryl, isobenzofuryl, benzothienyl, benzotriazolyl, imidazopyridyl, triazolopyridyl, imidazothiazolyl, pyrazinopyr Dazinyl, oxazolopyridyl, thiazolopyridyl and the like can be mentioned.
Examples of the aromatic heterocyclic group having 3 or more rings include carbazolyl, acridinyl, xanthenyl, phenothiazinyl, phenoxathinyl, phenoxazinyl, dibenzofuryl and the like.

“Non-aromatic heterocyclic group” means a monocyclic or bicyclic or more cyclic non-aromatic cyclic group having at least one hetero atom selected from O, S and N in the ring. Means group.
The non-aromatic heterocyclic group having 2 or more rings is a monocyclic or 2 or more non-aromatic heterocyclic group, the above “aromatic carbocyclic group”, “non-aromatic carbocyclic group”, and Also included are those in which each ring in the “aromatic heterocyclic group” is condensed.
Furthermore, the “non-aromatic heterocyclic group” includes a group which forms a bridge or a spiro ring as described below.

The monocyclic non-aromatic heterocyclic group is preferably 3 to 8 members, more preferably 5 or 6 members. For example, dioxanyl, thiranyl, oxiranyl, oxetanyl, oxathiolanyl, azetidinyl, thianyl, thiazolidinyl, pyrrolidinyl, pyrrolinyl, imidazolidinyl, imidazolinyl, pyrazolidinyl, pyrazolinyl, piperidyl, piperazinyl, morpholinyl, morpholino, thiomorpholinyl, morpholino, thiomorpholinyl, morpholino, thiomorpholinyl Furyl, tetrahydropyranyl, dihydrothiazolyl, tetrahydrothiazolyl, tetrahydroisothiazolyl, dihydrooxazinyl, hexahydroazepinyl, tetrahydrodiazepinyl, tetrahydropyridazinyl, hexahydropyrimidinyl, dioxolanyl, dioxazinyl Aziridinyl, dioxolinyl, oxepanyl, thiolanyl, thii Le, triazinyl, and the like.
Examples of the non-aromatic heterocyclic group having two or more rings include indolinyl, isoindolinyl, chromanyl, isochromanyl and the like.

“Alkyloxy” means a group in which the above “alkyl” is bonded to an oxygen atom. Examples thereof include methoxy, ethoxy, n-propyloxy, isopropyloxy, n-butyloxy, tert-butyloxy, isobutyloxy, sec-butyloxy, pentyloxy, isopentyloxy, hexyloxy and the like.
Preferable embodiments of “alkyloxy” include methoxy, ethoxy, n-propyloxy, isopropyloxy, tert-butyloxy.

“Alkylamino” includes monoalkylamino and dialkylamino.
“Monoalkylamino” means a group in which the above “alkyl” is replaced with one hydrogen atom bonded to the nitrogen atom of the amino group. For example, methylamino, ethylamino, isopropylamino and the like can be mentioned. Preferably, methylamino and ethylamino are used.
“Dialkylamino” means a group in which the above “alkyl” is replaced with two hydrogen atoms bonded to the nitrogen atom of the amino group. Two alkyl groups may be the same or different. Examples include dimethylamino, diethylamino, N, N-diisopropylamino, N-methyl-N-ethylamino, N-isopropyl-N-ethylamino and the like. Preferable examples include dimethylamino and diethylamino.

"Alkylthio" means a group in which the "alkyl" is bonded to a sulfur atom.

Examples of the substituent of “substituted or unsubstituted alkyl”, “substituted or unsubstituted alkenyl”, and “substituted or unsubstituted alkynyl” include the following substituents. The carbon atom at any position may be bonded to one or more groups selected from the following substituents.
Substituents: halogen, hydroxy, carboxy, amino, imino, hydroxyamino, hydroxyimino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso , Azide, hydrazino, ureido, amidino, guanidino, trialkylsilyl, alkyloxy, alkenyloxy, alkynyloxy, haloalkyloxy, alkylcarbonyl, alkenylcarbonyl, alkynylcarbonyl, monoalkylamino, dialkylamino, alkylsulfonyl, alkenylsulfonyl, alkynyl Sulfonyl, monoalkylcarbonylamino, dialkylcarbonylamino, monoalkylsulfonyl Mino, dialkylsulfonylamino, alkylimino, alkenylimino, alkynylimino, alkylcarbonylimino, alkenylcarbonylimino, alkynylcarbonylimino, alkyloxyimino, alkenyloxyimino, alkynyloxyimino, alkylcarbonyloxy, alkenylcarbonyloxy, alkynylcarbonyloxy , Alkyloxycarbonyl, alkenyloxycarbonyl, alkynyloxycarbonyl, alkylsulfanyl, alkenylsulfanyl, alkynylsulfanyl, alkylsulfinyl, alkenylsulfinyl, alkynylsulfinyl, monoalkylcarbamoyl, dialkylcarbamoyl, monoalkylsulfamoyl, dialkylsulfamoyl, aromatic Group carbocyclic group, Aromatic carbocyclic group, aromatic heterocyclic group, non-aromatic heterocyclic group, aromatic carbocyclic oxy, non-aromatic carbocyclic oxy, aromatic heterocyclic oxy, non-aromatic heterocyclic oxy, aromatic Carbocyclic carbonyl, non-aromatic carbocyclic carbonyl, aromatic heterocyclic carbonyl, non-aromatic heterocyclic carbonyl, aromatic carbocyclic oxycarbonyl, non-aromatic carbocyclic oxycarbonyl, aromatic heterocyclic oxycarbonyl, non-aromatic hetero Ring oxycarbonyl, aromatic carbocyclic alkyloxy, non-aromatic carbocyclic alkyloxy, aromatic heterocyclic alkyloxy, non-aromatic heterocyclic alkyloxy, aromatic carbocyclic alkyloxycarbonyl, non-aromatic carbocyclic alkyloxycarbonyl , Aromatic heterocyclic alkyloxycarbonyl, non-aromatic heterocyclic alkyloxycarbonyl, aromatic carbocyclic alkylamino, non-aromatic Aromatic carbocyclic alkylamino, aromatic heterocyclic alkylamino, non-aromatic heterocyclic alkylamino, aromatic carbocyclic sulfanyl, non-aromatic carbocyclic sulfanyl, aromatic heterocyclic sulfanyl, non-aromatic heterocyclic sulfanyl, non-aromatic Aromatic carbocyclic sulfonyl, aromatic carbocyclic sulfonyl, aromatic heterocyclic sulfonyl, and non-aromatic heterocyclic sulfonyl.

“Substituted or unsubstituted aromatic carbocyclic group”, “substituted or unsubstituted non-aromatic carbocyclic group”, “substituted or unsubstituted aromatic heterocyclic group”, “substituted or unsubstituted non-substituted aromatic carbocyclic group” "Aromatic heterocyclic group", "Substituted or unsubstituted aromatic carbocyclic alkyl", "Substituted or unsubstituted non-aromatic carbocyclic alkyl", "Substituted or unsubstituted aromatic heterocyclic alkyl" and "Substituted Alternatively, the substituents on the ring of “aromatic carbocycle”, “non-aromatic carbocycle”, “aromatic heterocycle” and “non-aromatic heterocycle” of “unsubstituted non-aromatic heterocycle alkyl” are as follows: The following substituents are mentioned. An atom at any position on the ring may be bonded to one or more groups selected from the following substituents.
Substituents: halogen, hydroxy, carboxy, amino, imino, hydroxyamino, hydroxyimino, formyl, formyloxy, carbamoyl, sulfamoyl, sulfanyl, sulfino, sulfo, thioformyl, thiocarboxy, dithiocarboxy, thiocarbamoyl, cyano, nitro, nitroso , Azide, hydrazino, ureido, amidino, guanidino, trialkylsilyl, alkyl, alkenyl, alkynyl, haloalkyl, alkyloxy, alkenyloxy, alkynyloxy, haloalkyloxy, alkyloxyalkyl, alkyloxyalkyloxy, alkylcarbonyl, alkenylcarbonyl, Alkynylcarbonyl, monoalkylamino, dialkylamino, alkylsulfonyl, alkenylsulfonyl, Lucinylsulfonyl, monoalkylcarbonylamino, dialkylcarbonylamino, monoalkylsulfonylamino, dialkylsulfonylamino, alkylimino, alkenylimino, alkynylimino, alkylcarbonylimino, alkenylcarbonylimino, alkynylcarbonylimino, alkyloxyimino, alkenyloxyimino Alkynyloxyimino, alkylcarbonyloxy, alkenylcarbonyloxy, alkynylcarbonyloxy, alkyloxycarbonyl, alkenyloxycarbonyl, alkynyloxycarbonyl, alkylsulfanyl, alkenylsulfanyl, alkynylsulfanyl, alkylsulfinyl, alkenylsulfinyl, alkynylsulfinyl, monoalkylcarba Mo , Dialkylcarbamoyl, monoalkylsulfamoyl, dialkylsulfamoyl, aromatic carbocyclic group, non-aromatic carbocyclic group, aromatic heterocyclic group, non-aromatic heterocyclic group, aromatic carbocycle Oxy, non-aromatic carbocyclic oxy, aromatic heterocyclic oxy, non-aromatic heterocyclic oxy, aromatic carbocyclic carbonyl, non-aromatic carbocyclic carbonyl, aromatic heterocyclic carbonyl, non-aromatic heterocyclic carbonyl, aromatic Carbocyclic oxycarbonyl, non-aromatic carbocyclic oxycarbonyl, aromatic heterocyclic oxycarbonyl, non-aromatic heterocyclic oxycarbonyl, aromatic carbocyclic alkyl, non-aromatic carbocyclic alkyl, aromatic heterocyclic alkyl, non-aromatic Heterocyclic alkyl, aromatic carbocyclic alkyloxy, non-aromatic carbocyclic alkyloxy, aromatic heterocyclic alkyloxy, non-aromatic heterocyclic alkyl Oxy, aromatic carbocyclic alkyloxycarbonyl, non-aromatic carbocyclic alkyloxycarbonyl, aromatic heterocyclic alkyloxycarbonyl, non-aromatic heterocyclic alkyloxycarbonyl, aromatic carbocyclic alkyloxyalkyl, non-aromatic carbocyclic alkyl Oxyalkyl, aromatic heterocyclic alkyloxyalkyl, non-aromatic heterocyclic alkyloxyalkyl, aromatic carbocyclic alkylamino, non-aromatic carbocyclic alkylamino, aromatic heterocyclic alkylamino, non-aromatic heterocyclic alkylamino, Aromatic carbocyclic sulfanyl, non-aromatic carbocyclic sulfanyl, aromatic heterocyclic sulfanyl, non-aromatic heterocyclic sulfanyl, non-aromatic carbocyclic sulfonyl, aromatic carbocyclic sulfonyl, aromatic heterocyclic sulfonyl, and non-aromatic hetero Ring sulfonyl.

The alkyl part of “aromatic carbocyclic alkyl”, “non-aromatic carbocyclic alkyl”, “aromatic heterocyclic alkyl”, and “non-aromatic heterocyclic alkyl” is the same as the above “alkyl”.

“Aromatic carbocyclic alkyl” means an alkyl substituted with one or more of the above “aromatic carbocyclic groups”. For example, benzyl, phenethyl, phenylpropynyl, benzhydryl, trityl, naphthylmethyl, groups shown below

Etc.
Preferable embodiments of “aromatic carbocyclic alkyl” include benzyl, phenethyl and benzhydryl.

“Non-aromatic carbocyclic alkyl” means alkyl substituted with one or more of the above “non-aromatic carbocyclic groups”. The “non-aromatic carbocyclic alkyl” also includes “non-aromatic carbocyclic alkyl” in which the alkyl moiety is substituted with the above “aromatic carbocyclic group”. For example, cyclopropylmethyl, cyclobutylmethyl, cyclopentylmethyl, cyclohexylmethyl, groups shown below

Etc.

“Aromatic heterocyclic alkyl” means alkyl substituted with one or more of the above “aromatic heterocyclic groups”. “Aromatic heterocyclic alkyl” also includes “aromatic heterocyclic alkyl” in which the alkyl moiety is substituted with the above “aromatic carbocyclic group” and / or “non-aromatic carbocyclic group”. . For example, pyridylmethyl, furanylmethyl, imidazolylmethyl, indolylmethyl, benzothiophenylmethyl, oxazolylmethyl, isoxazolylmethyl, thiazolylmethyl, isothiazolylmethyl, pyrazolylmethyl, isopyrazolylmethyl, pyrrolidinylmethyl, benz Oxazolylmethyl, group shown below

Etc.

“Non-aromatic heterocyclic alkyl” means an alkyl substituted with one or more of the above “non-aromatic heterocyclic groups”. In the “non-aromatic heterocyclic alkyl”, the alkyl portion is substituted with the above “aromatic carbocyclic group”, “non-aromatic carbocyclic group” and / or “aromatic heterocyclic group”. Also included are “non-aromatic heterocyclic alkyl”. For example, tetrahydropyranylmethyl, morpholinylethyl, piperidinylmethyl, piperazinylmethyl, groups shown below

Etc.

The antisense oligonucleotide of the present invention (or a modified product thereof) can be synthesized by a conventional method. For example, it can be easily synthesized with a commercially available automatic nucleic acid synthesizer (for example, manufactured by AppliedBiosystems, manufactured by Dainippon Seiki Co., Ltd.). Can be synthesized. Examples of the synthesis method include a solid phase synthesis method using phosphoramidite and a solid phase synthesis method using hydrogen phosphonate. For example, it is disclosed in Tetrahedron Letters 22, 1859-1862 (1981), International Publication No. 2011/052436, and the like.

The antisense oligonucleotides of the present invention can be any pharmaceutical that can provide (directly or indirectly) a biologically active metabolite or residue thereof when administered to an animal, including a human. including acceptable salts, esters, or salts of such esters, or any other equivalents. That is, it includes prodrugs and pharmaceutically acceptable salts of the antisense oligonucleotides of the invention, pharmaceutically acceptable salts of the prodrugs, and other biological equivalents.

A “prodrug” is an inactive or less active form that is converted into an active form (ie, drug) in vivo or in cells by the action and / or state of an endogenous enzyme or other chemical. Is a derivative. The prodrug of the antisense oligonucleotide of the present invention can be prepared according to the methods described in WO 93/24510, WO 94/26764 and the like.

“Pharmaceutically acceptable salt” refers to a physiologically and pharmaceutically acceptable salt of an antisense oligonucleotide of the invention, ie, retains the desired biological activity of the antisense oligonucleotide; It refers to salts that do not give unwanted toxicological effects.

Examples of pharmaceutically acceptable salts include alkali metals (eg, lithium, sodium, potassium, etc.), alkaline earth metals (eg, calcium, barium, etc.), magnesium, transition metals (eg, zinc, iron, etc.), Ammonia, organic bases (eg trimethylamine, triethylamine, dicyclohexylamine, ethanolamine, diethanolamine, triethanolamine, meglumine, diethanolamine, ethylenediamine, pyridine, picoline, quinoline etc.) and salts with amino acids, or inorganic acids (eg hydrochloric acid, Sulfuric acid, nitric acid, carbonic acid, hydrobromic acid, phosphoric acid, hydroiodic acid, etc.) and organic acids (eg formic acid, acetic acid, propionic acid, trifluoroacetic acid, citric acid, lactic acid, tartaric acid, oxalic acid, maleic acid) Fumaric acid, mandelic acid, Rutaru acid, malic acid, benzoic acid, phthalic acid, ascorbic acid, benzenesulfonic acid, p- toluenesulfonic acid, methanesulfonic acid, and salts with ethanesulfonic acid, etc.). In particular hydrochloric, sulfuric, phosphoric, tartaric, salts with methanesulfonic acid. These salts can be formed by a commonly performed method.

The present invention also includes a pharmaceutical composition containing the antisense oligonucleotide of the present invention. As the administration method and preparation of the pharmaceutical composition of the present invention, any administration method and preparation known in the art can be used. Antisense oligonucleotide administration methods and preparations are also disclosed in, for example, the following documents.
International Publication No. 2004/016749, International Publication No. 2005/083124, International Publication No. 2007/143315, International Publication No. 2009/071680, and the like.

The pharmaceutical composition of the present invention can be administered by various methods depending on whether local or systemic treatment is desired or on the region to be treated. The administration method may be, for example, topical (including eye drops, intravaginal, rectal, intranasal, transdermal), oral, or parenteral. Parenteral administration includes intravenous injection or infusion, subcutaneous, intraperitoneal or intramuscular injection, pulmonary administration by inhalation or inhalation, intradural administration, intraventricular administration, and the like.

When the pharmaceutical composition of the present invention is administered locally, preparations such as transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, powders and the like can be used.
Examples of compositions for oral administration include powders, granules, suspensions or solutions dissolved in water or non-aqueous media, capsules, powders, tablets and the like.
Examples of compositions for parenteral, subdural space, or intracerebroventricular administration include sterile aqueous solutions containing buffers, diluents and other suitable additives.

The pharmaceutical composition of the present invention comprises various pharmaceutical additives such as excipients, binders, wetting agents, disintegrants, lubricants, diluents and the like suitable for the dosage form in the effective amount of the antisense oligonucleotide of the present invention. The agent can be obtained by mixing as necessary. It may be a formulation subjected to sterilization treatment with a suitable carrier in the case of injections.

Excipients include lactose, sucrose, glucose, starch, calcium carbonate or crystalline cellulose. Examples of the binder include methyl cellulose, carboxymethyl cellulose, hydroxypropyl cellulose, gelatin, and polyvinyl pyrrolidone. Examples of the disintegrant include carboxymethyl cellulose, sodium carboxymethyl cellulose, starch, sodium alginate, agar powder, or sodium lauryl sulfate. Lubricants Talc, magnesium or macrogol stearate. As a suppository base, cocoa butter, macrogol, methylcellulose or the like can be used. In addition, when preparing as liquid or emulsion or suspension injections, commonly used solubilizers, suspending agents, emulsifiers, stabilizers, preservatives, isotonic agents, etc. are added as appropriate. You may do it. In the case of oral administration, flavoring agents, fragrances and the like may be added.

Administration depends on the severity and responsiveness of the condition being treated, and the course of treatment lasts from a few days to several months or until healing is achieved or a reduction in the condition is achieved. The optimal dosing schedule can be calculated from measurements of drug accumulation in the body. Persons of ordinary skill in the art can determine optimum dosages, dosing methodologies and repetition rates. The optimal dose will vary depending on the relative potency of the individual antisense oligonucleotides, but can generally be calculated based on the IC50 or EC50 in in vitro and in vivo animal experiments. For example, given the molecular weight of an antisense oligonucleotide (derived from the antisense oligonucleotide sequence and chemical structure) and an effective dose (derived experimentally), eg, IC50, in mg / kg The expressed dose is customarily calculated.

Since the pharmaceutical composition of the present invention has ACSL1 expression-suppressing activity, it can be used for prevention or treatment of diseases associated with ACSL1.
Diseases associated with ACSL1 include obesity (including weight management in obesity), obesity related diseases, diabetes (especially type II diabetes), syndrome X, cardiovascular disorders or cancer (breast cancer, colon cancer, colon cancer, Ovarian cancer, lung cancer, etc.).
An “obesity related disease” is a disease associated with, caused by, or caused by obesity. Examples of obesity-related diseases include bulimia, hypertension, impaired glucose tolerance, diabetes, metabolic syndrome, lipid metabolism disorder, arteriosclerosis, hyperuricemia, gout, fatty liver, proteinuria, obese nephropathy, endometrium Cancer, breast cancer, prostate cancer, colon cancer, osteoarthritis, low back pain, lumbar spondylosis, obstructive sleep apnea syndrome, coronary artery disease (myocardial infarction, coronary heart disease such as angina pectoris), cerebral infarction, cerebral thrombus Disease, transient cerebral ischemic attack, menstrual abnormalities, Prader-Willi syndrome, Frehrich syndrome, Pickwick syndrome and the like. The pharmaceutical composition of the present invention is also useful for reducing the risk of secondary outcomes of obesity, such as reducing the risk of left ventricular hypertrophy.
The pharmaceutical composition of the present invention can be used particularly for the prevention or treatment of obesity or type II diabetes.

When the pharmaceutical composition of the present invention is used for the prevention or treatment of obesity, other one or more known anti-obesity drugs (pharmaceutical compositions containing a compound having an anti-obesity action, obesity and obesity) It can also be used in combination with a drug that can be used for weight management and the like. Moreover, the administration therapy of the pharmaceutical composition of the present invention can also be used in combination with known diet therapy, drug therapy, exercise and the like.

For example, the following methods are also within the scope of the present invention.
A method for the prevention or treatment of obesity or obesity-related diseases or weight management in obesity, comprising administering a known anti-obesity drug in combination with the pharmaceutical composition of the present invention.
A method for the prevention or treatment of obesity or obesity-related diseases or weight management in obesity, comprising administering a known anti-obesity drug to a patient undergoing prevention or treatment by administration of the pharmaceutical composition of the present invention.

Known anti-obesity drugs include compounds having an appetite suppressing action (selective serotonin reuptake inhibitors, etc.), compounds having an action to suppress digestion and absorption of nutrients (α-glucosidase inhibitors; SGLT-2 inhibitors, etc.), fat Compounds having an inhibitory action (lipase inhibitor; bile acid adsorption resin, etc.), 5HT transporter inhibitor, NE transporter inhibitor, CB-1 antagonist / inverse agonist, ghrelin antagonist, H3 antagonist / inverse agonist, MCH R1 antagonist , MCH R2 agonist / antagonist, NPY Y1 receptor antagonist, NPY Y2 receptor agonist, NPY Y4 receptor agonist, NPY Y5 receptor antagonist, mGluR5 antagonist, leptin, leptin Gonist, leptin derivative, opioid antagonist, orexin antagonist, BRS3 agonist, CCK-A agonist, CNTF, CNTF agonist, CNTF derivative, GHS agonist, 5HT2C agonist, Mc4r agonist, monoamine reuptake inhibitor, GLP-1 agonist, UCP-1 2 and 3 activators, β3 agonists, thyroid hormone β agonists, PDE inhibitors, FAS inhibitors, DGAT1 inhibitors, DGAT2 inhibitors, ACC2 inhibitors, glucocorticoid antagonists, acyl-estrogens, fatty acid transporter inhibitors, dicarboxylic Examples include pharmaceutical compositions containing an acid transporter inhibitor and the like.

When the pharmaceutical composition of the present invention is used for the prevention or treatment of type II diabetes, it can also be used in combination with one or more other known type II diabetes therapeutic agents.

Known therapeutic agents for type II diabetes include insulin secretagogues (for example, sulfonylurea (SU) drugs), fast-acting insulin secretagogues (for example, phenylalanine derivative drugs), glucose absorption inhibitors (for example, α-glucosidase inhibitors) (ΑGI drug)), insulin sensitizers (for example, biguanide drugs (BG drugs), thiazolidine derivatives (TZD drugs)), insulin preparations, peptidyl peptidase IV (DPP-IV) inhibitors, GLP-1 receptors Examples include pharmaceutical compositions containing agonists, type 1 sodium-dependent glucose transporter (SGLT1) inhibitors, type 2 sodium-dependent glucose transporter (SGLT2) inhibitors, and the like.

When the pharmaceutical composition of the present invention is used in combination with another drug, the timing of administration is not limited, and it may be administered simultaneously to the administration subject or may be administered with a time difference. Furthermore, the pharmaceutical composition of the present invention and the other drug may be administered as a plurality of preparations containing each active ingredient, or may be administered as a single preparation containing both active ingredients.

Hereinafter, the present invention will be described in more detail with reference to examples of the present invention, but the present invention is not limited thereto.

Example 1 Oligonucleotide Synthesis Oligonucleotides related to the present invention were synthesized by a method described in Tetrahedron Letters 22, 1859-1862 (1981), International Publication No. 2011/052436, and the like.

Specifically, synthesis of the oligonucleotide containing LNA represented by the formula (a) was outsourced to Gene Design Co., Ltd.

(In the formula, Base is 5-methylcytosine (C), thymine (T), adenine (A) or guanine (G).)

The oligonucleotide containing amide BNA (AmNA) represented by the formula (b) was synthesized with reference to the method described in International Publication No. 2011/052436.

(In the formula, Base is 5-methylcytosine (C), thymine (T), adenine (A) or guanine (G), and Me is methyl.)

The 10mer to 19mer oligonucleotide containing the LNA represented by the formula (a) and the amide BNA (AmNA) represented by the formula (b) is an automatic nucleic acid synthesizer (nS-8 type, manufactured by Dainippon Seiki Co., Ltd.) Was synthesized on a 0.2 μmol scale. Chain length extension is performed using a standard phosphoramidite protocol (solid phase carrier: CPG resin, sulfurization using DDT (3H-1,2-Benzodithiole-3-one, 1,1-dioxide), etc.). Thus, an oligonucleotide in which the terminal hydroxyl group at the 5′-position was protected with a DMTr (dimethoxytrityl) group and the 3′-position was supported on a solid phase was obtained. Subsequently, the DMTr group was removed by acid treatment, followed by base treatment to cut out the target product from the solid phase carrier. After neutralization with dilute acid, the solvent was distilled off, and the resulting crude product was purified by gel filtration column chromatography and reverse phase HPLC to obtain the desired product.
In addition, as a negative control (NC) of the present invention, a sequence having a mismatch of 5 bases or more with ACSL1 was designed as shown in Table 1. In the sequences of Table 1, uppercase letters represent LNAs represented by formula (a). Lower case letters represent DNA. The linkage between nucleosides is phosphorothioate (P = S) throughout the oligonucleotide.

Example 2 Human Antisense Oligonucleotide Sequence Antisense oligonucleotide (AON) was designed to target human ACSL1 (GenBank: NM_001995, SEQ ID NO: 1). The oligonucleotide sequences are shown in Tables 2-6.
In the sequences of Tables 2 to 5, capital letters represent LNA represented by the formula (a). Lower case letters represent DNA. The linkage between nucleosides is phosphorothioate (P = S) throughout the oligonucleotide.

In the sequences in Table 6, uppercase letters represent amide BNA (AmNA) represented by formula (b). Lower case letters represent DNA. The linkage between nucleosides is phosphorothioate (P = S) throughout the oligonucleotide.

Example 3 Mouse Antisense Oligonucleotide Sequence Antisense oligonucleotide (AON) was designed to target mouse Acsl1 (GenBank: NM_007981, SEQ ID NO: 3). Oligonucleotide sequences are shown in Tables 7-12.
In the sequences of Tables 7 to 11, capital letters represent LNA represented by the formula (a). Lower case letters represent DNA. The linkage between nucleosides is phosphorothioate (P = S) throughout the oligonucleotide.

Sequence table 12 and the upper case letters represent the amide BNA (AmNA) represented by the formula (b). Lower case letters represent DNA. Internucleoside linkages are phosphorothioate (P = S) throughout the oligonucleotide.

Example 4: In vitro model Cell culture Cells are cultured in a suitable medium as described below, 37 ° C, 95-98% humidity and 5%
Maintained with CO ₂ .
HepG2: The human hepatoma-derived cell line HepG2 was cultured in DMEM High glucose (Sigma) + 10% fetal bovine serum (FBS) + Antibiotic Anticolytic Solution (10 mL / L).
HLE: Human hepatoma-derived cell line HLE was cultured in DMEM Low Glucose (Sigma) + 10% fetal bovine serum (FBS) + Penicillin (100 units / mL) + Streptomycin (100 ug / mL).
Hepa1c1c7: The mouse liver cancer-derived cell line Hepa1c1c7 was cultured in α-MEM (Gibco) + 10% FBS + Antibiotic Anticolytic Solution (10 mL / L).

Example 5: Evaluation of antisense oligonucleotides against ACSL1 (1) Evaluation by changes in mRNA expression level In this example, the effectiveness of antisense oligonucleotides designed based on the base sequence of human or mouse ACSL1 was demonstrated. .
Antisense oligonucleotides were designed and produced as described in Examples 2 and 3, and knockdown experiments were performed on human HepG2 cells and mouse Hepa1c1c7 cells.
Using the prepared antisense oligonucleotide and Negative Control (NC, SEQ ID NO: 5), knockdown experiments were conducted in human HepG2 cells and mouse Hepa1c1c7 cells. In human HepG2 cells, antisense oligonucleotides were introduced into cells using Lipofectamine LTX reagent (invitrogen) and added to the cell culture solution to a final concentration of antisense oligonucleotides of 5 nM or 20 nM. In mouse Hepa1c1c7 cells, cells were introduced using Lipofectamine RNAiMAX reagent (invitrogen) and added to the cell culture so that the final concentration of the antisense oligonucleotide was 20 nM. 24 hours after the introduction, the cells were collected with Fastlane (QIAGEN) and subjected to quantitative PCR. GAPDH was used as an endogenous control.
In the introduction experiment by natural uptake, in the cells described in Example 4, the antisense oligonucleotide was introduced into the cell culture solution without using a reagent, and added to the cell culture solution so that the final concentration of antisense was 5 μM. In human HLE cells and mouse Hepa1c1c7 cells, cells were collected 120 hours after introduction with Fastlane (QIAGEN) and subjected to quantitative PCR. GAPDH was used as an endogenous control.

The primer sequence used to measure the expression level of human ACSL1 is
Fw primer: GCAGCGGGCATCATCAGAAAC (SEQ ID NO: 157);
Rv primer: TGTCCATCATAGCCCGACTC (SEQ ID NO: 158)
Use
The primer sequence used to measure the expression level of human GAPDH is:
Fw primer: GCACCGTCAAGGCTGGAAC (SEQ ID NO: 159);
Rv primer: TGGTGAAGACGCCAGTGGA (SEQ ID NO: 160)
Was used.
The primer sequence used to measure the expression level of mouse Acsl1 is:
Fw primer: AGGTGCTTCAGCCCACATC (SEQ ID NO: 161);
Rv primer: AAAGTCCAACAGCCATCGCTTC (SEQ ID NO: 162)
Use
The primer sequence used to measure the expression level of mouse Gapdh is:
Fw primer: TGTGTCCGTCGTGGATCTGA (SEQ ID NO: 163);
Rv primer: TTGCTGTTTGAAGTCGCAGAG (SEQ ID NO: 164)
Was used.

The results are shown in Tables 13, 14, 15, 16 and FIG. Table 13 shows the amount of decrease in ACSL1 mRNA in mouse Hepa1c1c7 cells normalized with GAPDH for antisense oligonucleotides introduced into cells using Lipofectamine RNAiMAX reagent, as a percentage of untreated cells as knockdown efficiency. NC in Table 13 is the value of Negative Control, N.I. D. Means that the amount of decrease in mRNA of ACSL1 is below the detection limit, or the amount of mRNA is increased, and ACSL1 is not suppressed. Table 14 shows the amount of ACSL1 mRNA decrease in human HepG2 cells normalized with GAPDH as knockdown efficiency for antisense oligonucleotides introduced into cells using Lipofectamine LTX reagent. “NC” in Table 14 means “Negative Control”. Table 15 shows the amount of ACSL1 mRNA decrease in mouse Hepa1c1c7 cells normalized with GAPDH and the ratio of untreated cells as knockdown efficiency for antisense oligonucleotides introduced into cells without using reagents. Table 16 shows the amount of decrease in ACSL1 mRNA in human HLE cells normalized with GAPDH and the ratio of untreated cells as knockdown efficiency for antisense oligonucleotides introduced into cells without using reagents. FIG. 1 shows the knockdown efficiency of antisense oligonucleotides (5 nM and 20 nM) introduced into cells using Lipofectamine LTX reagent in human HepG2 cells.
As a result, the antisense oligonucleotide of the present invention showed excellent knockdown activity against HepG2 cells, HLE cells and / or Hepa1c1c7 cells, as compared with other antisense oligonucleotides.

Regarding antisense oligonucleotides introduced into cells using Lipofectamine LTX reagent or Lipofectamine RNAiMAX reagent, both hepG2 cells and Hepa1c1c7 cells showed a sequence that showed a knockdown efficiency of 75% or more with respect to untreated cells. Antisense oligonucleotide (AON) numbers 1, 4, 5, 6, 15, 17, 18, 42, 43, 50, 51, 55, 56, 57, 58 are defined as sequences having cross-reactivity between mouse different species. , 62, 63, 64, 65, 74, 75, 76, 77, 114, 115, 116, 117 were found to have interspecies crossing properties. Antisense oligonucleotide (AON) numbers 42 and 50, 43 and 51, 55 and 62, 56 and 63, 57 and 64, 58 and 65, 74 and 114, 75 and 115, 76 and 116, 77 and 117, respectively It is designed as a sequence for the same part of human and mouse ACSL1 gene. Even if the sequences are the same in human and mouse, both do not necessarily show knockdown activity, and thus the above sequences showing both knockdown activities are very useful for drug discovery.

(2) Crossability evaluation with other ACSL families In this example, the crosslinkability with ACSL3 and ACSL5 which are ACSL families other than ACSL1 was evaluated in the knockdown effect of the antisense oligonucleotide of the present invention.
(1) Quantitative PCR was performed on the sample collected by the method described. GAPDH was used as an endogenous control.
The primer sequence used to measure the expression level of human ACSL3 is:
Fw primer: ATACGGGGCTCACTGAATCTGCTG (SEQ ID NO: 165);
Rv primer: AGCAAACTAATGGTGCTCCCACTC (SEQ ID NO: 166)
Use
The primer sequence used to measure the expression level of human ACSL5 is
Fw primer: GGAACTCTGAAGATCATCGACCGTA (SEQ ID NO: 167);
Rv primer: CGTTGTCAGGAACCACCACTCCTA (SEQ ID NO: 168)
Was used.
The primer sequence used to measure the expression level of mouse Acsl3 is:
Fw primer: GCAACAACGCAGCGATTCA (SEQ ID NO: 169);
Rv primer: AGCAAACTAATGGTGCCTCCACTC (SEQ ID NO: 170)
Use
The primer sequence used to measure the expression level of mouse Acsl5 is:
Fw primer: CATTCGGCGGGACAGTTTG (SEQ ID NO: 171);
Rv primer: ATCCCATTGCCAGCCCCTGAAG (SEQ ID NO: 172)
Was used.

The results are shown in Tables 17 and 18. Table 17 shows the amount of decrease in ACSL3 or ACSL5 mRNA in mouse Hepa1c1c7 cells normalized with GAPDH as a percentage of untreated cells as knockdown efficiency. Table 18 shows the amount of decrease in ACSL3 or ACSL5 mRNA in human HepG2 cells normalized with GAPDH as a percentage of untreated cells as knockdown efficiency. N. in Table 17 or 18. D. Means that the amount of mRNA decrease in ACSL3 or ACSL5 is below the detection limit, or the amount of mRNA is increased, and ACSL3 or ACSL5 is not suppressed.
As a result, it was confirmed that the antisense oligonucleotide of the present invention suppresses ACSL1, but does not suppress ACSL3 and ACSL5.

(3) Evaluation by change in protein expression level In this example, knockdown activity evaluation by change in expression level of ACSL1 protein in HepG2 cells was performed on the antisense oligonucleotide and negative control (SEQ ID NO: 5) of the present invention. . Moreover, the ACSL family specificity in HepG2 cells was evaluated with respect to the antisense oligonucleotide of the present invention and the negative control (SEQ ID NO: 5).
(1) Cells were transfected with antisense oligonucleotides according to the method described, and after 48 hours, the cells were recovered with RIPA buffer (Sigma), and proteins were detected by Western blotting. Β-actin was detected as a control.
The primary antibody of ACSL1 was rabbit anti-ACSL1 antibody (Cell Signaling), and the secondary antibody was ECL ^™ Peroxidase-labeled anti-rabbit antibody (GE).
The primary antibody for ACSL3 was rabbit anti-ACSL3 antibody (Proteintech), and the secondary antibody was ECL ^™ Peroxidase-labeled anti-rabbit antibody.
The primary antibody for ACSL5 was rabbit anti-ACSL5 antibody (Proteintech), and the secondary antibody was ECL ^™ Peroxidase-labeled anti-rabbit antibody.
The primary antibody of β-actin was mouse anti β-actin antibody (Sigma), and the secondary antibody was ECL ^™ Peroxidase-labeled anti-mouse antibody (GE).

The results are shown in FIGS. FIG. 2 shows the knockdown effect on ACSL1. As a result, AON Nos. 1, 4, 5, 6, 43, 55, 56 and 57 were found to have a knockdown effect even at the protein level at a final concentration of 5 nM. FIG. 3 shows the evaluation results of the reactivity against ACSL3, ACSL5. As a result, it was found that the antisense oligonucleotide of the present invention suppresses ACSL1 even at the protein level, but does not suppress ACSL3 and ACSL5.

Example 6: Evaluation of in vivo activity at the time of single administration of antisense oligonucleotide (1) Evaluation by change in mRNA expression level AON Nos. 194, 196, 197, 198 selected by evaluation in mRNA expression level change in vitro For 199, 201, and 203, knockdown activity was evaluated by changing the mRNA expression level of ACSL1 in the mouse liver. C57BL / 6J (male, 10 weeks old, Claire, Japan), antisense oligonucleotide solution dissolved in physiological saline (Otsuka raw food injection, Otsuka Pharmaceutical Factory), about 0.2 mL, the dose per mouse is 10 mg / kg , 20 mg / kg, and 40 mg / kg. Approximately 0.5 mL of whole blood and liver tissue were collected under somnopentyl anesthesia 3 days, 7 days, and 14 days after administration. RNA extraction from the liver was performed according to the manufacturer's recommended protocol using RNeasy 96 Universal Tissue Kit (Qiagen). 1000 ng of the obtained RNA was reverse-transcribed according to a standard protocol using SuperScript III First-Strand Synthesis SuperMix for qRT-PCR (manufactured by Life Science) to obtain cDNA. Quantitative PCR was performed using SYBR Premix Ex Taq II (manufactured by Takara Bio Inc.). GAPDH was used as an endogenous control, and the same primers as those used in the in vitro experiment were used. The results are shown in Tables 19-21. N / A in the table means that ACSL1 mRNA is not measured. The ratio of ACSL1 mRNA normalized by GAPDH to untreated cells is shown.
As a result, it was confirmed that the antisense oligonucleotide of the present invention exhibited a concentration-dependent knockdown activity even in vivo.

(2) Evaluation by change in protein expression level Mouse liver tissue administered with antisense oligonucleotide (AON No. 196, 197 or 203) was crushed in a 5-fold amount of RIPA Buffer (manufactured by SIGMA), and 20,000 g, The supernatant was obtained by centrifugation for 20 minutes. The amount of protein contained in the supernatant was quantified using a BCA Assay Kit (Pierce), 0.01 mg of the protein was electrophoresed and subjected to Western blotting. In addition, Western Blotting was performed in the same manner as the in vitro experiment. The results are shown in FIGS.
As a result, it was found that the antisense oligonucleotide of the present invention can knock down ACSL1 even at the protein level.

Example 7: Evaluation of in vivo activity upon repeated administration of antisense oligonucleotide In this example, ACSL1 in mouse liver was repeatedly administered with AON No. 203 selected by evaluation based on changes in mRNA expression level in vitro. The knockdown activity was evaluated by changing the mRNA expression level. Diet-induced obese (DIO) mice were prepared by feeding C57BL / 6J (male 7-week-old, Claire, Japan) for 4 weeks and a high-fat fat diet (60% kcal fat: manufactured by TestDiet) for 4 weeks. About 0.2 mL of an antisense oligonucleotide solution of AON No. 203 dissolved in physiological saline (Otsuka raw food injection, Otsuka Pharmaceutical Factory) was subcutaneously administered once weekly to DIO mice. The dose was 5 mg / kg / week, 10 mg / kg / week, and 40 mg / kg of the initial administration and 10 mg / kg / week of the maintenance administration per mouse, and the administration was continued for 8 weeks. Liver tissues were collected from some individuals on the 14th, 28th, and 56th days after the first administration, and the changes in the expression of mRNA and protein were examined as in the single administration experiment. The results of mRNA expression changes are shown in the table. As a result, it was confirmed that AON No. 203 exhibited a concentration-dependent knockdown activity even after repeated administration in vivo. The result about the expression change of protein amount is shown in FIG.
As a result, it was confirmed that the antisense oligonucleotide of the present invention can knock down ACSL1 at the protein level even when it is repeatedly administered in vivo. Moreover, it discovered that knockdown efficiency of mRNA and protein was in general agreement.

Example 8: Weight gain inhibitory effect upon repeated administration of antisense oligonucleotide The effect on weight gain of mice upon repeated administration of AON No. 203 was evaluated. Diet-induced obese (DIO) mice were prepared by feeding C57BL / 6J (male 7-week-old, Claire, Japan) for 4 weeks and a high-fat fat diet (60% kcal fat: manufactured by TestDiet) for 4 weeks. Divide the group into 7 to 8 animals so that the average value of the body weight is the same. About 0.2 mL of antisense oligonucleotide solution of AON No. 203 dissolved in physiological saline (Otsuka raw food injection, Otsuka Pharmaceutical Factory) The ileum was administered subcutaneously. The dose per mouse is 5 mg / kg / week, 10 mg / kg / week, and 40 mg / kg for the initial dose and 10 mg / kg / week for the maintenance dose. The amount of food was measured. The weight transition is shown in FIG. Compared with the physiological saline administration group, no significant change in food intake was observed in any of the AON No. 203 administration groups, but weight gain suppression was confirmed in any of the groups administered with AON No. 203.
From this result, the anti-obesity effect was confirmed by suppressing ACSL1 expression in the liver with the antisense oligonucleotide of the present invention.

Example 9: Liver toxicity evaluation after single administration of antisense oligonucleotide AON toxicity was evaluated in mouse liver for AON Nos. 194, 198, 199, 201, 203. Specifically, glutamate oxaloacetate transaminase (GOT) and glutamate pyruvate transaminase (GPT) contained in plasma were measured as markers of liver toxicity. C57BL / 6J (male, 10 weeks old, Claire, Japan), antisense oligonucleotide solution dissolved in physiological saline (Otsuka raw food injection, Otsuka Pharmaceutical Factory), about 0.2 mL, the dose per mouse is 10 mg / kg , 20 mg / kg subcutaneously, 3 days, 7 days, and 14 days after administration, about 0.5 mL of whole blood was collected under somnopentyl anesthesia, and heparin (manufactured by Ajinomoto Pharmaceutical Co., Inc.) was immediately added to a final concentration of 0. It added so that it might become 0.01 U / microliter. GOT and GPT in the obtained plasma were measured using a transaminase C2 kit Wako (manufactured by Wako Pure Chemical Industries, Ltd.) according to the attached manual. Significant increases in GOT and GPT were not observed in the blood of mice administered with AON Nos. 194, 198, 199, 201, 203 as compared to the saline administration group.
As a result, it was confirmed that the antisense oligonucleotide of the present invention does not exhibit liver toxicity.

As is clear from the above examples, the antisense oligonucleotide of the present invention exhibits ACSL1 expression inhibitory activity. Therefore, the compound of the present invention can prevent or prevent obesity, obesity-related diseases, diabetes (particularly type II diabetes), syndrome X, cardiovascular disorder or cancer (breast cancer, colon cancer, colon cancer, ovarian cancer, lung cancer, etc.) or the like. It is very useful as a medicine for treatment (including a medicine for weight management).

Claims (11)

1. Under stringent conditions, positions 95 to 109, 176 to 192, 467 to 484, 940 to 954, 940 to 954, 1017 to 1032, 1102 to 1116, 1176 to 1197 of SEQ ID NO: 1. , 1222 to 1236, 1727 to 1743, 1858 to 1873, 1946 to 1960, 2294 to 2308, 2360 to 2377, 2449 to 2469, 2605 to 2624, An antisense oligonucleotide comprising a sequence hybridizable to a sequence consisting of positions 2689 to 2703, 2950 to 2964, 3424 to 3438, or 3591 to 3605.
2. The antisense oligonucleotide according to claim 1, which suppresses the expression of ACSL1.
3. The antisense oligonucleotide according to claim 1 or 2, which has a length of 13 to 19 bases.
4. The antisense oligonucleotide according to any one of claims 1 to 3, comprising at least one sugar-modified nucleoside having a cross-linked structure between the 4'-position and the 2'-position.
5. The antisense oligonucleotide according to claim 4, wherein the bridge structure is -CH ₂ -O- or -CO-NR ^1- (R ¹ is a hydrogen atom or alkyl).
6. The antisense oligonucleotide according to any one of claims 1 to 5, wherein the one or more bonds between nucleosides are phosphorothioate bonds.
7. SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70, or
   1 or number in the sequences of SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70 The antisense oligonucleotide according to any one of claims 1 to 6, comprising a sequence in which one base is deleted, substituted or inserted.
8. SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70, or
   1 or number in the sequences of SEQ ID NOs: 6-11, 13-18, 20-22, 24-30, 32, 35-37, 46, 48, 49, 52-54, 57-59, 64-68 or 70 The antisense oligonucleotide according to claim 7, comprising a sequence in which one base is deleted, substituted, inserted or added.
9. A pharmaceutical composition comprising the antisense oligonucleotide according to any one of claims 1 to 8.
10. ACSL1 is used for the prevention or treatment of diseases associated with, claim 9 pharmaceutical composition.
11. The disease is obesity or type II diabetes, claim 10 pharmaceutical composition.

Images