WO2013116503A2

WO2013116503A2 - Exhaled nucleic acid detection for non-invasive assessment of the lung

Info

Publication number: WO2013116503A2
Application number: PCT/US2013/024121
Authority: WO
Inventors: Simon D. Spivack; Weiguo Han; Miao Shi; Gregory J. Hurteau
Original assignee: Albert Einstein College Of Medicine Of Yeshiva University; Ordway Research Institute, Inc.
Priority date: 2012-02-02
Filing date: 2013-01-31
Publication date: 2013-08-08
Also published as: WO2013116503A3

Abstract

A method of detecting a microRNA present in a lung of a subject comprising amplifying, from a sample of exhaled breath condensate from the subject, a microRNA present therein by reverse transcription-polymerase chain reaction (RT-PCR) of the microRNA to corresponding DNA. Detection of pathogenic organisms or macromolecules in the lung are also encompassed.

Description

EXHALED NUCLEIC ACID DETECTION

FOR NON-INVASIVE ASSESSMENT OF THE LUNG

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of U.S. Provisional Application No. 61/594, 101, filed February 2, 2012, the contents of which are hereby incorporated by reference.

STATEMENT OF GOVERNMENT SUPPORT

[0002] This invention was made with government support under grant number 1R21CA121068 and 1K24-CA 139054-01 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

[0003] Throughout this application various publications are referred to by first author and year in parentheses. Full citations for these references may be found at the end of the specification. The disclosures of each of these publications, and also the disclosures of the patents and patent application publications and books referenced hereinbelow, are hereby incorporated by reference in their entirety into the subject application to more fully describe the art to which the subject invention pertains.

[0004] Non-invasive access to visceral organs allows for improved capacity for earlier diagnostics and disease screening, since the risk-benefit equation is shifted by their availability. Indeed, pre-symptomatic testing can be considered a critical prelude to population health management inherent to public health, rather than the late-stage disease management inherent to current models of health care.

[0005] Non-invasive approaches to the lung have been challenging. Sputum-based approaches are limited by the fact that only a small fraction of the cells/material in sputum are epithelial in origin, and many subjects simply do not produce sputum. Blood-based approaches are limited by the general finding that the lung epithelial compartment is not well reflected in the blood compartment.

[0006] The exhaled breath approaches solves this lung access problem by taking advantage of the anatomic and embryologic nature of the lung, as an invagination of the foregut, which contacts the ambient environment directly. As such it is a window into this visceral organ, to the extent that volatile or exfoliated and suspended molecules are carried in the breath. Exhaled breath condensate has been used for nucleic acid detection for DNA mutations [Gessner 2004], and micros atellite aberrancies [Carpagnano 2005, 2007]. However there are limitations to this technology, and it is not clear whether other nucleic acid types are present or detectable.

[0007] The present invention addresses the need for improved non-invasive diagnostic techniques based on exhaled nucleic acid detection.

SUMMARY OF THE INVENTION

[0008] A method is provided of detecting a microRNA ("miRNA") present in a lung of a subject comprising amplifying, from a sample of exhaled breath condensate from the subject, a microRNA present therein by reverse transcription-polymerase chain reaction (RT-PCR) of the microRNA to a corresponding DNA, and determining the presence of the DNA corresponding to the microRNA, so as to detect the microRNA present in the lung of the subject.

[0009] Also provided is a method of detecting a genomic DNA ("gDNA") of an organism present in a lung of a subject, wherein the organism is not the subject, comprising amplifying from a sample of exhaled breath condensate from the subject a genomic DNA fragment present therein by real-time transcription-polymerase chain reaction (PCR) of the genomic DNA fragment, and then determining the presence of a DNA corresponding to the genomic DNA of the organism, so as to detect the genomic DNA of the organism present in the lung of the subject.

[0010] Also provided is a method of diagnosing a subject as having lung cancer comprising, by any of the methods herein disclosed for detecting miRNAs in an exhaled breath condensate (EBC) of a subject, detecting if miRNAs 147b, 212, 216b, 18a, 21, 494, 566, 708, and 1827, are present in an EBC from the subject, wherein the subject is diagnosed as having lung cancer if (i) miRNAs 18a, 147b, 212, and 216b are detected in the EBC, and (ii) miRNAs 21, 494, 566, 708, and 1827 are not detected in EBC, and wherein the subject is not diagnosed as having lung cancer if any other combination of the miRNAs is detected present or absent.

[0011] Also provided is a method of diagnosing a subject as at risk for a respiratory system cancer comprising, by the methods above, detecting if miRNAs associated with being at risk for the respiratory system cancer are present in an exhaled breath condensate (EBC) from the subject, wherein the subject is diagnosed as at risk for the respiratory system cancer if the miRNAs associated with being at risk for the respiratory system cancer are present. [0012] A method of treating, or of reducing the development of, lung cancer in a subject comprising i) diagnosing the subject as having, or at risk of developing, the lung cancer by the methods described herein, and ii), for a subject so diagnosed as having or at risk of developing the lung cancer, a) administering to the subject a chemotherapeutic, a radiotherapy, or a combination of both so as to treat or reduce development of the lung cancer, and/or b) surgically operating on the lung so as treat or reduce development of the lung cancer.

[0013] A method of treating, or of reducing the development of, respiratory system cancer in a subject comprising i) diagnosing the subject as having, or at risk of developing, the respiratory system cancer by the methods described herein, and ii), for a subject so diagnosed as having or at risk of developing the respiratory system cancer, a) administering to the subject a chemotherapeutic, a radiotherapy, or a combination of both so as to treat or reduce development of the respiratory system cancer, and/or b) surgically operating on the lung so as treat or reduce development of the respiratory system cancer.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1. The tag-modified RT-PCR method is RNA-specific, and was adapted herein to the measurement of microRNA-PCR with internal housekeeper controls, as published in an in vitro experimental context [Hurteau 2006, Hurteau 2007]. The ability to perform this assay in exhaled breath is shown here for miRs 21, 193b, 200c, 205, showing gels of final PCR products from two donors, and the respective real-time dissociation (melt) curve analysis for verification. The translational implication is that the microRNA level of gene regulatory control in the lung is non-invasively accessible for study in humans.

[0015] Figure 2A-2B. Exhaled microRNA verification. MicroRNAs with phenotype- and expression-distinguishing characteristics are detected in exhaled breath condensate. In 30 subjects, miR-200b/c was sporadically detected (2A); others (e.g. miR-212, (2B)) were universally detected. Arrows show control, which is -40-60 bp because of the combined length of the miR (~20-22bp) plus the length of the URT primer with 10-20 poly Ts and 18 bp universal tag. Gels depict the extensive controls (a)-(f), used, including (a) cDNA from synthetic miRNA (200c, includes polyA tailing and RT steps); (b) no RT (RTase omitted, precluding RNA-derived product); (c) cDNA from messenger RNA (no polyA tailing step); (d) cDNA from EBC extract (includes polyA tailing and RT steps); (e) gDNA; (f) water. Gel & melt curves were concordant. [0016] Figure 3. A set of curves depict the ability of a panel of selected microR As to discriminate between human subjects who are lung cancer cases versus non-lung cancer controls. The receiver operated curves depict discriminant signal (area under curve of sensitivity plotted against non-specificity (1 -specificity) for candidate exhaled microRNAs; this ranges from 0.76 to 0.70, depending on the replicate batch, essentially a measure of (moderate) accuracy in categorizing the subject, and in line with those of other disease risk factors (e.g. blood cholesterol levels for coronary disease).

[0017] Figure 4. An example of a disposable cooled plastic condensing device (RTube®) is depicted.

DETAILED DESCRIPTION OF THE INVENTION

[0018] A method is provided of detecting a microRNA present in a lung of a subject comprising amplifying, from a sample of exhaled breath condensate from the subject, a microRNA present therein by reverse transcription-polymerase chain reaction (RT-PCR) of the microRNA to a corresponding DNA, and determining the presence of the DNA corresponding to the microRNA, so as to detect the microRNA present in the lung of the subject. In an embodiment, the method further comprises quantitatively determining the levels of one or more DNAs corresponding to one or more microRNAs from the sample, so as to thereby quantitatively profile the microRNAs present in the lung of the subject.

[0019] Also provided is a method of detecting a genomic DNA of an organism present in a lung of a subject, wherein the organism is not the subject, comprising amplifying from a sample of exhaled breath condensate from the subject a genomic DNA fragment present therein by real-time transcription-polymerase chain reaction (PCR) of the genomic DNA fragment, and then determining the presence of a DNA corresponding to the genomic DNA of the organism, so as to detect the genomic DNA of the organism present in the lung of the subject. In an embodiment, the method further comprises quantitatively determining the levels of one or more DNAs corresponding to genomic DNA of the organism from the sample, so as to thereby quantitatively profile the genomic DNA of the organism present in the lung of the subject.

[0020] In an embodiment, the methods further comprise obtaining the sample of exhaled breath condensate from the subject. In an embodiment, the exhaled breath is condensed on a cooled plastic condensing device so as to form an exhaled breath condensate.

[0021] In a preferred embodiment, wherein the method is applicable to miRNA, the microRNA is 20-22 nucleotide residues in length. In a preferred embodiment, the RT-PCR is effected comprising use of a universal reverse transcription primer. In a preferred embodiment, the method further comprises precipitating microRNAs from the exhaled breath condensate and polyA-tailing precipitated microRNAs prior to RT-PCR. In a preferred embodiment, the method further comprises effecting a real time-polymerase chain reaction (qRT-PCR) subsequent to the RT-PCR so as to increase the number of DNA molecules corresponding to the microRNA. In a preferred embodiment, the method further comprises comprising concentrating the miRNA prior to reverse transcription-polymerase chain reaction by precipitating the miRNAs with a carrier molecule. In a preferred embodiment, the carrier molecule is glycogen.

[0022] In a preferred embodiment, wherein the method is applicable to DNA, the method further comprises concentrating the gDNA fragment prior to polymerase chain reaction by precipitating the gDNA fragment with a carrier molecule. In a preferred embodiment, the carrier molecule is glycogen.

[0023] In an embodiment, the methods further comprise poly-A tailing the miRNA prior to the RT-PCR.

[0024] In an embodiment of the methods wherein the DNA of an organism which is not the subject is being detected, the organism is a pathogen relative to the subject. In a preferred embodiment the organism is a virus or bacterium. In a more preferred embodiment the organism is a mycobacterium. In a most preferred embodiment the mycobacterium is

Mycobacterium tuberculosis.

[0025] In an embodiment of the methods, the subject is unable to produce a sputum sample. In an embodiment of the methods, the subject is HIV positive. In an embodiment of the methods, the subject is suspected of having a cancer. In an embodiment of the methods, the cancer is cancer of the airways. In an embodiment of the methods, cancer is cancer of the lung.

[0026] A method is also provided of diagnosing a pathological state, or diagnosing a subject as at risk of developing a pathological state, in a subject based on the presence of a miRNA or a miRNA signature in an EBC sample of the subject. A miRNA signature is a pattern of miRNAs, the presence and/or absence of which, as a pattern, is indicative of a positive diagnosis of the disease state. In a non-limiting example, the (i) presence of a plurality of specific miRNAs and (ii) absence of a second plurality of miRNAs in the EBC sample of the subject can indicate a positive diagnosis for a disease state, or risk therefor, associated with that miRNA signature. In a non-limiting example, the (i) presence of a plurality of specific miRNAs and (ii) absence of a second plurality of miRNAs in the EBC sample of the subject can indicate a negative diagnosis for a disease state, or risk therefor, associated with that miRNA signature. In a non-limiting example, the presence of a plurality of specific miRNAs in the EBC sample of the subject can indicate a positive diagnosis for a disease state, or risk therefor, associated with that miRNA signature. In a non-limiting example, the presence of a plurality of specific miRNAs in the EBC sample of the subject can indicate a negative diagnosis for a disease state, or risk therefor, associated with that miRNA signature. In a non-limiting example, the absence of a plurality of specific miRNAs in the EBC sample of the subject can indicate a negative diagnosis for a disease state, or risk therefor, associated with that miRNA signature. In a non-limiting example, the absence of a plurality of specific miRNAs in the EBC sample of the subject can indicate a positive diagnosis for a disease state, or risk therefor, associated with that miRNA signature.

[0027] In an embodiment, the disease state is a cancer. In a preferred embodiment, the cancer is a cancer of the respiratory system. In an embodiment, the cancer is cancer of the esophagus, nasopharynx, pharynx, or lung. In a most preferred embodiment, the cancer is a cancer of the lung. In an embodiment, the cancer is cancer of the breast, bone, brain, sialaden, stomach, testes, ovary, uterus, liver, small intestine, appendix, colon, rectum, gall bladder, pancreas, kidney, urinary bladder, breast, cervix, vagina, vulva, prostate, or thyroid.

[0028] In an embodiment, the disease state is a disease of the respiratory system. In an embodiment, the disease is chronic obstructive pulmonary disorder, emphysema, or asthma.

[0029] As used herein "at risk" is a state of a subject, with regard to a pathological state, recognized in the art as being wherein the subject has a greater propensity to develop the disease than that portion of the population determined to be "not at risk." In effect, it identifies the subject as a member of the "at risk" portion of the population. The evaluation of miRNAs expression is of prognostic value, for example, as exemplified by the correlation of let-7 and mir-155 levels with disease survival in nonsmall cell lung cancer.

[0030] Also provided is a method of diagnosing a subject as having lung cancer comprising detecting, by any of the methods herein disclosed for detecting miRNAs in an exhaled breath condensate (EBC) of a subject, if miRNAs 147b, 212, 216b, 18a, 21, 494, 566, 708, and 1827, are present in an EBC from the subject, wherein the subject is diagnosed as having lung cancer if (i) miRNAs 18a, 147b, 212, and 216b are detected in the EBC, and (ii) miRNAs 21, 494, 566, 708, and 1827 are not detected in EBC, and wherein the subject is not diagnosed as having lung cancer if any other combination of the miRNAs is detected present or absent. (miRNA sequences can be found at www.mirbase.org). Mature sequence for 147b is gugugcggaaaugcuucugcua (SEQ ID NO: l); mature sequence for 212 is accuuggcucuagacugcuuacu (SEQ ID NO:2); mature sequence for 216b is aaaucucugcaggcaaauguga (SEQ ID NO:3); mature sequence for 18a is uaaggugcaucuagugcagauag (SEQ ID NO:4); mature sequence for 21 is uagcuuaucagacugauguuga (SEQ ID NO:5); mature sequence for 494 is ugaaacauacacgggaaaccuc (SEQ ID NO:6); mature sequence for 566 is gggcgccugugaucccaac (SEQ ID NO:7); mature sequence for 708 is aaggagcuuacaaucuagcugg (SEQ ID NO:8); mature sequence for 1827 is ugaggcaguagauugaau (SEQ ID NO:9).

[0031] A method is also provided of diagnosing a pathological state in a subject based on the presence of (i) a heterologous (relative to the subject) nucleic acid or (ii) a genomic DNA or a fragment thereof, of an organism wherein the organism is not the subject, in an EBC sample of the subject.

[0032] In an embodiment, the organism is pathogen. In an embodiment, the heterologous nucleic acid has a pathogenic origin. In an embodiment, the pathogen is a virus or a bacterium. In an embodiment, the pathogen is a Mycobacterium tuberculosis. In an embodiment, thesubject is unable to produce a sputum sample. In an embodiment, the method comprises use of the primers set forth in Example 2 of this description.

[0033] Also provided is a method of diagnosing a subject as at risk for a respiratory system cancer comprising, by the methods above, detecting if miRNAs associated with being at risk for the respiratory system cancer are present in an exhaled breath condensate (EBC) from the subject, wherein the subject is diagnosed as at risk for the respiratory system cancer if the miRNAs associated with being at risk for the respiratory system cancer are present. In an embodiment, the respiratory system cancer is lung cancer. In an embodiment, the miRNAs are 147b, 212, 216b, 18a, 21, 494, 566, 708, and 1827, and wherein the subject is diagnosed as being at risk for lung cancer if (i) miRNAs 18a, 147b, 212, and 216b are detected in the EBC, and (ii) miRNAs 21, 494, 566, 708, and 1827 are not detected in EBC, and wherein the subject is not diagnosed as being at risk for lung cancer if any other combination of the miRNAs is detected present or absent.

[0034] U.S. Patent No. 7, 141,372 describes RNA amplification suitable for use in the exhaled microRNA assay, the disclosure of which is hereby incorporated by reference in its entirety.

[0035] As used herein, a "microRNA" ("miRNA") is a short RNA sequence of 16-35 nucleotides in length, commonly in the range of 20-22 nucleotides in length, and as found in eukaryotes. Generally, miRNAs are post-transcriptional regulators that bind to complementary sequences on target messenger RNA transcripts (mRNAs), usually resulting in translational repression or target degradation and gene silencing. The miRNA database, miRBase, can be found at www.mirbase.org.

[0036] As used herein, a "pathogen" is a microorganism which has infected a host subject. In general, pathogens cause disease in the host subject. In an embodiment of the methods disclosed herein, the pathogen is a pathogen of the mammalian lung. In an embodiment the pathogen is a virus. Non-limiting examples of viral pathogens include influenza viruses. In a preferred embodiment the pathogen is a bacterium. Non-limiting examples of pathogens include Mycobacterium tuberculosis, Mycobacterium bovi, Pneumocystis carinii, Histopiasma capsuiatum, Aspergillus fumigatus, and Coccidioides immitis.

[0037] As used herein, an "exhaled breath condensate" is a condensate of breath expired or exhaled from a subject. Condensation of the exhaled breath can be obtained by any means known in the art, for example by cooling the collected exhaled breath. Devices are known in the art for easily effecting collection and condensation of exhaled breath, for example the RTube™ (Respiratory Research, Charlottesville, VA) (Fig. 4).

[0038] As used herein, a "primer" is a short, chemically synthesized oligonucleotide which is designed to be hybridized to a target nucleic acid and to permit initiation of DNA polymerization by a DNA polymerase. The primer can be of any suitable length that permits this function.

[0039] Pairs of primers preferably have similar melting temperatures since annealing in a PCR will then occur for both simultaneously. Primer sequences are preferably chosen to uniquely select for a region of DNA to avoid mishybridization to a similar sequence. For example, a BLAST search may be used, e.g. see www.ncbi.nlm.nih.gov/tools/primer-blast/. In an embodiment, mononucleotide repeats should be avoided. Primers are preferably selected such that the primers used should not easily anneal with other primers in the mixture.

[0040] As used herein, hybridizing a primer to each strand of a denatured DNA construct is a standard technique well known to one of ordinary skill in the art (for example, see PCR Primer: A Laboratory Manual, Second Edition, edited by Carl W. Dieffenbach and Gabriela S. Dveksler, Cold Spring Harbor Laboratory Press, 2003, ISBN 978-087969654-2, which is hereby incorporated by reference).

[0041] A method of treating, or of reducing the development of, lung cancer in a subject comprising i) diagnosing the subject as having, or at risk of developing, the lung cancer by the methods described herein, and ii), for a subject so diagnosed as having or at risk of developing the lung cancer, a) administering to the subject a chemotherapeutic, a radiotherapy, or a combination of both so as to treat or reduce development of the lung cancer, and/or b) surgically operating on the lung so as treat or reduce development of the lung cancer.

[0042] A method of treating, or of reducing the development of, respiratory system cancer in a subject comprising i) diagnosing the subject as having, or at risk of developing, the respiratory system cancer by the methods described herein, and ii), for a subject so diagnosed as having or at risk of developing the respiratory system cancer, a) administering to the subject a chemotherapeutic, a radiotherapy, or a combination of both so as to treat or reduce development of the respiratory system cancer, and/or b) surgically operating on the lung so as treat or reduce development of the respiratory system cancer.

[0043] The various methods disclosed herein can be used with any mammalian subject. Preferably, the mammal is a human.

[0044] Where a numerical range is provided herein, it is understood that all numerical subsets of that range, and all the individual integers contained therein, are provided as part of the invention. Thus, an miRNA which is from 16 to 35 nucleotides in length includes the subset of miRNA which are 18 to 22 nucleotides in length, the subset of miRNA which are 20 to 25 nucleotides in length etc. as well as a miRNA which is 20 nucleotides in length, a miRNA which is 21 nucleotides in length, a miRNA which is 22 nucleotides in length, etc. up to and including a miRNA which is 35 nucleotides in length.

[0045] All combinations of the various elements described herein are within the scope of the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[0046] This invention will be better understood from the Experimental Details, which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims that follow thereafter.

Introduction

[0047] There are few published data on microRNA deregulation in the human airway [Adcock 2006, 2007, Schembri 2009], and no published data on microRNAs in exhaled breath. It was hypothesized by applicants that small RNAs might be more resistant to degradation than larger transcripts. In this regard, this laboratory had previously developed an RNA-specific means of measuring microRNAs [Hurteau 2006, 2007] and this was used as a starting point. Example 1 - EBC-miR

[0048] In an initial experiment, four different microRNAs from deep lung in exhaled breath condensate were successfully detected (Fig. 1), and five other microRNAs tested were absent (not shown). These data indicate that the measurement at the microRNA level of gene (de)regulation in the lung is non-invasively determinable.

[0049] In subsequent studies, 14 arbitrarily chosen microRNAs from deep lung in exhaled breath condensate were successfully detected in 30 subjects (Fig. 2, Table 1). There were no sample failures, all subjects were positive for at least two of 14 microRNAs in exhaled breath.

[0050] Table 1 - Expression profiling of 18 miRNAs in 22 cases and 23 controls (n=45 total). MiR-18a, and miR-212 were statistically different between lung cancer cases (1), and non-cancer controls (2). Corroborating EBC data has been obtained for miR 18a, and 13 other miRs from additional subjects (See Table 2).

[0051]

1 1 1 1 1 1 1 1 + 1 1 1 + 1 + 1 1 1 1 1 1 1 1 1 1

1 1 1 1 1 1 1 1 1 + + 1 + 1 1 1 1 1 1 1 1 1 1 1 1

+ 1 + 1 1 1 1 + + 1 + 1 1 1 1 1 + 1 1 + 1 + 1 1 1

+ + + 1 1 1 + + + + + 1 + + + + + + 1 1 1 1 1 1 1

1 1 1 1 1 1 1 1 1 + 1 1 1 1 1 1 + 1 1 1 1 1 1 1 1

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

1 + + 1 1 1 1 1 1 1 1 1 1 1 1 + 1 1 1 1 1 1 1 1 1

1 + + 1 1 1 1 1 1 1 1 1 + + + 1 1 1 1 1 1 1 1 1 1 cn o cn CN] n LO cn co 00 cn o LO o CD en LO CD CN] t - en LO

CN] co LO CD CD t - 00 n CN] CN] CN] LO LO CD cn

CD CD CD LO LO LO LO LO LO LO LO LO LO LO CD CD CD CD CD CD CD CD CD CD CD

o o o o o o o o o o o o o o o o o o o o o o 23 cases 22 controls

[0052] Table 2: Batch 1; N=23 cases, 22 controls

[0053] Table 3: Batch 2; N=25 cases, 25 controls

[0054] Table 4: Pooled 1+2: N=48 cases, 47 controls

[0055] Tables 2-4 above list individual microRNA correlation with case-control status. ROC curves can be constructed which play sensitivity off of specificity for measuring test performance. The ROC curves represent the ability, for example, of the exhaled microRNA panel to distinguish a lung cancer case from a non-cancer control. The data is presented as cross sectional data (case-control). A random, useless test is ROC = 0.50. A perfect test = 100% sensi, 100%) speci, is ROC=1.00. Using logistic regression with bootstrap validation, in initial studies of exhaled microRNAs ROCs of 0.70-0.76 were found (Fig. 3), which demonstrates usefulness for defining a risk factor. Such results can be used in combination with, for example, CT screening as a disease detection tool to resolve the false positives problem of CT screening.

Materials and Methods

[0056] B. EBC-miR Protocol:

Part 1 : EBC (Exhaled Breath Condensate) collection

Use RTube™ (Respiratory Research, Charlottesville, VA) to collect patient's EBC.

[0057] Part 2 : Concentration of EBC microRNAs

Use ethanol to precipitate microRNAs in EBC.

In a 1.5 -ml eppendorf tube, add the following components:

EBC solution: 0.3 ml

3M sodium acetate (pH 5.5): 30 μΐ

20 μg/μl glycogen: 2 μΐ

Cold 100% ethanol: 1 ml

Chill the solution at -80 °C for 30 min.

Centrifuge the mixture at 14,000 rpm for 20 min at 4 °C. Discard the supernatant.

Rinse the pellet with cold 70% ethanol. Air-dry the pellet.

Dissolve the pellet in 15 μΐ RNase-free water.

[0058] Part 3 : microRNA real-time PCR

Step 1 : PolyA tailing

Ambion polyA tailing kit (Cat. No AM 1350)

First, dilute ATP to 100X

Then, prepare master mix:

3.45 μΐ mixture + 6.55 μΐ RNA

Incubate the reaction at 37°C for 30 min.

Step 2: reverse transcript for polyA tailed RNA Prepare master mix A:

URT (50 μΜ): 2 μΐ

3 μ1 + 10 μΙ ΚΝΑ-polyA

dNTP (10 μΜ each): 1 μΐ

Incubate the reaction at 65°C for 10 min. and then cool it on ice immediately.

Prepare master mix B:

5X first-strand buffer: 4 μΐ

7 μ1

[0059] Add B to A (final volume: 20 μΐ)

Incubate:

42 °C for 30 min.

50 °C for 30 min.

70 °C for 15 min.

Hold at 4 °C

[0060] Precipitate cDNA with ethanol

In a 1.5 -ml eppendorf tube, add the following components:

Reverse transcription products : 20 μΐ

3M sodium acetate (pH 5.5): 10 μΐ

RNase-free water: 70 μΐ

Cold 100% ethanol: 300 μΐ

[0061] Chill the solution at -80 °C for 30 min.

[0062] Centrifuge the mixture at 14,000 rpm for 20 min at 4 °C. Discard the supernatant.

[0063] Rinse the pellet with cold 70% ethanol. Air-dry the pellet.

[0064] Dissolve the pellet in 70 μΐ RNase-free water.

[0065] Step 3 : real-time PCR

PowerS YBR green master mix: Applied Biosystem, CAT#: 4367659 Master mix:

2X SYBR buffer: 10 μΐ

H₂0: 7.6 μΐ >~ 18 μ1 + 2 μ1 cDNA

Primers (10 μΜ mix): 0.4 μΐ _J

[0066] PCR conditions:

1. 50 °C for 2 min.

2. 95 °C for 10 min.

3. 95 °C for 15 s.

4. 60 °C for 15s.

5. 72 °C for 32 s. (reading plate)

6. Go back to step 3, repeat 45x

7. 72 °C for 2 min.

8. Melting curve

Example 2 - Pathogen diagnostics

[0067] It is envisioned that an EBC-coupled nucleic acid amplification can be used for pathogen diagnostics. For example, EBC-coupled nucleic acid amplification for tuberculosis (MTb) diagnostics may provide complementary data to tests on patients who simply cannot produce any sputum (10-30% in those with HIV) [Hartung 2002], as well as in those who do produce sputum but are 'smear negative' (about half of those with pulmonary TB and HIV co- infection), where typical nucleic acid amplification test (NAAT) sensitivities are 40-80%, and ROC AUC is typically -75% [Sarmiento, 2003; Breen 2007, Ling 2008, Broehme 2010].

[0068] Two previous literature reports of attempted exhaled breath diagnosis of MTb yielded negative results [Schreiber 2002, Jain 2007]. They did not employ, however, several techniques of isolation and amplification described herein.

[0069] An MDR- and XDR-MTb cohort can be assembled. Meticulous handling of EBC is employed, careful extraction of MTb gDNA first by ethanol precipitation, then phenol/chloroform extraction, and gDNA-qPCR using a "homebrew" quick-design primer/probeset aimed at the RD1 region, is expected to permit detection of Mtb genomes in human EBC, e.g. down to one copy (~2 femtograms Mtb genomic DNA) per milliliter of exhaled condensate, a typical EBC collection volume. Specificity to MTb, versus M. bovis and other non-tuberculosis mycobacteria will depend on the target sequence chosen for amplification.

[0070] EBC samples from sputum AFB smear negative, culture positive cases will be examined. All positive and negative controls should be clean. The incremental value of EBC in sputum culture negative cases that prove to have MTb on more invasive testing (bronchoscopy, surgical or post-mortem) microbiologic grounds is determined. EBC may be an effective biomarker for TB disease, and paucibacillary disease. EBC is also used to detect rpo B mutations for patients have known Rifampicin (RIF) resistance. It is expected the method is able to detect similar percentages of RIF resistance.

Protocol:

[0071] Exhaled breath condensate (EBC) collection: The EBC is collected in a handheld, disposable RTube® exhaled breath condenser (Respiratory Research, Charlottesville, VA) during 10 to 15 minutes of quiet tidal volume breathing, interspersed with frequent sighs, huffs, coughs. Approximately 1.0 ml of EBC is collected. The collected EBC can be stored at -20°C.

[0072] DNA extraction from EBC: 10μg of glycogen is added as DNA carrier. Add one tenth volume of 3M sodium acetate and one equal volume of isopropanol. Spin for 30 minutes at 4 °C. Wash the pellet with 0.5ml of 80% ethanol. The pellet is dissolved in 0.5ml water. Add 0.5ml Phenyl: chloroform: isoamyl ethanol (25:24: 1). Mix thoroughly, spin for 5 minutes at maximum speed. Remove aqueous layer (top layer) to a new tube, add equal volume of chloroform: isoamyl ethanol (24:1), mix and spin 2 minutes at maximum speed. Collect the aqueous (top) layer to a new tube; add one tenth volume of 3M sodium acetate and lOmg of glycogen. Add equal volume of isopropanol, mix thoroughly, and spin 30 minutes at 4 °C. Remove the supernatant carefully and add 0.5ml of 80% ethanol, spin 5 minutes. Remove the supernatant and dry the pellet for 15 minutes. Dissolve the pellet in 20 ml water.

[0073] Real-time PCR: The following primers and probe can be used - Forward RD1 region primer: 5^*-CTGGCTATATTCCTGGGCCCGG-3^* (SEQ ID NO: 10); Reverse RD1 region primer: 5 '-GAGGCGATCTGGCGGTTTGGGG-3 ' (SEQ ID NO: 11); Probe: FAM- AAAGTGTCTTCATCGGCTTCCACCCA- ABkFQ (SEQ ID NO: 12). PCR can be performed with 5μ1 of DNA extraction in a total volume of 50μ1 of PCR mix. The PCR mix can contain lOmM Tris-HCl (pH 8.3), 50mM KC1, 1.5mM MgCl₂, 200μΜ each deoxynucleoside triphosphate, 2.5 U of Gold DNA polymerase (AmpliTaq: Applied Biosystem), ΙμΜ each of primers and 200nM probe. The mixture is denatured for 9 minutes at 95°C, and cycled 45 times to 94°C for 30s and 65°C for 1 min. on ABI 7500 real-time PCR system.

Discussion

[0074] Herein, several nucleic acid assays for gene regulation and other studies are disclosed involving detection in an alternate airway specimen, exhaled breath condensate (EBC). The process details depend on the particular nucleic acid analyte class (e.g., microRNA versus DNA). Detection of native lung-derived small RNAs was observed in EBC.

[0075] While exhaled breath condensate has been used for nucleic acid detection for DNA mutations before [Gessner 2004], and microsatellite aberrancies [Carpagnano 2005, 2007] before, and failed attempts at mycobacterial genome detection in exhaled breath have been reported [Jain 2007, Schreiber 2002], the present exhaled nucleic acid technology is different and offers improved performance. For example, (1) exhaled microRNA detection has not been reported by others before to applicants' knowledge; (2) the approaches described herein generally use a more rigorous nucleic acid isolation techniques, including carrier molecules for nucleic acid pull-down; and careful attention to avoid shearing steps; (3) the approaches described herein generally use amplification and detection steps with several unique technologies developed for microRNA measurement. It is understood that these advantages confer a superior sensitivity and specificity.

[0076] The described assays have many applications. For chronic airways disease, they can serve as a screening tool for determining the incidence/course/severity of diffuse, airway- predominant disorders of the lung, such as asthma and COPD. For such monitoring, detecting gene dysregulation on the airway side offers an important adjunct to current clinical and mechanics-based disease course and severity assessments, to augment drug targeting and patient care. REFERENCES

1. Hurteau, GJ, Spivack SD, Brock G. Parallel identification of miRNA and target mRNA by combined informatics and qRT-PCR approaches: application to has-miR-200c. Cell Cycle 5(17): 1951-56, 2006.

2. Hurteau GJ, Carlson AJ, Spivack, SD, Brock GJ. Over-expression of the microRNA hsa-miR-200c leads to reduced expression of Transcription Factor 8 and increased expression of E-Cadherin. Cancer Res. 67(17):7972-96, 2007.

3. Adcock IA, Ford P, Kazuhiro I, Barnes PJ. Epigenetics and airways disease. Respir Res 7/1/21, 2006.

4. Adcock IA, Tsaprouni L, Bhavsar P, Ito K. Epigenetic regulation of airway inflammation. Curr Op Immunol 19:694-700, 2007.

5. Schembri F, Sridhar S, Perdomo C, et al. MicroRNAs as modulators of smoking- induced gene expression changes in human airway epithelium. PNAS 106(7):2319-24. 2009.

6. Sarmiento O, Weigle KA, Alexander J, et al. Assessment by meta-analysis of PCR for diagnosis of smear-negative pulmonary tuberculosis. J Clin Microbio. 41(7):3233-40, 2003.

7. Hartung TK, Maulu A, Nash J, Fredlund VG. Suspected pulmonary tuberculosis in rural South Africa: sputum induction as a simple diagnostic tool? S Afr Med J 92(6):455-8, 2002.

8. Breen RA, Hardy GA, Perrin FM, et al. Rapid diagnosis of smear-negative tuberculosis using immunology and microbiology with induced sputum in HIV-infected and uninfected individuals. PLoS One 2(12):21335, 2007.

9. Ling DI, Flores LL, Riley LW, Pai M. Commercial nucleic -acid amplification tests of diagnosis of pulmonary tuberculosis in respiratory specimens: Meta-analysis and meta- regression. PLoS One 2: el536, 2008.

10. Boehme CC, Nabeta P, Hillemann D, et al. Rapid molecular detection of tuberculosis and rifampin resistance. NEJM 363(11): 1005-15, 2010.

11. Schhreiber J, Meyer C, Rusch-Gerdes S, Richter E, et al. Mycobacterium tuberculosis gene-amplification in breath condensate of patients with lung tuberculosis. Europ. J Med Res. 7(6):290-l, 2002. 12. Jain R, Schriever CA, Danziger LH, Cho SH, Rubinstein I, The IS6110 Repetitive DNA element if Mycobacterium tuberculosis is not detected in exhaled breath condensate of patients with active pulmonary tuberculosis. Respiration 74:329-333, 2007.

Claims

What is claimed:

1. A method of detecting a microRNA present in a lung of a subject comprising amplifying, from a sample of exhaled breath condensate from the subject, a microRNA present therein by reverse transcription-polymerase chain reaction (RT-PCR) of the microRNA to a corresponding DNA, and determining the presence of the DNA corresponding to the microRNA, so as to detect the microRNA present in the lung of the subject.

2. A method of detecting a genomic DNA of an organism present in a lung of a subject, wherein the organism is not the subject, comprising amplifying from a sample of exhaled breath condensate from the subject a genomic DNA fragment present therein by polymerase chain reaction (PCR) of the genomic DNA fragment, and then determining the presence of a DNA corresponding to the genomic DNA of the organism, so as to detect the genomic DNA of the organism present in the lung of the subject.

3. The method of Claim 1, further comprising quantitatively determining the levels of one or more DNAs corresponding to one or more microRNAs from the sample, so as to thereby quantitatively profile the microRNAs present in the lung of the subject.

4. The method of Claim 2, further comprising quantitatively determining the levels of one or more DNAs corresponding to genomic DNA of the organism from the sample, so as to thereby quantitatively profile the genomic DNA of the organism present in the lung of the subject.

5. The method of any of Claims 1-4, further comprising obtaining the sample of exhaled breath condensate from the subject.

6. The method of any of Claims 1-5, wherein the exhaled breath is condensed on a cooled plastic condensing device so as to form exhaled breath condensate.

7. The method of any of Claims 1, 3, 5 or 6, wherein the microRNA is 20-22 nucleotide residues in length.

8. The method of any of Claims 1, 3, 5-7, wherein RT-PCR is effected using a universal reverse transcription primer.

9. The method of any of Claims 1, 3, 5-8, further comprising precipitating microRNAs from the exhaled breath condensate and polyA-tailing precipitated microRNAs prior to RT- PCR.

10. The method of any of Claims 1, 3, 5-9, further comprising effecting a real time- polymerase chain reaction (qRT-PCR) subsequent to the RT-PCR so as to increase the number of DNA molecules corresponding to the microRNA.

11. The method of any of Claims 1, 3, 5-10, further comprising concentrating the miRNA prior to reverse transcription-polymerase chain reaction by precipitating the miRNAs with a carrier molecule.

12. The method of any of Claims 2 or 4-6, further comprising concentrating the gDNA fragment prior to polymerase chain reaction by precipitating the gDNA fragment with a carrier molecule.

13. The method of Claim 11 or 12, wherein the carrier molecule is glycogen.

14. The method of any of Claims 1, 3, 5-11 or 13 further comprising poly- A tailing the miRNA prior to the RT-PCR.

15. The method of any of Claims 2, 4-6, or 11-13, wherein the organism is a pathogen relative to the subject.

16. The method of any of Claims 2, 4-6, 11 or 12, wherein the organism is a virus or bacterium.

17. The method of Claim 16, wherein the organism is a mycobacterium.

18. The method of Claim 17, wherein the mycobacterium is Mycobacterium tuberculosis.

19. The method of any of Claims 1-18, wherein the subject is unable to produce a sputum sample.

20. The method of any of Claims 1-19, wherein the subject is HIV positive.

21. The method of any of Claims 1-19, wherein the subject is suspected of having a cancer.

22. The method of Claim 21, wherein the cancer is cancer of the airways.

23. The method of Claim 21 , wherein the cancer is cancer of the lung.

24. A method of diagnosing a subject as having lung cancer comprising, by the method of Claim 1, 3 or 5-13, detecting if miRNAs 147b, 212, 216b, 18a, 21, 494, 566, 708, and 1827, are present in an exhaled breath condensate (EBC) from the subject, wherein the subject is diagnosed as having lung cancer if (i) miRNAs 18a, 147b, 212, and 216b are detected in the EBC, and (ii) miRNAs 21, 494, 566, 708, and 1827 are not detected in EBC, and wherein the subject is not diagnosed as having lung cancer if any other combination of the miRNAs is detected present or absent.

25. A method of diagnosing a subject as at risk for a respiratory system cancer comprising, by the method of Claim 1, 3 or 5-13, detecting if miRNAs associated with being at risk for the respiratory system cancer are present in an exhaled breath condensate (EBC) from the subject, wherein the subject is diagnosed as at risk for the respiratory system cancer if the miRNAs associated with being at risk for the respiratory system cancer are present.

26. The method of Claim 25, wherein the respiratory system cancer is lung cancer.

27. The method of Claim 25 or 26, wherein the miRNAs are 147b, 212, 216b, 18a, 21, 494, 566, 708, and 1827, and wherein the subject is diagnosed as being at risk for lung cancer if (i) miRNAs 18a, 147b, 212, and 216b are detected in the EBC, and (ii) miRNAs 21, 494, 566, 708, and 1827 are not detected in EBC, and wherein the subject is not diagnosed as being at risk for lung cancer if any other combination of the miRNAs is detected present or absent.

28. A method of treating, or of reducing the development of, lung cancer in a subject comprising i) diagnosing the subject as having, or at risk of developing, the lung cancer by the method of Claim 24, and ii), for a subject so diagnosed as having or at risk of developing the lung cancer, a) administering to the subject a chemotherapeutic, a radiotherapy, or a combination of both so as to treat or reduce development of the lung cancer, and/or b) surgically operating on the lung so as treat or reduce development of the lung cancer.

29. A method of treating, or of reducing the development of, respiratory system cancer in a subject comprising i) diagnosing the subject as having, or at risk of developing, the respiratory system cancer by the method of Claim 25, 26 or 27, and ii), for a subject so diagnosed as having or at risk of developing the respiratory system cancer, a) administering to the subject a chemotherapeutic, a radiotherapy, or a combination of both so as to treat or reduce development of the respiratory system cancer, and/or b) surgically operating on the lung so as treat or reduce development of the respiratory system cancer.