WO2013107529A1

WO2013107529A1 - Biologically active proteins having hotspots for directed crosslinking and immobilization

Info

Publication number: WO2013107529A1
Application number: PCT/EP2012/054058
Authority: WO
Inventors: Osman Ugur SEZERMAN; Günseli Bayram AKCAPINAR
Original assignee: Sabanci Üniversitesi
Priority date: 2012-01-18
Filing date: 2012-03-08
Publication date: 2013-07-25
Also published as: CN104136607A

Abstract

The present invention relates to a novel, biologically active loop mutant protein with sustained stability relative to the native protein having hotspots located away from the active center for directed immobilization and crosslinking properties. The invention further relates to a method of genetically engineering of said biologically active proteins, as well as further biological materials modified in accordance with the present invention.

Description

BIOLOGICALLY ACTIVE PROTEINS HAVING HOTSPOTS FOR DIRECTED CROSSLINKING AND IMMOBILIZATION

Field of the Invention

The present invention is concerned with a novel, biologically active loop mutant protein with sustained stability relative to the native protein. Another aspect of this invention is a method of genetically engineering biologically active proteins especially enzymes via site directed loop insertion.

More particularly, the present invention relates to a novel loop mutant protein especially an enzyme with sustained stability and activity relative to the native protein having hotspots located away from the active center for directed immobilization and crosslinking of the protein. Another aspect of this particular invention is the method of genetically engineering these proteins preferably enzymes via site directed loop insertion for hotspot creation for oriented immobilization and crosslinking.

Background of the Invention

Enzymes are biological catalysts and they are widely used in industrial processes due to their high activity, selectivity and specificity. Among all of the enzymes, cellulases, enzymes that degrade cellulose, are becoming very important materials for biotechnology and enzyme engineering. That is because cellulose is the most abundant polymer on earth. Cellulases are being used increasingly for a variety of industrial purposes and consequently, a lot of effort has been put into their expression as well as their study by site-directed mutagenesis. Application of cellulases in industrial processes has increased to a considerable amount in the last thirty years. Cellulases are widely used in textile industry, especially for biopolishing of textiles to improve fabric quality, biostoning of denim garments to obtain a fashionable aged appearance. They are also used extensively in feed, food industries, in pulp and paper processing and in laundry. In the last decade, several studies focused on the use of cellulases for the conversion of lignocellulosic biomass to produce biofuels as an alternative renewable energy source to fossil fuels.

Many studies propose use of crosslinking agents to enhance stability of the enzyme but they seem to have adverse impact on the activity since they target certain types of amino acids that may also exist in the vicinity of the active center. Crosslinking with agents like gluteraldehyde is known to reduce enzyme activity by restricting the conformational flexibility of the enzyme due to unspecific binding to Lysine residues (Busto et al., 1997; Domen et al., 1990).

Enzymes and other biomolecules immobilized on a support or cross-linked are generally known to have improved properties for use as biosensors or biocatalysts. Moreover they can be recycled for repeated use. However, immobilization of a biomolecule using available technologies is highly dependent on the properties of the biomolecule and the properties of the immobilization support or surface. In most of the cases, immobilization or crosslinking causes a reduction in the activity of the enzyme or interferes with the ligand binding properties of the biomolecule. Most of the available methods for crosslinking or immobilization do not enable directed binding. This event is an almost random process where the protein of interest can be immobilized from many different sites which would cause a reduction in the activity of the enzyme. For example, many studies propose use of crosslinking agents to enhance stability of the enzyme but they seem to have adverse impact on the activity since they target certain types of amino acids that may also exist in the vicinity of the active center (Busto et al., 1997; Rao et al., 1998; Yuan et al., 1999).

Oriented immobilization is a method that is currently used to overcome this reduction in biological activity. Alteration of the protein orientation for immobilization or crosslinking is problematic and generally case-specific. In many cases, this idea was used to facilitate electron transfer from support to the enzyme in redox biosensors (Ferapontova et al., 2002) For this purpose, cysteine residues on the target enzyme are used to immobilize the enzyme on a support that contains disulfide groups or that is made of gold. But, there is a major drawback for this method. Not all the biomolecules contain free cysteine residues or cysteine residues positioned in a way that would allow oriented immobilization of the biomolecule. US patent application No: 2009/0120809 describes a nitroreductase enzyme modified to comprise a plurality of cysteine residues incorporated into its structure for oriented immobilization of the enzyme onto a noble metal electrode. Additionally, there were some studies that solve this problem by introducing a cysteine residue into the enzyme surface (Ferapontova et al., 2002; Gwenin et al., 2007; Kallwass et al., 1993; Kapp et al., 2006; Viswanath et al., 1998). But this method's application is restricted to disulfide-thiol interchange chemistry which is not always favorable.

Additionally, in a few cases, site directed mutagenesis technique is used directly to alter the protein orientation for immobilization. There are some cases that involve the use of site-directed exchanged Histidine residues or His tags (Nakamura et al., 201 1 ; Porath et al., 1975). These are generally immobilized on immobilized metal chelate (IMAC) or gold supports (Andreescu et al., 2001 ). But one important drawback for this method is that the immobilization is reversible upon addition of a competitive ligand (Jerker, 1992). Additionally, the His-tags are usually added to N- or C- terminus of the protein of interest and therefore this may restrict the proper orientation of the protein to be immobilized to only N- and C- terminus. This restricts the application of the method to certain proteins which would be correctly oriented upon immobilization from N or C-terminus.

Enrichment of certain reactive groups on the protein surface is another method to direct oriented immobilization of the biomolecule. For this purpose Guisan et al. introduced three Lysine residues on the surface of penicillin G acylase enzyme that was already rich in Lys groups (Abian et al., 2004). It has been shown that rate of immobilization on glyoxyl-agarose was increased more than 10-fold and thermal stability of the enzyme increased. Terreni et al. designed a protein with a tag of three Lysines alternating with three Glycines on the C- terminal end of the beta chain of the same enzyme which also improved immobilization on PGA (Serra et al., 2009). The latter method had the same disadvantage with the use of His tags since application of this method is restricted to certain proteins. This application may also have the disadvantage if the active center is close to the N or C - terminus of the protein where lysine loops are inserted causing a reduction in the activity.

A combination of before mentioned methods is also applied in the literature. For example, a PCT patent application WO 03/044189 describes a modified protein, namely a modified HIV-1 capsid protein p24 encoded by a nucleotide sequence comprising of a nucleotide fragment, called polyK, coding for a succession of at least six lysine residues and second modified protein encoded by a nucleotide sequence comprising of a nucleotide fragment, called polyH, coding for a succession of at least six histidine residues. These poly Lysine and poly Histidine tags are also located either at the N-terminus or the C-terminus of the protein. Therefore, as mentioned earlier this method has restricted use.

In this present invention, amino acid loops are inserted in a manner positioned away from the active center of the protein in order to create local high affinity points for crosslinking and immobilization.

The operational stability of a protein, preferably an enzyme was improved successfully. In this invention, a modified protein which contains hotspots on the surface for oriented immobilization or crosslinking was produced. For this purpose, preferably Lysine and Glycine rich endo-loops were inserted to the surface of an enzyme using site-directed mutagenesis to create local high affinity points for immobilization and crosslinking. The selected loop location was a highly solvent accessible and flexible site which is located further away from active center in order not to interfere with the activity of the enzyme. Insertion of an endo-loop to a protein is a problematic process since the inserted sequence potentially interferes with the synthesis, folding pathway and global structure of the protein of interest. Indeed, among those trials reported in the prior art, endo- loop mutant proteins are proved to be either marginally functional or completely dysfunctional (Amatore and Baneyx, 2003; Doi et al., 1997; Doi et al., 1998; Heinis et al., 2006; Manoil and Bailey, 1997). In surprising contrast to the prior art, the endo-loop mutant enzyme of the invention was found to be fully functional in the sense that such mutants had retained all bioactivity when compared against the wild type enzyme. In many cases, a sustained stability of the folded state was also noted compared to the native enzyme.

Brief Description of the Invention

In the present invention, a novel loop mutant protein with sustained stability and activity relative to the native protein, with the hotspots located away from the active center in order to provide directed immobilization and crosslinking of the protein is enclosed.

Specifically, the present invention is related to a novel biologically active mutant protein comprising all essential tertiary structural elements of the corresponding native protein and at least one surface-exposed non-native structural element, characterized in that said non-native structural element is located endo within the protein primary structure and forms a surface-exposed peptide loop, which creates a hotspot to allow directed protein immobilization and enhanced stability of the folded protein tertiary structure.

The biologically active mutant protein comprising all essential tertiary structural elements of the corresponding native protein and at least one surface-exposed non-native structural element, characterized in that said non-native structural element is located endo within the protein primary structure and forms a surface- exposed peptide loop, which creates a hotspot to allow directed protein immobilization and enhanced stability of the protein tertiary structure wherein the native protein is preferably selected from a group of proteins comprising enzymes, antibodies, receptors, antibody fragments, binding proteins and synthetic peptides.

Another preferred embodiment of this particular invention is a novel biologically active mutant protein described above wherein the mutated protein is preferably an enzyme and preferably a cellulase enzyme and more preferably an endoglucanase enzyme (EGI) and most preferably an endoglucanase enzyme extracted from Trichoderma reesei. Another preferred embodiment of the invention is a biologically active loop mutant protein which creates a hotspot to allow directed protein immobilization and enhanced stability of the protein tertiary structure with one surface-exposed non-native structural element, characterized in that said non-native structural element is located endo within the protein primary structure and forms a surface- exposed peptide loop, is characterized in that the non-native structural element is an amino acid loop comprising at least 5 and at most 15 amino acids and most preferably comprising 10 amino acids.

Another preferred embodiment of the invention is a biologically active loop mutant protein with one surface-exposed non-native structural element, characterized in that said non-native structural element is located endo within the protein primary structure and forms a surface-exposed peptide loop, which creates a hotspot to allow directed protein immobilization and sustained stability of the protein tertiary structure which is characterized in that the non-native structural element is a loop comprising lysine and glycine amino acid sequence and preferably comprising alternating lysine and glycine amino acid sequence and most preferably the sequence is defined as KKGGKKKGGK.

Most preferably the mutant enzyme described herein is an endoglucanase enzyme extracted from Trichoderma reesei containing an endo loop which is positioned almost 180° on the opposite side of the active center; in a highly solvent accessible area and in a flexible area between 1 12^th and 1 13^th residues on the average 28 A ° away from the Ca of active center residues. Another aspect of this invention is the method of genetically engineering a biologically active mutant protein which is characterized by the steps of (1 ) defining a site along the exon region of the target protein gene for insertion of a surface-exposed loop-forming oligonucleotide, (2) defining the sequence of a DNA primer which is comprised of terminal overlapping ends bridged by said loop-forming oligonucleotide, whereof said primer is designed to hybridize, via said overlapping ends, along the region of said chosen insertion site, (3) chemically synthesizing a DNA primer comprising of said overlapping ends bridged by said loop-forming oligonucleotide sequence (4) applying the technique of overlap PCR extension to prepare a mutant gene containing said loop-forming oligonucleotide sequence within the specified region of the exon of the target protein gene, (5) applying an appropriate DNA isolation technique to purify said mutant gene, (6) expressing said mutant gene, and (7) isolating the mutant of said target protein containing said peptide loop.

According to another aspect of the present invention, there is provided an oligonucleotide sequence specifically designed at the level of gene expression to form a post-translational peptide loop. More specifically, the oligonucleotide code comprises an endoglucanase gene modified by site directed mutagenesis via the addition of a plurality of codons for lysine and glycine residues. Preferably the gene was selected from a codon optimized version of Trichoderma reesei (QM9414) egl1 gene. The nucleotide sequence of the codon optimized and modified Trichoderma reesei (QM9414) egl1 gene was given as SEQ NO1 and most preferably the endoglucanase gene is encoded by a nucleic acid sequence as set out in SEQ NO1 , the reverse complement of the said sequence, the complement of the said sequence, the reverse of the said sequence or sequences having at least 60% sequence identity with the nucleic acid sequences of any one of the afore-mentioned sequences:

SEQ N01 :

>egl1_L5_gene

gaattccagcaaccgggtacctctactccagaggttcacccaaagttgactacttacaagtgtactaagtccggtggttgtgttgctcaag acacttccgttgttttggactggaactacagatggatgcacgacgctaactacaactcctgtactgttaacggtggtgttaacactactttgtg tccagacgaggctacttgtggaaagaactgtttcatcgagggtgttgactatgctgcttccggtgttactacttctggttcctccttgactatg aaccagtacatgccatcttcctctggtggttactcttctgtttccccaagattgtacttgttggacaagaagggtaagaagaagggtaagaaa tccgacggtgaatacgttatgttgaagttgaacggtcaagagttgtctttcgacgttgacttgtccgctttgccatgtggtgaaaacggttcct tgtacttgtctcagatggacgaaaatggtggtgctaaccagtacaatactgctggtgctaactacggttctggttactgtgatgctcagtgtcc agttcagacttggagaaacggtactttgaacacttcccaccagggattctgttgtaacgagatggacatcttggagggaaattccagagctaac gctttgactccacactcttgtactgctactgcttgtgactctgctggttgtggttttaacccatacggttccggttacaagtcttactacggtc

caggtgacactgttgacacttccaagactttcactatcatcactcagttcaacactgacaacggttctccatccggtaacttggtttccatcac tagaaagtaccagcagaacggtgttgatattccatctgctcaaccaggtggtgacactatttcctcttgtccatccgcttcagcttatggtgga ttggctactatgggaaaggctttgtcctctggaatggttttggttttctccatctggaacgacaactcccaatacatgaactggttggactctg gtaatgctggtccatgttcttctactgagggtaacccatccaacatcttggctaacaacccaaacactcacgttgttttctccaacatcagatg gggtgacattggttccactacaaactctactgctccaccaccaccacctgcttcctctactactttctccactactagaagatcctccactact tcttcctctccatcctgtactcaaactcactggggacaatgtggtggtattggttactccggttgtaagacttgtacttccggtactacttgtc agtactccaacgactactactcgcaatgccttgctctaga A modification of the nucleotide sequence with an identity greater than 80 %, preferably more than 85 %, more preferably more than 90 % and most preferably more than 95 % of SEQ NO1 is envisaged.

According to another aspect of the present invention, a nucleic acid construct is provided that comprises a promoter or the expression of the endoglucanase gene; a plurality of codons for lysine and glycine residues; and a nucleotide sequence of an endoglucanase gene. Preferably the endoglucanase promoter is the AOX1 promoter from pPiczalphaA plasmid and more preferably the construct comprises a pPiczalphaA plasmid.

Detailed Description of the Invention

In this detailed description, the preferred embodiments regarding "biologically active proteins having hotspots for directed crosslinking and immobilization" are provided in order to illustrate the present invention, which are not intended to limit the scope as defined in the appended claims.

In this particular invention a novel, biologically active loop mutant protein with sustained stability relative to the native protein, having hotspots located away from the active center for directed immobilization and crosslinking of the protein is described. Another aspect of this particular invention is a method of genetically engineering these proteins, preferably enzymes, via site directed loop insertion for hotspot creation for oriented immobilization and crosslinking. Proteins described in this specific invention, are selected from a group of proteins, that is any recombinant mutant protein, comprising of enzymes, antibodies, receptors, antibody fragments, binding proteins and synthetic peptides. As used herein "active center" may refer to the region bearing the catalytic groups and substrate binding site.

As used herein "enzyme" may refer to a polypeptide which catalyzes the specific conversion of a molecular substrate to a molecular product.

Biologically active mutant proteins refer to endo-loop-bearing mutant proteins, which retain the functional role of the native protein. Mutant proteins that retain (engineering loop excepted) global three-dimensional structure of the native protein are said to comprise of all essential tertiary structural elements of the native protein.

The term "mutant enzyme" as used herein is an enzyme that is different from the native enzyme by one or more characteristics as caused by mutations. The term "mutation" as used herein is a permanent, heritable change in the nucleotide sequence in a gene or a chromosome. The term "native enzyme" can be used interchangeably with "wild type enzyme" as used herein, and is the enzyme inside the cell that is in its natural state and being unaltered by denaturing agents, such as heat, chemicals, enzyme actions, or the exigencies of extraction.

"Endo-loop" as used herein refers to a loop-forming structural element comprising of a short peptide, which is specifically located at the surface of the folded mutant protein and is exposed to water. The term "non-native structural element" as described herein is a structure that is absent in the corresponding native protein. Given that said non-native peptide loop is absent in the native protein, its oligonucleotide sequence must be engineered into the target protein gene using genetic modification techniques, yielding the desired mutant protein following protein expression. In the expressed mutant protein, the endo-loop structure reflects an endo addition of a specific loop-forming peptide to the primary sequence of the native protein.

Herein "endo addition" refers to incorporation of said peptide into the native primary sequence at a suitable point between the N and C terminal amino acid residue. Said suitable point refers to any region along the native protein primary sequence, which is located at the surface of the native folded protein. Incorporation of a peptide refers to the act of engineering a mutant protein primary sequence, NX-PP-YC, which contains said peptide, PP, located within the native protein primary sequence, NXYC.

Herein, N and C refer to the N and C terminus of the primary sequence, and X and Y depict one or more amino acid residues that are located N and C terminal with respect to the site of incorporation. The mutant protein therefore may be regarded as a polypeptide sequence comprising of the entire wild-type sequence, briefly extended at some non-terminus point by a short piece of additional loop-forming peptide.

"Sustained stability" of a protein as described herein refers to sustained thermal stability against denaturation of the folded protein as well as sustained stability against denaturation of the folded protein against denaturants. The term "denaturation" refers to the process of unfolding. Depending on the conditions, denaturation may be reversible or irreversible. Proceeding to higher temperatures can act to denature proteins, i.e., thermal denaturation. Denaturants can also be urea, guanidinium hydrochloride, surfactants, pH extremes and organic solvents. The term also describes a stably folded functional protein that works under the same conditions as the native protein. By use of the term "conditions" it is understood that these conditions are biological working conditions such as pH and temperature.

As used herein "directed protein immobilization" may refer to the alteration of the protein from a pre-selected site to enable attachment of the protein to a surface by covalent or non-covalent forces.

The term "hotspot", as used herein, may refer to an area within the protein with intense immobilization affinity.

According to another aspect of the present invention, there is provided an isolated nucleic acid sequence comprising an endoglucanase gene modified by site directed mutagenesis via the addition of a plurality of codons for lysine and glycine residues. Preferably the gene was selected from a codon optimized version of Trichoderma reesei (QM9414) egl1 gene. The nucleotide sequence of the codon optimized Trichoderma reesei (QM9414) egl1 gene was given as SEQ NO1 and most preferably the endoglucanase gene is encoded by a nucleic acid sequence as set out in SEQ NO1 . According to another aspect of the present invention, a nucleic acid construct is provided that comprises a promoter or the expression of the endoglucanase gene; a plurality of codons for lysine and glycine residues; and a nucleotide sequence of an endoglucanase gene. Preferably the endoglucanase promoter is the AOX1 promoter from pPiczalphaA plasmid and most preferably the construct comprises a pPiczalphaA plasmid.

In preferred embodiment of this invention, the oligonucleotide sequence described herein is characterized in that it comprises an insertion site for the insertion of the surface exposed endo-loop sequence via site directed mutagenesis and preferably the insertion site is any site, in the folded protein, encoding the amino acids that are away from the active center. In another preferred embodiment of this invention, the oligonucleotide sequence wherein the insertion site is positioned almost 180° on the opposite side of the active center within an existing loop and more preferably the insertion site is located at a highly solvent accessible and flexible area within an existing loop region. Most preferably the insertion site is positioned between 345^th and 346^th bases.

The oligonucleotide sequence is characterized in that it comprises a surface exposed endo-loop sequence introduced via site directed mutagenesis using the Overlap PCR Extension method. By this method, initial PCRs generate overlapping gene segments, which are then used as a template DNA for another PCR to create a full-length product.

The oligonucleotide sequence accordingly is characterized in that it comprises a surface exposed endo-loop sequence introduced via site directed mutagenesis using the Overlap PCR Extension method. Four primers and preferably three rounds of PCR reaction are typically applied.

In a preferred embodiment of this invention, the oligonucleotide sequence is characterized in that it comprises a surface exposed endo-loop sequence introduced via site directed mutagenesis using the Overlap PCR Extension method with four primers and preferably three rounds of PCR reaction and most preferably Primer 1 (5' CCGGAATTCCAGCAACCGGGTACCAGCACC 3') is complementary to the 5' end of the egl1 gene and contains an EcoRI restriction enzyme cleavage site (shown with bold letters and underlined); Primer 2 (5' ACCTTTCTTACCCTTCTTCTTACCCTTCTTGTCCAAGTACAATCTTG 3 ) is complementary to the 17 nucleotides of the egl1 gene between the 329^th and 345^th bases and contains a surface exposed endo-loop insertion sequence (5' ACCTTTCTTACCCTTCTTCTTACCCTTCTT 3') (shown with bold letters and underlined) encoding for KKGGKKKGGK; Primer 3 (5'

AAG AAG G GT AAG AAG AAG G GT AAG AA AG GTTCCG ACG GTG AATACG GT

3') is complementary to the 18 nucleotides of the egl1 gene between the 346^th and 364^th bases and contains a surface exposed endo-loop insertion sequence (5' AAGAAGGGTAAGAAGAAGGGTAAGAAAGGT 3') (shown with bold letters and underlined) encoding for KKGGKKKGGK; Primer 4 (5' CCGTCTAGAGCAAGGCATTGCGAGTAGTAG 3') is complementary to the 3' end of the egl1 gene and contains a Xbal restriction enzyme cleavage site (shown with bold letters and underlined)

At the level of the gene, a surface-exposed loop-forming oligonucleotide refers to an oligonucleotide sequence, which is designed to form, following expression, a peptide loop structure that is positioned at the water-accessible surface of the mutant protein. Said oligonucleotide must be genetically engineered at an appropriate site along the wild type exon. The site chosen for the genetic manipulation must be a site, which yields a native-like protein structure following expression of the mutant gene. Native-like protein structure refers to a tertiary (global) structure, which bears all essential structural elements of the native protein, plus one (or potentially more) additional surface-located endo-loop structure. In short, the site chosen for genetic manipulation must not interfere with normal posttranscriptional and posttranslational processing events and it must allow protein folding to follow the native pathway, yielding a mutant protein with native-like structure and one (or possibly many) additional loop. The notion of "insertion" and "site" are coined from original work using restriction enzymes and ligase enzymes, whereupon a site along the DNA is literally cut, an extra piece of DNA is inserted, and the pieces are ligated. In the case of the invention, which exploits the technique of overlap PCR extension, an oligonucleotide will again appear to have been inserted into the native exon at a specific site, hence, leading to the use of such terms. However, the mechanism of effecting such changes is completely different and relies on the use of DNA polymerase and appropriately chosen DNA primers. Hence, the use of terms such as "site" and "insertion" in this invention are limited to the scope and context of the technique of overlap PCR extension.

The term "overlap PCR extension", as used herein, may refer to a method that allows insertion of an oligonucleotide sequence into an oligonucleotide sequence of choice with the use of Polymerase Chain Reaction and without restriction endonucleases or T4 DNA ligase. Initial PCRs generate overlapping gene segments that are then used as template DNA for another PCR to create a full-length product. Internal primers generate overlapping, complementary 3' ends on the intermediate segments and introduce nucleotide substitutions, insertions or deletions for site-directed mutagenesis, or for gene splicing, encode the nucleotides found at the junction of adjoining gene segments. Overlapping strands of these intermediate products hybridize at this 3' region in a subsequent PCR and are extended to generate the full-length product amplified by flanking primers that can include restriction enzyme sites for inserting the product into an expression vector for cloning purposes.

As used herein, an "exon" may refer to a nucleic acid sequence (either DNA or RNA) that is represented in the mature form of an RNA molecule after introns of a precursor RNA have been removed by splicing. The mature RNA molecule can be a messenger RNA or a functional form of a non-coding RNA such as rRNA or tRNA.

As used herein the term "gene expression" may refer to the process by which information from a gene is used in the synthesis of a functional gene product. These products are often proteins.

As used herein the term "hybridization" may refer to the complementary base- pairing interaction of one nucleic acid with another nucleic acid that results in the formation of a duplex, triplex, or other higher-ordered structure, and is used herein interchangeably with "annealing."

As used herein "overlapping ends" may refer to the oligonucleotide sequences that are complementary to each other and positioned at either 5' or 3' end of an oligonucleotide sequence. These oligonucleotide sequences comprise the inserted sequences corresponding to the inserted loop segment at either 5' or 3' end. By use of the term "at least 60% identity" it is therefore understood that the invention encompasses more than use of the specific exemplary nucleotide sequence. Modifications to the sequence such as deletions, insertions, or substitutions in the sequence which produce either:

a) "silent" changes which do not substantially affect the functional properties of the protein molecule. For example, alterations in the nucleotide sequence which reflect the degeneracy of the genetic code or which result in the production of a chemically equivalent amino acid at a given site are contemplated, or:

b) promote improvements in activity or modifications in substrate specificity are also contemplated.

The term "codon" as used herein is a set of three adjacent nucleotides, also called triplet, specifying the type and sequence of amino acids for protein synthesis. The term "promoter" as described herein is a region of DNA that facilitates the transcription of a particular gene.

Endoglucanase I gene of Trichoderma reesei is the template used for site directed mutagenesis. Loop is inserted into this gene by site directed mutagenesis. Loop inserted Endoglucanase I gene is the mutant gene that is used to produce loop inserted Endoglucanase I protein. The gene was expressed recombinantly in Pichia pastoris. Loop inserted Endoglucanase I protein is the product that would be used for directed immobilization or crosslinking studies.

In a preferred embodiment of this particular invention, four different ten amino acid long loops consisting of lysine and glycine residues were introduced to Endoglucanase I (EGI), a major endoglucanase of Trichoderma reesei. In the invention EGI_L5 was found to be the most stable loop mutant enzyme. Both mutant Endoglucanase I (EGI_L5) and the native Endoglucanase I (EGI) were expressed in Pichia pastoris and purified successfully. Effects of the purposed mutation on the stability and activity of the enzyme were analyzed. Materials and methods

Microorganisms, enzymes and chemicals:

Escherichia coli Top10 F was used as host for the propagation of the vectors and subcloning. P. pastoris KM71 H (aox1 ::ARG4, arg4) (Invitrogen, San Diego, USA) was used for recombinant protein expression. pPICZaA vector (Invitrogen, San Diego, USA) was used for cloning and protein expression. pPICZaA plasmid contains an alpha factor secretion signal for extracellular secretion of cloned gene products, a Zeocin resistance gene for selection in E. coli , an alcohol oxidase (AOX) promoter for methanol induced expression of the cloned gene. Pfu Polymerase and Rapid Ligation Kit (Fermentas) were used for cloning purposes. Taq Polymerase (Qiagen) was used for colony PCR. All of the contained chemicals were of analytical grade. Protein Assays: Protein concentrations were determined using BCA Protein Assay Reagent (Pierce). Bovine serum albumin was used as the protein standard.

Enzyme Assays: All CMC activity assays were performed in triplicate with a standard deviation of below 10%. All 4-MUC activity assays were performed in duplicate or triplicate with a standard deviation below 10%.

The following examples are provided to illustrate the present invention and are not intended to limit the scope of the invention.

Example 1 :

Site directed mutagenesis of the endoglucanaganese enzyme:

Overlap PCR extension method was applied to introduce the loop mutation. Overlap PCR extension primers (Forward egl1 :

5'CCGGAATTCCAGCAACCGGGTACCAGCACC 3',

Reverse egl1 : 5' CCGTCTAGAGCAAGGCATTGCGAGTAGTAG 3', Forward overlap extension primer: 5' AAGAAGGGTAAGAAGAAGGGTAAGAAAGGTTCCGACGGTGAATACGGT 3', Reverse overlap extension primer: 5'

ACCTTTCTTACCCTTCTTCTTACCCTTCTTGTCCAAGTACAATCTTG 3') were designed according to literature (Vallejo et al., 1 994). Loop mutation was introduced between 1 12th and 1 13th amino acids. The fidelity of the constructs was confirmed by sequencing.

Example 2: Cloning of the egl1 and modified egl1(egl1_L5) genes

A codon optimized (for Pichia pastohs) endoglucanase 1 synthetic gene {egl1) carrying EcoRI and Xbal restriction sites on each arm was obtained from GeneART. Protein sequence of the synthetic gene is identical to Trichoderma reesei endoglucanase 1 (GenBank accession no. M15665). EcoRI and Xbal sites were added to the gene flanking regions. The synthetic gene was digested with EcoRI and Xfoa/ and re-ligated into EcoRI-Xbal site of pPiczaA vector using Rapid Ligation Kit (Fermentas). egl1 was subcloned in E.coli Top10 F cells. E.coli cells were cultured on law salt LB plates in the presence of 25 pg/ml zeocin. Zeocin positive colonies were selected, put into PCR tubes and colony PCR with 5' AOX (5^'-GACTGGTTCCAATTGACAAGC-3^') and 3' AOX

(5^'-GCAAATGGCATTCTGACATCC-3^') primers was performed as a normal PCR reaction except primary denaturation step was executed for 10 minutes at 95 °C instead of 5 minutes. Colony PCR positive colonies were selected and recombinant plasmids were isolated using MiniPrep Kit (Qiagen).

Example 3:

Transformation and screening of the mutant enzyme:

The recombinant plasmid pPICzaA-eg/7 was linearized with Sacl before transformation. This process resulted in the stable integration of one or multiple copies of the linearized vector at 5' AOX1 chromosomal locus of P. pastohs KM71 H by homologous recombination. All the obtained transformants were Muts (slow methanol utilizing phenotype). Competent P. pastohs KM71 H cells were prepared according to a procedure combining chemical transformation and electroporation (Wu and Letchworth, 2004). ~1 g linearized recombinant plasmid was mixed with competent KM71 H cells. The mixture was immediately transferred to a pre-chilled 0.2cm electroporation cuvette and incubated on ice for 5 minutes. About 1 ml of ice-cold 1 M sorbitol was immediately added to the cuvette after electroporation. The charging voltage, capacitance, and resistance were 1 .5 kV, 25F, and 200, respectively. The transformation mixture was spread onto YPD plates containing 100 pg/ml zeocin. The plates were incubated at 30 °C until the appearance and growth of colonies (about three days). Zeocin positive colonies were selected put into PCR tubes, the tubes were microwave treated and immediately put on ice-water bath and 10 μΙ of cold ddH₂O was added to each tube, 1 μΙ of this cell mixture was used as a template for colony PCR. Colony PCR with 5' AOX and 3' AOX primers was performed. Colony PCR positive colonies were selected.

Multicopy transformants were selected on Buffered Minimal Methanol Agar (BMM-agar) plates (100 mM potassium phosphate, pH 6.0, 1 .34% YNB, 4x 1 0- 5% biotin, 0.5% methanol) containing blue colored Azo- carboxymethylcellulose (Azo- CMC) (0.25 % w/v) as a substrate. More active transformants expressing the enzyme were selected according to the relative radii of the clear zones around the colonies. When the enzyme was active, it degraded Azo-CMC and clear zones were produced around the colonies as a result of enzymatic hydrolysis. Example 4:

Small Scale Expression of recombinant Pichia pastoris strains:

Pichia pastoris recombinant colonies producing Endoglucanase I and its loop mutant were inoculated into 50 imL BMG medium (100mM potassium phosphate, pH 6.0, 1 .34%YNB, 4x 1 0-5 % biotin and 1 % glycerol) and grown (250rpm) at 30 °C overnight in 250 ml baffled shake flasks. When OD600 reached 10 units/ml, the cells were collected by centrifugation (3000 xg , 5min). The cell pellet was resuspended in BMM medium (BMG with 0.5% (w/v) methanol instead of 1 % glycerol) with a starting OD600 of 30 units/ml. The culture was grown for about 120 hours at 30°C. Methanol was added to a final concentration of 10 g/L at every 24 hours. Cell culture supernatants were collected every 24 hours.

Example 5

General fermentation procedure:

Both EGI clone E12 and EGI_L5 clone D5 were subjected to fed-batch fermentation. During second part of the fermentation, glycerol was added to boost the growth of recombinant Pichia pastoris cultures. Fermentation products were collected at different time points throughout the fermentation process and SDS-PAGE and activity analysis were performed for fermentation products collected at different time points. Growth rates of the clones were followed by measuring and calculating dry cell weights (CDW) for each sample collected at different time points. For each sample, activity against 4-MUC was evaluated according to the rate of formation of 4-MU (imM) per minute. Methanol concentration at each time point of fermentation was monitored using a specific methanol probe inside the fermenter. Fermentation data analysis for EGI and EGI_L5 producing clones indicated that the growth rates and expression profiles were found to be very similar for EGI and EGI_L5 during fed-batch fermentations. Enzyme activity and enzyme production was found to be increased with the increase in methanol concentration. There was no enzyme production in glycerol batch and glycerol fed-batch phases in both fermentations as expected. EGI started to be produced after 24 hours and EGI_L5 after 20 hours with methanol induction of the AOX promoter. During methanol fed-batch phase cell growth was minimal. The activities of each recombinant enzyme produced were maximal at the end of the fermentation

Example 6:

Bioreactor Cultivations of recombinant Pichia pastoris strains: Pichia pastoris clones harboring Endoglucanasel and its loop mutant were grown in a 7.5L fermenter (BioFlo 1 10, New Brunswick Scientific) with a starting volume of 2L at 28 °C and pH 5 with feed rates of 1 8 ml/h/L glycerol and 1 -12 ml/h/L methanol. Invitrogen Corp.'s fermentation medium recipe was used for fed-batch fermentations along with PTM1 trace metal solution. Glycerol was used as the sole carbon source throughout glycerol batch and glycerol fed-batch phases of the fermentations. Methanol was used as an inducer of the AOX promoter during methanol fed-batch phase of the fermentations. Methanol levels were monitored using a specific methanol probe (Raven Biotech). Fermentation products were filtered, buffer exchanged and concentrated using Sartocon Micro and Ultrafiltration System (Sartorius-Stedim). Sartocon Slice 200 HydroSart membranes with 0.45 micron cutoff and Polyether sulfone (PES) membranes with 100 kDa and 10 kDa cutoff were used. Example 7:

SDS-polyacrylamide gel electrophoresis (SDS-PAGE), Zymogram Analysis and Limited Proteolysis with Trypsin :

Activity of the produced recombinant enzymes were monitored qualitatively using a zymogram gel analysis. 4-MUC was used as the substrate for the analysis. EGI produced recombinantly in Pichia pastoris was found to have more than one protein band with activity against 4-MUC (50, 70 and 100 kDa). These were thought to be different glycosylation (70 kDa) and/or dimerization products (100 kDa). Limited proteolysis of EGI protein with trypsin has indicated that 50 kDa product was present as a result of proteolytic degradation. EGI_L5 exhibited lower activity against 4-MUC in the zymogram analysis. It was also found to have more than one enzymatically active component, -100 kDa product being the predominant one, and a probable glycosylation product (-70 kDa). Both forms were found to be active against 4-MUC.

Collected cell culture supernatants were run on an SDS-PAGE gel with 5% (w/v) stacking gel and 12% (w/v) separating gel. About 15-20 μΙ of the supernatant was loaded into each well of the gel. After electrophoresis, the gel was stained with Coomassie Brilliant Blue R-250. For the zymogram analysis native SDS- PAGE was performed. The gels were washed with 2.5 % (v/v) TritonX-100- 50 mM sodium acetate solution at pH 4.8 three times for 10 minutes. Then, the gels were washed with 50 mM sodium acetate buffer at pH 4.8 three times for 10 minutes. Zymogram analysis was performed using 4-MUC (4-Methylumbelliferyl beta-D-cellobioside) as a substrate. 1 ml of 0.5 mg/ml 4-MUC in 50 mM sodium acetate buffer at pH 4.8 was used in the zymogram analysis. Activity of the enzymes were visualized and documented under UV-light. After zymogram analysis, the gels were stained with Coomassie Brilliant Blue R-250. All gel photographs were documented using Gel-Doc (BioRad). Limited proteolysis was performed on purified EGI protein using proteomics grade Trypsin (Sigma). Trypsin was dissolved in 50 mM acetic acid to a final concentration of 0.02 Mg/μΙ. 0.02 g/μΙ Trypsin was added to the EGI enzyme in 50 mM ammonium bicarbonate buffer (pH 7.8) such that the ratio of trypsin: protein in the sample is 1 :50 (w/w). The digestion reaction was incubated at 37°C for 75 minutes and samples were collected at different time points (0-5-10-15-30-45-60-75 minutes). The extent of protein digestion was monitored by removing an aliquot of the sample and running the sample on a SDS-PAGE gel. Example 8:

Purification of Recombinant Proteins :

Both enzymes were purified to homogeneity after batch affinity purification with RAC. Two protein bands around 70 and 100 kDa were purified from EGI crude protein solution and only one glycosylation form around 70 kDa was purified from EGI_L5 crude protein solution with RAC. The purified components were the most active products among other glycosylation products for both EGI and EGI_L5. EGI and EGI_L5 were purified using regenerated amorphous cellulose (RAC) as an affinity chromatography matrix. Batch affinity purifications of both enzymes were obtained. Avicel Ph 105 was used for the synthesis of regenerated amorphous cellulose. Purification was performed at room temperature. Recombinant cellulases were eluted with ethylene glycol and ethylene glycol was further removed and exchanged with 50 mM Sodium acetate buffer (pH 5) due to its interference with BCA protein assays by ultrafiltration through 10 kDa cutoff Vivaspin 500 membrane spin filters (Sartorius-Stedim).

Example 9

Experiment on the demonstration of the effect of temperature on the enzyme activity

Activity of each enzyme at different temperatures (15°C -95 °C) were determined by 3,5- Dinitrosalicylic acid (DNS) method against 0,5 % CMC (w/v) in 50 mM sodium acetate buffer (pH 4.8) (Ghose, 1987). Each enzyme and substrate was preincubated for 5 minutes at each assay temperature separately. Enzyme and the substrate were incubated at the assay temperature for 10 minutes. Reducing sugars produced were measured at 550 nm. Glucose was used as a standard and enzyme activity was calculated as CMC units/ml according to lUPAC method for measurement of cellulase activity (Ghose, 1987). Residual enzyme activity was calculated by taking the maximum activity of the enzyme at the determined temperature as 100 %.

Temperature activity profiles of EGI and EGI_L5 produced by fermentation were determined using DNS method and 0.5 % CMC (w/v) as substrate. Activities of both recombinant enzymes at different temperatures exhibited similar profiles. EGI exhibited maximal activity at 45 °C and 55 °C whereas EGI_L5 was found to have a maximum activity at 35 °C. Both enzymes showed activity over a broad temperature range (between 15 °C-65°C). Although EGI_L5 had a reduced activity at 55 °C with respect to EGI, it showed a slightly higher relative enzyme activity at 65 °C, 75 °C and 85 °C. Both enzymes kept -40 % of their activities at 75 °C and 30 % of their activities at 85 °C.

Example 10 Experiment on the demonstration of the effect of pH on enzyme activity

Activity of each enzyme at different pHs (pH 3-6) were determined using 3,5- Dinitrosalicylic acid (DNS) method against 0,5 % CMC (w/v) in different pH buffers for 10 minutes at 55 °C. Citrate-phosphate buffer (100 imM citric acid, 200 mM Na2HPO4) at pH 3, 50 mM sodium acetate buffer at pH 4 and pH 5, 50 mM sodium phosphate buffer at pH 6 were used for determining effect of pH on enzyme activity. Reducing sugars produced were measured at 550 nm. Glucose was used as a standard. Residual enzyme activity was calculated by taking the maximum activity of the enzyme at the determined pH as 100 %.

Both enzymes showed maximal activity at pH 5. pH activity profiles of both enzymes were observed to have followed a very similar pattern. Enzymes were found to be almost inactive at pH 3. Both EG I and EGI_L5 enzymes were found to exhibit Michaelis-Menten type of kinetics on the soluble substrate 4-MUC. The kinetic constants (Km and kcat) were determined at 45 °C. Km values for EG I and EGI_L5 were found to be 0.47 mM and 0.54 mM, respectively. Although the Km values were similar, there was a significant difference in EGI and EGI_L5 kcat values. EGI was found to have a kcat value of 0.013 1 /sec, whereas EGI_L5 has exhibited a kcat value of 0.004 1 /sec.

Example 11

4-MUC Assays

4-MUC assay was performed for fermentation products according to (Chernoglazov et al.,1989). Fermentation samples were incubated with 0.5 mg/ml 4-MUC in 50 mM sodium acetate buffer at pH 4.8. Kinetic analysis was performed at 45 °C for 30 minutes. 4-Methylumbelliferone (4-MU) was used as the standard. Liberated 4-MU was measured with a fluorescence spectrophotometer with excitation at 363 nm and emission at 435 nm. Enzyme activities were calculated as RFU liberated per minute or 4-MU (mM) liberated per minute. Kinetic constants (kcat and Km) for EGI and EGI_L5 proteins were determined against 4-MUC at 45 °C in 50 mM sodium acetate buffer at pH 4.8. Six different substrate concentrations (50-2000 μΜ) were used for the kinetic assay. The enzyme concentration was kept at 0.3 μΜ throughout the assay. All measurements were performed in duplicate. The kinetic constants, Km and kcat were calculated by fitting the initial rate data to the Michaelis-Menten equation with the programme of OriginPro.

Example 12

Stability assays

Enzyme stability was determined by first incubating about 0.4 mg/ml of each enzyme at 100 °C for 10 minutes. Enzymes were then chilled on ice for 10 minutes. Standard CMC assay was performed to 100 °C incubated and unincubated enzyme samples at 55 °C and pH 4.8 for 10 minutes. The stability of each enzyme was calculated with respect to its normal activity in the form of retained activity.

. , . . . Activity_of _enzyme_after _incubation_at _100°C . ..

Retained _tnzyme_ Activity— xLOO

Activity _ of _ enzytne_ without _ incubation_ at_l 00°C

Residual enzyme activity at 50 °C was determined by incubating about 0.4 mg/ml of both enzymes at 50 °C for Oh to 72h and assaying the enzyme activities against 1 % CMC (w/v) at 50 °C and pH 4.8 for 10 minutes. Activity of the enzymes with no incubation (time 0) at 50 °C were taken as 100 %. At least two independent activity tests were carried out for each incubation. At each incubation time, recombinant enzymes were assayed in triplicate with a standard deviation below 10 %.

Residual enzyme activity at 70 °C was also determined by incubating about 0.4 mg/ml of both enzymes at 70 °C for Oh to 2h and assaying the enzyme activities against 1 % CMC (w/v) at 50 °C and pH 4.8 for 10 minutes. Activity of the enzymes with no incubation (time 0) and assayed at 50 °C were taken as 100 %. Enzyme activity was determined in triplicate with a standard deviation below 10 %. After 10 minutes incubation at 100°C, EG I and EGI_L5 were found to retain 94,76 % and 95,41 % of their activities, respectively. The pi's of the EG I and EGI_L5 calculated with ExPASy (Bjellqvist et al., 1993) were 4,66 and 5,35, respectively. Although the calculated pi of EGI was shifted almost one pH unit with the introduction of a ten amino acid loop, its pH profile did not change Both EGI and EGI_L5 were shown to keep 65 % and 57 % of their activity at 50 °C after 72 hours incubation at 50 °C, respectively. Additionally, it was shown that EGI lost its activity more rapidly upon prolonged incubation at 50 °C (after 24h to 72h). Moreover, both enzymes have exhibited similar patterns for their residual enzyme activities upon incubation at 70°C for 2 hours. EGI has shown a 5.3 % decrease in residual enzyme activity whereas EGI_L5 has lost 18 % of its activity after 2 hours of incubation at 70 °C.

SEQUENCE LISTING

<1 10> SABANCI UNIVERSITESI <120> BIOLOGICALLY ACTIVE PROTEINS HAVING HOTSPOTS FOR DIRECTED CROSSLINKING AND IMMOBILIZATION

<130> 12T/7301 <160> 1

<170> BiSSAP 1 .0

<210> 1

<21 1 > 1352

<212> DNA

<213> Trichoderma reesei QM6a

<220>

<221 > source

<222> 1 ..1352

<223> /mol_type="other DNA"

/note="egl1_L5_gene"

/organism="Trichoderma reesei QM6a"

<400> 1

gaattccagc aaccgggtac ctctactcca gaggttcacc caaagttgac tacttacaag 60 tgtactaagt ccggtggttg tgttgctcaa gacacttccg ttgttttgga ctggaactac 120 agatggatgc acgacgctaa ctacaactcc tgtactgtta acggtggtgt taacactact 180 ttgtgtccag acgaggctac ttgtggaaag aactgtttca tcgagggtgt tgactatgct 240 gcttccggtg ttactacttc tggttcctcc ttgactatga accagtacat gccatcttcc 300 tctggtggtt actcttctgt ttccccaaga ttgtacttgt tggacaagaa gggtaagaag 360 aagggtaaga aatccgacgg tgaatacgtt atgttgaagt tgaacggtca agagttgtct 420 ttcgacgttg acttgtccgc tttgccatgt ggtgaaaacg gttccttgta cttgtctcag 480 atggacgaaa atggtggtgc taaccagtac aatactgctg gtgctaacta cggttctggt 540 tactgtgatg ctcagtgtcc agttcagact tggagaaacg gtactttgaa cacttcccac 600 cagggattct gttgtaacga gatggacatc ttggagggaa attccagagc taacgctttg 660 actccacact cttgtactgc tactgcttgt gactctgctg gttgtggttt taacccatac 720 ggttccggtt acaagtctta ctacggtcca ggtgacactg ttgacacttc caagactttc 780 actatcatca ctcagttcaa cactgacaac ggttctccat ccggtaactt ggtttccatc 840 actagaaagt accagcagaa cggtgttgat attccatctg ctcaaccagg tggtgacact 900 atttcctctt gtccatccgc ttcagcttat ggtggattgg ctactatggg aaaggctttg 960 tcctctggaa tggttttggt tttctccatc tggaacgaca actcccaata catgaactgg 1020 ttggactctg gtaatgctgg tccatgttct tctactgagg gtaacccatc caacatcttg 1080 gctaacaacc caaacactca cgttgttttc tccaacatca gatggggtga cattggttcc 1 140 actacaaact ctactgctcc accaccacca cctgcttcct ctactacttt ctccactact 1200 agaagatcct ccactacttc ttcctctcca tcctgtactc aaactcactg gggacaatgt 1260 ggtggtattg gttactccgg ttgtaagact tgtacttccg gtactacttg tcagtactcc 1320 aacgactact actcgcaatg ccttgctcta ga 1352

Claims

1. A biologically active mutant protein, comprising of all essential tertiary structural elements of a corresponding native protein and at least one surface-exposed non-native structural element, characterized in that said non-native structural element is located endo within protein primary structure and forms a surface-exposed peptide loop for creating a hotspot to allow directed protein immobilization and sustained stability of the folded protein tertiary structure.

2. The biologically active mutant protein according to claim 1 wherein the mutated protein is selected from a group of proteins comprising enzymes, antibodies, receptors, antibody fragments, binding proteins and synthetic peptides.

3. The biologically active mutant protein according to claim 2 wherein the mutated protein is preferably an enzyme and more preferably a cellulase enzyme.

4. The biologically active mutant protein according to claim 3 wherein the mutated protein is an endoglucanase enzyme.

5. The biologically active mutant protein according to claim 4 wherein endoglucanase enzyme is an extract of Trichoderma reesei.

6. The biologically active mutant protein according to any of the preceding claims wherein the inserted surface-exposed peptide loop comprises of at least 5 and at most 15 amino acids.

7. The biologically active mutant protein according to any of the preceding claims wherein the inserted surface-exposed peptide loop is a post- translation product of an oligonucleotide sequence comprising a modified endonuclease gene having plurality of codons for amino acid sequences selected from lysine and glycine.

8. The biologically active mutant protein according to claim 7 wherein the inserted surface-exposed peptide loop comprises of alternating lysine and glycine amino acid sequences.

9. The biologically active mutant protein according to claim 7 wherein the endonuclease gene comprises a nucleic acid sequence having at least 60% sequence identity with SEQ NO1 .

^"lO.The biologically active mutant protein according to claim 7 wherein the inserted surface-exposed peptide loop is defined as KKGGKKKGGK.

11. The biologically active mutant protein according to any of the preceding claims wherein the inserted surface-exposed peptide loop is positioned substantially 180° on the opposite side of active center of the protein within an existing loop which is solvent accessible and flexible.

12.The biologically active mutant protein according to claim 1 1 wherein the inserted surface-exposed peptide loop is positioned between 1 12^th and 1 13^th residues on about 28 A° away from the Ca of active center residues.

13. A method of genetically engineering a biologically active mutant protein as described in claims 1 , comprising the steps of:

(1 ) defining a site along an exon region of the target protein gene for insertion of a surface-exposed loop-forming oligonucleotide,

(2) defining a sequence of a DNA primer which is comprised of overlapping ends bridged by said loop-forming oligonucleotide, whereof said primer is designed to hybridize, via said overlapping ends, along the region of said chosen insertion site,

(3) chemically synthesizing a DNA primer comprising of said overlapping ends bridged by said loop-forming oligonucleotide sequence, (4) applying overlap PCR extension to prepare a mutant gene containing said loop-forming oligonucleotide sequence located within the specified region of the exon of the target protein gene,

(5) applying DNA isolation to purify said mutant gene,

(6) expressing said mutant gene, and

(7) isolating the mutant of said target protein containing said surface- exposed peptide loop.

14. A method according to claim 14 wherein the oligonucleotide sequence comprises a nucleic acid sequence having at least 60% sequence identity with SEQ NO1 SEQ NO1 .

15. An oligonucleotide sequence comprising a nucleotide sequence of modified endoglucanase gene having plurality of codons for amino acid sequences selected from lysine and glycine.

16. The oligonucleotide according to claim 15 wherein endonuclease gene comprises alternating lysine and glycine amino acid sequences.

17.The oligonucleotide sequence according to claim 15 wherein the endonuclease gene is selected from Trichoderma reesei (QM9414) egl1 gene.

18. The oligonucleotide sequence according to claims 15 wherein the endoglucanase gene is encoded by a nucleic acid sequence as set out in

SEQ NO1 , the reverse complement of the said sequence, the complement of the said sequence, the reverse of the said sequence or sequences having at least 60% sequence identity with the nucleic acid sequences of any one of the afore-mentioned sequences.

19. A nucleic acid construct comprising a promoter or expression of an endoglucanase gene comprising a nucleic acid sequence having at least 60% sequence identity with SEQ NO1 ; a plurality of codons for lysine and glycine residues; and a nucleotide sequence of said endoglucanase gene.

20. A nucleic acid construct according to claim 19 wherein the promoter comprises a pPiczalphaA plasmid.

21. A nucleic acid construct according to claim19 wherein the pPiczalphaA plasmid is expressed in a Pichia pastoris host, and most preferably in Pichia pastoris KM71 H strain.

22. A nucleic acid sequence having at least 60% sequence identity with SEQ NQ1 .