WO2013114406A2 - Primer for amplifying farnesyl pyrophosphate synthase from mango - Google Patents
Primer for amplifying farnesyl pyrophosphate synthase from mango Download PDFInfo
- Publication number
- WO2013114406A2 WO2013114406A2 PCT/IN2013/000071 IN2013000071W WO2013114406A2 WO 2013114406 A2 WO2013114406 A2 WO 2013114406A2 IN 2013000071 W IN2013000071 W IN 2013000071W WO 2013114406 A2 WO2013114406 A2 WO 2013114406A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- fpps
- mango
- synthase
- sequence
- farnesyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present invention relates to primers for amplifying farnesyl pyrophosphate synthase gene from mango.
- the invention further relates to a nucleotide sequence encoding said amplified Farnesyl Pyrophosphate Synthase (FPPS) for enzyme production in an artificial system thus generating the desired flavor in food products.
- FPPS Farnesyl Pyrophosphate Synthase
- Terpenoids form the largest class of plant secondary metabolites, comprising more than 55000 compounds. These molecules play very important ecological and physiological functions in plant life including attraction of pollinators, seed disseminators and predators of herbivores, repulsion of herbivores and pathogens, photosynthetic pigments, protein management (prenylation and ubiquitination) and growth regulation (gibberellins) (Vandermoten et al., 2009). In spite of such vast diversity in structure and function, all the terpenoids are derived from the common C5 precursors: dimethylallyl pyrophosphate (DMAPP) and isopentenyl pyrophosphate (IPP).
- DMAPP dimethylallyl pyrophosphate
- IPP isopentenyl pyrophosphate
- prenyl pyrophosphates formed by isoprenyldiphosphate synthases are the substrates in turn for terpene synthases, which produce the parent carbon skeletons of the terpenes. Being rich in the terpene flavorants, mango forms an appropriate system to study biosynthesis and regulation of monoterpenes.
- Farnesyl pyrophosphate synthase (FPPS) is one of the central enzymes in the terpenoid biosynthetic pathway in mango.
- FPP precursor for sesquiterpene volatiles and also for the higher terpenoids such as dolichols, phytoalexins, sterols, ubiquinones, farnesylated proteins and prenylatedheme group of cytochrome a and a3 (Chappell, 1995; Weinstein et al., 1986).
- FPP also contributes to the biosynthesis of carotenoids, chlorophylls, tocopherols, gibberellins and geranylgeranylated proteins, when it is involved in the formation of GGPP (Szkopinska and Plochocka, 2005).
- FPPS could well acts as a key regulatory point in terpenoid biosynthesis as well as an important player in controlling cell cycle progression, growth, development and general metabolism (Chappell, 1995; Gaffe et al., 2000; Grunler et al., 1994). Being such an important component of fruit physiology and metabolism, it has been hypothesized that FPPS plays a key role in the variable fruit quality that mango (Mangifera indica cv. Alphonso) exhibits among localities (Kulkarni et al., 2012).
- glycosylated sesquiterpenes contribute to the taste and flavor of fruits, volatile sesquiterpenes to the odor, carotenoids to the color and sterols to the texture (Chappell, 1995; Clark et al., 1987; Seigler, 1998).
- the deduced amino acid sequence of lupinfarnesyl pyrophosphate synthase pFPS2 shares 90% and 79% identity with those from Lupinusalbus (pFPSl ) and Arabidopsis thaliana, respectively, 51% with the yeast enzyme, and 44% identity with those from rat and human.
- Nucleotide sequencing revealed that it is a full length cDNA of 1.28 kb and the putative amino acid sequence exhibited 80.7 %, 78.9 % and 71.6 % identities with the FPP synthases of Artimisia annua, Arabidopsis thaliana and Zea mays respectively.
- the present invention provides primer sequence for amplifying farnesyl pyrophosphate synthase from mango.
- the invention provides an isolated nucleotide sequence encoding farnesyl pyrophosphate synthase (FPPS) from mango and a process of isolating the gene encoding functional farnesyl pyrophosphate synthase from mango.
- FPPS farnesyl pyrophosphate synthase
- a novel nucleotide sequence encoding farnesyl pyrophosphate synthase (FPPS) from mango is elucidated which is useful for enzyme production in an artificial system by appropriately mixing with the mango pulp to generate the desired flavor.
- the nucleotide sequences are also useful in the flavor industry for semi-biosynthesis of flavors via various approaches such as enzyme immobilization, single cell culture, etc., as well as to improve other varieties of mango.
- primers useful for amplification of farnesyl pyrophosphate synthase gene of mango wherein the said sequence is selected from the group consisting of Seq ID Nos 1-3 and 4-7.
- the present invention a forward and reverse gene specific primers of FPPS for amplification of the ends of cDNA by rapid amplification of cDNA ends (RACE).
- primers corresponding to the terminal regions of the mRNA which are designed for FPPS and which are used for the PCR amplification with mango cDNA as a template are provided.
- Figure 1 Complete open reading frame encoding farnesyl pyrophosphate synthase isolated from mango. (Seq ID 8)
- Figure 2 (a) Alignment of FPPS with the most similar sequences of other characterized plant FPP synthases. Five regions which are conserved among the isoprenyldiphosphate synthases (I-V) are indicated in dark cyan colour; FARM (region II) and SARM (region V) motifs are indicated in coral colour and the chain length determining stretch in the region II is indicated in purple colour.
- NCBI accession numbers of the sequences were: AAP74719 (Artemisia tridentata), AAV58896 (Centellaasiatica), AAR27053 (Ginkgo biloba), AAA86687 (Lupinusalbus), AAK63847 (Mentha x piperita), AAY87903 (Panax ginseng), AAS 19931 (Taxus x media), NP_001 105039 (Zea mays) and ACA21460 (Piceaabies). (b) Genomic organization of MFPPS. Numbers on the top and the bottom indicate sizes (base pair) of the introns and the exons, respectively.
- Figure 3 LC-MS/MS chromatogram of the in vitro assay products formed from IPP and DMAPP with the protein expressed from the empty vector (upper panel), and the purified MFPPS (middle panel). Chromatogram of standards for GPP, FPP and GGPP is presented in the lower panel.
- Figure 4 Optimum temperature, pH and MgC concentration of recombinant MFPPS. For each parameter, the maximum activity was set to 1. Letters over each point indicate the significance of ANOVA (p ⁇ 0.05) carried out by Fisher's LSD test independently for each of the three parameters; the values having different letters are significantly different from each other.
- Figure 5 Homology model of MFPPS generated using Avian FPPS (1 FPS) as a template.
- Figure 6 Abundance of MiFPPS transcripts relative to EF la during ripening of mango fruits from three cultivation localities, Dapoli, Deogad and Vengurle, in India (DAH: days after harvest). Values presented are averages of four independent biological replicates each of which was represented by at least two technical replicates. Letters over the columns indicate the significance of ANOVA (p ⁇ 0.05) carried out by Fisher's LSD test for the comparison between localities for each ripening stages; the values having different letter are significantly different from each other.
- the ANOVA based comparison is independent for each ripening stage and therefore, is represented by different series of letters (0 DAH: A, B, C; 5 DAH: a, b, c; 10 DAH: m, n, o and 15 DAH: x, y, z).
- Farnesyl pyrophosphate synthase means and refers to an enzyme that catalyzes formation of farnesyl pyrophosphate.
- the present invention relates to a primer sequence for amplifying farnesyl pyrophosphate synthase having sequence selected from the group consisting of Seq Id. nos.1 -3 and 5-7.
- the degenerate primers for amplification of mango cDNA are:
- RACE rapid amplification ends
- Primers corresponding to the terminal regions of the mRNA which are designed for FPPS and for the PCR amplification with mango cDNA as a template represent the following sequences:
- the present invention discloses an isolated novel nucleotide sequence encoding FPPS derived from mango (NCBI sequence ID: EU 513268).
- NCBI sequence ID: EU 513268 The complete open reading frame encoding farnesyl pyrophosphate synthase isolated from mango is as shown in Figure 1.
- a cDNA encoding farnesyl pyrophosphate synthase from mango has been isolated and sequenced, and the corresponding amino acid sequence has been deduced. Accordingly, the present invention relates to isolated DNA sequences which code for the expression of farnesyl pyrophosphate synthase, such as the sequence designated SEQ ID No: 8 which encodes farnesyl pyrophosphate synthase from mango.
- the nucleotide sequence encoding FPPS is useful for enzyme production in an artificial system.
- This artificially synthesized enzyme can be appropriately mixed with the mango pulp to generate the desired flavor.
- the nucleotide sequence is also useful for semi-biosynthesis of fla vors via various approaches such as enzyme immobilization, single cell culture, etc., as well as to improve other varieties of mango.
- Mature raw fruits of mango used in the present invention are collected from Dapoli, Deogad and Vengurle regions of Maharashtra.
- the complete open reading frame encoding farnesyl pyrophosphate synthase isolated from mango is as shown in Figure 1.
- the degenerate primers of farnesyl pyrophosphate synthase useful for the amplification of the mango cDNA are:
- the present invention disclose a process for isolating full-length nucleotide sequence encoding farnesyl pyrophosphate synthase from ripe mangoes designated as FPPS (JN388975) (Mangifera indica farnesyl pyrophosphate synthase). The process comprises the following steps:
- step (iv) designing gene specific primers for FPPS based on the sequence of the fragments obtained in step (iv);
- step (viii) amplifying mango cDNA using primers obtained in step (vii) by PCR (polymerase chain reaction) using the Expand High Fidelity PCR System (La Roche,
- the process of isolating full-length sequence of farnesyl pyrophosphate synthase ( /FPPS)from ripe mango fruits comprises isolating RNA by CTAB method, treating isolated RNA with DNase and carrying out reverse transcription of the isolated RNA.
- CTAB method treating isolated RNA with DNase and carrying out reverse transcription of the isolated RNA.
- primers are designed. These primers are used for the amplification of cDNA prepared from ripe fruits of mango. This is followed by designing gene specific primers based on the sequence of the fragments obtained by amplification over the cDNA.
- the gene specific primers are used for amplification of the ends of the cDNA by rapid amplification of cDNA ends (RACE). Based on the alignments of the 5' and 3' RACE fragments with the FPPS sequences reported from the other plants, primers corresponding to the terminal regions of the mRNA are designed and are used for obtaining full-length sequence of MiFPPS.
- the fragments are eluted from the agarose gel, ligated in a pGEM-T Easy vector and transformed in E.coli cells. Positive colonies are identified by colony PCR and the presence of desired insert is confirmed by sequencing. Sequences are aligned and analysed for the presence of uninterrupted reading frame in the MEGA 4.1 software.
- the degenerate primers designed in step (iii) of the process for isolating full-length nucleotide sequence encoding FPPS from ripe mangoes are as follows;
- step (v) of the process of isolating full-length nucleotide sequence encoding FPPS from ripe mangoes are as follows;
- the terminal primers designed in step (vii) of the process of isolating full-length nucleotide sequence encoding FPPS from ripe mangoes are as follows;
- the complete open reading frame (ORF) of MFPPS (JN 035296) thus obtained is 1029 base pair long and is flanked by 40 untranslated nucleotides at 5' end up to the first in-frame ATG and 259 nucleotides at the 3' end including the AATAAAA motif between the stop codon and the polyadenylation sequences.
- the reading frame encodes a protein of 343 amino acids with a calculated molecular weight of 39.5 kD and an isoelectric point of 5.35.
- ends of the cDNAs are amplified by RACE, the obtained fragments show sequence similarity to the 5 ' and 3' ends of full-length FPP synthase genes reported from the other plants.
- M. indica FPP synthase M. indica FPP synthase
- the genomic organization of M/FPPS shows the presence of 1 1 introns and 12 exons, consistent with that of an Arabidopsis FPP synthase gene, the only previous such gene whose genomic structure has been reported (Cunillera et a!., 1996).
- the length of the gene sequence isolated is 33 1 base pair.
- DMAPP condenses with the first molecule of IPP to produce gerenyl pyrophosphate (GPP) which remains enzyme bound (Elitzur et al., 2010) and this is used as an allylic substrate for the sub-sequential addition of another molecule of IPP.
- GPP gerenyl pyrophosphate
- FPPS does not show any activity when Mn 2+ is used as a divalent metal ion. Since mango fruits contain a more than 600 fold higher concentration of magnesium as compared to manganese (Malik et al., 2004), the lack of activity with Mn 2+ might be explained as an adaptation of M/ ' FPPS to the higher concentration of Mg 2+ in the fruits. The absence of activity with the other two divalent cations, Zn 2+ and Ca 2+ is consistent with most of the isopentenyldiphosphate synthases reported till now.
- the optimum pH of 7.5 observed for M/ ' FPPS is similar to the near-neutral optimal pH observed for FPP synthase from pumpkin fruit (Ogura et al., 1985), Ricinus communis (Green and West, 1974) and cotton (Widmaier et al., 1980).
- the pH of the mango fruit pulp is highly acidic and there is a sharp increase in fruit pH during ripening (Yashoda et al., 2006) which could result in increased activity of M/ ' FPPS because of shift of the physiological pH towards the optimal range of M/ ' FPPS.
- the temperature of mango fruits rises almost up to 40°C because of increased rate of respiration while ripening (Kumar et al., 1990). This balances the increased activity of M/ ' FPPS due to increased pH.
- the present invention further provides three-dimensional structure of M/ ' FPPS using avian FPPS as a template.
- the avian FPPS shows 50% sequence identity with ' M/ ' FPPS. Accordingly, homology modeling with the avian FPPS as a template is performed and the quality of the generated model is assessed by a Ramachandran plot, which shows the presence of 98% residues in the allowed region. All isoprenyl diphosphate synthases which carry out additions of IPP units to allylic substrates show the presence of five conserved regions (I-V). M/ ' FPPS contains all of these regions with regions II and V having the first and second aspartate-rich motifs (FARM and SARM), respectively.
- aspartate residues in these regions are involved in binding with the pyrophosphate moiety of substrate through Mg 2+ bridges (King and Rilling, 1977).
- the replacement of aspartate residues in these regions with other amino acids results in drastic reduction in enzymatic efficiency (Marrero et al., 1992) (Joly and Edwards, 1993; Song and Poulter, 1994).
- extension of the carboxylic side chains of these aspartate residues into the substrate binding cleft supports their role in binding the pyrophosphate moieties of the substrate.
- GGPP geranylgeranyl pyrophosphate
- Type II FPPS only the 4th amino acid upstream of FARM is aromatic and FARM is formed by DDX 4 D (Ohnuma et al., 1997). Based on these reports and the sequence analysis, M/FPPS can be classified as a Type I FPPS.
- the transcripts of M/FPPS are profiled through the four ripening stages of mango from Dapoli, Deogad and Vengurle regions of Maharashtra.
- the transcript profiling of M/FPPS reveals that the profile is consistent through the ripening process for all three localities. Such consistency suggests a key ripening-related role of the M/FPPS protein.
- the highest expression is observed at 10 days after harvest DAH stage. This is an important stage in the ripening of mango fruits in which the color turns yellowish and fruit softening begins.
- yeast FPPS resulted in the increased accumulation not only of sterols, but also of carotenoids (Daudonnet et al., 1997). Considering that the carotenoids are the major components of ripe mango color, a role of M ' FPPS in this aspect is also likely.
- the novel nucleotide sequence encoding FPPS may be used to generate a transgenic variety of mango.
- Sesquiterpenes represent one of the important classes of flavor and fragrance chemicals. These chemicals are also nowadays being considered for the biofuel applications.
- the coding sequence of the enzyme, farnesyl diphosphate synthase, characterized in this study can be used for biotechnological production of the recombinant enzyme which can be further used for the production of sesquiterpenes.
- the degenerate primers described here have been designed by homology-based approach based on the putative gene sequences reported from the other plants. These primers can thus be used for isolating similar genes from the other plants also.
- novel nucleotide sequences of the present invention can be used for enzyme production in an artificial system and later this artificially synthesized enzyme can be mixed appropriately with any desired food product for generating the desired flavor.
- the nucleotide sequences can also be used for semi-biosynthesis of flavors via various approaches such as enzyme immobilization, single cell culture, etc., as well as to improve other varieties of mango.
- farnesyl pyrophosphate (FPP) which is the product of FPPS, is a starting material for the synthesis of anticancer drugs (for example, artemisin).
- the dephosphorylated derivative of FPP, farnesol, as well as the downstream biological product of FPP, sesquiterpenes can be used as fragrance materials to impart floral odor.
- Farnesol also has the potential to be used as a biofuel component. References cited in Specification
- Arabidopsis thaliana contains two differentially expressed farnesyl-diphosphate synthase genes. Journal of Biological Chemistry 271, 7774-7780.
- the Arabidopsis thaliana FPSl gene generates a novel mRNA that encodes a mitochondrial farnesyl-diphosphate synthase isoform. Journal of Biological Chemistry 272, 15381 -15388.
- Daudonnet S., Karst, F., Tourte, Y., 1997. Expression of the farnesyldiphosphate synthase gene of Saccharomyces cerevisiae in tobacco. Molecular Breeding 3, 137- 145.
- LEFPS1 a tomato farnesyl pyrophosphate gene highly expressed during early fruit development. Plant Physiology 123, 1351-1362.
- MEGA4 Molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596-1599.
- Mature raw fruits of mango were collected from the orchards of Konkan Krishi Vidyapeeth at Dapoli ( ⁇ 17°45' E73° l ) and Deogad ( 16°3 ⁇ ⁇ 73°20') and from a private orchard at Vengurle ( ⁇ 15°51 ' ⁇ 73°39').
- fruits were collected from four plants. After harvesting, fruits were put in hay, carried to the laboratory and allowed to ripen at ambient temperature. At intervals of five days, fruits were cut, immediately frozen in the liquid nitrogen and stored at -80 °C until use, giving rise to four measurement points during ripening: 0, 5, 10 and 15 DAH (days after harvest) from each of the three localities.
- YTAYTTYTGCCTCTTRTADATYTT -3 ' were designed. These primers were used for the amplification over the cDNA prepared from ripe fruits of mango.
- the gene specific primers (for 5'- AGTATTCATTGCCACTTCATTGCCAG -3', rev 5'- ACTTTCATACTCTGCAAACGCACCC -3') designed based on the sequence of the fragments obtained were used for amplification of the ends of the cDNA by rapid amplification of cDNA ends (RACE) using a SMARTTM RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA).
- primers corresponding to the terminal regions of the mRNA were designed (for 5'- ATGAGTGATTTGAAGTCCAAGTTCG -3', rev 5'- CTACTTCTGCCTCTTATATATCTTGG -3') and were used for the PCR with mango cDNA as a template.
- the genomic fragment M/FPPS was isolated by carrying out PCR using the above-mentioned terminal primers over the genomic DNA isolated from mango leaves by the method described earlier (Pandit et al., 2007).
- the complete open reading frame of 1029 bp was flanked by 40 untranslated nucleotides at 5 ' end up to the first in-frame ATG and 259 nucleotides at the 3' end including the AATAAAA motif between the stop codon and the polyadenylation sequences.
- the reading frame encoded a protein of 342 amino acids with a calculated molecular weight of 39.5 kD and an isoelectric point of 5.35.
- MFPPS Mangifera indica FPPS
- regions II and V contained the first aspartate rich motif (FARM, between amino acids 93 and 97) and the second aspartate rich motif (SARM, between amino acids 232 and 236), respectively which are essential for substrate binding and catalysis ( Figure 2a).
- FARM first aspartate rich motif
- SARM second aspartate rich motif
- PCR was carried out on the genomic DNA of mango using the terminal primers. The resulting fragment of about 3.8 kb was cloned and its sequence was determined by primer walking.
- the genomic sequence of M/FPPS showed the presence of 1 1 introns having a total size of 2717 base pairs ( Figure 2b). The shortest and the longest introns had sizes of 87 base pairs and 897 base pairs, respectively. Almost all the introns followed the "GT-AG" rule (Breathnach and Chambon, 1981): the introns began with GT at the 5' ends and ended with AG at the 3' end. The length of the gene sequence isolated was 331 base pair.
- the full length sequence of mango FPPS ( FPPS) was amplified using the Expand High Fidelity PCR System (La Roche, Basel, Switzerland) with the terminal primers described above.
- cDNA prepared from the ripe fruit was used as template and the resulting fragment was cloned in the pEXP5-CT/TOPO expression vector (Invitrogen).
- the ligation reaction was transformed in the E. coli strain TOPI OF' (Invitrogen) and the transformants were selected on the LB-agar media containing 100 ⁇ g/ml carbenicillin.
- the recombinant plasmids were transformed in the BL21 (DE3) pLysS cells (Invitrogen). Five ml of starter culture grown at 18°C for 48 hours was used as inoculum for the expression in 100 ml LB medium with the Overnight Express Autoinduction System 1 ( ovagen, Madison, WI, USA). Cultures were grown for 24 hours at 18°C and the pellet obtained after centrifugation was resuspended in the buffer containing 25 mM MOPSO (pH 7.2), 10 mM MgCl 2 and 10% (v/v) glycerol and lysed by sonication.
- the (his) 6 -tagged recombinant protein was purified by passing the cleared lysate through Ni-NTA resin (Qiagen, Hilden, Germany) following the manufacturer's instructions. Elution was carried out with a buffer containing 250 mM imidazole, 25 mM MOPSO (pH 7.2), 10 mM MgCl 2 and 10% (v/v) glycerol. Both crude lysate and the purified protein were checked for the presence of the recombinant protein by SDS-PAGE. Before actual expression, the deduced amino acid sequence of FPPS was analyzed on the PROSO server to predict the solubility of the recombinantly expressed protein in E. coli.
- In vitro assay for determining the activity of FPPS was carried out in a final volume of 200 ⁇ containing about 0.5 ⁇ g of the purified protein, 25 mM MOPSO (pH 7.0), 10% (v/v) glycerol, 2 mM DTT, 10 mM MgCI 2 and 67 ⁇ of each DMAPP and IPP (Echelon Biosciences, Salt Lake City, USA).
- 67 ⁇ GPP was used as an allylic substrate instead of DMAPP in the separate reaction having the same composition as mentioned above.
- assays were performed in 25 mM MOPSO (pH 6 and 6.5), 25 mM HEPES (pH 7 and 7.5) or 25 mM TRIS (pH 8, 8.5 and 9) containing the other required components as mentioned above.
- the assays carried out for determining the optimum Mg 2+ concentration contained varied concentrations of MgCl 2 along with the other required components as mentioned above. After overnight incubation, the assay reactions were deproteinized by washing with equal volume of chloroform and used directly for LC-MS/MS analysis.
- the optimum temperature for the activity of recombinant enzyme was found to be 25°C and more than 75% of the optimum activity was retained at 15°C and 20°C; however, the activity was sharply reduced beyond 25°C (Figure 4).
- maximum FPP production was observed at pH 7.5 with retention of more than 80% activity between pH 7 and 9; however, only about 10% of the optimum activity was detected below pH 7.
- the enzyme also required Mg 2+ as a divalent metal ion cofactor for its activity.
- MgCl 2 concentration was found to be 0.3 mM with 67 ⁇ DMAPP and IPP and the enzyme possessed more than 75% of the maximum activity at 1 mM MgCl 2 after which the activity declined slowly.
- M/ ' FPPS specifically required Mg 2+ for catalysis and was found to be inactive with other divalent metal ions such as Mn 2+ , Zn 2+ and Ca 2+ in the concentration range of 0.5-12 mM.
- GPP was added as the allylic substrate instead of DMAPP. It was observed that i ' FPPS was able to condense GPP and IPP to produce FPP.
- Separation was achieved using a gradient starting at 0% B increasing to 10% B in 2 min, 64% B in 12 min and 100% B in 2 min keeping it at 100% B for 1 min followed by a change to 0% B in 1 min and keeping it for another 5 min before the next injection.
- Injection volume for samples and standards was 10 ⁇ .
- the mass spectrometer was used in the negative electrospray ionization mode. Optimal settings were determined using standards purchased from Sigma- Aldrich.
- Ion source gas 1 and 2 were set at 60 and 70 psi having a temperature of 700°C, curtain gas was set at 30 psi and collision gas at 7 psi.
- Ion spray voltage was maintained at -4200 V.
- M ' FPPS The three-dimensional structure of M ' FPPS was determined on the CPH model 3.0 server.
- Avian FPPS (PDB ID 1FPS) (Tarshis et al., 1994), which shows 50% sequence identity with FPPS, was used as a template.
- Ramchandran plot assessment of the structure was carried out on the RAMPAGE server (Lovell et al., 2003). Further quality parameters of the generated model were assessed on a web- based program, ProSA (Sippl, 1993; Wiederstein and Sippl, 2007).
- the quality of the generated model was assessed by a Ramachandran plot, which showed the presence of 98% residues in the allowed region. Further evaluation of the structure by ProSA-web yielded a Z-score of -9.46 and negative energy values for all the residues in the energy plot. Root mean square deviation for superimposition of the modeled structure of M/FPPS with the template (avian FPPS) was 0.61 A. All of these assessments point towards the good quality of the model generated for MFPPS.
- the avian FPPS has 10 helices (A-J). While the structure of MFPPS at the region corresponding to helix A of avian FPPS could not be determined because of low sequence identity of this region, the other nine helices (B-J) were evident and surrounded the central reaction cavity (Figure 5a). All the five regions conserved in isoprenyl diphosphate synthases lined the substrate binding cavity. The FARM and SARM regions were present on the opposite walls of the cavity on the D and H helix, respectively. The carboxylate side chains of all six aspartate residues in FARM and SARM were extended into the substrate binding cleft. The side-chain of ⁇ the phenylalanine residue present before FARM, known to be involved in the chain- length determination of the product, also protruded into the active-site cavity ( Figure 5b). EXAMPLE 8
- M/EFla Mango elongation factor la
- the transcripts were present in the higher amounts in the ripe ( 15 DAH) stage than the raw stage, the levels were reduced by about half in comparison with 10 DAH, at all three localities.
- the localities were compared to each other for the expression level of M/FPPS, at 0 and 15 DAH the highest expression was depicted by the Deogad fruits; whereas, at 5 and 10 DAH, the maximum expression was shown by the Dapoli fruits ( Figure 6).
- the M/FPPS expression pattern through ripening was similar for all three localities, only the correlation between Dapoli and Vengurle was significant at p ⁇ 0.05
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Mycology (AREA)
- Botany (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Enzymes And Modification Thereof (AREA)
- General Preparation And Processing Of Foods (AREA)
- Preparation Of Fruits And Vegetables (AREA)
- Coloring Foods And Improving Nutritive Qualities (AREA)
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP13708534.6A EP2809808A2 (en) | 2012-02-03 | 2013-02-01 | Primer for amplifying farnesyl pyrophosphate synthase from mango |
| US14/376,402 US9650683B2 (en) | 2012-02-03 | 2013-02-01 | Primer for amplifying farnesyl pyrophosphate synthase from mango |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| IN0303/DEL/2012 | 2012-02-03 | ||
| IN303DE2012 IN2012DE00303A (cg-RX-API-DMAC7.html) | 2012-02-03 | 2013-02-01 |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2013114406A2 true WO2013114406A2 (en) | 2013-08-08 |
| WO2013114406A3 WO2013114406A3 (en) | 2013-12-19 |
| WO2013114406A4 WO2013114406A4 (en) | 2014-01-23 |
Family
ID=47844419
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IN2013/000071 Ceased WO2013114406A2 (en) | 2012-02-03 | 2013-02-01 | Primer for amplifying farnesyl pyrophosphate synthase from mango |
Country Status (4)
| Country | Link |
|---|---|
| US (1) | US9650683B2 (cg-RX-API-DMAC7.html) |
| EP (1) | EP2809808A2 (cg-RX-API-DMAC7.html) |
| IN (1) | IN2012DE00303A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2013114406A2 (cg-RX-API-DMAC7.html) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016008885A1 (en) * | 2014-07-14 | 2016-01-21 | Photanol B.V. | Biosynthesis of sesquiterpenes in cyanobacteria |
| US9650683B2 (en) | 2012-02-03 | 2017-05-16 | Council Of Scientific And Industrial Research | Primer for amplifying farnesyl pyrophosphate synthase from mango |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6600094B1 (en) | 1999-06-22 | 2003-07-29 | Korea Kumho Petrochemical Co., Ltd. | Recombinant plant expression vector comprising isolated cDNA nucleotide sequence encoding farnesyl pyrophosphate synthase (FPS) derived from seedlings of sunflower (Helianthus annus) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IN2012DE00303A (cg-RX-API-DMAC7.html) | 2012-02-03 | 2015-04-10 | Council Scient Ind Res |
-
2013
- 2013-02-01 IN IN303DE2012 patent/IN2012DE00303A/en unknown
- 2013-02-01 EP EP13708534.6A patent/EP2809808A2/en not_active Ceased
- 2013-02-01 WO PCT/IN2013/000071 patent/WO2013114406A2/en not_active Ceased
- 2013-02-01 US US14/376,402 patent/US9650683B2/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6600094B1 (en) | 1999-06-22 | 2003-07-29 | Korea Kumho Petrochemical Co., Ltd. | Recombinant plant expression vector comprising isolated cDNA nucleotide sequence encoding farnesyl pyrophosphate synthase (FPS) derived from seedlings of sunflower (Helianthus annus) |
Non-Patent Citations (66)
| Title |
|---|
| ADIWILAGA, K.; KUSH, A.: "Cloning and characterization of cDNA encoding farnesyl diphosphate synthase from rubber tree (Hevea brasiliensis", PLANT MOLECULAR BIOLOGY, vol. 30, 1996, pages 935 - 946 |
| ATTUCCI, S.; AITKEN, S. M.; GULICK, P. J.; IBRAHIM, R. K.: "Farnesyl pyrophosphare synthase from white lupin - molecular cloning, expression and purification of the expressed protein", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 321, 1995, pages 493 - 500 |
| ATTUCCI: "Farnesyl pyrophosphate synthase from white lupin: molecular cloning, expression, and purification of the expressed protein", ARCH BIOCHEM BIOPHYS., vol. 321, no. 2, 20 August 1995 (1995-08-20), pages 493 - 500 |
| ATTUCCIET.: "A cDNA Encoding Farnesyl Pyrophosphate Synthase in White Lupin", PLANT PHYSIOL., vol. 108, 1995, pages 835 - 836 |
| BANYAI, W.; KIRDMANEE, C.; MII, M.; SUPAIBULWATANA, K.: "Overexpression of farnesyl pyrophosphate synthase (FPS) gene affected artemisinin content and growth of Artemisia annua L", PLANT CELL TISSUE AND ORGAN CULTURE, vol. 103, 2010, pages 255 - 265 |
| BREATHNACH, R.; CHAMBON, P.: "Organization and expression of eukaryotic split genes-coding for proteins", ANNUAL REVIEW OF BIOCHEMISTRY, vol. 50, 1981, pages 349 - 383 |
| CHAPPELL, J.: "The biochemistry and molecular biology of isoprenoid metabolism", PLANT PHYSIOLOGY, vol. 107, 1995, pages 1 - 6 |
| CHEN, A. J.; KROON, P. A.; POULTER, C. D.: "Isoprenyl diphosphate synthases - protein-sequence comparison, a phylogenetic tree, and prediction of secondary structure", PROTEIN SCIENCE, vol. 3, 1994, pages 600 - 607 |
| CHEN, D. H.; YE, H. C.; LI, G. F: "Expression of a chimeric farnesyl diphosphate synthase gene in Artemisia annua L. transgenic plants via Agrobacterium tumefaciens-mediated transformation", PLANT SCIENCE, vol. 155, 2000, pages 179 - 185 |
| CHOW, E. T. S.; JEN, J. J.: "Phytosterol biosynthesis in ripening tomatoes.", JOURNAL OF FOOD SCIENCE, vol. 43, 1978, pages 1424 - 1426 |
| CLARK, B. C.; CHAMBLEE, T. S.; LACOBUCCI, G. A.: "HPLC isolation of the sesquiterpene hydrocarbon germacrene B from lime peel oil and its characterization as an important flavor impact constituent", JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY, vol. 35, 1987, pages 514 - 518 |
| CLOSA, M.; VRANOVA, E.; BORTOLOTTI, C.; BIGLER, L.; ARRO, M.; FERRER, A.; GRUISSEM, W.: "The Arabidopsis thaliana FPP synthase isozymes have overlapping and specific functions in isoprenoid biosynthesis, and complete loss of FPP synthase activity causes early developmental arrest", PLANT JOURNAL, vol. 63, 2010, pages 512 - 525 |
| CUNILLERA, N.; ARRO, M.; DELOURME, D.; KARST, F.; BORONAT, A.; FERRER, A.: "Arabidopsis thaliana contains two differentially expressed farnesyl-diphosphate synthase genes", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, 1996, pages 7774 - 7780 |
| CUNILLERA, N.; BORONAT, A.; FERRER, A.: "Spatial and temporal patterns of GUS expression directed by 5 ' regions of the Arabidopsis thaliana farnesyl diphosphate synthase genes FPS1 and FPS2", PLANT MOLECULAR BIOLOGY, vol. 44, 2000, pages 747 - 758 |
| CUNILLERA, N.; BORONAT, A.; FERRER, A.: "The Arabidopsis thaliana FPSI gene generates a novel mRNA that encodes a mitochondrial farnesyl-diphosphate synthase isoform", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, 1997, pages 15381 - 15388 |
| DAUDONNET, S.; KARST, F.; TOURTE, Y.: "Expression of the farnesyldiphosphate synthase gene of Saccharomyces cerevisiae in tobacco", MOLECULAR BREEDING, vol. 3, 1997, pages 137 - 145 |
| DELOURME, D.; LACROUTE, F.; KARST, F.: "Cloning of an Arabidopsis thaliana cDNA coding for farnesyl diphosphate synthase by functional complementation in yeast", PLANT MOLECULAR BIOLOGY, vol. 26, 1994, pages 1867 - 1873 |
| ELITZUR, T.; VREBALOV, J.; GIOVANNONI, J. J.; GOLDSCHMIDT, E. E.; FRIEDMAN, H.: "The regulation of MADS-box gene expression during ripening of banana and their regulatory interaction with ethylene", JOURNAL OF EXPERIMENTAL BOTANY, vol. 61, 2010, pages 1523 - 1535 |
| GAFFE, J.; BRU, J. P.; CAUSSE, M.; VIDAL, A.; STAMITTI-BERT, L.; CARDE, J. P.; GALLUSCI, P.: "LEFPS 1, a tomato farnesyl pyrophosphate gene highly expressed during early fruit development.", PLANT PHYSIOLOGY, vol. 123, 2000, pages 1351 - 1362 |
| GALLIARD, T.: "Aspects of lipid metabolism in higher plants -11. Identification and quantitative analysis of lipids from pulp of pre- and post-climacteric apples", PHYTOCHEMISTRY, vol. 7, 1968, pages 1915 - 1922 |
| GREEN, T. R.; WEST, C. A.: "Purification and characterization of 2 forms of geranyl transferase from Ricinus communis", BIOCHEMISTRY, vol. 13, 1974, pages 4720 - 4729 |
| GRUNLER, J.; ERICSSON, J.; DALLNER, G.: "Branch-point reactions in the biosynthesis of cholesterol, dolichol, ubiquinone and prenylated proteins", BIOCHIMICA ET BIOPHYSICA ACTA-LIPIDS AND LIPID METABOLISM, vol. 1212, 1994, pages 259 - 277 |
| HAN, J. L.; LIU, B. Y.; YE, H. C.; WANG, H.; LI, Z. Q.; LI, G. F.: "Effects of overexpression of the endogenous farnesyl diphosphate synthase on the artemisinin content in Artemisia annua L", JOURNAL OF INTEGRATIVE PLANT BIOLOGY, vol. 48, 2006, pages 482 - 487 |
| HEMMERLIN, A.; RIVERA, S. B.; ERICKSON, H. K.; POULTER, C. D.: "Enzymes encoded by the farnesyl diphosphate synthase gene family in the big sagebrush Artemisia tridentata ssp spiciformis", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 278, 2003, pages 32132 - 32140 |
| JOLY, A.; EDWARDS, P. A.: "Effect of site-directed mutagenesis of conserved aspartate and arginine residues upon farnesyl diphosphate synthase activity", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 268, 1993, pages 26983 - 26989 |
| KIM, O. T.; AHN, J. C.; HWANG, S. J.; HWANG, B.: "Cloning and expression of a farnesyl diphosphate synthase in Centella asiatica (L.) urban", MOLECULES AND CELLS, vol. 19, 2005, pages 294 - 299 |
| KIM, O. T.; BANG, K. H.; JUNG, S. J.; KIM, Y. C.; HYUN, D. Y.; KIM, S. H.; CHA, S. W.: "Molecular characterization of ginseng farnesyl diphosphate synthase gene and its up-regulation by methyl jasmonate", BIOLOGIA PLANTARUM, vol. 54, 2010, pages 47 - 53 |
| KING, H. L.; RILLING, H. C.: "Avian liver prenyltransferase - Role of metal in substrate binding and orientation of substrates during catalysis", BIOCHEMISTRY, vol. 16, 1977, pages 3815 - 3819 |
| KULKARNI RS; CHIDLEY HG; PUJARI KH; GIRI AP; GUPTA VS: "Geographic variation in the flavour volatiles of Alphonso mango", FOOD CHEMISTRY, vol. 130, 2012, pages 58 - 66 |
| KUMAR, S.; PATIL, B. C.; SINHA, S. K.: "Cyanide resistant respiration is involved in temperature rise in ripening mangoes", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 168, 1990, pages 818 - 822 |
| LIAO, Z. H.; CHEN, M.; GONG, Y. F.; LI, Z. G.; ZUO, K. J.; WANG, P.; TAN, F.; SUN, X. F.; TANG, K. X.: "A new farnesyl diphosphate synthase gene from Taxus media Rehder: Cloning, characterization and functional complementation", JOURNAL OF INTEGRATIVE PLANT BIOLOGY, vol. 48, 2006, pages 692 - 699 |
| LIU CHANG-JUN, ACTA BOTANICA SINICA, vol. 40, no. 8, 1998, pages 703 - 710 |
| LIU, C., MENG; Y., HOU; S., CHEN, X.: "Cloning and sequencing of a cDNA encoding farnesyl pyrophosphate synthase from Gossypium arboreum and its expression pattern in the developing seeds of Gossypium hirsutum cv. ''Sumian-6", ACTA BOTANICA SINICA, vol. 40, 1998, pages 703 - 710 |
| LOVELL, S. C.; DAVIS, 1. W.; ADRENDALL, W. B.; DE BAKKER, P. 1. W.; WORD, J. M.; PRISANT, M. G.; RICHARDSON, J. S.; RICHARDSON, D.: "Structure validation by C alpha geometry: phi,psi and C beta deviation. Proteins-Structure", FUNCTION AND GENETICS, vol. 50, 2003, pages 437 - 450 |
| MALIK, 1. O.; BABIKER, E. E.; YOUSIF, N. E.; E1 TINAY, A. H.: "In vitro availability of minerals of some tropical and citrus fruits as influenced by antinutritional factors", NAHRUNG-FOOD, vol. 48, 2004, pages 65 - 68 |
| MANZANO, D.; BUSQUETS, A.; CLOSA, M.; HOYEROVA, K.; SCHALLER, H.; KAMINEK, M.; ARRO, M.; FERRER, A.: "Overexpression of farnesyl diphosphate synthase in Arabidopsis mitochondria triggers light-dependent lesion formation and alters cytokinin homeostasis", PLANT MOLECULAR BIOLOGY, vol. 61, 2006, pages 195 - 213 |
| MARRERO, P. F.; POULTER, C. D.; EDWARDS, P. A.: "Effects of site-directed mutagenesis of the highly conserved aspartate residues in domain-II of farnesyl diphosphate synthase activity", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 267, 1992, pages 21873 - 21878 |
| MASFERRER, A.; ARRO, M.; MANZANO, D.; SCHALLER, H.; FERNANDEZ-BUSQUETS, X.; MONCALEAN, P.; FERNANDEZ, B.; CUNILLERA, N.; BORONAT,: "Overexpression of Arabidopsis thaliana farnesyl diphosphate synthase (FPS 1 S) in transgenic Arabidopsis induces a cell death/senescence-like response and reduced cytokinin levels", PLANT JOURNAL, vol. 30, 2002, pages 123 - 132 |
| MATSUSHITA, Y.; KANG, W.; CHARLWOOD, B. V.: "Cloning and analysis of a cDNA encoding farnesyl diphosphate synthase from Artemisia annua", GENE, vol. 172, 1996, pages 207 - 209 |
| OGURA, K.; NISHINO, T.; SHINKA, T.; SETO, S.: "Prenyltransferases of pumpkin fruit", METHODS IN ENZYMOLOGY, vol. 110, 1985, pages 167 - 171 |
| OHNUMA, S.; HIROOKA, K., OHTO; C., NISHINO, T.: "Conversion from archaeal geranylgeranyl diphosphate synthase to farnesyl diphosphate synthase - Two amino acids before the first aspartate-rich motif solely determine eukaryotic farnesyl diphosphate synthase activity", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 272, 1997, pages 5192 - 5198 |
| OHNUMA, S.; NARITA, K.; NAKAZAWA, T.; ISHIDA, C.; TAKEUCHI, Y.; OHTO, C.; NISHINO, T.: "A role of the amino acid residue located on the fifth position before the first aspartate-rich motif of farnesyl diphosphate synthase on determination of the final product", JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 271, 1996, pages 30748 - 30754 |
| PAN, Z. Q.; HERICKHOFF, L.; BACKHAUS, R. A.: "Cloning, characterization, and heterologous expression of cDNAs for farnesyl diphosphate synthase from the guayule rubber plant reveals that this prenyltransferase occurs in rubber particles", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 332, 1996, pages 196 - 204 |
| PANDIT, PLANT PHYSIOLOGY AND BIOCHEMISTRY, vol. 48, 2010 |
| PANDIT, S. S.; KULKARNI, R. S.; GIRI, A. P.; KOELLNER, T. G.; DEGENHARDT, J.; GERSHENZON, J.; GUPTA, V. S.: "Expression profiling of various genes during the fruit development and ripening of mango", PLANT PHYSIOLOGY AND BIOCHEMISTRY (PARIS, vol. 48, 2010, pages 426 - 433 |
| PANDIT, S. S.; MITRA, S. S.; GIRI, A. P.; GUPTA, V. S.: "A quick method for isolating RNA from raw and ripe fleshy fruits as well as for co-isolating DNA and RNA from polysaccharide- and polyphenol-rich leaf tissues", JOURNAL OF PLANT BIOLOGY, vol. 50, 2007, pages 60 - 64 |
| SALLAUD, C.; RONTEIN, D.; ONILLON, S.; JABES, F.; DUFFE, P.; GIACALONE, C.; THORAVAL, S.; ESCOFFIER, C.; HERBETTE, G.; LEONHARDT,: "A novel pathway for sesquiterpene biosynthesis from Z,Z-farnesyl pyrophosphate in the wild tomato Solanum habrochaites", PLANT CELL, vol. 21, 2009, pages 301 - 317 |
| SANMIYA, K.; IWASAKI, T.; MATSUOKA, M.; MIYAO, M.; YAMAMOTO, N.: "Cloning of a cDNA that encodes farnesyl diphosphate synthase and the blue-light-induced expression of the corresponding gene in the leaves of rice plants", BIOCHIMICA ET BIOPHYSICA ACTA-GENE STRUCTURE AND EXPRESSION, vol. 1350, 1997, pages 240 - 246 |
| SCHMIDT, A.; GERSHENZON, J.: "Cloning and characterization of isoprenyl diphosphate synthases with farnesyl diphosphate and geranylgeranyl diphosphate synthase activity from Norway spruce (Picea abies) and their relation to induced oleoresin formation", PHYTOCHEMISTRY, vol. 68, 2007, pages 2649 - 2659 |
| See also references of EP2809808A2 |
| SEIGLER, D. S.: "Plant secondary metabolism.", 1998, KLUWER ACADEMIC PUBLISHERS |
| SIPPL, M. J.: "Recognition of errors in 3-dimensional structures of proteins", PROTEINS-STRUCTURE FUNCTION AND GENETICS, vol. 17, 1993, pages 355 - 362 |
| SONG, L. S.; POULTER, C. D.: "Yeast farnesyl-diphosphate synthase - site-directed mutagenesis of residues in highly conserved prenyltransferase domain-I and domain-II", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 91, 1994, pages 3044 - 3048 |
| SZKOPINSKA, A.; PLOCHOCKA, D.: "Farnesyl diphosphate synthase; regulation of product specificity", ACTA BIOCHIMICA POLONICA, vol. 52, 2005, pages 45 - 55 |
| TAMURA, K.; DUDLEY, J.; NEI, M.; KUMAR, S.: "MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0", MOLECULAR BIOLOGY AND EVOLUTION, vol. 24, 2007, pages 1596 - 1599 |
| TARSHIS, L. C.; YAN, M. J.; POULTER, C. D.; SACCHETTINI, J. C.: "Crystal-structure of recombinant farnesyl diphosphate synthase at 2.6-angstrom resolution", BIOCHEMISTRY, vol. 33, 1994, pages 10871 - 10877 |
| VANDERMOTEN, S.; HAUBRUGE, E.; CUSSON, M.: "New insights into short-chain prenyltransferases: structural features, evolutionary history and potential for selective inhibition", CELLULAR AND MOLECULAR LIFE SCIENCES, vol. 66, 2009, pages 3685 - 3695 |
| WANG, K.; OHNUMA, S.: "Chain-length determination mechanism of isoprenyl diphosphate synthases and implications for molecular evolution", TRENDS IN BIOCHEMICAL SCIENCES, vol. 24, 1999, pages 445 - 451 |
| WANG, P.; LIAO, Z. H.; GUO, L.; LI, W. C.; CHEN, M.; PI, Y.; GONG, Y. F.; SUN, X. F.; TANG, K. X.: "Cloning, and functional analysis of a cDNA encoding Ginkgo biloba farnesyl diphosphate synthase", MOLECULES AND CELLS, vol. 18, 2004, pages 150 - 156 |
| WEINSTEIN, J. D.; BRANCHAUD, R.; BEALE, S. I.; BEMENT, W. J.; SINCLAIR, P. R.: "Biosynthesis of the farnesyl moiety of heme a from exogenous mevalonic acid by cultured chick liver-cells", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 245, 1986, pages 44 - 50 |
| WHITAKER, B. D.: "Changes in the steryl lipid-content and composition of tomato fruit during ripening", PHYTOCHEMISTRY, vol. 27, 1988, pages 3411 - 3416 |
| WIDMAIER, R.; HOWE, J.; HEINSTEIN, P.: "Prenyltransferase from Gossypium hirsutum", ARCHIVES OF BIOCHEMISTRY AND BIOPHYSICS, vol. 200, 1980, pages 609 - 616 |
| WIEDERSTEIN, M.; SIPPL, M. J.: "ProSA-web: interactive web service for the recognition of errors in three-dimensional structures of proteins", NUCLEIC ACIDS RESEARCH, vol. 35, 2007, pages W407 - W410 |
| XIANG, L.; ZHAO, K. G.; CHEN, L. Q.: "Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids", PLANT PHYSIOLOGY AND BIOCHEMISTRY, vol. 48, 2010, pages 845 - 850 |
| YASHODA, H. M.; PRABHA, T. N.; THARANATHAN, R. N.: "Mango ripening: changes in cell wall constituents in relation to textural softening", JOURNAL OF THE SCIENCE OF FOOD AND AGRICULTURE, vol. 86, 2006, pages 713 - 721 |
| ZHAO, Y. J.; YE, H. C.; LI, G. F.; CHEN, D. H.; LIU, Y.: "Chinese Science Bulletin", vol. 48, 2003, article "Cloning and enzymology analysis of farnesyl pyrophosphate synthase gene from a superior strain of Artemisia annua L", pages: 63 - 67 |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9650683B2 (en) | 2012-02-03 | 2017-05-16 | Council Of Scientific And Industrial Research | Primer for amplifying farnesyl pyrophosphate synthase from mango |
| WO2016008885A1 (en) * | 2014-07-14 | 2016-01-21 | Photanol B.V. | Biosynthesis of sesquiterpenes in cyanobacteria |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2809808A2 (en) | 2014-12-10 |
| WO2013114406A4 (en) | 2014-01-23 |
| WO2013114406A3 (en) | 2013-12-19 |
| IN2012DE00303A (cg-RX-API-DMAC7.html) | 2015-04-10 |
| US9650683B2 (en) | 2017-05-16 |
| US20150119562A1 (en) | 2015-04-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cherian et al. | Natural rubber biosynthesis in plants, the rubber transferase complex, and metabolic engineering progress and prospects | |
| Abbas et al. | Functional characterization and expression analysis of two terpene synthases involved in floral scent formation in Lilium ‘Siberia’ | |
| Tholl et al. | Terpene specialized metabolism in Arabidopsis thaliana | |
| Landmann et al. | Cloning and functional characterization of three terpene synthases from lavender (Lavandula angustifolia) | |
| Matsuba et al. | Evolution of a complex locus for terpene biosynthesis in Solanum | |
| Paetzold et al. | The isogene 1-deoxy-D-xylulose 5-phosphate synthase 2 controls isoprenoid profiles, precursor pathway allocation, and density of tomato trichomes | |
| Brückner et al. | Characterization of two genes for the biosynthesis of abietane-type diterpenes in rosemary (Rosmarinus officinalis) glandular trichomes | |
| Martin et al. | Functional annotation, genome organization and phylogeny of the grapevine (Vitis vinifera) terpene synthase gene family based on genome assembly, FLcDNA cloning, and enzyme assays | |
| Jin et al. | Next generation sequencing unravels the biosynthetic ability of spearmint (Mentha spicata) peltate glandular trichomes through comparative transcriptomics | |
| Jones et al. | Isolation of cDNAs and functional characterisation of two multi-product terpene synthase enzymes from sandalwood, Santalum album L. | |
| US20120052535A1 (en) | Production of terpenes and terpenoids in glandular trichome-bearing plants | |
| Gutensohn et al. | Metabolic engineering of monoterpene biosynthesis in tomato fruits via introduction of the non-canonical substrate neryl diphosphate | |
| Wei et al. | Characterization and function of 3-hydroxy-3-methylglutaryl-CoA reductase in Populus trichocarpa: Overexpression of PtHMGR enhances terpenoids in transgenic poplar | |
| Nguyen et al. | Molecular characterization of Glycine max squalene synthase genes in seed phytosterol biosynthesis | |
| Xu et al. | Evaluation, characterization, expression profiling, and functional analysis of DXS and DXR genes of Populus trichocarpa | |
| Lan et al. | Molecular cloning and expression of Hedychium coronarium farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral and wounding/herbivory induced leaf volatile sesquiterpenoids | |
| Hao et al. | Cloning, molecular characterization and functional analysis of 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate reductase (HDR) gene for diterpenoid tanshinone biosynthesis in Salvia miltiorrhiza Bge. f. alba | |
| Xiang et al. | Molecular cloning and expression of Chimonanthus praecox farnesyl pyrophosphate synthase gene and its possible involvement in the biosynthesis of floral volatile sesquiterpenoids | |
| Kulkarni et al. | Characterization of three novel isoprenyl diphosphate synthases from the terpenoid rich mango fruit | |
| Majdi et al. | Spatial and developmental expression of key genes of terpene biosynthesis in Tanacetum parthenium | |
| Moehninsi et al. | Altering potato isoprenoid metabolism increases biomass and induces early flowering | |
| Fujita et al. | Biosynthesis of volatile terpenes that accumulate in the secretory cavities of young leaves of Japanese pepper (Zanthoxylum piperitum): Isolation and functional characterization of monoterpene and sesquiterpene synthase genes | |
| Tezuka et al. | The rice ent-KAURENE SYNTHASE LIKE 2 encodes a functional ent-beyerene synthase | |
| US9650683B2 (en) | Primer for amplifying farnesyl pyrophosphate synthase from mango | |
| Lin et al. | Molecular cloning and functional analysis of the gene encoding geranylgeranyl diphosphate synthase from Jatropha curcas |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 13708534 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 14376402 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2013708534 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2013708534 Country of ref document: EP |