WO2013103808A1 - Expression of negative sense rna viruses and double-stranded rna viruses, and uses thereof - Google Patents

Abstract

The invention relates to the fields of viruses, vaccines and compounds and methods for expression. In particular, the invention includes methods and agents capable of producing quantities of a vaccine to a mono-segmented, bi-segmented, tri-segmented or multi- segmented negative sense, single stranded RNA ("(-)sense RNA") virus.

Description

Expression of Negative Sense RNA Viruses and Double-Stranded RNA Viruses, and Uses

Thereof Cross Reference to Related Applications

This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 61/583,477, filed January 5, 2012, the entire content of which is hereby incorporated by reference in its entirety.

Field of the Invention

The invention relates to the fields of viruses, vaccines and compounds and methods for expression. In particular, the invention includes methods and agents capable of producing quantities of a vaccine to a negative sense, single- stranded RNA ("(-)sense RNA") virus and double- stranded RNA ("dsRNA") virus.

Cross Reference to Sequence Listing

The Sequence Listing created on December 4, 2013, and identified as "VTC0002-

00WO_ST25.txt" (21,000 bytes), is hereby incorporated by reference.

Background of the Invention

Use of attenuated virus is often the most effective way of vaccinating. If a commercial attenuated vaccine is to be produced by treating an infectious virus, a commercial quantity of infectious virus must be produced for treatment. An impediment to that production often exists since an infective virus will kill its host cell before commercial quantities can be obtained. Accordingly, an alternative means for production of commercial quantities of an infectious or attenuated virus are needed.

Baculo viruses represent a family of large, rod-shaped enveloped viruses with a double stranded DNA genome size of from 80-180 Kb. Baculo viruses are considered to be species- specific among invertebrates with over 600 host species described, but they are not known to infect mammalian or other vertebrate animal cells. In the 1940's they were used widely as biopesticides and since the 1990's they have been used for producing complex eukaryotic proteins in insect culture cells (e.g., Sf9) or insect larvae (e.g., lepidopteron larvae). The most widely studied baculo virus is Autographa calif omica multicapsid nucleopolyhedrovirus (AcMNPV), a 134 Kb genome virus with 154 open reading frames.

Brief Description of the Drawings Figure 1. Vector map of shrimp viral promoter, P2 in pFastbacDual™ vector (pFastBac

P2).

Figure 2. Vector map of shrimp viral promoter, P2 and bacterial promoter, T7 in FastbacDual™ vector (pFastBac Dual P2/T7).

Figure 3. Vector map of negative sense single- stranded RNA viral genome under shrimp viral promoter, P2 in pFastbacDual™ vector that contains a bacterial promoter T7 downstream of the viral genome (pFastBac Dual P2/T7 NV).

Figure 4. Vector map of shrimp viral promoter, P61 in pFastBac P2/T7 NV (pFastBac Dual P2/P61/T7 NV).

Figure 5. Vector map of negative sense, single- stranded RNA virus under shrimp viral promoter in pFastBac Dual vector containing bacterial T7 polymerase gene (pNV pol).

Figure 6. Vector map of a RNA-L of Lymphocytic choriomeningitis virus (LCMV) under shrimp viral promoter, P2 in pFastbacDual™ vector that contains a bacterial promoter T7 downstream of the viral genome (pLCMV-L).

Figure 7. Vector map of a RNA-L of Lymphocytic choriomeningitis virus (LCMV) under shrimp viral promoter, P2 in pFastbacDual™ vector that contains a bacterial T7 polymerase gene (pT7pol LCMV-L).

Figure 8. Vector map of a RNA-L of Lymphocytic choriomeningitis virus (LCMV) under shrimp viral promoter, HPV P2 in pGL3-Basic vector that contains a T7 terminator sequence at the 5'-end and a T7 promoter sequence (pGL3B-LCMV-S).

Figure 9. Vector map of Lymphocytic choriomeningitis virus (LCMV) RNAs L and S under the transcriptional control of shrimp promoters in pFastbacDual™ vector that contains a bacterial T7 polymerase gene (pT7pol LCMV-L-S).

Figure 10. Vector map of LACV RNA segment M under the control of a shrimp viral promoter, IHHNV P2 in pFastbacDual™ vector (pLACV-M).

Figure 11. Vector map of LACV RNA segment M under the control of a shrimp viral promoter, IHHNV P2 with a T7 terminator sequence and T7 RNA Polymerase under the control of HPV P2 promoter (pLACV-M-T7pol).

Figure 12. Vector map of LACV RNA segment S under the control of a shrimp viral promoter WSSV iel in pGL3Basic vector (pGL3B-LACV-S).

Figure 13. Vector map of LACV RNA segment M under the control of a shrimp viral promoter, IHHNV P2 with a T7 terminator sequence upstream of the S RNA under the control of shrimp viral promoter WSSV iel and a T7 promoter downstream of the S RNA and T7 RNA Polymerase under the control of HPV P2 promoter (pLACV-M-T7pol-S).

Figure 14. Vector map of LACV RNA segment L under the control of a shrimp viral promoter IHHNV PI 1 in pGL3Basic vector (pGL3B-LACV-L).

Figure 15. Vector map of LACV RNA segments L, M and S under the control of shrimp viral promoters in baculo virus vector (pLaCV-M-T7pol-S-L).

Figure 16. Vector map of influenza viral genomic segment 5 cloned into a baculovirus vector (pSeg 5).

Figure 17. Vector map of influenza viral genomic segment 5 and T7 RNA Polymerase gene cloned into a baculovirus vector (pT7pol Seg 5).

Figure 18. Vector map of influenza viral genomic segment 1 cloned into pGL3-Basic vector (pGL3B-Seg 1).

Figure 19. Vector map of influenza viral genomic segment 2 cloned into pGL3-Basic vector (pGL3B-Seg 2).

Figure 20. Vector map of influenza viral genomic segment 3 cloned into pGL3-Basic vector (pGL3B-Seg 3).

Figure 21. Vector map of influenza viral genomic segment 4 cloned into pGL3-Basic vector (pGL3B-Seg 4).

Figure 22. Vector map of influenza viral genomic segment 6 cloned into pGL3-Basic vector (pGL3B-Seg 6).

Figure 23. Vector map of influenza viral genomic segment 7 cloned into pGL3-Basic vector (pGL3B-Seg 7).

Figure 24. Vector map of influenza viral genomic segment 8 cloned into pGL3-Basic vector (pGL3B-Seg 8).

Figure 25. Vector map of influenza virus RNA segments #5 and #7 under the control of shrimp viral promoters, IHHNV P2 and P61 in pFastbacDual™ vector (pT7pol Seg 5-7).

Figure 26. Vector map of influenza virus RNA segments #5, #7, and #3 under the control of shrimp viral promoters in pFastbacDual™ vector (pT7pol Seg 5-7-3).

Figure 27. Vector map of influenza virus RNA segments #5, #7, #3, and #4 under the control of shrimp viral promoters in pFastbacDual™ vector (pT7pol Seg 5-7-3-4).

Figure 28. Vector map of influenza virus RNA segments #5, #7, #3, #4, and #6 under the control of shrimp viral promoters in pFastbacDual™ vector (pT7pol Seg 5-7-3-4-6). Figure 29. Vector map of influenza virus RNA segments #5, #7, #3, #4, #6, and #8 under the control of shrimp viral promoters in pFastbacDual™ vector (pT7pol Seg 5-7-3-4-6- 8).

Figure 30. Vector map of influenza virus RNA segments #5, #7, #3, #4, #6, #8, and #1 under the control of shrimp viral promoters in pFastbacDual™ vector (pT7pol Seg 5-7-3-4-6-8- 1).

Figure 31. Vector map of influenza virus RNA segments #5, #7, #3, #4, #6, #8, #1, and #2 under the control of shrimp viral promoters in pFastbacDual™ vector (pT7pol Seg 5-7-3-4- 6-8-1-2). Detailed Description of the Invention

Pal et al. (J. Virol., 81:9339 (2007)) describe the production of an insect virus

(Rhopalo siphon padi; RhPV) in a homologous insect system. A second insect virus

(baculo virus) was used as an expression vector for the RhPV. The RhPV was downstream from two promoters - the /^/-promoter and the core baculo virus late promoter of pFastBacl.

The expression of genes in heterologous systems is generally more difficult than in homologous systems, particularly if the gene sources and the heterologous system are phylo genetically distant such as insects and crustaceans. The term "heterologous" is used hereinafter for any combination of nucleic acid sequences that is not normally found intimately associated with a mono- segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense, single- stranded RNA virus or mono-, bi-, tri-, or multi- segmented (-)sense, single- stranded RNA virus host in nature. In an aspect, chimeric promoter domains are heterologous promoters.

Issues of codon usage, specific and unique regulatory sequences, and post-translational modifications all need to be considered when using heterologous production systems.

One skilled in the art may refer to general reference texts for detailed descriptions of known techniques discussed herein or equivalent techniques. These texts include Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc. (1995); Sambrook et al, Molecular Cloning, A Laboratory Manual (2d ed.), Cold Spring Harbor Press, Cold Spring Harbor, New York (1989); Birren et al., Genome Analysis: A Laboratory Manual, volumes 1 through 4, Cold Spring Harbor Press, Cold Spring Harbor, New York (1997-1999); R. K. Upadhyay, Advances in microbial control of insect pests, Springer; 1 edition (2003); Klein, Donald W.; Prescott, Lansing M.; Harley, John (1993). Microbiology . Dubuque, Iowa: Wm. C. Brown. ISBN 0-697-01372-3; Baculovirus and Insect Cell Expression Protocol (Methods in Molecular Biology, 2007, Second Edition, Ed. David W. Murhammer, Humana Press. These texts can, of course, also be referred to in making or using an aspect of the invention.

The present invention includes and utilizes a facilitating virus capable of infecting a facilitating host comprising a positive strand promoter and a negative stand promoter flanking each nucleic acid sequence that codes for a functional genomic segment of a mono-, bi-, tri-, or multi- segmented negative- sense single- stranded RNA ("(-)sense RNA") virus that is not capable of infecting the facilitating host, wherein the negative strand promoter has a corresponding terminator between the positive strand promoter and the viral segment. The present invention includes a virus capable of infecting a facilitating host that codes for a mono- , bi-, tri-, or multi- segmented negative- sense single stranded RNA ("(-)sense RNA") viral genome. In a host cell, a (-) strand RNA viral genome requires an RNA-dependant RNA Polymerase (RdRp) to transcribe the (-)strand RNA viral genome before translation.

A segment is the genetic element of many viruses consisting of one copy of a nucleic acid (DNA or RNA) molecule, and its nucleic acid sequence codes for a single functional

RNA transcript or polypeptide. For example, the genome of hepatitis C virus (HCV) consists of a single RNA molecule that contains one cistron which codes for a large polypeptide. The viral genome in the case of HCV is represented by a single segmented RNA (mono- segmented) and the RNA is mono-cistronic. A cistron is a nucleic acid sequence that is equivalent to a gene and codes for a single functional polypeptide. There are also viruses, the genome of which consists of a single RNA molecule (mono-segmented) that contain a single cistron which codes for more than a single functional polypeptide. A second polypeptide may be produced from a second open reading frame or may be generated by endoproteolytic cleavage of a single precursor polypeptide.

A (-)strand RNA viral genome that has a single segment is a mono -segmented virus.

Negative sense, single- stranded, linear non-segmented RNA viruses are classified in the Order Mononegavirales, families Bornaviridae (Genus: Bornavirus), family Rhabdoviridae (Genus: Vesiculovirus, Lyssavirus, Ephemerovirus, Novirhabdovirus, Cytorhabdovirus,

Nucleorhabdovirus), family Filoviridae (Genus: Marburgvirus and Ebola virus), and family Paramyxoviridae (Genus: Rubalavirus, Avulavirus, Respirovirus, Henipavirus, Morbillivirus, Pneumovirus, and Metapneumovirus). Viruses belonging to the above listed families infect plants, invertebrates and vertebrates, cause a wide range of diseases and sometimes cause fatal infection. For example, Rabies virus (RABV), the type species in the genus Lyssavirus, is the etiological agent of rabies encephalitis in mammals including humans. Infectious

hematopoietic necrosis virus (IHNV), the type species of the genus Novirhabdovirus, is an important viral pathogen of salmonid fish, and is prevalent in Europe, North America and Asia. Lettuce necrotic yellow virus (LNYV), the type species of the genus Cytorhabdovirus, is an important plant virus that infects lettuce. Marburg virus (MARV), and Ebolavirus (EBOV), members of the family Filoviridae, are the two deadliest viral pathogens in humans. Mump virus (MuV), the type species of the genus Rubulavirus infects humans. Newcastle disease virus (NDV), the type species of the genus Aulavirus, infects chickens. Human respiratory syncytial virus (HRSV), the type species of the genus Pneumovirus infects humans. Citrus psorosis virus (CPsV), the type species of the genus Ophiovirus, causes diseases in citrus.

The genome of the viruses belonging to the Order Mononegavirales, families

Bornaviridae, Rhabdoviridae , Filoviridae, and Paramyxoviridae contain negative sense, single- stranded, linear, non-segmented RNA, 8.9- 19.0 kb in size and encodes envelope glycoprotein s), a matrix protein, a major RNA binding protein, nucleocapsid associated protein(s), and a large polymerase protein. The 5'- and the 3' terminal ends of the viruses contain inverse complementarity and conserved motives (Pringle, C. R. Order:

Mononegavirales, In: Virus Taxonomy, Eight Report of the International Committee on Taxonomy of Viruses. (Eds.) C. M. Faquet, M. A. Mayo, J. Maniloff, U. Desselberger, L. A. Ball, International Union of Microbiological Societies, pp 609-614).

There are (-)strand RNA viruses, the genome of which consists of more than one RNA segment. These viruses include (-) strand RNA viruses containing bi-segmented genome such as those belonging to the family A re naviridae (2 +/- segments); (-) strand RNA viruses containing

3/4/5 -segmented genome such as those belonging to the family Bunyaviridae (3 or +/- segments), family Orthomyxoviridae (7-8 segements), and the unassigned genera of

Varicosavirus and Ophiovirus (3-4 segments).

Examples of a single- stranded negative- sense RNA viruses containing tri-segmented genome include viruses in each of the five genera Orthobunyavirus, Hantavirus, Nairovirus, Phelbovirus and Topsovirus in the family Bunyaviridae. Virions representing these genera are generally spherical or pleomorphic, 80-120 nm in diameter with glycoprotein projections that are embedded in the lipid bilayered envelop of the virus. The genome of these viruses consists of three negative or ambisense, single- stranded RNA molecules designated as L (large), M (medium) and S (small), and the terminal nucleotide sequence of each genomic fragment are base-paired forming non-covalently closed circular RNAs. The nucleotide lengths of the three RNAs vary from -6.5 to 12.2 kb for L, -3.2 to 4.9 kb for M, and -0.96 to 2.9 kb for S. The L segment codes for a viral RNA polymerase, the M segment codes for envelop glycoproteins and no n- structural proteins, and the S segment codes a nucleocapsid and no n- structural proteins (Nichol, S. T., Beaty, B. J., Elliott, R. M., Goldbach, R., Plyusnin, A., Schmaljohn, C. S., and Tesh, AR. B. 2005. Family: Bunyaviridae, In: Virus Taxonomy, Eight Report of the International Committee on Taxonomy of Viruses. (Eds.) C. M. Faquet, M. A. Mayo, J.

Maniloff, U. Desselberger, L. A. Ball, International Union of Microbiological Societies, pp 695-716).

The shrimp viral promoters can be used to expressing a double- stranded RNA virus in insect and mammalian cells. These viruses are classified in the families Cystoviridae,

Reoviridae ( Genera Orthoreovirus, Orbivirus, Rotavirus, Coltivirus, Seadornavirus,

Aquareovirus, Idnoreovirus, Cypovirus, Fijivirus, Phytoreovirus, Oryzavirus, and

Mycoreovirus), Bimaviridae (Genera Aquabirnavirus, Avibimavirus and Entompbimavirus), Totiviridae (Genera Totivirus, Giardiavirus and Leishmaniavirus), Partitiviridae (Genera Partitivirus, Alphacryptovirus and Betacryptovirus, Chrysoviridae (Genus Chrysovirus), Hypoviridae (Genus Hypovirus)and a monotypic genus, Endomavirus.

Genomes of these viruses include either non-segmented (e.g. Endomavirus genome which contains a linear dsRNA of -14-17.6 kbp in length, Cryphonectria hypovirus 1 in the family Hypoviridae the genome of which contains a linear dsRNA of -9-13 kbp in size;

Totivirus, Giardiavirus and Leishmaniavirus of the family Totiviridae the genome of which contains a single molecule of linear uncapped dsRNA of 4.6-7.0 kb in size) or bi-segmented (e.g. White clover cryptic virus 1 in the genus Alphacryptovirus which contains two dsRNA of about 1.7 and 2.0 kbp; White clover cryptic virus 2 in the genus Betacryptovirus which contains two dsRNA of about 2.1 and 2.25 kbp; Atkinsonella hypoxylon virus in the genus Partitivirus the genome of which contains two dsRNA of 1.4 to 2.2 kbp; Aquabirnavirus, Avibimavirus and Entompbimavirus in the family Bimaviridae the genome of which contains two dsRNA of -2.9-3.2 kbp and -2.7 to 2.9 kbp); tri-segmented (e.g. Cystovirus in the family Cystoviridae with three dsRNA of -6.3 kbp, -4.1 kbp, and -2.9 kbp) and multi- segmented (e.g. Chrysovirus where the genome contains four linear dsRNA of 2.4 to 3.6 kbp in size; and 10, 11 or 12 segmented genome of the members of the family Reoviridae). (In: Virus

Taxonomy, Eight Report of the International Committee on Taxonomy of Viruses. (Eds.) C. M. Faquet, M. A. Mayo, J. Maniloff, U. Desselberger, L. A. Ball, International Union of Microbiological Societies, pp443-605).

In an aspect, a bi-segmented virus is a multi- segmented virus. In such an aspect, the methods of the present invention used to amplify, replicate, or amplify and replicate a bi- segmented (-) sense RNA virus can be used for all multi- segmented viruses. Viruses for which the genome is multi- segmented include members of the family "Orthomyxoviridae" (among others) and include members of the genus Influenzavirus A. The Influenzavirus virus genome consists of eight pieces of negative- sense RNA and is thus a multi- segmented genome.

In an aspect of the present invention, each segment of a (-)sense RNA viral genome is operably linked to at least one promoter sequence, preferably two. As used herein, linked means physically linked, operably linked, or physically and operably linked. As used herein, physically linked means that the physically linked nucleic acid sequences are located on the same nucleic acid molecule, for example a facilitating viral genome can be physically linked to a mono-, bi-, tri-, or multi- segmented (-)sense viral genome as part of a single nucleic acid molecule. In a preferred aspect, two promoters are operably linked to each DNA sequence that codes for a (-)sense RNA viral genome segment of the present invention such that a single promoter transcribes a single strand of a(-)sense RNA viral genome segment and a second promoter transcribes the reverse complementary strand of a (-)sense RNA viral genome segment. In another preferred aspect, a transcription terminator sequence is present 3' to a promoter and the functional (-)sense RNA viral genome segment. In an aspect, a DNA sequence that codes for a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome of the present invention is not operably linked to any promoter derived from a host of the (-)sense RNA virus.

A promoter can be any promoter. Promoters include ds-acting transcriptional control elements and regulatory sequences that are involved in regulating or modulating the timing and/or rate of transcription of a gene or genes. A promoter can be operably linked to a coding sequence for RNA polymerase to initiate transcription at the promoter and transcribe the coding sequence into RNA. In an aspect, a promoter can be pantropic, cell type-specific, tissue-specific, or a promoter functional in an insect cell, a mammalian cell, or a human cell. In a preferred aspect, the promoter is a pantropic promoter. In another aspect, a promoter is CMV, pol, plO, polH, gp64, TK, P2, Pll and P61 of IHHNV, or iel of white spot syndrome virus or P2, Pll and P48 of HPV. See Dhar, A. K., Kaizer, K. N., Lakshman, D. K. 2010. Transcriptional analysis of Penaeus stylirostris densovirus genes, Virology, 402: 112-120; Dhar, A. K., Lakshman, D. K., Natarajan, S., Allnutt, F. C. T., and van Beek, N. A. M., 2007. Functional characterization of putative promoter elements from infectious hypodermal and hematopoietic necrosis virus (IHHNV) in shrimp and in insect and fish cell lines. Virus Res. 127: 1-8; Liu, W-J., Chang, Y- S., Wang, C-H., Kou, G-H., Lo, C-F. 2005. Micro array and RT-PCR screening for white spot syndrome virus immediate-early genes in cyclohexamide- treated shrimp. Virology 334: 327-341; Sukhumsirichart, W., Attasart, P., Boonsaeng, V., and Panyim, S., 2006. Complete nucleotide sequence and genome organization of hepatopancreatic parvovirus (HPV) of Penaeus monodon. Virology 346: 266-277, all hereby incorporated by reference in their entirety. In one aspect, phylogenetic analysis reports that HPV is closely related to mosquito densoviruses, Aedes aegypti densovirus (AaeDNV) and Aedes albopictus DNV (AalDNV) and IHHNV. Based on the genome organization and phylogenetic

relationship, it has been proposed that HPV should be a new member of the sub-family Densovirinae, family Parvoviridae (Sukhumsirchart et al., 2006).

A positive strand promoter can be any promoter that is operably linked to a nucleic acid sequence that codes for a viral genomic segment and controls the transcription of a nucleic acid sequence that codes for a positive strand of a (-)sense RNA virus. In an aspect, a positive strand promoter is CMV, pol, plO, polU, gp64, TK, P2, Pll and P61 of IHHNV, or iel of white spot syndrome virus or P2, Pll and P48 of HPV. A positive strand promoter flanking a nucleic acid sequence that codes for a genomic segment results in the transcription of (+) strand RNA. A negative strand promoter can be any promoter that is operably linked to a nucleic acid sequence that codes for a viral genome segment and controls the transcription of a nucleic acid sequence that codes for a negative strand of a (-) sense RNA virus. A negative strand promoter flanking a nucleic acid sequence that codes for a genomic segment results in the transcription of (-)strand RNA. In an aspect, a negative strand promoter is a promoter recognized by a single chain DNA- dependent RNA polymerase. In a preferred aspect, a negative strand promoter is a T7 DNA- dependent RNA polymerase promoter, a T3 DNA- dependent RNA polymerase promoter, or an SP6 DNA-dependent RNA polymerase promoter.

A transcription terminator sequence is a nucleic acid sequence present in a DNA template that causes the termination of transcription leading to the formation of the 3' terminus of an RNA transcript. A transcription terminator sequence is strand specific and terminates transcription of a DNA-dependent RNA polymerase initiated at a promoter located on a DNA nucleic acid sequence 5' of the terminator. In an aspect of the invention, a transcription terminator sequence is present 3' (e.g. downstream) to a promoter and the functional (-)sense RNA viral genome segment. In another aspect, the transcription terminator sequence terminates transcription of the transcript initiated from a negative strand promoter. In a preferred aspect of the invention, the negative strand terminator sequence is present between the positive strand promoter and the viral segment. In an aspect of the invention, a transcription terminator can be a viral terminator. In another aspect, a transcription terminator can be a bacteriophage transcription terminator. In another aspect, the transcription terminator sequence can be a T7 transcription terminator, a T3 transcription terminator or an SP6 transcription terminator.

Promoter elements, motifs, boxes, or regions can be used alone, in combination with each other, or in combination with other promoters. For example, P2 promoter (SEQ ID NO:4) contains GC-rich sequences (23-30 nts), a palindromic region (49-66 nts), a TATA-box (69-75 nts), an initiation of transcription motif (Inr; 100- 103 nts), a G-residue at +24 from the transcription start site and a downstream promoter element (DPE)-like motif (128- 132 nts). See Table 1. The PI 1 (SEQ ID NO:5) promoter contains a CTTTC tandem repeat element, also known as activation sequence- 1 like (ASL) box (406-410 and 416-420 nts), a downstream TATA- like box (437-445 nts), an Inr (466-469 nts), three Gs at positions +23 to +25 relative to C of the Inr, and a DPE (494-498 nts). See Table 1. Each of these elements, motifs, boxes, or regions can be used. The P61 promoter (SEQ ID NO:6) contains an A-rich region (2409- 2416 nts), a TATA-like box (2435-2442 nts), an initiator element/transcription initiation signal (Inr/TIS) motif (2441-2444 nts), a guanine nucleotide 24 residues from the transcription initiation site (+24 G-nucleotide, 2465 nt), and a DPE (2469-2473). See Table 1. Each of these elements, motifs, boxes, or regions can be used with any promoter of the present invention. Unlike the canonical TATA box found in P2, the PI 1 and P61 promoters contain the sequences AAATAT and AAATAA, respectively, in the corresponding locations.

In an aspect, these same or similar domains can be identified in other promoters, for example, shrimp and pantropic promoters such as HPV promoters, P2, P22, and P48

(GenBank accession number DQ002873). Each of these elements, motifs, boxes, or regions can be used alone or in combination with one or more other elements. The nucleotide sequence of such promoters can be analyzed using both the Neural Network Promoter Prediction (PPNN: on the world wide web as fruitfly.org/seq_tools/promoter.html) and the TRANSFAC Promoter signal scan (on the world wide web as

bimas.dcrt.nih.gov:80/molbio/signal/) programs. A number of sequence motifs are identified in such promoters. See also, W. Sukhumsirichart, A. Pongsopee, V. Boonsaeng, S. Panyim, Complete nucleotide sequence and genomic organization of hepatopancreatic parvovirus (HPV) of Penaeus monodon. Virology: 46 (2006) 266-277. Modified or native shrimp promoters of the present invention can be used to express a segment of a mono-, bi-, tri-, or multi- segmented (-)sense single stranded RNA virus in any cell, such as bacteria, yeast, fungus, insect cells, and mammalian cells.

In another aspect, a promoter is derived from an invertebrate gene, such as an insect gene or crustacean gene or a fish gene, a recombinant baculo virus vector or a baculo virus infecting shrimp such as Monodon baculo virus (MBV). In a further aspect, a promoter driving the transcription of a segment of a mono-, bi-, tri-, or multi- segmented (-)sense single stranded RNA viral genome is functional in a facilitating host cell, is recognized by a facilitating host RNA polymerase, or both.

In another aspect, the promoter driving transcription of a segment of a mono-, bi-, tri- , or multi- segmented (-)sense single stranded RNA viral genome can be selected based on strength in driving transcription. In an aspect, strength in driving transcription can be assessed by an in vitro assay before cloning the promoter upstream of the (-)sense RNA viral genome. For example, to determine the functional activities of three promoters (P2, Pll, and P61) of IHHN virus of shrimp, these promoter elements can be cloned upstream of a firefly luciferase gene in a promoter assay vector, pGL3-Basic (Fig. 1A) and cotransfected with pGL4.75 hRLuc/CMV into Sf9 cells. Luciferase activities can be determined using the Dual-Glo^® Luciferase Assay Kit (Promega^®) following the manufacturer's recommendations. An in vitro luciferase assay can be done three times and luciferase data (fLuc/rLuc values) can be normalized to a control treatment (such as non-transfected Sf9 cells) before running paired two t-test. Normalized data can then be taken to plot in a bar diagram.

Table 1. Sequence Motifs Present in the IHHNV Promoters.

1. P2 promoter

constructs

P2 4 GC - rich (GCGAGCGC), Inverted

Repeat (ACCTATGAC

GTCATAGGTXSEQ ID NO:32), TATA box

(TAT AT A A), 24+ G, DPE-like box (TCCAA).

p₂ADPE 20 GC - rich, Inverted Repeat, TATA box, G

p₂ADPEAG 21 GC - rich, Inverted Repeat, TATA box

p₂ADPEAGAGC 22 Inverted Repeat, TATA box p₂ADPEAGAIR 23 GC - rich, TATA box

P2 Basal 24 TATA box

PI 1 promoter constructs

Pl l 5 ASL box (CTTTCtctacCTTTC)

(SEQ ID NO:63), TATA-like box (AAATAT), 24+ G, DPE (AGACC) p _{l l}ADPE 25 ASL box, TATA-like box, G p _{j j} ADPEAG 26 ASL box, TATA-like box p _{l l}AASL 27 TATA-like box

2. P61 promoter

constructs

P61 6 A-rich

(AAACAAGAACAAAAA)(SE Q ID NO:39), TATA-like box (AAATAAAA), 24+ G, DPE box (AGATC)

p₆₁ADPE 28 A-rich, TATA-like box, G

^, , , ΔϋΡΕΔΟ

Pol 29 A-rich, TATA-like box p₆₁ AAR 30 TATA-like box, G, DPE box

P61 Basal 31 TATA-like box

Table 2. The nucleotide sequence of the primers used to clone PsiDNV promoter constructs. The restriction sites are italicized and the name of the restriction enzyme indicated next to the primer sequence wherever applied.

Table 3. Categorization of transiently transfected shrimp viral promoters based on their transcriptional activity in insect and in mammalian cells and in bacteria.

Promoter strength is measured by determining the relative luciferase expression (fLuc/rLuc) driven by shrimp viral promoters in Sf9 and CHO cells. Promoter strength in bacteria is measured by determining the luciferase expression level relative to the total protein in bacteria.

Promoter Promoters in S19 Promoters in CHO Promoters in

Strength cells cells bacteria Strong CMV (SEQ ID NO: 15) CMV WSSV iel (SEQ ID promoters NO:7)

WSSV iel IHHNV PI 1 HPV P22 (SEQ ID

NO:2)

IHHNV P2 IHHNV P2 CMV

polH

Moderate IHHNV PI 1 WSSV iel plO

promoters

IHHNV P61 WSSV pkl (SEQ ID HPV P48 (SEQ ID

NO:8) NO:3)

WSSV rrl (SEQ ID HPV P2 (SEQ ID NO: l) IHHNV P61

NO: 10)

WSSV rr2 (SEQ ID HPV P48 WSSV pkl

NO: 11)

HPV P2 IHHNV P61 WSSV VP28 (SEQ ID

NO: 12)

Weak promoters WSSV pkl WSSV rr2 WSSV rrl

WSSV DNA pol (SEQ ID polH HPV P2

NO:9)

HPV P48 WSSV rrl IHHNV P2

polH (SEQ ID NO: 14) plO (SEQ ID NO: 13) WSSV DNA pol plO WSSV DNA pol WSSV rr2

HPV P22 WSSV VP28 IHHNV PI 1

WSSV VP28 HPV P22

In an aspect, luciferase assays can reveal relative expression of firefly luciferase driven by different promoters. In this aspect, the relative expression of firefly luciferase is measured to a 95% confidence level of greater than p < 0.05, 0.01, 0.005 or 0.001 to be significant. In an aspect, a promoter driving the transcription of a (-)sense RNA viral structural proteins has a 1.5-4 fold higher, 2-5 fold higher, 3-5 fold higher, or 4-5 fold higher level of transcription than a promoter operably linked to only nonstructural components. A promoter is selected so as when operably linked to segments, expression of said segments are optimized in order to maximize processing and virus assembly into mature virions.

Deletion or addition of promoter elements, motifs, boxes, or regions can be used to modify expression levels either to increase or decrease depending on the change. In an aspect, addition of a DPE and a G at +24 can be important in enhancing transcriptional activity of a promoter if those elements, motifs, boxes, or regions are not present in the native sequence. Removal of those elements, motifs, boxes, or regions can have about a 2-fold, 3-fold, 4-fold, or 5-fold decrease in transcription expression of an operably linked segment where the native promoter contained the elements, motifs, boxes, or regions.

For example, the highest level of gene expression for the IHHNV promoters is driven by the P2 promoter (SEQ ID NO:4), followed by the PI 1 (SEQ ID NO:5) and P61 (SEQ ID NO:6) promoters, in descending order. The luciferase expression driven by the P2 promoter is preferably between 1- and 5-fold higher, between 2- and 4-fold higher, about 3-fold higher, or 3- fold higher than expression driven by the PI 1 promoter; and is preferably between 5- and 9-fold higher, between 6- and 8-fold higher, about 7-fold higher, or 7-fold higher than expression driven by the P61 promoter. The promoter activity of PI 1 is preferably between 1- and 5-fold higher, between 2- and 4-fold higher, about 2.5-fold higher, or 2.5-fold higher than P61 activity for luciferase expression. In a preferred aspect, activities of all three promoters are significantly different or reasonably different from each other (Figure 3).

The deletion of the DPE element in the P2 promoter (Ρ2^ΔΟΡΕ) (SEQ ID NO: 20) or the deletion of DPE and the residue G at +24 (Ρ2^ΔΟΡΕΔΟ) (SEQ ID NO: 21) preferably reduces expression by between 0.5- and 3.5-fold, between 1- and 3-fold, about 1.6-fold, or 1.6-fold compared to the full-length P2 promoter. In this aspect, deletion of DPE, but not G at +24, can have a measurably or significant negative effect on P2 activity. In another aspect, _p2ADPEAGAGc _{(SEQ m} J^Q. ₂₂) has an effect of between 10- and 15-fold, of between 11- and 14-fold, of about 13-fold, or of 13-fold on the promoter activity compared to the deletion of either DPE or DPE and G at +24 (about -1.6 fold). In an aspect, the GC-rich box in P2 promoter plays a role in the transcription of NS 1 protein in IHHNV. In an aspect, a GC-rich box is deleted in whole or in part to reduce expression.

In another aspect, the deletion of an IR element along with DPE and a guanine nucleotide 24 residues from the transcription initiation site (SEQ ID NO: 23) provides a reduction of between 30- and 44-fold, between 35- and 39-fold, about 37-fold or 37-fold in luciferase expression driven by a promoter, including without limitation, a P2 promoter. In an aspect, both DPE-and GC-rich box modulate promoter activity. In this aspect, deletion of an IR region has the highest negative impact on promoter activity compared to deletion of either DPE- or GC-rich box elements, such as for the P2 promoter. In one aspect, a P2 basal promoter (SEQ ID NO:24) showed a barely detectable level of expression. Although the TATA-box and TIS together are capable of driving heterologous gene expression, sequence elements, motifs, boxes, or regions, such as IR region, DPE, GC-rich motifs are three important elements in modulating transcriptional activity of promoters, such as IHHNV P2 promoter. In an aspect, the combination of the following elements, motifs, boxes, or regions are determined that would provide the desired expression level.

Similar to the P2 promoter (SEQ ID NO:4), the full-length PI 1 promoter (SEQ ID

NO:5) can have the highest transcriptional activity compared to deletions of elements in the full-length promoter. A deletion of the DPE element alone (PI 1^ΔΟΡΕ) (SEQ ID NO:25) from the full-length PI 1 construct can reduce the promoter activity preferably by between 6- and 10-fold, between 7- and 9-fold, about 8-fold, or 8-fold; or a deletion of both the DPE and the nucleotide G at +24 (PI ΐ^ΔΟΡΕΔΟ) (SEQ ID NO:26) from the full-length PI 1 construct can reduce the promoter activity preferably by between 14- and 20-fold, between 16- and 18-fold, about 17-fold, or 17-fold. In one aspect, a deletion of G at +24 can have a negative effect in PI 1 promoter or other promoter activity. In another aspect, deletion of the ASL-box (PI 1^AASL) can have a negative effect on promoter activity, and the effect of one aspect can be

significantly or measurably lower than the deletion of DPE or the DPE and G at +24 (SEQ ID NO:27) (Figure 3). In one aspect, the PI 1 promoter, DPE, G at +24 and ASL-box can be the regulators of transcriptional activity.

In one aspect, among P2, PI 1 and P61, the P61 promoter has the lowest transcriptional activity. In another aspect, like the P2 and PI 1 promoters, deletion of DPE motif from the P61 promoter (P61^ADPE) (SEQ ID NO:28) reduces the transcriptional activity of P61 promoter significantly or in a measurable amount. In an aspect, deletion of DPE can reduce the transcriptional activity of a promoter. In another aspect, deletion of both the DPE and +24 G (Ρ61^ΔΟΡΕΔΟ) (SEQ ID NO:29) can decrease promoter activity to almost a basal level or preferably to a reduction of between 1.6- and 3.6-fold, between 2- and 3.2-fold, about 2.6-fold, or 2.6 fold. In an aspect, DPE and the G at +24 are important in enhancing the transcriptional activity of P61 promoter. In an aspect, deletion of the A-rich region (P61^AAR) (SEQ ID

NO:30) can have an effect (preferably -1.3 fold) on P61 transcriptional activity, preferably between 1.0- and 1.6-fold, between 1.1- and 1.5-fold, about 1.3-fold, or 1.3-fold (Figure 3). The P61 Basal promoter (SEQ ID NO:31) contains a TATA-like box and TIS element only shows a transcriptional activity similar to Ρ615^ΔΟΡΕΔ°. In an aspect, addition of DPE and the G at +24 can be important in enhancing transcriptional activity of a promoter. Addition of these domains in promoters lacking these sequence enhances the promoter activity for the expression of a heterologous gene or virus in at least one of an insect, mammalian, yeast, fungus, or bacterial cell culture system relative to a promoter without said domain. Where the domain is removed from a promoter otherwise having the domain in nature, the transcriptional activity is reduced.

In another aspect, STAT-binding sequences increase expression of operably linked genes, and the deletion of the STAT-binding sequence in the reporter gene construct significantly or measurably reduces the expression. In a preferred aspect, the STAT sequence operable in said facilitating host cell comprises ACTCATTTATTC (SEQ ID NO:33) or CTTGTTACTCATTTAATCCAAGAAA (SEQ ID NO:34).

In a further aspect, STAT sequences have any substitution for a STAT sequence except at five nucleotides that are conserved across species boundaries selected from the group consisting of nucleotide C at position 11, nucleotide A at position 12, nucleotide T at positions 14 and 15, and 18 of the WSSV STAT-binding sequence

(CCTTGTTACTCATTTATTCCTAGAAA, SEQ ID NO:35).

In an aspect, the WSSV STAT-binding sequence is added at nucleotide 76 of P61 deltaAR. In a preferred aspect, the WSSV STAT-binding sequence increases promoter activity by about 2-fold relative to the same promoter without the sequence after infection.

In an aspect, the added STAT sequence increases promoter expression when in a facilitating host infected with a virus that infects the facilitating host more than the expression is increased when the facilitating host is under physical stress and not infected with a virus. In a preferred aspect, the added STAT sequence is located between 2-6, 3-6, 4-6, or 5-6 times in a promoter. In a preferred aspect, the added STAT sequence is added once, twice, three times, four times, five times, or six times in a promoter. More preferably, the added STAT sequence is added up to six times in a promoter.

In an aspect, the addition of a WSSV STAT-binding sequence is at 76 nucleotide of P61 deltaAR. Preferably, the addition of said STAT sequence is located upstream of the TATA-box. More preferably, the addition of said STAT sequence located upstream of the TATA-box provides higher expression than when located between the TATA box and the transcription initiation site (TIS). In a preferred aspect, the added STAT sequence is a consensus STAT sequence NCANTTNTTCNNNGAAN (SEQ ID NO:36).

In an aspect, addition of the domain in promoters lacking these sequence enhances the promoter activity for the expression of a heterologous gene or virus in at least one of an insect, mammalian, yeast, fungus, or bacterial cell culture system relative to a promoter without the domain.

In an aspect, a promoter or any number of promoters operably linked to a DNA sequence that codes for a (-)sense RNA viral genomic segment or complement thereof is a promoter in an infectious hypodermal and hematopoetic virus (IHHNV) of a shrimp, or has more than about 95%, 90%, 80% or 70% sequence identity to a IHHNV promoter. Percent identity can include freely available, or subscription-based algorithms including BLAST, TBLASTN, GOTOH, CLUSTAL, TBLASTX, MOTIF, or other nucleotide and/or protein sequence alignments based on the Needleman-Wunsch algorithm and/or the Smith- Waterman algorithm. In an aspect, the Needleman-Wunsch algorithm is preferred. In another aspect, a promoter or any number of promoters operably linked to a DNA sequence that codes for a (- )sense RNA viral genomic segment or complement thereof is heterologous to a host cell of the (-)sense RNA virus.

In an aspect, a (-)sense RNA viral genome can be the genetic material of a virus whose genetic information consists of a single strand of RNA that is the sense (or positive) strand which encodes messenger RNA (mRNA) and protein in its host cell. Replication of a functional (-)sense RNA virus in its host cell is via a positive- strand intermediate. Replication of an (-)sense RNA virus in its host cell requires an RNA-dependant RNA Polymerase (RdRP) to transcribe the (-)sense RNA viral genome before translation. A functional (-)sense RNA viral genome can encode a single protein which is modified by host and viral proteins to form the various proteins needed for replication and infection. One of these proteins is RNA- dependent RNA polymerase, which copies the viral RNA to form a double- stranded replicative form, which in turn directs the formation of new virions. In another aspect, a (-)sense RNA viral genome is inserted into a facilitating viral genome as a complimentary DNA copy of a (- )sense RNA viral genome. In an aspect, a (-)sense RNA viral genome is from a natural isolate or from an attenuated modification thereof. In an aspect, a (-)sense RNA viral genome can be the equivalent amount, about 75%, 75%, about 85%, 85% about 90%, 90%, about 95%, 95% about 97%, 97%, about 98%, 98%, or about 99%, 90%-95%, 80%-95%, 99%, 90%-95%, 80%-95% of an entire naturally occurring (-) sense RNA viral genome. In another aspect, a (- )sense RNA viral genome can be sufficient to produce a functional (-)sense RNA virus. In another aspect, a (-) sense RNA viral genome can be the open reading frame only. The identity can be over contiguous or noncontiguous nucleotides. In this aspect, an entire naturally occurring (-)sense RNA viral genome can be identified on GenBank on the NCBI website.

As used herein, the percent identity is preferably determined using the "Best Fit" or "Gap" program of the Sequence Analysis Software Package™ (Genetics Computer Group, Inc., University of Wisconsin Biotechnology Center, Madison, WI). "Gap" utilizes the algorithm of Needleman and Wunsch to find the alignment of two sequences that maximizes the number of matches and minimizes the number of gaps. Percent identity can include freely available, or subscription-based algorithms including BLAST, TBLASTN, GOTOH,

CLUSTAL, TBLASTX, MOTIF, or other nucleotide and/or protein sequence alignments based on the Needleman- Wunsch algorithm and/or the Smith- Waterman algorithm. "BestFit" performs an optimal alignment of the best segment of similarity between two sequences and inserts gaps to maximize the number of matches using the local homology algorithm of Smith and Waterman. The percent identity calculations may also be performed using the Megalign program of the LASERGENE bio informatics computing suite (default parameters, DNASTAR Inc., Madison, Wisconsin). The percent identity is most preferably determined using the "Best Fit" program using default parameters.

In an aspect, a (-)sense RNA virus can consist of a segment, a mono-segmented, bi- segmented, a tri- segmented, or a multi- segmented genome. In this aspect, a viral genome for two or more transcripts of a (-)sense RNA virus can be operably controlled by multiple promoters. As the number of segments increase, the choice of promoter is a more critical aspect so that a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus having two or more transcripts will package correctly for proper infection in its host cell.

A (-)sense RNA virus, coded for by a facilitating host virus, is not capable of infecting the facilitating host or replicating independently of the facilitating virus genome inside a facilitating host cell. A functional mono-, bi-, tri-, or multi- segmented (-)sense RNA virus can infect and replicate within its native host cell. A functional (-)sense RNA virus includes structural and no n- structural viral genes sufficient for infection in a mono-, bi-, tri-, or multi- segmented (-) sense RNA virus host cell. Structural and no n- structural viral genes are defined in the art and are specific to a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus. As used herein, the term "gene" refers to a nucleic acid sequence that can be translated to produce a polypeptide chain, or regulate gene transcription, reproduction or stability. In an aspect, genes include regions preceding and following the coding region, such as leader and trailer, promoters and enhancers, as well as, where applicable, intervening sequences (introns) between individual coding segments (exons).

Structural genes, no n- structural genes, or a combination of structural and non- structural genes can be incorporated in the same facilitating virus operably linked to the same or a different promoter with a same or different promoter sequence than a promoter operably linked to an entire segment of (-)sense mono-, bi-, tri-, or multi- segmented RNA viral genome. A structural viral gene, no n- structural viral gene, or both operably linked to at least one separate promoter may improve production of a mono-, bi-, tri-, or multi- segmented (- )sense RNA virus or replication of its (-)sense RNA viral genome in a facilitating host or its own host. Examples of structural genes in mono-, bi-, tri-, or multi- segmented (-)sense RNA viruses are envelope proteins or proteases. In an aspect, a facilitating viral genome includes a second, third, or greater DNA sequence that codes for a protease gene of the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus.

A (-)sense RNA virus host can be any cell type or organism, cell culture, or larvae having a cell type that a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus can infect. As used herein, infection is characterized by (-)sense RNA viral entry and viral protein expression. In an aspect, a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus host cell is a mammalian cell, a human cell, a hepatoma cell, a vertebrate cell, an animal cell, a pig cell, a monkey cell, a canine cell, a mouse cell, or a eukaryotic cell. In this aspect, a mono-, bi-, tri- , or multi- segmented (-)sense RNA virus host cell can be a cell line including but not limited to Huh-7 cells, Chinese Hamster Ovary (CHO) cells, HeLa cells, Hep2G cells, primary hepatocyte cells of human or other mammalian origin, and others. In another aspect, a (-)sense RNA virus host cell can be a primary culture including but not limited to cells derived from hepatocytes. In another aspect, a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus host is a human cell. In a further aspect, a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus host cell is a human patient in need of gene therapy. In an aspect, there is more than one host cell for a mono-, bi-, tri-, or multi- segmented (-) sense RNA virus, such as a primary and secondary host cell, where a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus kills a culture of primary host cells more quickly than the same number of secondary host cells in the same culture conditions. In this aspect, a secondary host could be vaccinated with a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus native in a primary host cell, such as with cowpox.

A facilitating host can be any organism or cell that is not infected by the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus, which genome is coded for by the facilitating virus genome. In an aspect, a facilitating host can be any cell type or organism, cell culture, or larvae having a cell type where the facilitating virus can replicate and infect another cell and the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus cannot infect the same cell. In an aspect, a facilitating host can also be any whole organism-based production system, such as a crustacean or shrimp, a plant, algae, a cell from the Phyla Arthropoda, an invertebrate cell. In this aspect, a facilitating host is an insect cell, such as a S. frugiperda cell or Sf9 cell or any Lepidopteran insect species. In another aspect, a facilitating host can be a mammalian cell when a mono- segmented, bi-segmented, bi-segmented, tri- segmented, multi- segmented (- ) sense RNA virus does not infect and replicate in a mammalian cell.

In one aspect of the present invention, nucleic acid sequences that code for one or more functional segments of a mono-, bi-, tri-, or multi- segmented (-)sense, single stranded RNA viral genome may undergo replication within said facilitating host cell. In an aspect, replication of the RNA viral genome is the synthesis of a complimentary copy of the viral genome using RNA as a template and an RNA-dependent RNA polymerase. In an aspect, for an (-)sense RNA virus, the RNA template may be the (-) sense RNA genome or may be the positive strand of the (-)sense RNA genome. In some aspects, the replication of the RNA genome may require the synthesis of proteins from the RNA genome itself. In another aspect, the proteins required for the replication of the RNA genome may be provided by the facilitating host cell or by a helper virus. For a (-) strand RNA genome, replication may produce a complementary (+)strand RNA genome synthesized by an RNA-dependent RNA polymerase (RdRP). In this aspect, the resultant (+) strand RNA copy may then serve as a template for the production of one or more complementary (-)strand RNA genome copies. In an aspect, mono-, bi-, tri-, or multi- segmented (-)sense, single stranded RNA viral genomes produced by either transcription or replication may be assembled into a mature virion in a facilitating host or its host.

In an aspect, a facilitating virus is a double- stranded DNA virus. A facilitating virus can include a virus from a family of virus such as Ascoviridae, Ascoviruses, Baculoviridae,

Iridoviridae, Parvoviridae, Polydnaviridae, and Poxviridae. In an aspect, a facilitating virus is a baculovirus. In an aspect, a recombinant baculovirus can contain a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome. The baculovinis genome can be based on a commercial vector system or other known baculovinis vectors such as, but not limited to, Sapphire™

Baculovinis, pBAC5, pBAC-6, BestBac (e.g. v-cath/chit deleted), AcNPV Baculovinis, and pFastBacDual with a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome included. Any virus with a sufficiently large genome or packaging flexibility can be used as a facilitating virus. In an aspect, a facilitating virus is capable of transducing a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome into a host cell of the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus. As used herein, transducing refers to a facilitating virus mediating deliveryof a dsDNA copy of a (-)sense RNA viral genome into a host cell of the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus. A facilitating virus may or may not induce an immune response in the host of the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus. For additional description of an adjuvant having insect cells or proteins, see US Patent No. 6,224,882 (hereby expressly incorporated in its entirety). In an aspect, the present invention includes a DNA molecule comprising a first DNA sequence coding for a baculovinis and a second DNA sequence coding for a functional mono-, bi-, tri-, or multi- segmented (- )sense RNA viral genome that does not infect insect cells, where the second DNA sequence is operably linked to only one promoter.

The term "immune response" means the reaction of the immune system when a foreign substance or microorganism enters the organism. By definition, the immune response is divided into a specific and a non-specific reaction although both are closely related. The nonspecific immune response is the immediate defense against a wide variety of foreign

substances and infectious agents. The specific immune response is the defense raised after a lag phase, when the organism is challenged with a substance for the first time. The specific immune response is highly efficient and is responsible for the fact that an individual who recovers from a specific infection is protected against this specific infection. Thus, a second infection with the same or a very similar infectious agent causes much milder symptoms or no symptoms at all, since there is already a "pre-existing immunity" to this agent. Such immunity and immunological memory persist for a long time, in some cases even lifelong. Accordingly, an attenuated virus of the present invention can be advantageous as a way to induce an immunological memory by vaccination. In an aspect, attenuation of a virus by treatment of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus which would otherwise have the replication and infection properties of a naturally occurring version of the same strain may be the best way to induce immunological memory.

In an aspect, a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus is produced by a facilitating host cell. Following infection of a facilitating host cell with a facilitating virus, such as a baculovirus, a heterologous viral genome, such as a mono-, bi-, tri-, or multi- segmented (-) sense RNA viral genome, is transcribed in parallel with the facilitating viral genome as part of its lifecycle. In an aspect, mature virions of the facilitating virus and those of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus will be produced as translated and processed viral coat proteins combine with RNA transcribed from a complementary DNA copy of an entire mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome embedded in the facilitating viral genome, such as a recombinant baculovirus vector. In this aspect, facilitating virions, (-)sense RNA virions, or facilitating virions and (- )sense RNA virions can be obtained from the facilitating hostcell. Many (-)sense RNA virions can be produced in the facilitating host regardless of how toxic the (-)sense RNA virus would be in its host cell since only the facilitating virus and not the (-)sense RNA virus will be able to infect new facilitating host cells. In an aspect, a recombinant baculovirus is able to produce 10 -50 times, 50-100 times, 100-1000 times, 1000-10⁴ times, 10⁴-10⁵ times, 10⁵-10⁶ times, 10⁶-10⁷ times, and as much as 10¹⁰ times as many (-)sense RNA virions in insect cell culture as in an equivalent mono-, bi-, tri-, or multi- segmented (-)sense RNA virus host cell culture.

In an aspect, the amplification of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus genome can be measured by real-time RT-PCR. For example, Sf9 cells are infected with recombinant baculovirus containing a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus genome at 100 MOI. Total RNA can be isolated at 0, 24, 48, 72, 96 and 120 hours post- infection. SYBR® Green Real-time RT-PCR is performed using primers designed based on the genome sequence of the (-) sense RNA virus and following published protocols. See Dhar, A. K., Bowers, R. A., Licon, K. S., Veaze, G., and Reads, B. 2009. Validation of reference genes for quantitative measurement of immune gene expression in shrimp. Molecular Immunology, 46:

1688-95; Dhar, A. K., Roux, M. and Klimpel, K. R. 2001. Detection and

quantification of infectious hypoderrrfal and hematopoietic necrosis virus (IHHNV) and white spot virus (WSV) of shrimp by real time quantitative PCR using SYBR® Green chemistry. Journal of Clinical Microbiology 39: 2835-2845, hereby incorporated by reference in their entirety. Copy number of a (-)sense RNA virus at different times post-infection (at 24, 48, 72, 96 and 120 hours) can be calculated and normalized to the viral copy number at 0 hr to determine the amplification of the (-)sense RNA virus genome over time. Copy number of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus genome can also be expressed with respect to the total genomic content of a single Sf9 cell since the number of Sf9 cells seeded before infecting with the recombinant baculo virus is known.

In an aspect of the present invention, a baculovirus that infects a facilitating host has a DNA sequence that codes for a functional mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof that does not infect the facilitating host, but is packaged. In a further aspect, a promoter operably linked to the mono-, bi-, tri-, or multi- segmented (- )sense RNA viral genome or complement thereof is not derived from a host cell of the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus. In another aspect, the present invention includes a composition comprising a first virus capable of infecting a facilitating host comprising a first DNA sequence that codes for a functional mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof that is not capable of infecting the facilitating host and a second DNA sequence coding for a baculovirus genome capable of infecting the facilitating host comprising a third DNA sequence that codes for a structural gene of the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus, where the expression of the first DNA sequence is under the control of a single promoter. Optionally in such an aspect, a second DNA sequence further comprises a fourth DNA sequence that codes for a no n- structural gene of the (-)sense RNA virus, where the fourth DNA sequence is under the control of one or more promoters.

In an aspect of the present invention, a functional genomic segment of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus is a nucleic acid sequence that when expressed as a (-) sense RNA is capable of at least being packaged into a (-)sense RNA viral particle. In another aspect of the present invention, a functional genomic segment capable of being packaged into a (-)sense RNA virus particle has an attenuating, inactivating or other mutation that affects the function of the virus particle. In another aspect of the invention, a (- )sense RNA virus particle comprising a functional genomic segment of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus can be a functional (-)sense RNA virus particle. In another aspect of the invention, a (-)sense RNA virus particle comprising a functional genomic segment of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus can be a non- functional (-)sense RNA virus particle.

In an aspect of the present invention, a functional mono-, bi-, tri-, or multi- segmented (-) sense RNA virus can be attenuated or killed for use as a vaccine. In an aspect of the present invention, a vaccine may cause an antibody- mediated immune response, cell- mediated immunity, or both in the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus host. The present invention includes a vaccine containing a baculovirus capable of infecting a facilitating host comprising a DNA sequence that codes for a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus that is not capable of infecting the facilitating host, where the expression of mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome is under the control of a single promoter. In another aspect, a vaccine included in the present invention has a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus, which can be in an attenuated form, that is not capable of infecting a facilitating host and has a viral envelope comprising proteins from the facilitating host. The origin of the envelope proteins can be determined based on comparison of glycosylation patterns and fatty acid profiles of the different host cells. The present invention also includes a vaccine containing a DNA molecule that codes for a baculovirus capable of infecting a facilitating host and codes for a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof that is not capable of infecting the facilitating host, where the expression of (-)sense RNA viral genome is under the control of a single promoter. In an aspect, a DNA vaccine of the present invention has a DNA molecule comprising a first DNA sequence that codes for a facilitating host cell virus comprising structural and no n- structural genes sufficient for infection in a facilitating host cell and a second DNA sequence that codes for a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof that comprises structural and no n- structural genes sufficient for infection of a host cell of a (- )sense RNA virus, but not sufficient for infection of a facilitating host cell, where the expression of the mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof is under the control of a single promoter.

In another aspect of the present invention, a mono-, bi-, tri-, or multi- segmented (- )sense RNA virus can be used directly or after purification from the facilitating host cell, host cell proteins, or both. A (-)sense RNA virus that has an envelope coat can have envelope proteins from the facilitating host cell, rather than the mono-, bi-, tri-, or multi- segmented (-) sense RNA virus host cell or a native host cell. In an aspect, a vaccine containing such a virus would have the envelope coat proteins from a facilitating host cell, such as an insect cell. This could be an advantage due to an increase in stimulating an immune response in a host cell. See US Patent No. 6,224,882, hereby explicitly incorporated in its entirety by reference. In an aspect a vaccine may include one or more

pharmaceutically acceptable and/or approved carriers, additives, antibiotics, preservatives, adjuvants, diluents and/or stabilizers. Such auxiliary substances can be water, saline, glycerol, ethanol, wetting or emulsifying agents, pH buffering substances, or the like.

Suitable carriers are typically large, slowly metabolized molecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates, or the like.

For the preparation of vaccines, an attenuated or killed mono-, bi-, tri-, or multi- segmented (-)sense RNA virus of the present invention is converted into a physiologically acceptable form. This can be done based on experience in the preparation of poxvirus vaccines used for vaccination against smallpox (as described by Stickl, H. et al. [1974] Dtsch. med. Wschr. 99, 2386-2392). For example, the 45 purified virus is stored at -80° C. with a titer of 5xl0⁸ TCID/ml formulated in about 10 mM Tris, 140 mM NaCl, pH 7.4. For

2 8

the preparation of vaccine shots, e.g. , 10 -10 particles of the virus are lyophilized in 100 ml of phosphate- buffered saline (PBS) in the presence of 2% peptone and 1% 50 human albumin in an ampoule, preferably a glass ampoule. Alternatively, the vaccine shots can be produced by stepwise, freeze-drying of the virus in a formulation. This formulation can contain additional additives such as mannitol, dextran, sugar, glycine, lactose,

polyvinylpyrrolidone, or other additives, such as antioxidants or inert gas, stabilizers or recombinant proteins {e.g. human serum albumin) suitable for in vivo administration. The glass ampoule is then sealed and can be stored between 4° C and room temperature for several months. However, as long as no need exists the ampoule is stored preferably at temperatures below -20° C.

For vaccination or therapy, the lyophilisate can be dissolved in 0.1 to 0.5 ml of an aqueous solution, preferably physiological saline or Tris buffer, and administered either systemically or locally, i.e., by parenteral, intramuscular, or any other path of administration know to a skilled practitioner. The mode of administration, dose, and number of

administrations can be optimized by those skilled in the art in a known manner.

In another aspect, the present invention includes a vaccine against a (-)sense RNA virus comprising a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof comprising a signature (non-native) nucleic acid sequence having a length of 5-200, about 100, 50-60, 25-200, 50-100 nucleotides at the 5' end, 3' end, or 5' and 3' ends of the viral genome. The signature nucleic acid sequence is an addition of nucleic acid sequence at the 5' or 3' end of the mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome of the present invention relative to a naturally occurring mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome of the same strain. In a particular aspect, the nucleic acid sequence of the signature is the complement of a portion of a facilitating host promoter DNA sequence. Even more specifically, the d5ngling bit of nucleic acid sequence is a transcription initiation site or the sequence 20-30 nucleotides downstream of the TATA box from a facilitating host promoter DNA sequence or complements thereof.

In another aspect, a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus may have one or more mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome segment missing up to 200, about 200, 100-200 nucleotides at the 5' end and up to 500 nucleotides, about 500, 200-500 nucleotides on the 3' end of at least one said (-)sense RNA viral genomic segment relative to a naturally occurring mono-, bi-, tri-, or multi- segmented (- )sense RNA viral genomic segment of the same strain. The missing untranscribed nucleotides can result in a replication deficient, inactivated, or attenuated mono-, bi-, tri-, or multi- segmented (-)sense RNA virus. In an aspect, the at least one segment missing at least 200 nucleotides on the 5' end encodes RdRP. In another aspect, the missing 5' untranslated region can increase expression of that segment by reducing the distance between the start of the segment and its initiation start codon as well as optionally removing secondary structure from the untranslated region.

In another aspect, a (-)sense RNA virus can have envelope proteins from the (-)sense RNA virus host cell, such as a CHO cell line. Viruses that have envelopes are known in the art, such as influenza and HCV. In an aspect, a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus from a facilitating host cell can infect a mono-, bi-, tri-, or multi- segmented (- ) sense RNA virus host cell and the RNA viral genome will be replicated and packaged into new (-)sense RNA virus. In an aspect, a functional or nonfunctional (-)sense RNA virus is attenuated, inactivated/killed after obtaining it from a (-)sense RNA virus host cell or facilitating host cell. Methods of attenuating a virus are known in the art as are methods of killing, such as by treatment with formalin. In an aspect, a (-)sense RNA virus is attenuated if it has reduced virulence relative to the viral genome of a naturally occurring (-)sense RNA virus of the same strain. For example, the rate of infection or replication or both with an attenuated (-)sense RNA virus is reduced compared to a naturally occurring (-)sense RNA virus of the same strain. The growth behavior or amplification/replication of a virus can be expressed by the ratio of virus produced from an infected cell (Output) to the amount originally used to infect the cell in the first place (Input) ("amplification ratio"). A ratio of "1" between Output and Input defines an amplification status where the amount of virus produced from the infected cells is the same as the amount initially used to infect the cells. Such a ratio is understood to mean that the infected cells are permissive for virus infection and virus reproduction. An amplification ratio of less than I, i.e., a decrease of the amplification below input level, indicates a lack of reproductive replication and thus, attenuation of the virus. In a particular aspect of attenuated viruses, a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof has a codon bias different than the codon bias of its native (-)sense RNA virus host cell.

In another aspect, vaccines produced using the instant invention can be delivered to vertebrates, including human, by subcutaneous injection, or via technologies know in the art for mucosal delivery of vaccines such as, but not limited to, oral or nasal delivery. In an aspect, a vaccine can be used in a vaccination program. "Vaccination" means that a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus host is challenged with (-)sense RNA virus of the present invention, e.g. , an attenuated or inactivated form of a (-)sense RNA virus, to induce a specific immunity. A specific immune response against a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus may be induced. The (-)sense RNA virus host, thus, is immunized, or has immunity, against the (-)sense RNA virus.

"Immunity" means partial or complete protection of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus host against diseases caused by the (-)sense RNA virus due to a successful elimination of a preceding infection with the mono-, bi-, tri-, or multi- segmented (-) sense RNA virus or a characteristic part thereof. Immunity is based on the existence, induction, and activation of specialized cells of the immune system.

In an aspect, small or large scale fermentor operations known in the art can be used to produce 10⁴- 10¹⁰, 10⁵- 10⁹ , 10⁶-10⁹, 10⁶-10¹⁰, 10⁷-10⁹ (-)sense RNA virions. In a further aspect, operations can include growth of a facilitating host cell in a range of temperature such as 20°C to 35°C, 23°C to 30°C, 24°C to 29°C, or 20°C to 30°C. In this aspect, growth of a (- ) sense RNA host cell is not optimal. In another aspect, a temperature- sensitive mutant of a facilitating host cell, such as Sf9 cells, may be used to enhance and/or optimize cell growth. In another aspect, cell harvest virus purification is around 5 days, 5 days, about 3-8 days, 1-7 days, 2-6 days, or 5-7 days. Reusable fermentation devices from roller bottles to stirred tank fermentors can be used. Alternatively, single use fermentation systems such as, but not limited to, the WAVE bioreactor (Invitrogen, Inc.; Carlsbad, CA) or Flex- Factory biomanufacturing platform (Xcellerex Inc. Marlborough, MA) can also be used. Advantages of the later involve portability, such that the viral vaccine can be manufactured at remote locations that may be more amenable to the delivery of vaccines to the patients. Alternatively, the baculovirus can be used to directly infect lepidopteron larvae for the production of the RNA virus in a whole organism. In this latter case, the lepidopteron larvae would be grown in facilities designed for such a purpose of producing baculo virus-based recombinant vaccines (e.g., Chesapeake PERL; 8510A Corridor Road,

Savage, MD 20763). In an aspect of a method included in the present invention further includes a method of amplifying a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome comprising: a) infecting a facilitating host cell with virus comprising a DNA molecule comprising a first DNA sequence coding for a viral genome of the facilitating host cell and a second DNA sequence coding for a negative strand ssRNA viral genome that does not infect the facilitating host cell, where the second DNA sequence is operably linked to only one promoter; b) obtaining the supernatant, cell lysate, or supernatant and cell lysate of the infected facilitating host cell; and c) transducing a host cell of the (-)sense RNA virus with the supernatant, cell lysate, or supernatant and cell lysate. In this aspect when making a baculovirus clone, the infection is at an MOI between 0.1 - 10 for 24 to 72 hours, preferably 72 hours on a monolayer of facilitating host cells. In a separate aspect, theOinfection for commercial production of (- )sense RNA virus is at an MOI of 1- 10,000, 10- 100, 1- 100, 50- 100 for about 72 hours in a suspension culture of 10⁶-10⁹ the facilitating host cells. Another aspect of a method included in the present invention includes transducing a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral host cell with a baculovirus having a (-)sense RNA viral genome under the control of a single promoter. The transduction by baculovirus has better delivery of (-)sense RNA than transfection of (-)sense RNA viral genome or complement thereof without the

baculovirus component. In a preferred aspect, the facilitating host cells are insect cells. In a further aspect of a method of the present invention, the supernatant, cell lysate, or supernatant and cell lysate of the host cell of the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus is obtained and is capable of producing antibodies in mice that cross react with a naturally occurring form of the (-) sense RNA virus. In a further aspect of a method of the present invention, the supernatant, cell lysate, or supernatant and cell lysate of the facilitating host cells can be obtained and is capable of producing antibodies in mice that cross react with a naturally occurring form of the negative strand ssRNA virus. In another aspect of a method of the present invention, the supernatant, cell lysate, or supernatant and cell lysate of the host cell of the (-)sense RNA virus is obtained and any one or more of these is capable of replicating and propagating in a mammalian cell line.

In a different aspect, the present invention includes a method of making a baculo virus vector containing a nucleic acid sequence of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus or the complement thereof by obtaining a nucleic acid sequence of a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus; and cloning that sequence into a baculovirus vector. Another aspect of the present invention includes a method of amplifying a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome by transfecting an insect cell with a DNA molecule comprising a nucleic acid sequence coding for an insect viral genome and a nucleic acid sequence coding for a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof; where the nucleic acid sequence coding for a mono-, bi-, tri-, or multi- segmented (-) sense RNA viral genome or complement thereof is operably linked to a heterologous promoter; obtaining supernatant, cell lysate, or supernatant and cell lysate of progeny of the transfected insect cell; and isolation of the mono-, bi-, tri-, or multi- segmented (-)sense RNA virus.

In a further aspect, a method of the present invention includes producing a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus by expressing in a facilitating host cell a DNA molecule with a nucleic acid sequence coding for a portion of a virus of the facilitating host cell and a nucleic acid sequence coding for a mono-, bi-, tri-, or multi- segmented (-)sense RNA viral genome or complement thereof that does not infect the facilitating host cell, obtaining a mono-, bi-, tri-, or multi- segmented (-)sense RNA virus that does not infect the facilitating host cell. Optionally, each segment has a different promoter.

In a further5aspect, a method of the present invention includes producing a vaccine by expressing in a facilitating host cell a baculovirus comprising a DNA sequence that encodes a mono-, bi-, tri-, or multi- segmented (-)sense viral genome or complement thereof; and amplification of the mono-, bi-, tri-, or multi- segmented (-)sense viral genome or complement thereof inside the facilitating host cell. The mono-, bi-, tri-, or multi- segmented (-)sense viral genome or complement thereof can serve as the vaccine or, in another aspect, the facilitating host cell can package the (-) sense viral genome or complement thereof for production of a (- ) sense RNA virus and that virus can be inactivated or attenuated.

Having now generally described the invention, the same will be more readily understood through reference to the following examples that are provided by way of illustration, and are not intended to be limiting of the present invention, unless specified.

Each periodical, patent, and other document or reference cited herein is

herein incorporated by reference in its entirety.

EXAMPLES Example 1: Expression of a negative sense, single-stranded, linear, non-segmented

RNA virus in insect and mammalian cells.

Example la: Expression of RABV negative sense, single-stranded non-segmented RNA virus

A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector (see Figure 1).

A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes (see Figure 2).

A non-segmented RNA virus genome from RABV is amplified by RT-PCR. The resultant DNA is ligated downstream of a P2 promoter and a T7 terminator in the

pFastBacDual™ vector by In- Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone (Figure 3).

A positive strand P10 promoter from a recombinant pFastBacDual™clone containing a full-length RABV viral genome is excised from the vector by restriction enzyme and replaced with a positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906 (Figure 4).

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to a IHHNV P61 promoter (Figure 5). While a P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, a T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to a T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing a viral genome for RABV and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to- Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re- streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi-preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculo virus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an RABV virus and characterizing a virus RNA and viral encoded proteins using virus- specific antibodies and western blot methods.

Example lb: Expression of IHNV negative stranded non-segmented RNA virus A polH promoter in a pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. A PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector (see Figure 1).

A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes.

A non-segmented RNA virus genome from IHNV is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T7 terminator in the

pFastBacDual™ vector by In- Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone containing a full-length IHNV viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to a IHHNV P61 promoter. While a P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, a T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to a T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing a viral genome for IHNV and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re- streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with a baculo virus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an IHNV virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods. Example lc: Expression of MARV negative stranded non-segmented RNA virus

A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A Shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. A PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector (see Figure 1).

A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes .

A non-segmented RNA virus genome from MARV is amplified by RT-PCR. The resultant DNA is ligated downstream of a P2 promoter and T7 terminator in a

pFastBacDual™ vector by In-Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone containing the full-length MARV viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to the IHHNV P61 promoter. While a P2 promoter transcribes a positive sense viral transcript for g5nerating viral encoded protein, a T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to a T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for MARV and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculovirus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating a MARV virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods.

Example Id: Expression of EBOV negative stranded non-segmented RNA virus

The polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A Shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector (see Figure 1).

A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes .

A non-segmented RNA virus genome from EBOV is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T7 terminator in the

pFastBacDual™ vector by In- Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

The positive strand P10 promoter from a recombinant pFastBacDual™ clone containing the full-length EBOV viral genome is excised from the vector by restriction enzyme and replaced with a positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for EBOV and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculovirus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an EBOV virus and characterizing a virus RNA and viral encoded proteins using virus- specific antibodies and western blot methods.

Example le: Expression ofMuV negative stranded non-segmented RNA virus

A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A Shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector (see Figure 1).

A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of a P2 promoter in the opposite orientation using unique restriction enzymes.

A non-segmented RNA virus genome from MuV is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T7 terminator in the pFastBacDual™ vector by In-Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone containing a full-length MuV viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for MuV and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculovirus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an MuV virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods.

Example If: Expression of NDV negative stranded non-segmented RNA virus

A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A Shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector (see Figure 1).

A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes.

A non-segmented RNA virus genome from NDV is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T7 terminator in the pFastBacDual™ vector by In- Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone containing a full-length NDV viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the

T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion. A plasmid DNA of a recombinant clone containing the viral genome for NDV and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculovirus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an NDV virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods. Example lg: Expression ofHRSV negative stranded non-segmented RNA virus

A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A Shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector (see Figure 1).

A SP6 terminator sequence and SP6 promoter are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes .

A non-segmented RNA virus genome from HRSV is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and SP6 terminator in the

pFastBacDual™ vector by In- Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone. A positive strand P10 promoter from a recombinant pFastBacDual™ clone

containing a full-length HRSV viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, SP6, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the SP6 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the SP6 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for HRSV and the SP6 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to- Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi-preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculo virus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an HRSV virus and characterizing a virus RNA and viral encoded proteins using virus- specific antibodies and western blot methods.

Example lh: Expression of CP sV negative stranded non-segmented RNA virus

A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A Shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector (see Figure 1).

A T3 terminator sequence and T3 promoter are then cloned downstream of the

P2 promoter in the opposite orientation using unique restriction enzymes .

A non-segmented RNA virus genome from CPsV is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T3 terminator in the pFastBacDual™ vector by In-Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone

containing a full-length CPsV viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T3, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the T3 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T3 promoter site and transcribes a5negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for CPsV and the T3 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculo virus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evalulate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an CPsV virus and characterizing a virus RNA and viral encoded proteins using virus- specific antibodies and western blot methods.

Example 2: Expression of negative-sense, single-stranded, bi-segmented

RNA virus in insect and mammalian cells

Example 2a. Expression of the negative sense, single-stranded, linear RNA- containing virus with bi-segmented genome, LCVM

A member of the family Are naviridae, genus Arenavirus species Lymphocytic choriomeningitis virus has a genome consisting of two single- stranded, negative sense, ambisense RNA molecules of about 7.5 and 3.5 kb in size called L and S RNA,

respectively. Both L and S RNAs are not polyadenylated and the 3-terminal sequences in both RNA are similar.

Lymphocytic choriomeningitis virus (LCMV) is expressed in insect cells using shrimp positive strand viral promoters and a baculovirus-based vector (e.g. pFastBacDual™ vector of Invitrogen, Inc.). The polH promoter in the pFastBacDual™ vector is replaced with a shrimp virus promoter, IHHNV P2 promoter. A T7 terminator sequence and T7 promoter are cloned downstream of the P2. Subsequently, the L RNA segment of Lymphocytic choriomeningitis virus is amplified by RT-PCR and the resulting cDNA is ligated downstream of the P2 promoter in the vector by InFusion™ PCR (Clonetech Corp.) generating clone (pLCMV-L) (Figure 6).

A plO promoter is excised from a recombinant clone containing the LCMV L segment by restriction digestion and replaced with a positive strand promoter, the IHHNV P61 promoter, as described in the provisional application 61/392,906 (Figure 6). The bacterial T7 polymerase

gene is amplified and cloned downstream of IHHNV P61 promoter making pT7pol

LCMV-L (Figure 7). While the P2 promoter transcribes a positive sense LCMV viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T7 promoter site and transcribes a negative sense viral RNA genome for producing mature LCMV virion.

An LCMV RNA S is amplified by RT-PCR and cloned under the control of a shrimp positive strand viral promoter, HPV P2, in a pGL3 -Basic vector that contains a T7 terminator sequence at the 5 '-end and a T7 promoter sequence at the 3 '-end of the LCMV S gene (Figure 8).

A nucleic acid sequence containing the HPV P2 promoter, T7 terminator, LCMV-S RNA and T7 promoter is amplified by PCR and ligated downstream of the T7 promoter sequence in pT7pol LCMV-L generating a pT7pol LCMV-L-S clone (Figure 9).

A plasmid DNA of a recombinant clone containing a LCMV viral genome and an RNA polymerase that initiates transcription at a negative strand promoter, a T7 polymerase gene, is taken to generate recombinant baculo virus using a Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and prepare rnidi- preparations to isolate baculo virus Bacmid DNA. Sf9 cells are then transfected with the baculovirus Bacmid DNA using CellFectin reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an

LCMV virus and characterizing a virus RNA and viral encoded proteins using virus- specific antibodies and western blot methods.

Example 2b. Expression of the negative sense, single-stranded, linear KNA- containing virus with bi-segmented genome, Lassa virus

A member of the family Are naviridae, genus Arenavirus species Lassa virus has a genome consisting of two single- stranded, negative sense, ambisense RNA molecules of about 7.5 and 3.5 kb in size called L and S RNA, respectively. Both L and S RNAs are not polyadenylated and the 3-terminal sequences in both RNA are similar.

Lassa virus is expressed in insect cells using shrimp positive strand viral promoters and a baculo virus-based vector (e.g. pFastBacDual™ vector of Invitrogen, Inc.). The polH promoter in the pFastBacDual™ vector is replaced with a shrimp virus promoter, IHHNV P2 promoter. A T3 terminator sequence and T3 promoter are cloned downstream of the P2. Subsequently, the L RNA segment of Lassa virus is amplified by RT-PCR and the resulting cDNA is ligated downstream of the P2 promoter in the vector by InFusion™ PCR (Clonetech Corp.) generating clone (p Lassa virus -L).

A plO promoter is excised from a recombinant clone containing the Lassa virus L segment by restriction digestion and replaced with a positive strand promoter, the IHHNV P61 promoter, as described in the provisional application 61/392,906. The bacterial T3 polymerase gene is amplified and cloned downstream of IHHNV P61 promoter making pT3pol Lassa virus - L. While the P2 promoter transcribes a positive sense Lassa virus viral transcript for generating viral encoded protein, the T3 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T3 promoter site and transcribes a negative sense viral RNA genome for producing mature Lassa virus virion.

The Lassa virus RNA S is amplified by RT-PCR and cloned under the control of a shrimp positive strand viral promoter, HPV P2, in a pGL3-Basic vector that contains a T3 terminator sequence at the 5 '-end and a T3 promoter sequence at the 3 '-end of the Lassa virus S gene.

The nucleic acid sequence containing the HPV P2 promoter, T3 terminator, Lassa virus - S RNA and T3 promoter is amplified by PCR and ligated downstream of the T3 promoter sequence in pT3pol Lassa virus -L generating a pT3pol Lassa virus -L-S clone.

A plasmid DNA of a recombinant clone containing a Lassa virus viral genome and an

RNA polymerase that initiates transcription at a negative strand promoter, a T3 polymerase gene, is taken to generate recombinant baculovirus using a Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and prepare rnidi- preparations to isolate baculovirus Bacmid DNA. Sf9 cells are then transfected with the baculovirus Bacmid DNA using CellFectin reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating a Lassa virus and characterizing a virus RNA and viral encoded proteins using virus- specific antibodies and western blot methods.

Example 2c. Expression of negative sense, single-stranded, linear RNA- containing virus with bi-segmented genome, Flexal virus

A member of the family Are naviridae, genus Arenavirus species Flexal virus has a genome consisting of two single- stranded, negative sense, ambisense RNA molecules of about 7.5 and 3.5 kb in size called L and S RNA, respectively. Both L and S RNAs are not polyadenylated and the 3-terminal sequences in both RNA are similar.

Flexal virus is expressed in insect cells using shrimp positive strand viral promoters and a baculo virus-based vector (e.g. pFastBacDual™ vector of Invitrogen, Inc.). The polH promoter in the pFastBacDual™ vector is replaced with a shrimp virus promoter, IHHNV P2 promoter. A SP6 terminator sequence and SP6 promoter are cloned downstream of the P2. Subsequently, the L RNA segment of Flexal virus is amplified by RT-PCR and the resulting cDNA is ligated downstream of the P2 promoter in the vector by InFusion™ PCR (Clonetech Corp.) generating clone (pFlexal -L).

The plO promoter is excised from a recombinant clone containing the Flexal virus L segment by restriction digestion and replaced with a positive strand promoter, the IHHNV P61 promoter, as described in the provisional application 61/392,906 (Figure 6). The bacterial SP6 polymerase gene is amplified and cloned downstream of IHHNV P61 promoter making pSP6pol Flexal virus -L. While the P2 promoter transcribes a positive sense Flexal virus viral transcript for generating viral encoded protein, the SP6 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the SP6 promoter site and transcribes a negative sense viral RNA genome for producing mature Flexal virus virion.

The Flexal virus RNA S is amplified by RT-PCR and cloned under the control of a shrimp positive strand viral promoter, HPV P2, in a pGL3-Basic vector that contains a SP6 terminator sequence at the 5 '-end and a SP6 promoter sequence at the 3 '-end of the Lassa virus S gene.

The nucleic acid sequence containing the HPV P2 promoter, SP6 terminator, Flexal virus -S RNA and SP6 promoter is amplified by PCR and ligated downstream of the SP6 promoter sequence in pSP6pol Flexal virus -L generating a pSP6pol Flexal virus -L-S clone.

A plasmid DNA of a recombinant clone containing a Flexal virus viral genome and an RNA polymerase that initiates transcription at a negative strand promoter, a SP6 polymerase gene, is taken to generate recombinant baculovirus using a Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and prepare rnidi- preparations to isolate baculovirus Bacmid DNA. Sf9 cells are then transfected with the baculovirus Bacmid DNA using CellFectin reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating a Flexal virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods.

Example 2d. Expression of the negative sense, single-stranded, linear KNA- containing virus with bi-segmented genome, Pritial virus

A member of the family Are naviridae, genus Arenavirus species Pritial virus has a genome consisting of two single- stranded, negative sense, ambisense RNA molecules of about 7.5 and 3.5 kb in size called L and S RNA, respectively. Both L and S RNAs are not polyadenylated and the 3-terminal sequences in both RNA are similar.

Pritial virus is expressed in insect cells using shrimp positive strand viral promoters and a baculovirus-based vector (e.g. pFastBacDual™ vector of Invitrogen, Inc.). The polH promoter in the pFastBacDual™ vector is replaced with a shrimp virus promoter, IHHNV P2 promoter. A T7 terminator sequence and T7 promoter are cloned downstream of the P2. Subsequently, the L RNA segment of Pritial virus is amplified by RT-PCR and the resulting cDNA is ligated downstream of the P2 promoter in the vector by InFusion™ PCR (Clonetech Corp.) generating clone (pPritial 1 -L).

The plO promoter is excised from a recombinant clone containing the Pritial virus L segment by restriction digestion and replaced with a positive strand promoter, the IHHNV P61 promoter, as described in the provisional application 61/392,906 (Figure 6). The bacterial T7 polymerase gene is amplified and cloned downstream of IHHNV P61 promoter making pT7pol Pritial virus -L. While the P2 promoter transcribes a positive sense Pritial virus viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and tra¾slation of cognate mRNA, binds to the T7 promoter site and transcribes a negative sense viral RNA genome for producing mature Pritial virus virion.

The Pritial virus RNA S is amplified by RT-PCR and cloned under the control of a shrimp positive strand viral promoter, HPV P2, in a pGL3-Basic vector that contains a T7 terminator sequence at the 5 '-end and a T7 promoter sequence at the 3 '-end of the Pritial virus S gene.

The nucleic acid sequence containing the HPV P2 promoter, T7 terminator, Pritial virus - S RNA and T7 promoter is amplified by PCR and ligated downstream of the T7 promoter sequence in pT7pol Pritial virus -L generating a pT7pol Pritial virus -L-S clone.

A plasmid DNA of a recombinant clone containing a Pritial virus viral genome and an RNA polymerase that initiates transcription at a negative strand promoter, a T7 polymerase gene, is taken to generate recombinant baculovirus using a Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and prepare rnidi- preparations to isolate baculovirus Bacmid DNA. Sf9 cells are then transfected with the baculo virus Bacmid DNA using CellFectin reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating a Pritial virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods.

Example 2e. Expression of negative sense, single-stranded, linear RNA- containing virus with bi-segmented genome, Tamiami virus

A member of the family Are naviridae, genus Arenavirus species Tamiami virus has a genome consisting of two single- stranded, negative sense, ambisense RNA molecules of about 7.5 and 3.5 kb in size called L and S RNA, respectively. Both L and S RNAs are not polyadenylated and the 3-terminal sequences in both RNA are similar.

Tamiami virus is expressed in insect cells using shrimp positive strand viral promoters and a baculovirus-based vector (e.g. pFastBacDual™ vector of Invitrogen, Inc.). The polH promoter in the pFastBacDual™ vector is replaced with a shrimp virus promoter, IHHNV P2 promoter. A T7 terminator sequence and T7 promoter are cloned downstream of the P2.

Subsequently, the L RNA segment of Tamiami virus is amplified by RT-PCR and the resulting cDNA is ligated downstream of the P2 promoter in the vector by InFusion™ PCR (Clonetech Corp.) generating clone (pTamiami-L).

The plO promoter is excised from a recombinant clone containing the Tamiami virus L segment by restriction digestion and replaced with a plus strand promoter, the IHHNV P61 promoter, as described in the provisional application 61/392,906 (Figure 6). The bacterial T7 polymerase gene is amplified and cloned downstream of IHHNV P61 promoter making pT7pol Tamiami virus -L. While the P2 promoter transcribes a positive sense Tamiami virus viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T7 promoter site and transcribes a negative sense viral RNA genome for producing mature Tamiami virus virion. The Tamiami virus RNA S is amplified by RT-PCR and cloned under the control of a shrimp positive strand viral promoter, HPV P2, in a pGL3-Basic vector that contains a T7 terminator sequence at the 5 '-end and a T7 promoter sequence at the 3 '-end of the Tamiami virus S gene.

The nucleic acid sequence containing the HPV P2 promoter, T7 terminator, Tamiami virus -S RNA and T7 promoter is amplified by PCR and ligated downstream of the T7 promoter sequence in pT7pol Tamiami virus -L generating a pT7pol Tamiami virus -L-S clone.

A plasmid DNA of a recombinant clone containing a Tamiami virus viral genome and an RNA polymerase that initiates transcription at a negative strand promoter, a T7 polymerase gene, is taken to generate recombinant baculovirus using a Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium.

Subsequently, recombinant colonies are taken to seed broth cultures and prepare rnidi- preparations to isolate baculovirus Bacmid DNA. Sf9 cells are then transfected with the baculovirus Bacmid DNA using CellFectin reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating a

Tamiami virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods.

Example 3: Expression of the negative-sense, single-stranded, tri-segmented RNA virus, LACV, in insect and mammalian cells

To express the single- stranded negative- sense RNA virus containing tri-segmented genome, California encephalitis virus strain La Crosse virus (LACV), in insect cells using a baculovirus expression vector, pFastBacDual™ (Invitrogen) containing shrimp viral promoters, A polH promoter in the pFastBacDual™ vector is excised from the vector and replaced with a positive strand shrimp viral promoter, IHHNV P2, and subsequently the T7 terminator sequence and T7 promoter are cloned downstream of the IHHNV P2 promoter. LACV RNA segment M (medium) that codes for the envelope glycoproteins and nonstructural protein is amplified by RT-PCR and the resulting DNA is ligated downstream to the T7 terminator sequence in the pFastBacDual™ vector by In Fusion PCR (Clonetech Corp.) generating a clone (pLACV-M) (Figure 10).

Finally, the bacterial T7 polymerase gene is amplified and cloned downstream of a positive strand promoter, HPV P2 promoter, to generate a clone pLACV-M-T7pol (Figure 11).

To clone LACV RNA segment S, the firefly lucif erase coding sequence is removed by restriction digestion from the pGL3-Basic plasmid containing the WSSV iel promoter.

LACV RNA segment S is then amplified by RT-PCR, and cloned downstream of the WSSV iel promoter in the pGL3-Basic plasmid by In-Fusion™ PCR (Clontech), generating clone pGL3B- LACV-S (Figure 12).

Finally, the region of pGL3-Basic that includes the WSSV iel promoter, T7 terminator LACV S RNA and the T7 promoter region are amplified, and the amplified cDNA is inserted into the clone pLACV-M downstream of the SV40 late polyadenylation signal by In-Fusion™ PCR creating a clone pLACV-M-T7pol-S (Figure 13).

To clone LACV RNA segment L, the firefly luciferase coding sequence is removed by restriction digestion from the pGL3-Basic plasmid containing the positive strand promoter, IHHNV PI 1 promoter. LACV RNA segment L is then amplified by RT-PCR, and cloned downstream of the IHHNV PI 1 promoter in the pGL3-Basic plasmid by In-Fusion™ PCR (Clontech), generating clone pGL3B-LACV-L (Figure 14).

Finally, the region of pGL3-Basic that includes the IHHNV PI 1 promoter, T7 terminator, LACV L RNA, and the T7 promoter are amplified, and the amplified cDNA is inserted into clone pLACV-M-S downstream of the SV40 late polyadenylation signal by InFusion PCR creating a clone pLACV-M-T7pol-S-L (Figure 15).

Example 3: Expression of the negative sense, single-stranded, linear, multi- segmented RNA influenza virus with eight genomic RNA segments in insect and mammalian cells.

Table 1 summarizes the relative abundance of eight different transcripts in fowl plague virus. These eight viral genomic segments are cloned downstream of promoters with a relative strength that matches with relative abundance of each viral genomic transcript. RNA segments

1, 2 and 3 that encode PI, P2 and P3 polymerases are least abundant and are cloned downstream of three weak promoters, HPV P48, WSSV pkl, and WSSV DNA pol. The RNA segments 4, 6, 7 and 8, that are expressed at moderate levels, are cloned downstream of moderately expressing promoters, HPV P2, WSSV rrl, fflHNV P61 and WSSV r2. The transcript level of segment 5 in infected cells remains highest among the eight different transcripts of an influenza virus. Therefore, this segment is cloned downstream of a strong promoter for insect cell and mammalian cell expression, IHHNV P2.

Table 1. The relative abundance of different genomic segments of an influenza virus, fowl plague virus in chick embryonic fibroblast cells and promoters used for expression of the

corresponding RNA segment in insect and mammalian cells.

* Hay, A. J. and Skehel, J. J. 1979. Influenza virus transcription. British Medical Bulletin 35:47-50.

At 72-120 hours post-transfection, cell supernatants containing baculo virus particles are collected for subsequent amplification. In addition, at 72- and 120-hours post-transfection, cell supernatant as well as intact cells are collected for Northern and western blot analyses using anti- influenza virus antibody to evaluate the expression of the eight viral transcripts of the influenza virus, and viral encoded proteins, respectively. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of the influenza virus in Sf9 cells following standard methods. The recombinant virus is also purified by density gradient centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified influenza virus. Northern blot hybridization and western blot analysis are performed to determine the presence of viral RNA in the mature virions and to determining the antigenicity of the virus.

Influenza virus RNA segment #5 that codes for nucleoprotein and represents the most relatively abundant transcript of influenza virus is amplified by PCR and is placed under the control of a shrimp positive strand viral promoter, IHHNV P2, in pFastBacDual™ vector pSeg5 (Figure 16).

Influenza virus RNA segment #5 under control of shrimp viral promoter IHHNV P2 and T7 RNA polymerase gene under the control of shrimp viral promoter IHHNV Pl l are prepared using standard methods in pFastBacDual™ vector to generate pT7pol Seg 5 (Figure 17).

RNA segment #1 of influenza virus is placed under the control of the positive strand shrimp viral promoter, HPV P48, in pGL3-Basic vector to generate pGL3B-Seg 1 (Figure 18).

RNA segment #2 of influenza virus is placed under the control of the positive strand shrimp viral promoter, WSSV pkl, in pGL3-Basic vector to generate pGL3B- Seg 2 (Figure 19).

RNA segment #3 of influenza virus is placed under the control of the positive strand shrimp viral promoter, WSSV DNA pol, in pGL3-Basic vector to generate

pGL3B- Seg 3 (Figure 20).

RNA segment #4 of influenza virus is placed under the control of the positive strand shrimp viral promoter, HPV P2, in pGL3-Basic vector to generate pGL3B- Seg 4 (Figure 21).

RNA segment #6 of influenza virus is placed under the control of the positive strand shrimp viral promoter, WSSV rrl, in pGL3-Basic vector to generate pGL3B-S Seg 6 (Figure 22). RNA segment #7 of influenza virus is placed under the control of the positive strand shrimp viral promoter, IHHNV P61, in pGL3-Basic vector to generate pGL3B- Seg 7 (Figure 23).

RNA segment #8 of influenza virus is placed under the control of the positive strand shrimp viral promoter, WSSV rr2, in pGL3-Basic vector to generate pGL3B- Seg 8 (Figure 24).

Influenza virus RNA segment #5 from pT7pol Seg 5 and Influenza virus RNA segment 7 from pGL3B-Seq 7 are joined under the control of the positive strand shrimp viral promoters, IHHNV P2 and P61, respectively in pFastBacDual™ vector to generate pT7pool Seg 5-7 (Figure 25).

Influenza virus RNA segment #3 from pGL3B- Seg 3 is cloned into a pT7pool Seg 5-7 pFastBacDual™ vector under the control of a shrimp viral promoter to generate pT7pol Seg 5- 7-3 (Figure 26).

Influenza virus RNA segment # 4 from pGL3B- Seg 4 is cloned into a pT7pol Seg 5- 7-3 pFastBacDual™ vector under the control of a shrimp viral promoter to generate pT7pol Seg 5-7-3-4 (Figure 27).

Influenza virus RNA segment #6 from pGL3B- Seg 6 is cloned into a pT7pol Seg 5-7- 3-4 pFastBacDual™ vector under the control of a shrimp viral promoter to generate pT7pol Seg 5-7-3-4-6 (Figure 28).

Influenza virus RNA segment #8 from pGL3B- Seg 8 is cloned into a pT7pol Seg 5-7-

3-4-6 pFastBacDual™ vector under the control of a shrimp viral promoter to generate pT7pol Seg 5-7-3-4-6-8 (Figure 29).

Influenza virus RNA segment #1 from pGL3B- Seg 1 is cloned into a pT7pol Seg 5-7- 3-4-6-8 pFastBacDual™ vector under the control of a shrimp viral promoter to generate pT7pol Seg 5-7-3-4-6-8-1 (Figure 30).

Influenza virus RNA segments #2 from pGL3B- Seg 2 is cloned into a pT7pol Seg 5-7- 3-4-6-8 pFastBacDual™ vector under the control of a shrimp viral promoter to generate pT7polSeg 5-7-3-4-6-8-1-2 (Figure 31).

The remaining segments, segments #4 to segment #8, are cloned by In- Fusion™ PCR in pGL3-Basic vector containing promoter #4 to promoter #8 sequentially (Figures 21-24). Upon cloning of each of the segments #4, #6, #8, #1, and #2, respectively, a region

containing its positive strand promoter, a negative strand terminator (T7 terminator) the corresponding RNA segment and a polyadenylation sequence is amplified and inserted downstream of the polyadenylation site of the preceding segment in the clone pSeg-5-7-3-N (where N= segments #4, #6, #8, #1, and #¾5The clones generated sequentially in this manner include: pT7pol Seg 5-7-3-4 (Figure 27), pT7pol Seg 5-7-3-4-6 (Figure 28), pT7pol Seg 5-7-3-4-6-8 (Figure 29), pT7pol Seg 5-7-3-4-6-8-1 (Figure 30), and finally pSeg-5-7-3- 4-6-8-1-2 (Figure 31).

Plasmid DNA of pSeg-5-7-3-4-6-8-1-2 clone is used to generate recombinant baculovirus using a Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, a recombinant colony is used to seed broth cultures and prepare midi-preparations to isolate baculovirus Bacmid DNA. Sf9 cells are then transfected with the baculovirus Bacmid DNA using CellFectin® reagent (Invitrogen, Carlsbad, CA).

Example 4: Expression of a double-stranded, non-segmented RNA virus in insect and mammalian cells.

Example 4a: Expression of Cry phone ctria hypovirus 1 double-stranded (dsRNA) non- segmented RNA virus

For a dsRNA virus, the RNA virus genome is expressed from two promoters oriented to drive transcription of the positive and negative sense strands. A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector. A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes.

The non- segmented, double- stranded RNA virus genome from Cryphonectria hypovirus 1 is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T7 terminator in the pFastBacDual™ vector by In-Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone containing a full-length Cryphonectria hypovirus 1 viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T7 promoter site and transcribes anegative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for Cryphonectria hypovirus 1 and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to-Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re- streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi-preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculo virus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an Cryphonectria hypovirus 1 virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods.

Example 4b: Expression of Totivirus double-stranded non-segmented RNA virus For a dsRNA virus, the RNA virus genome is expressed from two promoters oriented to drive transcription of the positive and negative sense strands. A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector. A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes.

The no n- segmented, double- stranded RNA virus genome from Totivirus is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T7 terminator in the pFastBacDual™ vector by In-Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone containing a full-length Totivirus viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for Totivirus and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to- Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculovirus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient

centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an Totivirus virus and characterizing a virus RNA and viral encoded proteins using virus-specific antibodies and western blot methods.

Example 4c: Expression of Giardiavirus, a double-stranded non-segmented RNA virus

Leishmaniavirus

For a dsRNA virus, the RNA virus genome is expressed from two promoters oriented to drive transcription of the positive and negative sense strands. A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector. A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes.

The no n- segmented, double- stranded RNA virus genome from Giardiavirus is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T7 terminator in the pFastBacDual™ vector by In-Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone containing a full-length Giardiavirus viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for Giardiavirus and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to- Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculo virus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an Giardiavirus virus and characterizing a virus RNA and viral encoded proteins using virus- specific antibodies and western blot methods.

Example 4d: Expression of Leishmaniavirus, a double-stranded non-segmented RNA virus

For a dsRNA virus, the RNA virus genome is expressed from two promoters oriented to drive transcription of the positive and negative sense strands. A polH promoter in the pFastBacDual™ vector is excised from the vector by restriction enzyme digestion. A shrimp viral positive strand promoter, P2 of IHHNV (SEQ ID NO: 4) as described in the patent application 61/392,906, is amplified from a plasmid DNA clone containing P2 (SEQ ID NO: 4) sequence using PCR primers with homologous restriction sites. The PCR amplified amplicon is then digested with the corresponding restriction enzymes and ligated into pFastBacDual™ vector. A T7 terminator sequence (SEQ ID NO:37) and T7 promoter (SEQ ID NO:38) are then cloned downstream of the P2 promoter in the opposite orientation using unique restriction enzymes. The non-segmented, double- stranded RNA virus genome from Leishmaniavirus is amplified by RT-PCR. The resultant DNA is ligated downstream of the P2 promoter and T7 terminator in the pFastBacDual™ vector by In-Fusion™ PCR (Clonetech Corp.) generating a full-length viral clone.

A positive strand P10 promoter from a recombinant pFastBacDual™ clone containing a full-length Leishmania virus viral genome is excised from the vector by restriction enzyme and replaced with the positive strand IHHNV P61 promoter (SEQ ID NO: 6), as described in provisional application 61/392,906.

In a final step, a bacterial phage reverse strand polymerase gene, T7, is amplified and operably linked to the IHHNV P61 promoter. While the P2 promoter transcribes a positive sense viral transcript for generating viral encoded protein, the T7 polymerase protein, generated upon transcription by P61 promoter and translation of cognate mRNA, binds to the T7 promoter site and transcribes a negative sense viral RNA genome segment for producing a mature virion.

A plasmid DNA of a recombinant clone containing the viral genome for

Leishmaniavirus and a T7 polymerase gene is then taken to generate recombinant baculo virus using the Bac-to- Bac® system (Invitrogen, Inc.). Recombinant colonies are picked and verified by re-streaking on selective medium. Subsequently, recombinant colonies are taken to seed broth cultures and midi- preparations prepared to isolate baculo virus Bacmid DNA. Sf9 cells are transfected with the baculovirus Bacmid DNA using CellFectin™ reagent (Invitrogen, Carlsbad, CA).

At 72-120 hours post-transfection, cell supernatants containing virus particles are collected for subsequent amplification. In addition, at 72- and 120- hours post-transfection, cell supernatant as well as intact cells are collected. Northern and western blot analyses are performed to evaluate the expression of the viral RNA transcripts as well as the viral encoded proteins using virus- specific antibodies. Transmission electron microscopy (TEM) of the Sf9 cells demonstrates the expression of recombinant virus following standard methods. The negative stranded non-segmented RNA virus is also purified by density gradient centrifugation from Sf9 cells expressing the virus, and TEM performed to determine the morphology and size of the purified virus.

Virions generated in insect cells is taken to infect mammalian cells, generating an Leishmaniavirus virus and characterizing a virus RNA and viral encoded proteins using virus- specific antibodies and western blot methods.

Example 5: Expression of double-stranded, bi-segmented RNA virus in insect and mammalian cells

Example 5a. Expression of double-stranded, RNA-containing virus with bi-segmented genome, White clover cryptic virus 1

For the dsRNA virus, White clover cryptic virus 1, each segment of the bi-segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment.

Example 5b. Expression of double-stranded, RNA-containing virus with bi- segmented genome, White clover cryptic virus 2

For the dsRNA virus, White clover cryptic virus 2, each segment of the bi-segmented

RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment.

Example 5c. Expression of double-stranded, RNA-containing virus with bi- segmented genome, Atkinsonella hypoxylon virus (AhV)

For the dsRNA virus, AhV, each segment of the bi-segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment.

Example 5d. Expression of double-stranded, RNA-containing virus with bi-segmented genome, Infectious pancreatic necrosis virus (IPNV) For the dsRNA virus, IPNV, each segment of the bi-segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment.

Example 5e. Expression of double-stranded, RNA-containing virus with bi- segmented genome, infectious bursal disease virus (IBDV)

For the dsRNA virus, IBDV, each segment of the bi-segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. Example 6: Expression of the double-stranded tri-segmented RNA Cystovirus virus in insect and mammalian cells.

For a dsRNA Cystovirus virus, each segment of the bi-segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment.

Example 7: Expression of a double-stranded, multi-segmented RNA virus in insect and mammalian cells.

Example 7a. Expression of the double-stranded, RNA-containing virus with multi- segmented genome, Bluetongue virus

For a Bluetongue virus dsRNA virus, each segment of the multi- segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. A nucleic acid sequence coding for an RNA polymerase that initiates transcription at a negative strand promoter added in a vector with each segments of a

Bluetongue virus dsRNA viral genome flanked by a positive strand promoter and a negative stand promoter produces a double- stranded genome of a Bluetongue virus.

Example 7b. Expression of the double-stranded, RNA-containing virus with multi- segmented genome, Rotavirus A

For a Rotavirus A dsRNA virus, each segment of the multi- segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. A nucleic acid sequence coding for an RNA polymerase that initiates transcription at a negative strand promoter added in a vector with each segments of a Rotavirus A dsRNA viral genome flanked by a positive strand promoter and a negative stand promoter produces a double- stranded genome of a Rotavirus A.

Example 7c. Expression of the double-stranded, RNA- containing virus with

multi- segmented genome, Rotavirus B

For a Rotavirus B dsRNA virus, each segment of the multi- segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. A nucleic acid sequence coding for an RNA polymerase that initiates transcription at a negative strand promoter added in a vector with each segments of a Rotavirus B dsRNA viral genome flanked by a positive strand promoter and a negative stand promoter produces a double- stranded genome of a Rotavirus B.

Example 7d Expression of the double-stranded, RNA- containing virus with

multi- segmented genome, Colorado tick fever virus

For a Colorado tick fever virus dsRNA virus, each segment of the multi- segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. A nucleic acid sequence coding for an RNA polymerase that initiates transcription at a negative strand promoter added in a vector with each segments of a Colorado tick fever virus dsRNA viral genome flanked by a positive strand promoter and a negative stand promoter produces a double- stranded genome of a Colorado tick fever virus. Example 7e. Expression of the double -stranded, RNA- containing virus with

multi- segmented genome, Grass carp reo virus

For a Grass carp reo virus dsRNA virus, each segment of the multi- segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. A nucleic acid sequence coding for an RNA polymerase that initiates transcription at a negative strand promoter added in a vector with each segments of a Grass carp reo virus dsRNA viral genome flanked by a positive strand promoter and a negative strand promoter produces a double- stranded genome of a Grass carp reo virus.

Example 7f. Expression of the double-stranded, RNA- containing virus with

multi- segmented genome, Avian orthoreovirus

For a Avian orthoreovirus dsRNA virus, each segment of the multi- segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. A nucleic acid sequence coding for an RNA polymerase that initiates transcription at a negative strand promoter added in a vector with each segments of a Avian orthoreovirus dsRNA viral genome flanked by a positive strand promoter and a negative strand promoter produces a double- stranded genome of a Avian orthoreovirus.

Example 7g. Expression of the double-stranded, RNA- containing virus with

multi- segmented genome, Aquareovirus

For a Aquareovirus dsRNA virus, each segment of the multi- segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. A nucleic acid sequence coding for an RNA polymerase that initiates transcription at a negative strand promoter added in a vector with each segments of a

Aquareovirus dsRNA viral genome flanked by a positive strand promoter and a negative strand promoter produces a double- stranded genome of a Aquareovirus.

Example 7h. Expression of the double-stranded, RNA- containing virus with

multi- segmented genome, Fijivirus

For a Fijivirus dsRNA virus, each segment of the multi- segmented RNA virus genome is expressed from a flanking positive strand promoter and a negative strand promoter. A positive strand promoter from a shrimp virus is used for expression of the positive strand of each segment and a negative strand promoter from a bacterial virus for expression of negative strand of each segment. A nucleic acid sequence coding for an RNA polymerase that initiates transcription at a negative strand promoter added in a vector with each segments of a Fijivirus dsRNA viral genome flanked by a positive strand promoter and a negative stand promoter produces a double- stranded genome of a Fijivirus.

All cited publications and references are hereby incorporated by reference in their entirety.

Claims

What is claimed is:

1. A facilitating virus capable of infecting a facilitating host comprising a positive strand promoter and a negative stand promoter flanking each nucleic acid sequence that codes for a functional genomic segment of a mono-segmented, bi-segmented, tri- segmented, or multi- segmented negative- sense single- stranded RNA ("(-)sense RNA") virus that is not capable of infecting said facilitating host, wherein said negative strand promoter has a corresponding terminator between said positive strand promoter and said viral segment.

2. The baculo virus according to claim 1, wherein said baculo virus further comprises a

nucleic acid sequence coding for an RNA polymerase that initiates transcription at said negative strand promoter.

3. The baculovirus according to claim 1, wherein said multi- segmented virus comprises 3, 4, 5, 6, 7, or 8 segments.

4. The baculovirus according to claim 1, wherein transcription of at least one of said each nucleic acid sequence is under the control of a promoter heterologous to said facilitating host and heterologous to said RNA viral genome.

5. The baculovirus according to claim 4, wherein at least two of said heterologous

promoters express at least two transcripts with a different relative abundance after infection and a transcript encoding structural proteins has a higher abundance than a transcript expressing only nonstructural proteins.

6. The baculovirus according to claim 4, wherein at least two of said heterologous

promoters express at least two transcripts with a difference of more than 5%, 10%, 20%, 30%, or 40% in relative abundance of each transcript after infection of said facilitating host.

7. The baculovirus according to claim 4, wherein at least two of said heterologous

promoters express at least two transcripts with a difference of more than 5%, 10%, 20%, 30%, or 40% in relative abundance of each transcript after transduction of said mono- segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA in a host.

8. The baculovinis according to claim 4, wherein at least two of said heterologous promoters express two, three, four, five, six, seven, or eight transcripts with a difference of more than 5%, 10%, or 20% in relative abundance between each of said transcripts after infection in said facilitating host.

9. The baculovinis according to claim 4, wherein at least two of said heterologous promoters express at least two transcripts with a difference of more than 2-fold, 3-fold, 4-fold, 5-fold in relative abundance of each transcript after infection in said facilitating host cell or said host cell.

10. The baculovinis according to claim 4, wherein at least two of said heterologous promoters express at least two transcripts with a difference of more than 2-fold, 3-fold, 4-fold, 5-fold in relative abundance of each transcript after transduction in a host cell for said (-) sense RNA virus.

11. The baculovinis according to claim 7, wherein at least one of said heterologous

promoters is a shrimp virus promoter.

12. The baculovinis according to claim 4, wherein at least one of said at least two

heterologous promoters is modified with the addition or deletion of a domain selected from the group consisting of an inverted repeat sequence, a GC - rich sequence, a Downstream Promoter Element (DPE), a guanine nucleotide 24 residues from the transcription initiation site, a STAT sequence operable in said facilitating host, said host, and said facilitating host and said host, and combinations thereof.

13. The baculovinis according to claim 12, wherein a sequence of said domain is selected from the group consisting of SEQ ID NO 32 (ACCTATGAC GTCATAGGT from SEQ ID NO: 4), SEQ ID NO: 33 (GCGAGCGC from SEQ ID NO:4), and SEQ ID NO: 34 (TCCAA, DPE from SEQ ID NO:4), SEQ ID NO 35 (AGACC, DPE from SEQ ID NO:5) and SEQ ID NO: 36 (AGATC, DPE from SEQ ID NO:6).

14. The baculovinis according to claim 13, wherein said sequence has 1, 2, 3, 4, or 5

substitutions selected from the group consisting of C, G, and A.

15. The baculovinis according to claim 12, wherein said STAT sequence operable in said facilitating host cell comprises ACTCATTTATTC (SEQ ID NO:33) or

CTTGTTACTCATTTAATCCAAGAAA (SEQ ID NO:34).

16. The baculovinis according to claim 15, wherein said STAT sequence has any substitution except at five nucleotides that are conserved across species boundaries selected from the group consisting of nucleotide C at position 11, nucleotide A at position 12, nucleotide T at positions 14 and 15, and 18 of the WSSV STAT-binding sequence

(CCTTGTTACTCATTTATTCCTAGAAA, SEQ ID NO:35).

17. The baculovinis according to claim 12, wherein said STAT sequence is a WSSV STAT- binding sequence added at nucleotide 76 of IHHNV P61 deltaAR.

18. The baculovinis according to claim 17, wherein said WSSV STAT-binding sequence increases relative abundance of an operably linked transcript by about 2-fold after infection in a facilitating host relative to the abundance of said transcript without said WSSV STAT-binding sequence after infection in said facilitating host.

19. The baculovinis according to claim 12, wherein said STAT sequence increases relative abundance of an operably linked transcript after infection in a facilitating host more than the relative abundance is increased when said facilitating host is under physical stress and not infected with a virus.

20. The baculovinis according to claim 12, wherein said added STAT sequence is added between 2-6, 3-6, 4-6, or 5-6 times in a promoter.

21. The baculovinis according to claim 12, wherein said added STAT sequence is added once, twice, three times, four times, five times, or six times in said at least one of said promoters.

22. The baculovinis according to claim 12, wherein said added STAT sequence is added up to six times in at least one of said promoters.

23. The baculovinis according to claim 12, wherein the addition of a STAT sequence in at least one of said promoters increases the relative abundance of an operably linked transcript after infection of said facilitating host relative to the same transcript operably linked to said promoter without the added STAT sequence after infection of said facilitating host.

24. The baculovirus according to claim 12, wherein said STAT sequence is added to said at least one of said promoters upstream of its TATA-box.

25. The baculovirus according to claim 24, wherein said STAT sequence added upstream of the TATA-box produces a higher relative abundance of an operably linked transcript after infection of said facilitating host than when said STAT sequence is located between the TATA-box and the transcription initiation site (TIS).

26. The baculovirus according to claim 12, wherein said added STAT sequence is a

consensus STAT sequence (NCANTTNTTCNNNGAAN, SEQ ID NO:36).

27. The baculovirus according to claim 12, wherein addition of said domain in said at least one of said promoters increases the relative abundance of an operably linked transcript in at least one of an insect, mammalian, yeast, fungus, or bacterial cell culture system relative to said at least one of said promoters without said added domain in said cell culture system.

28. The baculovirus according to claim 11, wherein said shrimp virus promoter is the P2 promoter of IHHNV comprising a Downstream Promoter Element and a nucleotide G at

+24 set forth in SEQ ID NO: 4.

29. A nucleic acid molecule comprising a non-IHHNV viral genome and a P2 promoter of IHHNV comprising a Downstream Promoter Element and a guanine nucleotide 24 residues from the transcription initiation site.

30. An invertebrate virus promoter operably linked to a nucleic acid sequence that codes for at least one viral genomic segment of a bi-segmented, tri- segmented, or multi- segmented negative- sense single- stranded RNA ("(-)sense RNA") virus, wherein said at least one viral genomic segment expressed from said invertebrate virus promoter and at least one other viral genomic segment expressed from a second promoter have similar relative abundance in at least two cell culture systems selected from the group consisting of insect, mammalian, yeast, fungus, and bacterial.

31. The invertebrate virus promoter of Claim 30, wherein the relative abundance of said at least one viral segment and said at least one other viral segment in a first cell culture system is within 30% of the relative abundance of said at least one viral segment and at least one other viral segment in at least one other cell culture system.

32. The invertebrate virus promoter of Claim 31, wherein said at least two culture systems are insect and mammalian.

33. The invertebrate virus promoter of Claim 30, wherein said promoter is the P2 of IHHNV with native DPE and G at +24 (SEQ ID NO: 4).

34. The invertebrate virus promoter of Claim 30, wherein said promoter is modified with the addition or deletion of a domain selected from the group consisting of an inverted repeat sequence, a GC - rich sequence, a Downstream Promoter Element (DPE), a G at +24, a STAT sequence operable in said facilitating host, and combinations thereof.

35. A baculovinis that infects a facilitating host comprising a positive strand promoter and a negative stand promoter flanking each nucleic acid sequence that codes for a functional segment of a mono-segmented, bi-segmented, tri- segmented, or multi- segmented (- )sense, single- stranded RNA virus that does not infect said facilitating host.

36. The baculovinis according to Claim 35, wherein said functional genomic segments of said mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense, single- stranded RNA virus replicate, assemble, or replicate and assemble in said facilitating host.

37. A baculovinis that infects a facilitating host comprising a comprising a positive strand promoter and a negative stand promoter flanking each nucleic acid sequence that codes for a functional genomic segment of a mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-) sense RNA virus that does not infect said facilitating host, wherein the expression of at least one of said nucleic acid sequences that codes for said functional genomic segment of said (-)sense RNA virus is not under the control of a promoter derived from a host of said mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA virus or from said facilitating host.

A DNA molecule comprising a first nucleic acid sequence coding for a baculovirus and a second nucleic acid sequence that codes for a functional genomic segment of a mono- segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA virus wherein said functional mono-segmented, bi-segmented, tri- segmented, or multi- segmented single- stranded RNA virus does not infect insect cells.

A composition comprising a first virus capable of infecting a cell, wherein said first virus comprises a functional genomic segment of a second virus that is not capable of infecting said cell, wherein said second virus has a (-)sense, single- stranded RNA genome.

A method of assembling a mono -segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA virus comprising

a) infecting a facilitating host cell with a virus comprising a DNA molecule

comprising

i) a nucleic acid sequence coding for a viral genome of said facilitating host cell virus;

ii) a nucleic acid sequence coding for a functional genomic segment of a mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA virus that does not infect said facilitating host cell; and

iii) a positive strand promoter and a negative stand promoter flanking each said nucleic acid sequence that codes for a functional genomic segment of a (-

) sense RNA virus;

b) providing an RNA polymerase that initiates transcription at said negative strand promoter;

c) obtaining the supernatant, cell lysate, or supernatant and cell lysate of said

infected facilitating host cell; and

d) transducing, infecting, or transducing and infecting a host cell of said mono- segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense, single- stranded RNA virus with said supernatant, cell lysate, or supernatant and cell lysate.

The method according to Claim 40, wherein said functional genomic segments of said mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense single stranded RNA virus replicate in said facilitating host.

42. A method of assembling a mono -segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA virus comprising

a) infecting a facilitating host cell with a virus comprising a DNA molecule

comprising

i) a nucleic acid sequence coding for a viral genome of said facilitating host cell virus;

ii) a positive strand promoter and a negative stand promoter flanking each nucleic acid sequence that codes for a functional genomic segment of a mono- segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA viral genome that does not infect said facilitating host cell; and

iii) an expression cassette for a nucleic acid sequence coding for an RNA polymerase that initiates transcription at said negative strand promoter;

b) obtaining the supernatant, cell lysate, or supernatant and cell lysate of said

infected facilitating host cell;

c) transducing a non-host and non-facilitating host cell of the mono-segmented, bi- segmented, tri- segmented, or multi- segmented (-) sense RNA virus with said supernatant, cell lysate, or supernatant and cell lysate; and

d) obtaining a mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-) sense RNA virus from said non-host and non-facilitating host cell supernatant, cell lysate, or supernatant and cell lysate.

43. The method of claim 42, wherein said non-host cell of the mono-segmented, bi- segmented, tri- segmented, or multi- segmented (-)sense RNA virus produces a mono- segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA virus with glycosylation sufficient to allow infection of a host.

44. A vaccine comprising an replication deficient, inactivated, or attenuated (-)sense RNA virus comprising a mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA viral genome produced by the method of

a) infecting a facilitating host cell with a virus comprising a nucleic acid sequence coding for a viral genome of said facilitating host cell virus; a positive strand promoter and a negative stand promoter flanking each nucleic acid sequence that codes for a functional genomic segments of a mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA viral genome that does not infect said facilitating host cell; a nucleic acid sequence coding for an RNA polymerase that initiates transcription at said negative strand promoter;

b) obtaining the supernatant, cell lysate, or supernatant and cell lysate of said

infected facilitating host cell; and

c) transducing a host cell of said (-)sense RNA virus with said supernatant, cell lysate, or supernatant and cell lysate.

45. The vaccine according to Claim 44, wherein said mono-segmented, bi-segmented, tri- segmented, or multi- segmented (-)sense RNA virus is purified from said host cell before inactivation.

46. The vaccine according to Claim 44, wherein said replication deficient, inactivated, or attenuated mono-segmented, bi-segmented, tri-segmented, or multi- segmented (-)sense RNA virus comprises a (-)sense RNA viral genomic segment lacking at least portion of a 5' UTR relative to a naturally occurring mono-segmented, bi-segmented, tri-segmented, or multi- segmented (-)sense RNA viral genomic segment of the same strain.

47. The vaccine according to Claim 46, wherein said (-)sense RNA viral genomic segment lacking at least portion of a 5' UTR comprises a nonstructural gene.

48. The vaccine according to Claim 44, wherein each segment of said mo no -segmented, bi- segmented, tri-segmented, or multi- segmented (-)sense RNA viral genome is operably linked to only said flanking positive strand promoter and negative stand promoter.

49. A vaccine comprising a mono-segmented, bi-segmented, tri-segmented, or multi- segmented (-)sense RNA virus that is not capable of infecting a facilitating host comprising a viral envelope that comprises proteins derived from said facilitating host.

50. A vaccine against a mono-segmented, bi-segmented, tri-segmented, or multi- segmented (-) sense RNA virus comprising a mono-segmented, bi-segmented, tri-segmented, or multi- segmented (-)sense RNA viral genome missing up to 200 nucleotides at the 5' end and up to 500 nucleotides on the 3' end of each said (-)sense RNA viral genomic segment relative to a naturally occurring mono-segmented, bi-segmented, tri-segmented, or multi- segmented (-) sense RNA viral genomic segment of the same strain.

51. A baculo virus capable of infecting a facilitating host comprising a positive strand

promoter and a negative stand promoter flanking a nucleic acid sequence that codes for each functional genomic segment of a mono-segmented, bi-segmented, tri-segmented, or multi- segmented double- stranded RNA ("dsRNA") virus that is not capable of infecting said facilitating host.

52. The baculo virus according to claim 51, wherein said baculo virus further comprises a

nucleic acid sequence coding for an RNA polymerase that initiates transcription at said negative strand promoter.

53. A method of assembling a mono -segmented, bi-segmented, tri-segmented, or multi- segmented (-)sense RNA virus comprising a) transducing, infecting, or transducing and infecting a host cell with a virus

comprising a DNA molecule comprising

i) a nucleic acid sequence coding for a viral genome of said facilitating host cell virus;

ii) a nucleic acid sequence coding for a functional genomic segment of a mono-segmented, bi-segmented, tri-segmented, or multi- segmented (-)sense RNA virus that does not infect said facilitating host cell; and

iii) a positive strand promoter and a negative stand promoter flanking each said nucleic acid sequence that codes for a functional genomic segment of a (-)sense RNA virus;

b) providing an RNA polymerase that initiates transcription at said negative strand promoter;

c) obtaining the supernatant, cell lysate, or supernatant and cell lysate of said

infected facilitating host cell; and

d) transducing, infecting, or transducing and infecting a second host cell of said mono- segmented, bi-segmented, tri-segmented, or multi- segmented (-) sense, single- stranded RNA virus with said supernatant, cell lysate, or supernatant and cell lysate.