WO2013102061A1

WO2013102061A1 - Actb primers and probes

Info

Publication number: WO2013102061A1
Application number: PCT/US2012/072045
Authority: WO
Inventors: Heather ALEXANDER; James Rhoads; Edward Pabich; Kathleen S. RIESING; Carolyn Mullen
Original assignee: Abbott Laboratories
Priority date: 2011-12-30
Filing date: 2012-12-28
Publication date: 2013-07-04

Abstract

The present disclosure relates to systems and methods for nucleic acid detection. In particular, the present disclosure provides primer and probe sequences for detection of human Beta-Actin (ACTB).

Description

ACTB PRIMERS AND PROBES

This application claims priority to U.S. Provisional Application No. 61/581 ,749, filed December 30, 201 1 , which is herein incorporated by reference in its entirety.

FIELD OF INVENTION

BACKGROUND

Nucleic acids found in cells can be deoxyribonucleic acid or ribonucleic acid and can be genomic DNA, extraehrornosonial DNA (e.g. plasmids and episom.es), mitochondrial DNA, messenger RNA and transfer NA, Nucleic acids can also be foreign to the host and contaminate a cell as an infectious agent, e.g. bacteria, viruses, fungi or single celled organisms and infecting multicellular organisms (parasites). Recently, detection and analysis of the presence of nucleic acids has become important for the identification of single nucleotide polymorphisms (SNPs), chromosomal rearrangements and the insertion of foreign genes. These include infectious viruses, e.g. HIV and other retroviruses, jumping genes, e.g. transposons, and the identification of nucleic acids from recombinantly engineered organisms containing foreign genes, e.g.

ROUNDUP READY plants.

The analysis of nucleic acids has a wide array of uses. For example, the presence of a foreign agent can be used as a medical diagnostic tool. The identification of the genetic makeup of cancerous tissues can also be used as a medical diagnostic tool, confirming that a tissue is cancerous, and determining the aggressive nature of the cancerous tissue. Chromosomal rearrangements, SNPs and abnormal variations in gene expression can be used as a medical diagnostic for particular disease states. Further, genetic information can be used to ascertain the effectiveness of particular pharmaceutical drugs, known as the field of pharmacogenetics. Genetic variations between humans and between domestic animals can also be ascertained by DNA analysis. This is used in fields including forensics, paternity testing and animal husbandly. Therefore, there is a need for improved methods of analyzing nucleic acid samples. SUMMARY

The present disclosure relates to systems and methods for nucleic acid detection. In particular, the present disclosure provides primer and probe sequences for detection of human Beta-Aetin (ACTB).

Embodiments of the present invention provide compositions, kits, systems and methods for amplification and detection of ACTB. For example, in some embodiments, the present invention provides a composition, comprising: at least one isolated oligonucleotide primer pair that comprises forward and reverse primers about 15 to 35 niicleobases in length, wherein the forward primer comprises at least 70% identity with a sequence selected from SEQ ID NOs: 1 and 6, and wherein the reverse primer comprises at, least 70% identity with a sequence selected from SEQ ID NOs:2 and 7. In some embodiments, the primer pair comprises SEQ ID NOs: 6 and 7. In some embodiments, the composition further comprises a probe, wherein said probe comprises at least 70%, 80%, 90%, 95%, or 99% identity to or comprises, consists essentially of, or consists of a sequence selected from SEQ ID NOs 3, 4, 5, 8 and 9 (e.g., SEQ ID NO:5). In some embodiments, the probe comprises one or more 5 'methyl dC or 5' propynyl dU. In some embodiments, the probe comprises a label, for example, a tluorophore (e.g., VIC) and a quencher (e.g., a black hole quencher). In some embodiments, the composition further comprise reagents for detection of a nucleic acid (e.g., NA) target of interest (e.g., a primer pair and probe configured for amplification and detection of the target of interest). In some embodiment, the composition further comprises reagents for performing a amplification (e.g., reverse transcriptase PGR) and/or detection (e.g., real time PGR) reaction.

Further embodiments provide kits and systems comprising the aforementioned compositions.

Additional embodiments provide a method of detecting ACTB in a sample, comprising: amplifying an ACTB nucleic acid from the sample using at least one isolated oligonucleotide primer pair that comprises forward and reverse primers about 15 to 35 nucleobases in length, wherein the forward primer comprises at least 70% identity with a sequence selected from SEQ ID NOs: 1 and 6, and wherein the reverse primer comprises at least 70% identity with a sequence selected from SEQ ID NQs:2 and 7; and (b) detecting the amplification product. In some embodiments, the method further comprises detecting a nucleic acid target of interest. Additional embodiments will be apparent to persons skilled in the relevant art based on the teachings contained herein.

DETAILED DESCRIPTION

Definitions

To facilitate an understanding of the present technology, a number of terms and phrases are defined below. Additional definitions are set forth throughout the detailed description.

As used herein, "a" or "an" or "the" can mean one or more than one. For example, "a" widget, can mean one widget, or a plurality of widgets.

As used herein, the term "amplicon" refers to a nucleic acid generated using the primer pairs described herein .

Amp! icons typically comprise from about 45 to about 500 consecutive nucleobases (i.e., from about 45 to about 500 linked nucleosides). One of ordinary skill in the art will appreciate that this range expressly embodies compounds of 45, 46, 47, 48, 49, 50, 51 , 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 , 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 , 72, 73, 74, 75, 76, 77, 78, 79, 80, 81 , 82, 83, 84, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 , 102, 103, 104, 105, 106, 107, 108, 109, 1 10, 1 1 1 , 1 12, 1 13, 1 14, 1 15, 5 56, 1 1 7, 1 1 8, 1 19, 120, 121 , 122, 523, 124, 125, 126, 127, 128, 129, 130, 131 , 132, 133, 134, 135, 136, 137, 138, 139, 140, 141 , 142, 143, 144, 145, 146, 147, 148, 149, 150, 151 , 152, 153, 154, 155, 156, 157, 158, 159, 160, 161 , 162, 163, 164, 165, 166, 167, 168, 169, 170, 171 , 172, 173, 174, 175, 176, 177, 178, 179, 180, 181 , 182, 183, 184, 185, 186, 187, 188, 189, 190, 191 , 192, 193, 194, 195, 196, 197, 198, 199, 200 nucleobases, etc. in length. One ordinarily skilled in the art will further appreciate that the above range is not an absolute limit to the length of an amplicon, but instead represents a preferred length range.

The term "amplifying" or "amplification" in the context of nucleic acids refers to the production of multiple copies of a polynucleotide, or a portion of the polynucleotide, typically starting from a small amount of the polynucleotide (e.g., a single polynucleotide molecule), where the amplification products or amplicons are generally detectable. Amplification of polynucleotides encompasses a variety of chemical and enzymatic processes. The generation of multiple DNA copies from one or a few copies of a target or template DNA molecule during a polymerase chain reaction (PCR) or a ligase chain reaction (LCR) are forms of amplification, Amplification is not limited to the strict duplication of the starting molecule. For example, the generation of multiple cDNA molecules from a limited amount of RNA in a sample using reverse transcription (RT)-PCR is a form of amplification. Furthermore, the generation of multiple RNA molecules from a single DNA molecule during the process of transcription is also a form of amplification.

The term "primer" refers to an oligonucleotide, whether occurring naturally as in a purified restriction digest, or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product which is complementary to a nucleic acid strand is induced, (i.e., in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH). The primer is preferably single stranded for maximum efficiency in amplification, but may alternatively be double stranded. If double stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an

oligodeoxyribonucleotide. The primer should be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent. The exact lengths of the primers will depend on many factors, including temperature, source of primer and the use of the method.

The term "target," when used in reference to the polymerase chain reaction, refers to the region of nucleic acid bounded by the primers used for polymerase chain reaction. Thus, the "target" is sought to be sorted out from other nucleic acid sequences. A "segment" is defined as a region of nucleic acid within the target sequence.

As used herein, the term "probe" or "hybridization probe" refers to an oligonucleotide

(i.e., a sequence of nucleotides), whether occurring naturally as in a purified restriction digest or produced synthetically, recombinantlv or by PCR amplification, that is capable of hy bridizing, at least in part, to another oligonucleotide of interest. A probe may be single-stranded or double- stranded. Probes are useful in the detection, identification and isolation of particular sequences, In some preferred embodiments, probes used in the present invention will be labeled with a "reporter molecule," so that is detectable in any detection system, including, but not limited to enzyme (e.g., ELISA, as well as enzyme-based histochemical assays), fluorescent, radioactive, and luminescent systems. It is not intended that the present invention be limited to any particular detection system or label. "Solid support" as used herein refers to any solid surface to which nucleic acids can be attached, such as for example, including but not limited to, metal surfaces, latex beads, dextran beads, polystyrene surfaces, polypropylene surfaces, polyacrylamide gel, gold surfaces, glass surfaces and silicon wafers.

The term "label" as used herein refers to any atom or molecule that can be used to provide a. detectable (preferably quantifiable) effect, and that can be attached to a nucleic acid or protein. Labels include but are not limited to dyes; radiolabels such as ^j2P; binding moieties such as biotin; haptens such as digoxgenin; luminogenic, phosphorescent or fluorogenic moieties; and fluorescent dyes alone or in combination with moieties that can suppress or shift, emission spectra by fluorescence resonance energy transfer (FRET). Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like. A label may be a charged moiety (positive or negative charge) or alternatively, may be charge neutral. Labels can include or consist of nucleic acid or protein sequence, so long as the sequence comprising the label is detectable.

The term "signal" as used herein refers to any detectable effect, such as would be caused or provided by a label or an assay reaction.

The term "detection" as used herein refers to quantitatively or qualitatively identifying an analyte (e.g., DNA, RNA or a protein) within a sample. The term "detection assay" as used herein refers to a kit, test, or procedure performed for the purpose of detecting an analyte nucleic acid within a sample. Detection assays produce a detectable signal or effect when performed in the presence of the target analyte, and include but are not limited to assays incorporating the processes of hybridization, nucleic acid cleavage (e.g., exo- or endonuclease), nucleic acid amplification, nucleotide sequencing, primer extension, or nucleic acid ligation.

As used herein, the terms "subject" and "patient" refer to any animal, such as a dog, a cat, a bird, livestock, and particularly a mammal, and preferably a human.

As used herein, the term "sample" is used in its broadest sense. In one sense, it is meant to include a representative portion or culture obtained from any source, including biological and environmental sources. Biological samples may be obtained from animals (including humans) b and encompass fluids, solids, tissues, and gases. In some embodiments, biological samples are tissue (e.g., tumor tissue) embedded (e.g., in paraffin) or preserved. Biological samples include blood products, such as plasma, serum, and the like. Environmental samples include

environmental material such as surface matter, soil, mud, sludge, biofilms, water, and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present invention.

Embodiments of the technology

The present disclosure relates to systems and methods for nucleic acid detection. In particular, the present disclosure provides primer and probe sequences for detection of human Beta- Ac tin (ACTB).

Embodiments of the present invention provide compositions, systems, kits and methods comprising primer and probe sequences for detection of human beta-actin (e.g., during real time amplification and detection assays).

In detection and amplification reactions, detection of a ubiquitous nucleic acid in no- template amplification and detection assays serves to detect contamination of assay component material in no-template control reactions by DNA or NA and thus reduce the false-positive frequency rate. Detection of ubiquitous nucleic acids also serves to normalize assay results against varying input amounts of sample RNA. In certain assays, ACTB (NCBI accession number NM_001 505) serves as a template for such control and normalization reactions as is it detectable in ail human samples.

The present invention is illustrated for use in real time amplification and detection assays (e.g., reverse transcriptase (RT) amplification reactions). However, the compositions and methods described herein find use in any number of nucleic acid amplification and detection assays.

In some embodiments, the present invention provides forward primers comprising SEQ ID NOs: 1 or 6. In some embodiments, the present invention provides reverse primers comprising SEQ ID NOs: 2 or 7. In some embodiments, the present invention provides probe sequences comprising SEQ ID NOs: 3, 4, or 5. In some embodiments, compositions and methods utilize the primers of SEQ ID NOs: 6 and 7 and the probe of SEQ ID NO:5. One with ordinary skill in the art of design of amplification primers will recognize that a given primer need not hybridize with 100% complementarity in order to effectively prime the synthesis of a complementary nucleic acid strand in an amplification reaction. A primer may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., for example, a loop structure or a hairpin structure). The primers may comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity with any of the primers described herein. Thus, in some embodiments, an extent of variation of 70% to 100%, or any range failing within, of the sequence identity is possible relative to the specific primer sequences disclosed herein. To illustrate, determination of sequence identity is described in the following example: a primer 20 nucleobases in length which is identical to another 20 nucleobase primer having two non- identical residues has 18 of 20 identical residues (18/20 = 0.9 or 90% sequence identity). In another example, a primer 15 nucleobases in length having all residues identical to a 15 nucleobase segment of primer 20 nucleobases in length would have 15/20 = 0.75 or 75% sequence identity with the 20 nucleobase primer. Percent identity need not be a whole number, for example when a 28 consecutive nucleobase primer is completely identical to a 31 consecutive nucleobase primer (28/31 = 0.9032 or 90.3% identical).

Percent homology, sequence identity or complementarity, can be determined by, for example, the (Jap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison WI), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1985 , 2, 482-489). In some

embodiments, complementarity of primers is between about 70% and about 80%. in other embodiments, homology, sequence identity or complementarity, is between about 80% and about 90%. in yet other embodiments, homology, sequence identity or complementarity, is at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or is 100%.

In some embodiments, the primers described herein comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99%, or 100% (or any range falling within) sequence identity with the primer sequences specifically disclosed herein. One with ordinary skill is able to calculate percent sequence identity or percent sequence homology and is able to determine, without undue experimentation, the effects of variation of primer sequence identity on the function of the primer in its role in priming synthesis of a complementary strand of nucleic acid for production of an amplicon.

In some embodiments, the oligonucleotide primers are 13 to 35 nucleobases in length (13 to 35 linked nucleotide residues). These embodiments comprise oligonucleotide primers 13, 14, 15, 16, 17, 18, 19, 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 , 32, 33, 34 or 35 nucleobases in length, or any range therein.

In some embodiments, any given primer comprises a modification comprising the addition of a non-templated T residue to the 5' end of the primer (i.e., the added T residue does not necessarily hybridize to the nucleic acid being amplified). The addition of a non-templated T residue has an effect of minimizing the addition of non-templated A residues as a result of the non-specific enzyme activity of, e.g., Taq DNA polymerase (Magnuson et al ., Bioteehniques, 1996, 21 , 700-709).

Primers may contain one or more universal bases. Because any variation (due to codon wobble in the third position) in the conserved regions among species is likely to occur in the third position of a DNA (or RNA) triplet, oligonucleotide primers can be designed such that the nucleotide corresponding to this position is a base which can bind to more than one nucleotide, referred to herein as a "uni versal nucleobase." For example, under this "wobble" pairing, inosine (I) binds to U, C or A; guanine (G) binds to U or C, and uridine (IS) binds to U or C. Other examples of universal, nucleobases include nitroindoles such as 5-nitroindole or 3-nitropyrrole (Loakes et al., Nucleosides and Nucleotides, 1995, 14, 1001 -1003), the degenerate nucleotides dP or dK (Hill et al.), an acyclic nucleoside analog containing 5-nitroindazoie (Van Aerschot et al., Nucleosides and Nucleotides, 1995, 14, 1053-1056) or the purine analog l-(2-deoxy-.beta. - D-ribofuranosyl)-irnidazole-4-carboxamide (Sala et al., Nucl. Acids Res., 1996, 24, 3302-3306).

In some embodiments, to compensate for weaker binding by the wobble base, the oligonucleotide primers are configured such that the first and second positions of each triplet are occupied by nucleotide analogs which bind with greater affinity than the unmodified nucleotide. Examples of these analogs include, but are not limited to, 2,6-diaminopurine which binds to thymine, 5-propynyluracil which binds to adenine and 5-propynylcytosine and phenoxazines, including G-clamp, which binds to G. Propynylated pyrimidines are described in U.S. Patent Nos. 5,645,985, 5,830,653 and 5,484,908, each of which is commonly owned and incorporated herein by reference in its entirety. Fropynylated primers are described in U.S Pre-Grant

Publication No. 2003-0170682; also commonly owned and incorporated herein by reference in its entirety. Phenoxazines are described in U.S. Patent Nos, 5,502,177, 5,763,588, and

6,005,096, each of which is incorporated herein by reference in its entirety. G-eiamps are described in U.S. Patent Nos. 6,007,992 and 6,028,183, each of which is incorporated herein by reference in its entirety.

In some embodiments, probe sequences comprise fully or partially modified nucleotides (e.g., 5 'methyl dC in place of c nucleotides or 5' propynyi dU in place of t nucleotides),

In some embodiments, non-template primer tags are used to increase the melting temperature (Tin) of a primer-template duplex in order to improve amplification efficiency. A non-template tag is at least three consecutive A. or T nucleotide residues on a primer which are not complementary to the template. In any given non-template tag, A can be replaced by C or G and T can also be replaced by C or G. Although Watson-Crick hybridization is not expected to occur for a non-template tag relative to the template, the extra hydrogen bond in a G-C pair relative to an A-T pair confers increased stability of the primer-template duplex and improves amplification efficiency for subsequent cycles of amplification when the primers hybridize to strands synthesized in previous cycles.

In some embodiments, probes comprise a fluorophore and a high efficiency dark quencher, such as the Black Hole Quenchers (BHQ; Biosearch Technologies, Inc., Novate,

Calif). As is known in the art, the high quenching efficiency and lack of native fluorescence of the BHQ dyes allows "random-coil" quenching to occur in linear probes labelled at one terminus with a fluorophore and at the other with a BHQ dye thus ensuring that the fluorophore does not fluoresce when the probe is in solution. Upon binding its target sequence, the probe stretches out, the fluorophore and quencher are thus spatially separated and the fluorophore fluoresces. One skilled in the art will appreciate that the BHQ dyes can also be used as the quencher moiety in molecular beacon or TAQMAN probes.

Suitable fiuorophores and quenchers for use with the polynucleotides of the present invention can be readily determined by one skilled in the art (see also, Tgayi et al., Nature Biotechnol., 16:49 53 (1998); Marras et al., Genet. Anal.: Biomolec. Eng., 14: 151 156 (1999)). Many fiuorophores and quenchers are available commercially, for example from Molecular Probes (Eugene, Oreg.) or Biosearch Technologies, Inc. ( ovato, Calif.). Examples of fiuorophores that can he used in the present invention include, but are not limited to, fluorescein and fluorescein derivatives such as FAM, VIC, and JOE, 5-(2'-aminoethy l)amino naphthalene- 1- suiphonic acid (EDANS), coumarin and coumarin derivatives, Lucifer yellow, NED, Texas red, tetramethyirhodamine, tetrachloro-6-carboxyfluoroscein, 5-carboxyrhodamine, cyanine dyes and the like. Quenchers include, but are not limited to, DABCYL, 4'-(4- dimethyia.minopheiiylazo)beiizoic acid (DABSYL), 4-diniethylaminophenyia.zophenyi-4'- maieiniide (DABMT), tetramethyirhodamine, carboxytetramethylrhodamine (TAMRA), BHQ dyes and the like. Methods of coupling fiuorophores and quenchers to nucleic acids are well- known in the art. In some embodiments, modifications increase the Tm of the probe, which allows for the use of a shorter, more specific probe.

In some embodiments, detection methods are real time amplification and detection assays (e.g., real time RT-PCR). The compositions and methods described herein find use in a variety of nucleic acid analysis methods in research, screening, clinical, and therapeutic applications.

Exemplary methods are described below .

Illustrative non-limiting examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), transcription-mediated amplification (TMA), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA), Those of ordinary skill in the art will recognize that certain amplification techniques (e.g., PCR.) require that RNA be reversed transcribed to DNA prior to amplification (e.g., RT- PCR), whereas other amplification techniques directly amplify RNA (e.g., TMA and NASBA). The polymerase chain reaction (U.S. Pat. Nos. 4,683,195, 4,683,202, 4,800,159 and 4,965,188, each of which is herein incorporated by reference in its entirety), commonly referred to as PCR, uses multiple cycles of denaturation, annealing of primer pairs to opposite strands, and primer extension to exponentially increase copy numbers of a target nucleic acid sequence. For other various permutations of PCR see, e.g., U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159;

Mullis et al, Meth. Enzymol. 155: 335 (1987); and, Murakawa et al, DNA 7: 287 (1988), each of which is herein incorporated by reference in its entirety.

Transcription mediated amplification (U.S. Pat. Nos. 5,480,784 and 5,399,491, each of which is herein incorporated by reference in its entirety), commonly referred to as TMA, synthesizes multiple copies of a target nucleic acid sequence autoeatalytically under conditions of substantially constant temperature, ionic strength, and pH in which multiple RNA copies of the target sequence autoeatalytically generate additional copies. See, e.g., U.S. Pat, Nos.

5,399,491 and 5,824,518, each of which is herein incorporated by reference in its entirety. In a variation described in U.S. Publ. No, 20060046265 (herein incorporated by reference in its entirety), TMA optionally incorporates the use of blocking moieties, terminating moieties, and other modifying moieties to improve TMA process sensitivity and accuracy.

The ligase chain reaction (Weiss, R,, Science 254: 1292 (1991), herein incorporated by reference in its entirety), commonly referred to as LCR, uses two sets of complementary DNA oligonucleotides that hybridize to adjacent regions of the target nucleic acid. The DNA.

oligonucleotides are covalently linked by a DNA ligase in repeated cycles of thermal denaturation, hybridization and ligation to produce a detectable double-stranded ligate oligonucleotide product.

Strand displacement amplification (Walker, G. et al,, Proc. Natl. Acad. Sci. USA 89: 392- 396 (1992); U.S. Pat. Nos. 5,270,184 and 5,455,166, each of which is herein incorporated by reference in its entirety), commonly referred to as SDA, uses cycles of annealing pairs of primer sequences to opposite strands of a target sequence, primer extension in the presence of a dNTPaS to produce a duplex hemiphosphorotbioated primer extension product, endonuclease- mediated nicking of a hemimodified restriction endonuclease recognition site, and polymerase- mediated primer extension from the 3' end of the nick to displace an existing strand and produce a strand for the next round of primer annealing, nicking and strand displacement, resulting in geometric amplification of product. Thermophilic SDA (tSDA) uses thermophilic endonucleases and polymerases at higher temperatures in essentially the same method (EP Pat. No. 0 684 315).

Other amplification methods include, for example: nucleic acid sequence based amplification (U.S. Pat. No. 5,130,238, herein incorporated by reference in its entirety), commonly referred to as NASBA; one that uses an RNA replicase to amplify the probe molecule itself (Lizards et ai., BioTechnol. 6: 1197 (1988), herein incorporated by reference in its entirety), commonly referred to as QP replicase; a transcription based amplification method (Kwoh et al., Proc. Natl. Acad. Sci. USA 86: 1173 (1989)): and, self-sustained sequence replication (Guatelli et al., Proc. Natl. Acad. Sci. USA 87: 1874 (1990), each of which is herein incorporated by reference in its entirety). For further discussion of known amplification methods see Persing, David H., "In Vitro Nucleic Acid Amplification Techniques" in Diagnostic Medical Microbiology: Principles and Applications (Persing et al., Eds.), pp. 51-87 (American Society for Microbiology, Washington, DC (1993)).

Non-amplified or amplified nucleic acids can be detected by any conventional means. For example, the nucleic acids can be detected by hybridization with a detectably labeled probe and measurement of the resulting hybrids. Illustrative non-limiting examples of detection methods are described below.

One illustrative detection method, the Hybridization Protection Assay (HP A) involves hybridizing a. chemiluminescent oligonucleotide probe {e.g., an acridinium ester-labeled (AE) probe) to the target sequence, selectively hydrolyzing the chemiluminescent label present on unhybridized probe, and measuring the chemi luminescence produced from the remaining probe in a lurninometer. See, e.g., U.S. Pat. No. 5,283,174 and Norman C. Nelson et al., Nonisotopic Probing, Blotting, and Sequencing, ch. 17 (Larry J. Kricka ed., 2d ed. 1995, each of which is herein incorporated by reference in its entirety).

Another illustrative detection method provides for quantitative evaluation of the amplification process in real-time. Evaluation of an amplification process in "real-time" involves determining the amount of amp!icon in the reaction mixture either continuously or periodically during the amplification reaction, and using the determined values to calculate the amount of target sequence initial ly present in the sampl e, A variety of methods for determining the amount of initial target sequence present in a sample based on real-time amplification are well known in the art. These include methods disclosed in U.S. Pat. Nos. 6,303,305, 5,645,801 and 6,541 ,205, each of which is herein incorporated by reference in its entirety. Another method for determining the quantity of target sequence initially present in a sample, but which is not based on a real-time amplification, is disclosed in U.S. Pat. No. 5,710,029, herein incorporated by reference in its entirety.

Amplification products may be detected in real-time through the use of various self- hybridizing probes, most of which have a stem-loop structure. Such sel f-hybridizing probes are labeled so that they emit differently detectable signals, depending on whether the probes are in a self-hybridized state or an altered state through hybridization to a. target sequence. By way of non-limiting example, "molecular torches" are a type of self-hybridizing probe that includes distinct regions of self-complementarity (referred to as "the target binding domain" and "the target closing domain") which are connected by a joining region (e.g., non-nucleotide linker) and which hybridize to each other under predetermined hybridization assay conditions. In a preferred embodiment, molecular torches contain single-stranded base regions in the target binding domain that are from 1 to about 20 bases in length and are accessible for hybridization to a target sequence present in an amplification reaction under strand displacement conditions. Under strand displacement conditions, hybridization of the two complementary regions, which may be fully or partially complementary, of the molecular torch is favored, except in the presence of the target sequence, which will bind to the single-stranded region present in the target binding domain and displace all or a portion of the target closing domain. The target binding domain and the target, closing domain of a molecular torch include a detectable label or a pair of interacting labels (e.g., luminescent/quencher) positioned so that a different signal is produced when the molecular torch is self-hybridized than when the molecular torch is hybridized to the target sequence, thereby permitting detection of probe :target duplexes in a test sample in the presence of unhybridized molecular torches. Molecular torches and a variety of types of interacting label pairs are disclosed in U.S. Pat. No. 6,534,274, herein incorporated by reference in its entirety.

Another example of a detection probe having self-complementarity is a "molecular beacon." Molecular beacons include nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation in the absence of a target sequence present in an amplification reaction, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target sequence and the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Molecular beacons are disclosed in U.S. Pat. Nos. 5,925,517 and 6,150,097, herein incorporated by reference in its entirety.

In some embodiments, the present invention utilizes TAQMAN probes. As is known in the art, TAQMAN probes are dual-labelled fluorogenic nucleic acid probes composed of a polynucleotide complementary to the target sequence that is labelled at the 5' terminus with a fluorophore and at the 3' terminus with a quencher. TAQMAN are typically used as real-time probes in amplification reactions. In the free probe, the close proximity of the fluorophore and the quencher ensures that the fluorophore is internally quenched. During the extension phase of the amplification reaction, the probe is cleaved by the 5' nuclease activity of the polymerase and the fluorophore is released. The released fluorophore can then fluoresce and thus produces a detectable signal,

Other self-hybridizing probes are well known to those of ordinary skill in the art. By way of non-limiting example, probe binding pairs having interacting labels, such as those disclosed in U.S. Pat. No. 5,928,8(52 (herein incorporated by reference in its entirety) might be adapted for use in the present invention. Probe systems used to detect single nucleotide polymorphisms (SNPs) might also be utilized in the present invention. Additional detection systems include "molecular switches," as disclosed in U.S. Pub!. No. 20050042638, herein incorporated by reference in its entirety. Other probes, such as those comprising intercalating dyes and/or ft uoro chromes, are also useful for detection of amplification products in the present invention. See, e.g., U.S. Pat. No. 5,814,447 (herein incorporated by reference in its entirety).

In some embodiments, nucleic acids are detected and characterized by the identification of a unique base composition signature (BCS) using mass spectrometry (e.g., Abbott PLEX-ID system.. Abbot Ibis Biosciences, Abbott Park, Illinois,) described in U.S. Patents 7,108,974, 8,017,743, and 8,017,322; each of which is herein incorporated by reference in its entirety.

In some embodiments, a computer-based analysis program is used to translate the raw data generated by the detection assay (e.g., the presence, absence, or amount of a given nucleic acid) into data of predicti ve value for a clinician. The clinician can access the predictive data using any suitable means. Thus, in some preferred embodiments, the present invention provides the further benefit that the clinician, who is not likely to be trained in genetics or molecular biology, need not understand the raw data. The data is presented directly to the clinician in its most useful form. The clinician is then able to immediately utilize the information in order to optimize the care of the subject.

The present invention contemplates any method capable of receiving, processing, and transmitting the information to and from laboratories conducting the assays, information provides, medical personal, and subjects. For example, in some embodiments of the present invention, a sample (e.g., a biopsy or a serum or urine sample) is obtained from a subject and submitted to a profiling sendee (e.g., clinical lab at a medical facility, genomic profiling business, etc.), located in any part of the world (e.g., in a country different than the country where the subject resides or where the information is ultimately used) to generate raw data. Where the sample comprises a tissue or other biological sample, the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves (e.g., a. urine sample) and directly send it to a profiling center. Where the sample comprises previously determined biological information, the information may be directly sent to the profiling sendee by the subject (e.g., an information card containing the information may be scanned by a computer and the data transmitted to a. computer of the profiling center using an electronic communication systems). Once received by the profiling sendee, the sample is processed and a profile is produced (i.e. , expression data), specific for the diagnostic or prognostic information desired for the subject.

The profile data is then prepared in a format suitable for interpretation by a treating clinician. For example, rather than providing raw expression data, the prepared format may- represent a diagnosis or risk assessment (e.g., presence or absence of a nucleic acid) for the subject, along with recommendations for particular treatment options. The data may be displayed to the clinician by any suitable method. For example, in some embodiments, the profiling service generates a report that can be printed for the clinician (e.g., at, the point, of care) or displayed to the clinician on a computer monitor.

In some embodiments, the information is first analyzed at the point of care or at a regional facility. The raw data is then sent to a central processing facility for further analysis and/or to convert the raw data to information useful for a clinician or patient. The central processing facility provides the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis. The central processing facility can then control the fate of the data following treatment of the subject. For example, using an electronic communication system, the central facility can provide data to the clinician, the subject, or researchers.

In some embodiments, the subject is able to directly access the data using the electronic communication system. The subject may chose further intervention or counseling based on the results. In some embodiments, the data is used for research use. For example, the data may be used to further optimize the inclusion or elimination of markers as useful indicators of a particular condition or stage of disease or as a companion diagnostic to determine a treatment course of action. In some embodiments, the compositions and methods described herein find use in a variety of research, screening and clinical applications, including but not limited to, in the fields of genomics, pharmacogenomics, drug discovery, food characterization, genotyping, diagnostics, gene expression monitoring, genetic diversity profiling, whole genome sequencing and polymorphism discovery, or any other applications involving the detection of amplified nucleic acids.

The amplification and/or detection methods in which the polynucleotides according to the present invention can be employed are suitable for adaptation as high-throughput assays. High- throughput assays provide the advantage of processing many samples simultaneously and significantly decrease the time required to screen a large number of samples. The present invention, therefore, contemplates the use of the pol ynucleotides of the present invention in high- throughput screening or assays to detect and/or quantitate ACTB target, nucleic acids in a plurality of test samples and assay formats.

For high-throughput assays, reaction components are usually housed in a multi-container carrier or platform, such as a multi-well microliter plate, which allows a plurality of assays each containing a different test sample to be monitored simultaneously. The present invention also contemplates highly automated high-throughput assays to increase the efficiency of the screening or assay process. Many high-throughput screening or assay systems are now available commercially, as are automation capabilities for many procedures such as sample and reagent pipetting, liquid dispensing, timed incubations, formatting samples into microarrays, microplate thermocycling and microplate readings in an appropriate detector, resulting in much faster throughput times.

The polynucleotides in accordance with the present invention can be provided as part of a kit that allows for the detection of ACTB as part of a detection assay. Kits comprise any components necessary, sufficient or useful for detection of ACTB, alone or in combination with targets of interest. Such kits comprise one or more of the primer and probes described herein. In one embodiment of the present invention, the polynucleotides are provided in the kits in combinations for use as primers to specifically amplify ACTB nucleic acids in a test sample. In a related embodiment, the polynucleotides are provided in combinations that comprise the nucleic acid sequences as set forth in SEQ ID NOs: 1-7. The kits can optionally include amplification reagents, reaction components and/or reaction vessels. One or more of the polynucleotides provided in the kit can incorporate a detectable label, or the kit may include reagents for labelling the polynucleotides. One or more of the components of the kit may be lyophilised and the kit may further comprise reagents suitable for the reconstitution of the lyophilised components. The kit can additionally contain instructions for use.

Kits may also comprise a sufficient quantity of reverse transcriptase, a DNA polymerase, suitable nucleoside triphosphates, a DNA ligase, and/or reaction buffer, or any combination thereof, for the amplification processes described above. A kit may further include instructions pertinent for the particular embodiment of the kit, such instructions describing the primer pairs and ampl ification conditions for operation of the method. Kits may al so comprise instructions for analysis, interpretation and dissemination of data acquired by the kit. In other embodiments, instmctions for the operation, analysis, interpretation and dissemination of the data of the kit are provided on computer readable media. A kit may also comprise amplification reaction containers such as microcentrifuge tubes, microtiter plates, and the like. A kit may also comprise reagents or other materials for isolating nucleic acid from samples or analyzing amplicons, including, for example, detergents, solvents, or ion exchange resins which may be linked to magnetic beads.

In some embodiments, kits include components for detection of any desirable nucleic acid (e.g., RNA or DNA) target. The present invention is not limited to a particular target nucleic acid. Examples include, but are not limited to, human nucleic acid (e.g., associated with a disease or response to treatment for a disease), pathogen (e.g., virus, fungus or bacteria), etc. In some embodiments, such kits comprise the primers and probes described herein for detection of ACTB as a control. For example, in some embodiments, levels of ACTB RNA or DNA are utilized to normalize levels of target nucleic acid for use in quantitating levels of target nucleic acid.

EXPERIMENTAL

The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof. Example 1 ealTi/Ke MAGEA3 Assay ACTB primer and probe design and testing results

The reverse transcription PGR reaction mix contains the primer and probe sequences, thermostable RNA-DNA polymerase (r^'Tth), dNTP's, MnCl and buffer. The RT-PCR reaction, containing various levels of cell line total RNA as a sample, was subjected to 1 minute of 95°C denaturation, 20 minutes of 62°C reverse transcription, and 55 cycles of heating and cooling between 95°C, 92^CC and 62°C. During the 62°C reverse transcription and hybridization steps, the primers bind to the ACTS target region. The primers are then extended by the polymerase enzyme, and subsequently the extension products (amplicons) serve as templates for primer extension in the next round of PCR cycling. At each cycle, the probes bind to the target region in the original reverse transcribed DNA template and in the amplification products. As the polymerase extends the primers, the 5 -3' nuclease activity of the polymerase cleaves the probe. The emitter fluorophore is thus released from the quencher, and the fluorescent signal is read on a fluorescence reader instrument. The amount of fluorescent, signal is directly proportional to the amount of amplification product, which in turn is directly proportional to the starting quantity of ACTB mRNA in the sample.

ACTB forward primer (HA001) 5' CATGAAGATCCTCACCGAGCG 3' (SEQ ID NO: 5) ACTB reverse primer (HA003) 5' CTTCTCCTTAATGTCACGCACG 3' (SEQ ID NO:2) ACTB probe (HA002) 5' VIC- FFGTGGTGGTG A AGFTGT AGFFGF-B HQ 1 dT 3' (SEQ ID NO:3)

F = 5'Methyl dC

VIC ^:=: emitter fluorophore

BHQ 1 dT = Black Hole Quencher - 1 dT

Testing results showed a low frequency of ACTB false positive signal (Table 1 ).

Table 1

ACTS VIC (V MAGE A3 Positive False Positive

F AM Ct¹ Frequency² Frequency"

Redesign 22.72i-0.26 29.06±0.05 5.56% 2.08%»

(HAOO 1 /ΗΑ002/Ή A003

'Representative data from one run for 500 pg tumor cell line RNA per RT-PCR reaction.

2False positive frequency determined from 8 individual runs, 18 no-template control reactions per run.

Optimization of redesigned probe to decrease ACTS VIC Ct.

Fully modified HA002 BHQl probe 5' VIC-FFGLGGLGGLGAAGFLGLAGFFGF-BHQ 1 dT 3 ' (SEQ ID NO:4)

F = 5'Methyl dC

L = 5'Propynyl dli

VIC =^: emitter fiuoro hore

BHQldT = Black Hole Quencher -1 dT

Testing results showed no improvement in ACTB Ct using the fully modified probe (Table 2). Table 2

eai ai to BS (cnns aiea to £001570-033 eono ions of SB ^: C raaarso transoapitan

fl!*€ annaai tomparakiro}.

Fully modified, partially modified, and unmodified FIA002 BHQ2dT probes

Full 5' VIC-FFGLGGLGGLGAAGFLGLAGFFGF-BHQ2dT 3 ' (SEQ ID NO:8)

Partial 5' VIC-FFGTGGTGGTGAAGFTGTAGFFGF-BHQ2dT 3' (SEQ ID NO: 5)

Unmodified 5' VIC-CCGTGGTGGTGAAGCTGTAGCCGC-BHQ2dT 3 ' (SEQ ID NO:9) F = 5'Methyl dC L = 5'Propynyl dlJ

VIC =^: emitter fluoro hore

BHQ2dT = Black Hole Quencher -2 d^"f

Testing results demonstrated increased VIC signal with no significant delay in ACTB Ct using the partially modified BHQ2dT probe (Tables 3 and 4),

Table 3

able 4

Optimization of redesigned primers to decrease ACTB VIC Ct.

The forward and reverse primers were lengthened by 2 bases to increase the T_m and increase amplification efficiency under the current conditions.

ACTB forward primer +2 (HA001+2) 5' CTCATGAAGATCCTCACCGAGCG 3' (SEQ ID NO:6)

ACTB reverse primer +2 (HA003+2) 5' AGCTTCTCCTTAATGTCACGCACG 3 ' (SEQ ID NO:7)

Testing results showed decreased ACTB Ct's with longer redesigned primers (Table 5), Table 5

Mean of 3 replicates for 128 pg tumor cell line RNA. per RT-PCR reaction.

4 MR (Maximum Ratio) is a measure of VIC fluorescent signal intensity and robustness. Range of MR values for 3 replicate reactions are shown.

³ False positive frequency determined from 3 no-template control reactions in one run.

4 £2°c reverse transcription and 62°C anneal, 75 uL total reaction volume, 2.73 mM MnC12, 8 units rTth. Confirmation of redesigned ACTB primer and probe performance with final MAGEA3 assay conditions, using RNA extracted from an FFPE tissue sample positive for MAGE A3.

ACTB primer and probe sequences for final assay configuration:

ACTB forward primer ±2 (HA001+2) 5' CTCATGAAGATCCTCACCGAGCG 3' (SEQ ID NO:6)

ACTB reverse primer +2 (HA003+2) 5 ' AGCTTCTCCTTAATGTCACGCACG 3 ' (SEQ ID NO:7)

ACTB probe, partially modified, HA002 BHQ2dT

5' VIC-FFGTGGTGGTGAAGFTGTAGFFGF-BHQ2dT 3' (SEQ 1D 0:5)

F = 5 'Methyl dC

VIC ^:=: emitter fluorophore

BHQ2dT = Black Hole Quencher -2 dT

Testing results showed acceptable detection of ACTB mRNA in FFPE sample RNA dilutions, and 0% of no-template control reactions were positive for ACTB VIC signal (Table 6). T

All publications and patents mentioned in the above specification are herein incorporated by reference in their entirety for all purposes. Various modifications and variations of the described compositions, methods, and uses of the technology will be apparent to those skilled in the art without departing from the scope and spirit of the technology as described. Although the technology has been described in connection with specific exemplary embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.

Claims

WE CLAIM: L A composition, comprising:

at least one isolated oligonucleotide primer pair that comprises forward and reverse primers about 15 to 35 nucleobases in length, wherein said forward primer comprises at least 70% identity with a. sequence selected from SEQ ID NOs: I and 6, and wherein said reverse primer comprises at least 70% identity with a sequence selected from SEQ ID NOs: 2 and 7.

2. The composition of claim 1 , wherein said primer pair comprises SEQ ID NOs: 6 and 7.

3. The composition of claim 1, wherein said primer pairs amplify human beta-actin (ACTB),

4. The composition of claim 1 , wherein said composition further comprises a probe, wherein said probe comprises at least 70% identity with a sequence selected from SEQ ID NOs 3, 4, and 5, 8 and 9.

5. The composition of clam 4, wherein said probe has the sequence of SEQ ID NO:

5.

6. The composition of claim 4, wherein said probe hybridizes to ACTB.

7. The composition of claim 4, wherein said probe comprise one or more 5 'methyl dC or 5 ' propynyl dU.

8. The composition of claim 4, wherein said probe comprises a label,

9. The composition of claim 8, wherein said label comprises a fluorophore and a quencher.

10. The composition of claim 9, wherein said fluorophore is VIC and said quencher is a black hole quencher,

11. The composition of any one of claims 4 to 10, wherein said probe comprises at least a sequence selected from SEQ ID NOs 3, 4, and 5, 8 and 9.

12. The composition of claim 1 , wherein said composition further comprises reagents for detection of a nucleic acid target of interest.

13. The composition of claim 12, wherein said reagents comprises a primer pair and probe configured for amplification and detection of said target of interest.

14. The composition of claim 12, wherein said nucleic acid target of interest is RNA.

15. The composition of claim I , wherein said composition further comprises reagents for performing a amplification and/or detection reaction.

16. The composition of claim 54, wherein said amplification reaction is reverse transcriptase PCR and said detection reaction is real-time PGR detection.

17. A kit comprising the composition of any one of claims 1 to 16.

17. A method of detecting ACTB in a sample, comprising:

(a) amplifying an ACTB nucleic acid from said sample at least one isolated oligonucleotide primer pair that comprises forward and reverse primers about 15 to 35 nucleobases in length, wherein said forward primer comprises at least 70% identity with a sequence selected from SEQ ID NOs: 1 and 6, and wherein said reverse primer comprises at least 70% identity with a sequence selected from SEQ ID NOs:2 and 7: and

9 f (b) detecting said amplification product.

17. The method of claim 17, wherein said primer pair comprises SEQ ID NOsi 6 and o

18. The method of claim 17, wherein said detecting comprises hybridizing a probe to said amplified product, wherein said probe comprises at least 70% identity with a sequence selected from SEQ ID NOs 3, 4, and 5. 0

19. The method of claim 18, wherein said probe has the sequence of SEQ ID NO: 5.

20. The method of claim 18, wherein said probe comprise one or more 5 'methyl dC or 5 ' propynyl dU. 5

21. The method of claim 20, wherein said probe comprises a label.

22. The method of claim 21 , wherein said label comprises a fluorophore and a quencher. 0

23. The method of claim 22, wherein said fluorophore is VIC and said quencher is a black hole quencher.

24. The method of claim 17, further comprising the step of detecting a nucleic acid target of interest.

5

25. The method of claim 24, wherein said nucleic acid target of interest is RNA.

26. The method of claim 17, wherein said amplifying is reverse transcriptase PCR and said detecting is real-time PCR detection,

0