WO2013101711A1 - Assessing likelihood of developing fuchs' corneal dystrophy - Google Patents
Assessing likelihood of developing fuchs' corneal dystrophy Download PDFInfo
- Publication number
- WO2013101711A1 WO2013101711A1 PCT/US2012/071165 US2012071165W WO2013101711A1 WO 2013101711 A1 WO2013101711 A1 WO 2013101711A1 US 2012071165 W US2012071165 W US 2012071165W WO 2013101711 A1 WO2013101711 A1 WO 2013101711A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- tgc
- expanded
- human
- trinucleotide repeat
- repeat
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the methods and materials provided herein can be used to screen eye tissue donors.
- a sample can be obtained from a potential human eye tissue donor. Once obtained, the sample can be evaluated to determine if the potential donor contains an expanded TGC repeat within intron 3 of TCF4 nucleic acid. If the potential donor contains an expanded TGC repeat within intron 3 of TCF4 nucleic acid, then an eye tissue bank can elect to decline to accept eye tissue from that potential donor. If the potential donor does not contain an expanded TGC repeat within intron 3 of TCF4 nucleic acid, then an eye tissue bank can elect to accept eye tissue from that potential donor.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
This document provides methods and materials for assessing the likelihood of a human to develop FCD. For example, methods and materials for using the presence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid to identify humans having an elevated risk of developing FCD are provided.
Description
ASSESSING LIKELIHOOD OF DEVELOPING FUCHS' CORNEAL
DYSTROPHY
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application Serial No. 61/581,889, filed December 30, 201 1. The disclosure of the prior application is considered part of (and is incorporated by reference in) the disclosure of this application.
STATEMENT AS TO FEDERALLY SPONSORED RESEARCH
This invention was made with government support under grant number EYO 14467 awarded by National Institutes of Health. The government has certain rights in the invention.
BACKGROUND
1. Technical Field
This document relates to methods and materials involved in assessing the likelihood of a human to develop Fuchs' corneal dystrophy (FCD). For example, this document provides methods and materials for using the presence of an expanded TGC repeat within intron 3 of transcription factor 4 (TCF4) nucleic acid to identify humans having an elevated risk of developing FCD.
2. Background Information
FCD is a leading cause of corneal transplantation and affects 5% of people in the United States who are over the age of 40 years. Clinically visible deposits called guttae develop under the corneal endothelium in patients with FCD. A loss of endothelial cells and deposition of an abnormal extracellular matrix are observed microscopically. In advanced disease, the cornea swells and becomes cloudy because the remaining endothelial cells are not sufficient to keep the cornea dehydrated and clear. Signs and symptoms of the disease are rarely evident prior to 40 years of age.
SUMMARY
This document provides methods and materials for assessing the likelihood of a human to develop FCD. For example, this document provides methods and
materials for using the presence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid to identify humans having an elevated risk of developing FCD.
Transcription factor 4 nucleic acid encodes the E2-2 polypeptide and has also been termed SEF-2 or ITF-2. In some cases, the presence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid for an allele can be used to identify humans having the minor allele of rs613872 on that allele. The presence of the minor allele of rs613872 is associated with FCD as described elsewhere (Baratz et ah, N. Eng. J. Med., 363 : 1016-1024 (2010)).
As described herein, humans having normal corneas and homozygous for the major allele in rs613872 can lack the presence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid, while humans with Krachmer grade 6 FCD and heterozygous or homozygous for the minor allele in rs613872 can contain an expanded TGC repeat within intron 3 of TCF4 nucleic acid. These results demonstrate that the presence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid can be used to identify a human as having an elevated risk of developing FCD with or without knowing that human's allele status in rs613872.
Having the ability to identify humans having an elevated risk of developing FCD can allow patients and clinicians to better elect eye treatments prior to development of FCD. For example, a young person considering LASIK,
photorefractive keratectomy, or any type of laser refractive surgery can be evaluated as described herein to determine if that person has an increased likelihood of developing FCD. If that person is identified as having an increased likelihood of developing FCD, then that person may elect to avoid such procedures as they can have the potential to complicate future FCD treatment options and may adversely affect the outcome after a corneal transplant. In another example, a person considering an intra-ocular surgery to correct nearsightedness, farsightedness, and/or astigmatism can be assessed as described herein to determine if that person has an increased likelihood of developing FCD. If that person is identified as having an increased likelihood of developing FCD, then that person may elect to avoid such intra-ocular surgeries as they can have the potential to accelerate the loss of cornea endothelial cells. Examples of intra-ocular surgeries to correct nearsightedness, farsightedness, and/or astigmatism include, without limitation, those that involve removing and replacing the natural lens and those that involve implanting a second lens over the existing lens so that the existing lens remains intact.
Having the ability to identify humans having an elevated risk of developing FCD as described herein also can allow corneal tissue banks to avoid accepting corneal tissue from donors identified as having an elevated risk of developing FCD. For example, corneal tissue banks can use the methods and material provided herein to screen prospective corneal tissue donors so that they avoid accepting corneal tissue from donors identified as having an elevated risk of developing FCD.
In general, one aspect of this document features a method for identifying a human as having an elevated likelihood of developing Fuchs' corneal dystrophy. The method comprises, or consists essentially of, (a) detecting the presence of an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid, and (b) classifying the human as having the elevated likelihood of developing Fuchs' corneal dystrophy based at least in part on the presence. The detecting step can comprise performing a polymerase chain reaction. The detecting step can comprise using gel electrophoresis to detect the presence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid. The expanded TGC trinucleotide repeat can comprise greater than 37 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 52 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 55 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 60 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 70 TGC repeats. The human can be less than 40 years old. The method can comprise determining whether or not the human has at least one minor rs613872 allele.
In another aspect, this document features a method for determining whether or not it is advisable for a human to undergo an eye procedure. The method comprises, or consists essentially of, determining whether or not the human contains an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid, wherein the presence of the expanded TGC trinucleotide repeat indicates that it is not advisable for the human to undergo the eye procedure, and wherein the absence of the expanded TGC trinucleotide repeat indicates that it is advisable for the human to undergo the eye procedure. The determining step can comprise performing a polymerase chain reaction. The determining step can comprise using gel electrophoresis to detect the presence or absence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid. The expanded TGC trinucleotide repeat can comprise greater than 37 TGC repeats. The expanded TGC trinucleotide repeat can comprise
greater than 52 TGC repeats. The eye procedure can be an intra-ocular surgery, LASIK, a photo-refractive keratectomy, or a laser refractive surgery. The method can comprise detecting the presence of the expanded TGC trinucleotide repeat. The method can comprise detecting the absence of the expanded TGC trinucleotide repeat. The human can be less than 40 years old. The method can comprise determining whether or not the human has at least one minor rs613872 allele.
In another aspect, this document features a method for identifying a human who should avoid undergoing an eye procedure. The method comprises, or consists essentially of, (a) detecting the presence of an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid, and (b) classifying the human as being a human who should avoid undergoing the eye procedure based at least in part on the presence. The detecting step can comprise performing a polymerase chain reaction. The detecting step can comprise using gel electrophoresis to detect the presence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid. The expanded TGC trinucleotide repeat can comprise greater than 37 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 52 TGC repeats. The eye procedure can be an intra-ocular surgery, LASIK, a photo-refractive keratectomy, or a laser refractive surgery. The human can be less than 40 years old. The method can comprise determining whether or not the human has at least one minor rs613872 allele.
In another aspect, this document features a method for screening an eye tissue donor. The method comprises, or consists essentially of, (a) determining whether or not a human contains an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid, (b) classifying the human as being an acceptable eye tissue donor if the human lacks the expanded TGC trinucleotide repeat, and (c) classifying the human as being an unacceptable eye tissue donor if the human contains the expanded TGC trinucleotide repeat. The determining step can comprise performing a polymerase chain reaction. The determining step can comprise using gel electrophoresis to detect the presence or absence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid. The expanded TGC trinucleotide repeat can comprise greater than 37 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 52 TGC repeats. The human can be less than 40 years old. The method can comprise determining whether or not the human has at least one minor rs613872 allele. The method can comprise detecting the presence of the expanded
TGC trinucleotide repeat. The method can comprise detecting the absence of the expanded TGC trinucleotide repeat.
In another aspect, this document features a method for identifying a human as having an elevated likelihood of developing Fuchs' corneal dystrophy. The method comprises, or consists essentially of, (a) performing an amplification reaction using a nucleic acid sample of the human and a primer pair configured to amplify nucleic acid comprising an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid to obtain an amplification product, (b) detecting the presence of the expanded TGC trinucleotide repeat within the amplification product, and (c) classifying the human as having the elevated likelihood of developing Fuchs' corneal dystrophy based at least in part on the presence. The detecting step can comprise using gel electrophoresis to detect the presence of a band indicative of the presence of an expanded TGC repeat in the amplification product. The expanded TGC trinucleotide repeat can comprise greater than 37 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 52 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 55 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 60 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 70 TGC repeats. The human can be less than 40 years old. The method can comprise determining whether or not the human has at least one minor rs613872 allele.
In another aspect, this document features a method for determining whether or not it is advisable for a human to undergo an eye procedure. The method comprises, or consists essentially of, (a) performing an amplification reaction using a nucleic acid sample of the human and a primer pair configured to amplify nucleic acid comprising an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid to obtain an amplification product, (b) detecting the presence or absence of the expanded TGC trinucleotide repeat within the amplification product, and (c) classifying the eye procedure as not being advisable for the human if the expanded TGC trinucleotide repeat is present within the amplification product, and classifying the eye procedure as being advisable for the human if the expanded TGC trinucleotide repeat is absent from the amplification product. The detecting step can comprise using gel electrophoresis to detect the presence or absence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid. The expanded TGC trinucleotide repeat can comprise greater than 37 TGC repeats. The expanded TGC
trinucleotide repeat can comprise greater than 52 TGC repeats. The eye procedure can be an intra-ocular surgery, LASIK, a photo-refractive keratectomy, or a laser refractive surgery. The method can comprise detecting the presence of the expanded TGC trinucleotide repeat within the amplification product. The method can comprise detecting the absence of the expanded TGC trinucleotide repeat within the amplification product. The human can be less than 40 years old. The method can comprise determining whether or not the human has at least one minor rs613872 allele.
In another aspect, this document features a method for screening an eye tissue donor. The method comprises, or consists essentially of, (a) performing an amplification reaction using a nucleic acid sample of the donor and a primer pair configured to amplify nucleic acid comprising an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid to obtain an amplification product, (b) detecting the presence or absence of the expanded TGC trinucleotide repeat within the
amplification product, (c) classifying the human as being an acceptable eye tissue donor if the expanded TGC trinucleotide repeat is absent from the amplification product, and (d) classifying the human as being an unacceptable eye tissue donor if the expanded TGC trinucleotide repeat is present is the amplification product. The detecting step can comprise using gel electrophoresis to detect the presence or absence of a band indicative of the presence of an expanded TGC repeat in the amplification product. The expanded TGC trinucleotide repeat can comprise greater than 37 TGC repeats. The expanded TGC trinucleotide repeat can comprise greater than 52 TGC repeats. The human can be less than 40 years old. The method can comprise determining whether or not the human has at least one minor rs613872 allele. The method can comprise detecting the presence of the expanded TGC trinucleotide repeat within the amplification product. The method can comprise detecting the absence of the expanded TGC trinucleotide repeat within the amplification product.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In
case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
The details of one or more embodiments of the invention are set forth in the accompanying drawings and the description below. Other features, objects, and advantages of the invention will be apparent from the description and drawings, and from the claims.
DETAILED DESCRIPTION
This document provides methods and materials for assessing the likelihood of a human to develop FCD. For example, this document provides methods and materials for using the presence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid to identify humans having an elevated risk of developing FCD. In some cases, the presence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid for an allele can be used to identify humans having the minor allele of rs613872 on that allele.
Any appropriate type of sample containing a human's nucleic acid can be used to determine the human's genotype and whether or not that human contains an expanded TGC repeat within intron 3 of TCF4 nucleic acid. For example, cells such as white blood cells or skin cells can be collected and assessed for the presence or absence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid or a minor or major allele of rs613872. In some cases, a biopsy (e.g., punch biopsy, aspiration biopsy, excision biopsy, needle biopsy, or shave biopsy), tissue section, lymph fluid sample, blood sample, or synovial fluid sample can be used.
Any appropriate method can be used to determine whether or not an expanded
TGC repeat within intron 3 of TCF4 nucleic acid is present within a human's genome. For example, nucleic acid amplification reactions (e.g., PCR), gel electrophoresis techniques, DNA or RNA sequencing techniques, nucleic acid hybridization techniques (e.g., "Southern" blotting), or genotyping techniques can be performed to detect the presence or absence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid.
The term "expanded" as used herein with respect to a TGC repeat within intron 3 of TCF4 nucleic acid refers to those repeats that are longer than 37 repeats. In general, TGC repeats within intron 3 of TCF4 nucleic acid that are 37 or less in
number are not considered to be expanded. In some cases, a repeat length that is between 37 and 52 may be associated with FCD, while those longer than 52 repeats can be strongly predictive of FCD.
The sequence of human TCF4 nucleic acid is set forth in GenBank Accession No. NC_000018 as it is present on chromosome 18. The following sequence is the sequence for intron 3 of TCF4 with the location of the TGC site underlined: 5'-GTA- AGAAAGAACGGTGGAAACTAACAACAGCTGTGAAAAAAACAAAACAAAA ACCCAAACACTTCAGCTAGAAACCAGTAGGAATCTAAAGGACAGTAATAA TTTTTAATTGGCTGAATCCTTGGTAAATATGAAGGTCTTTTTGACAAGTTTT TAACTATAATTTTGTGGTGTGATGGAAGATTCAGGCTTTTTTTTTTTTTTGA GTTTTATTACTGGCCTTCAATTCCCTACCCACTGATTACCCCAAATAATGG AATCTCACCCCAGTGGAAAGCAAAAATAGACACCCCTAAAACTAAACCAC CCCTAAAACTTGGCCATGTCTGAACACTGAGACTACTAATACTTTGCACAC TACTCTTCGTTTTATTTATTGTTTTTGGAAATGGAAAATAGAAAATAGGAG ACCCAGTTGTCTCTTTAAAGTTTTAAGCTAATGATGCTTTGGATTGGTAGG ACCTGTTCCTTACATCTTACCTCCTAGTTACATCTTTTCCTAGGATTCTTAA AACTAGTATGGATATGCTGAGCATACATTCTTTAGAACCTTTTGGACTGTT TTGGTAAATTTCGTAGTCGTAGGATCAGCACAAAGCGGAACTTGACACAC TTGTGGAGTTTTACGGCTGTACTTGGTCCTTCTCCATCCCTTTGCTTCCTTT TCCTAAACCAAGTCCCAGACATGTCAGGAGAATGAATTCATTTTTAATGCC AGATGAGTTTGGTGTAAGATGCATTTGTAAAGCAAAATAAAAAGAATCCA CAAAACACACAAATAAAATCCAAACCGCCTTCCAAGTGGGGCTCTTTCAT GCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC TGCTGCTGCTGCTGCTGCTGCTGCTGCTCCTCCTCCTCCTCCTCCTTCTC CTCCTCCTCCTCCTCTTCTAGACCTTCTTTTGGAGAAATGGCTTTCGGAAGT TTTGCCAGGAAACGTAGCCCTAGGCAGGCAGCTTTGCAGCCCCCTTTCTGC TTGTTGCACTTTCTCCATTCGTTCCTTTGCTTTTTGCAGGCTCTGACTCAGG GAAGGTGTGCATTATCCACTAGATACGTCGAAGAAGAGGGAAACCAATTA GGGTCGAAATAAATGCTGGAGAGAGAGGGAGTGAAAGAGAGAGTGAGAG TGAGAGAGAGAGAGAGTCTTGCTTCAAATTGCTCTCCTGTTAGAGACGAA ATGAGAATTTAGTGCAGGTGGCACTTTTATTTTTATTTGGGTTCACATATG ACAGGCAAATCCTATACGAGATGGAAATGGACATTGCCACGTTTATGGCC AAGGTTTTCAATATAAAACAAAACAACTTTTTTCTTCTCCTTGGTGAAACT AGTGTTTTTCTAGAGAGGCTGCTGGCCTCCAACCTGAATCTTGATAACATT
ATGGGGACTGTGTTTGTTCCAAATGTAGCAGTAGTACTGCTTGGCCATCTA ATGAACCTGAGGAAAAAGAAAGAACAGAGTGATAATGGGGGCTGGGGTG GGATCTGTAATGTTGTTTCTCTTTTAGTTTTAAGTTGGATGGTGATGTATTT TACTAAATAAACCCTTAGCATAAACTCTAAGCTGTTTGGTAACAGTATGA AAGATCTTTGAGGAGCTCTGAAGGCACAAGTGTCTTCTTTTCAACTGTAAT ATTTCTTTGTTTCTTTTAG-3 ' (SEQ ID NO: l).
The methods and materials provided herein can be used at any time during a human's life to determine whether or not the human is susceptible to developing FCD. In some cases, the methods and materials provided herein can be used to assess a human infant, child, teenager, young adult (e.g., less than 25, 30, or 40 years old), or an adult over the age of about 40, 50, or 60. For example, a sample can be obtained from a human between about 20 to about 50 years of age (e.g., between about 20 to about 45, between about 20 to about 40, between about 25 to about 45, or between about 25 to about 40 years of age). Once obtained, the sample can be evaluated to determine if the human contains an expanded TGC repeat within intron 3 of TCF4 nucleic acid. If the human contains an expanded TGC repeat within intron 3 of TCF4 nucleic acid, then that human can be classified as having an elevated risk of developing FCD.
In some cases, the methods and materials provided herein can be used to determine whether or not it is advisable for a human to undergo an eye procedure. For example, a sample can be obtained from a human considering undergoing an eye procedure. Examples of eye procedures include, without limitation, intra-ocular surgeries, LASIK surgeries, photo-refractive keratectomy surgeries, laser refractive surgeries, thermokeratoplasty, and conductive keratoplasty. Once obtained, the sample can be evaluated to determine if the human contains an expanded TGC repeat within intron 3 of TCF4 nucleic acid. If the human contains an expanded TGC repeat within intron 3 of TCF4 nucleic acid, then that human can be advised to not undergo the considered eye procedure. If the human does not contain an expanded TGC repeat within intron 3 of TCF4 nucleic acid, then that human can be advised to undergo the considered eye procedure.
In some cases, the methods and materials provided herein can be used to screen eye tissue donors. For example, a sample can be obtained from a potential human eye tissue donor. Once obtained, the sample can be evaluated to determine if the potential donor contains an expanded TGC repeat within intron 3 of TCF4 nucleic
acid. If the potential donor contains an expanded TGC repeat within intron 3 of TCF4 nucleic acid, then an eye tissue bank can elect to decline to accept eye tissue from that potential donor. If the potential donor does not contain an expanded TGC repeat within intron 3 of TCF4 nucleic acid, then an eye tissue bank can elect to accept eye tissue from that potential donor.
This document also provides kits that can be used to assess a mammal for the presence or absence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid. For example, reagents used to determine the presence or absence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid in a nucleic acid sample can be combined as an article of manufacture such as a kit. In some cases, a kit can contain reagents for performing an amplification reaction of nucleic acid that includes the site of the TGC repeat within intron 3 of TCF4 nucleic acid such as primer pairs and
polymerases (e.g., polymerases adapted or selected for PCR). For example, one primer can be designed to have a sequence that hybridizes to a sequence upstream of the underlined TGC repeat region set forth above for SEQ ID NO: 1, and another primer can be designed to have a sequence that hybridizes to a sequence on the opposite strand that is downstream of the underlined TGC repeat region set forth above for SEQ ID NO: 1. Such primers can be spaced apart such that a PCR product using such primers includes the site of the TGC repeat within intron 3 of TCF4 nucleic acid.
In some cases, a kit provided herein can include buffers, nucleotides, positive control samples (e.g., a nucleic acid sample containing a known number of TGC repeats within intron 3 of TCF4 nucleic acid), or combinations thereof. The reagents within a kit can be housed together in various combinations or can be packaged in separate vials or containers. The kits provided herein also can include labels or packaging inserts setting out instructions for preparation and use. For example, a kit can contain a packaging insert describing that the reagents can be used to assess a mammal for the presence or absence of an expanded TGC repeat within intron 3 of TCF4 nucleic acid or can be used to assess a mammal (e.g., a human) for the likelihood of developing FCD.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1 - Association between expanded trinucleotide repeats in TCF4 and FCD The presence of the minor allele of rs613872 is associated with FCD as described elsewhere (Baratz et al, N. Eng. J. Med., 363 : 1016-1024 (2010)). The following was performed to determine whether the presence of an expanded TGC trinucleotide repeat in intron 3 of TCF4 is associated with FCD.
Genomic DNA obtained from ten patients with Krachmer grade 6 FCD and from ten human subjects with normal corneas was examined. Briefly, polymerase chain reactions were designed to amplify the TGC trinucleotide repeat region of intron 3 of TCF4. The forward primer was designed to have the following sequence: 5 '-CAGATGAGTTTGGTGTAAGATG-3 ' (SEQ ID NO:2). The reverse primer was designed to have the following sequence: 5 ' -ACAAGCAGAAAGGGGGCTGCAA- 3 ' (SEQ ID NO:3).
All ten subjects with normal corneas were homozygous for the major allele in rs613872 and contained DNA that yielded PCR products indicating the presence of less than 30 TGC repeats. Nine of the ten FCD patients were heterozygous for the minor allele in rs613872, and all nine of these patients contained DNA that yielded PCR products indicating the presence of more than 50 TGC repeats in one allele and less than 20 repeats in the other allele. In one subject, who was homozygous for the minor rs613872 allele, the DNA yielded only products with more than 75 TGC repeats, indicating the presence of two copies of an expanded TGC repeat. The initial agarose gel electrophoresis analysis in these samples was confirmed by fragment size analysis using a fluorescently labeled primer and DNA sequencing studies.
In additional studies, a few cases were identified where the TGC repeats and the rs613872 status did not agree. For these cases, the TGC repeat status appeared to agree with FCD status better than the minor allele in rs613872. In addition, one case was identified with a clear TGC repeat expansion in a human not currently diagnosed with FCD, thereby indicating that this human has an increased likelihood of developing FCD.
Taken together, these results demonstrate that the presence of an expanded
TGC trinucleotide repeat in intron 3 of TCF4 segregated with the FCD phenotype. Thus, these results indicate that the presence of an expanded TGC trinucleotide repeat in intron 3 of TCF4 can be used to identify humans having an increased likelihood of developing FCD.
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. A method for identifying a human as having an elevated likelihood of developing Fuchs' corneal dystrophy, wherein said method comprises:
(a) detecting the presence of an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid, and
(b) classifying said human as having said elevated likelihood of developing Fuchs' corneal dystrophy based at least in part on said presence.
2. The method of claim 1, wherein said detecting step comprises performing a polymerase chain reaction.
3. The method of claim 1, wherein said detecting step comprises using gel electrophoresis to detect the presence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid.
4. The method of claim 1, wherein said expanded TGC trinucleotide repeat comprises greater than 37 TGC repeats.
5. The method of claim 1, wherein said expanded TGC trinucleotide repeat comprises greater than 52 TGC repeats.
6. The method of claim 1, wherein said expanded TGC trinucleotide repeat comprises greater than 55 TGC repeats.
7. The method of claim 1, wherein said expanded TGC trinucleotide repeat comprises greater than 60 TGC repeats.
8. The method of claim 1, wherein said expanded TGC trinucleotide repeat comprises greater than 70 TGC repeats.
9. The method of claim 1, wherein said human is less than 40 years old.
10. The method of claim 1, wherein said method comprises determining whether or not said human has at least one minor rs613872 allele.
1 1. A method for determining whether or not it is advisable for a human to undergo an eye procedure, wherein said method comprises determining whether or not said human contains an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid, wherein the presence of said expanded TGC trinucleotide repeat indicates that it is not advisable for said human to undergo said eye procedure, and wherein the absence of said expanded TGC trinucleotide repeat indicates that it is advisable for said human to undergo said eye procedure.
12. The method of claim 11, wherein said determining step comprises performing a polymerase chain reaction.
13. The method of claim 11, wherein said determining step comprises using gel electrophoresis to detect the presence or absence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid.
14. The method of claim 11, wherein said expanded TGC trinucleotide repeat comprises greater than 37 TGC repeats.
15. The method of claim 11, wherein said expanded TGC trinucleotide repeat comprises greater than 52 TGC repeats.
16. The method of claim 11 , wherein said eye procedure is an intra-ocular surgery, LASIK, a photo-refractive keratectomy, or a laser refractive surgery.
17. The method of claim 11, wherein said method comprises detecting the presence of said expanded TGC trinucleotide repeat.
18. The method of claim 11, wherein said method comprises detecting the absence of said expanded TGC trinucleotide repeat.
19. The method of claim 11, wherein said human is less than 40 years old.
20. The method of claim 1 1, wherein said method comprises determining whether or not said human has at least one minor rs613872 allele.
21. A method for identifying a human who should avoid undergoing an eye procedure, wherein said method comprises:
(a) detecting the presence of an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid, and
(b) classifying said human as being a human who should avoid undergoing said eye procedure based at least in part on said presence.
22. The method of claim 21, wherein said detecting step comprises performing a polymerase chain reaction.
23. The method of claim 21, wherein said detecting step comprises using gel electrophoresis to detect the presence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid.
24. The method of claim 21 , wherein said expanded TGC trinucleotide repeat comprises greater than 37 TGC repeats.
25. The method of claim 21, wherein said expanded TGC trinucleotide repeat comprises greater than 52 TGC repeats.
26. The method of claim 21, wherein said eye procedure is an intra-ocular surgery, LASIK, a photo-refractive keratectomy, or a laser refractive surgery.
27. The method of claim 21, wherein said human is less than 40 years old.
28. The method of claim 21, wherein said method comprises determining whether or not said human has at least one minor rs613872 allele.
29. A method for screening an eye tissue donor, wherein said method comprises:
(a) determining whether or not a human contains an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid,
(b) classifying said human as being an acceptable eye tissue donor if said human lacks said expanded TGC trinucleotide repeat, and
(c) classifying said human as being an unacceptable eye tissue donor if said human contains said expanded TGC trinucleotide repeat.
30. The method of claim 29, wherein said determining step comprises performing a polymerase chain reaction.
31. The method of claim 29, wherein said determining step comprises using gel electrophoresis to detect the presence or absence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid.
32. The method of claim 29, wherein said expanded TGC trinucleotide repeat comprises greater than 37 TGC repeats.
33. The method of claim 29, wherein said expanded TGC trinucleotide repeat comprises greater than 52 TGC repeats.
34. The method of claim 29, wherein said human is less than 40 years old.
35. The method of claim 29, wherein said method comprises determining whether or not said human has at least one minor rs613872 allele.
36. The method of claim 29, wherein said method comprises detecting the presence of said expanded TGC trinucleotide repeat.
37. The method of claim 29, wherein said method comprises detecting the absence of said expanded TGC trinucleotide repeat.
38. A method for identifying a human as having an elevated likelihood of developing Fuchs' corneal dystrophy, wherein said method comprises: (a) performing an amplification reaction using a nucleic acid sample of said human and a primer pair configured to amplify nucleic acid comprising an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid to obtain an amplification product,
(b) detecting the presence of said expanded TGC trinucleotide repeat within said amplification product, and
(c) classifying said human as having said elevated likelihood of developing Fuchs' corneal dystrophy based at least in part on said presence.
39. The method of claim 38, wherein said detecting step comprises using gel electrophoresis to detect the presence of a band indicative of the presence of an expanded TGC repeat in said amplification product.
40. The method of claim 38, wherein said expanded TGC trinucleotide repeat comprises greater than 37 TGC repeats.
41. The method of claim 38, wherein said expanded TGC trinucleotide repeat comprises greater than 52 TGC repeats.
42. The method of claim 38, wherein said expanded TGC trinucleotide repeat comprises greater than 55 TGC repeats.
43. The method of claim 38, wherein said expanded TGC trinucleotide repeat comprises greater than 60 TGC repeats.
44. The method of claim 38, wherein said expanded TGC trinucleotide repeat comprises greater than 70 TGC repeats.
45. The method of claim 38, wherein said human is less than 40 years old.
46. The method of claim 38, wherein said method comprises determining whether or not said human has at least one minor rs613872 allele.
47. A method for determining whether or not it is advisable for a human to undergo an eye procedure, wherein said method comprises:
(a) performing an amplification reaction using a nucleic acid sample of said human and a primer pair configured to amplify nucleic acid comprising an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid to obtain an amplification product,
(b) detecting the presence or absence of said expanded TGC trinucleotide repeat within said amplification product, and
(c) classifying said eye procedure as not being advisable for said human if said expanded TGC trinucleotide repeat is present within said amplification product, and classifying said eye procedure as being advisable for said human if said expanded TGC trinucleotide repeat is absent from said amplification product.
48. The method of claim 47, wherein said detecting step comprises using gel electrophoresis to detect the presence or absence of a band indicative of the presence of an expanded TGC repeat in a copy of TCF4 nucleic acid.
49. The method of claim 47, wherein said expanded TGC trinucleotide repeat comprises greater than 37 TGC repeats.
50. The method of claim 47, wherein said expanded TGC trinucleotide repeat comprises greater than 52 TGC repeats.
51. The method of claim 47, wherein said eye procedure is an intra-ocular surgery, LASIK, a photo-refractive keratectomy, or a laser refractive surgery.
52. The method of claim 47, wherein said method comprises detecting the presence of said expanded TGC trinucleotide repeat within said amplification product.
53. The method of claim 47, wherein said method comprises detecting the absence of said expanded TGC trinucleotide repeat within said amplification product.
54. The method of claim 47, wherein said human is less than 40 years old.
55. The method of claim 47, wherein said method comprises determining whether or not said human has at least one minor rs613872 allele.
56. A method for screening an eye tissue donor, wherein said method comprises:
(a) performing an amplification reaction using a nucleic acid sample of said donor and a primer pair configured to amplify nucleic acid comprising an expanded TGC trinucleotide repeat in intron 3 of TCF4 nucleic acid to obtain an amplification product,
(b) detecting the presence or absence of said expanded TGC trinucleotide repeat within said amplification product,
(c) classifying said human as being an acceptable eye tissue donor if said expanded TGC trinucleotide repeat is absent from said amplification product, and
(d) classifying said human as being an unacceptable eye tissue donor if said expanded TGC trinucleotide repeat is present is said amplification product.
57. The method of claim 56, wherein said detecting step comprises using gel electrophoresis to detect the presence or absence of a band indicative of the presence of an expanded TGC repeat in said amplification product.
58. The method of claim 56, wherein said expanded TGC trinucleotide repeat comprises greater than 37 TGC repeats.
59. The method of claim 56, wherein said expanded TGC trinucleotide repeat comprises greater than 52 TGC repeats.
60. The method of claim 56, wherein said human is less than 40 years old.
61. The method of claim 56, wherein said method comprises determining whether or not said human has at least one minor rs613872 allele.
62. The method of claim 56, wherein said method comprises detecting the presence of said expanded TGC trinucleotide repeat within said amplification product. The method of claim 56, wherein said method comprises detecting the absence expanded TGC trinucleotide repeat within said amplification product.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161581889P | 2011-12-30 | 2011-12-30 | |
| US61/581,889 | 2011-12-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013101711A1 true WO2013101711A1 (en) | 2013-07-04 |
Family
ID=48698563
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/071165 WO2013101711A1 (en) | 2011-12-30 | 2012-12-21 | Assessing likelihood of developing fuchs' corneal dystrophy |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2013101711A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017060317A1 (en) * | 2015-10-05 | 2017-04-13 | Proqr Therapeutics Ii B.V. | Use of single-stranded antisense oligonucleotide in prevention or treatment of genetic diseases involving a trinucleotide repeat expansion |
| US20190142972A1 (en) * | 2016-04-22 | 2019-05-16 | Intellia Therapeutics, Inc. | Compositions and Methods for Treatment of Diseases Associated with Trinucleotide Repeats in Transcription Factor Four |
-
2012
- 2012-12-21 WO PCT/US2012/071165 patent/WO2013101711A1/en active Application Filing
Non-Patent Citations (5)
| Title |
|---|
| DATABASE PUBMED accession no. 7417937 * |
| LI Y.J. ET AL. ET AL.: "Replication of TCF4 through association and linkage studies in late- onset Fuchs endothelial corneal dystrophy", PLOS ONE, vol. 6, no. 4, 20 April 2011 (2011-04-20), pages 1 - 8, XP055075339 * |
| ORR H.T. ET AL. ET AL.: "Trinucleotide repeat disorders", ANNU REV NEUROSCI, vol. 30, 2007, pages 575 - 621, XP055075340 * |
| RIAZUDDIN S.A. ET AL.: "Replication of the TCF4 Intronic Variant in Late-Onset Fuchs Corneal Dystrophy and Evidence of Independence from the FECD2 Locus", INVESTIGATIVE OPHTHALMOLOGY & VISUAL SCIENCE, vol. 52, no. 5, April 2011 (2011-04-01), pages 2825 - 2829 * |
| WIEBEN E.D. ET AL.: "A Common Trinucleotide Repeat Expansion within the Transcription Factor 4 (TCF4, E2-2) Gene Predicts Fuchs Corneal Dystrophy", PLOS ONE, vol. 7, no. 11, 21 November 2012 (2012-11-21), pages E49083, XP055075341 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017060317A1 (en) * | 2015-10-05 | 2017-04-13 | Proqr Therapeutics Ii B.V. | Use of single-stranded antisense oligonucleotide in prevention or treatment of genetic diseases involving a trinucleotide repeat expansion |
| CN108291225A (en) * | 2015-10-05 | 2018-07-17 | ProQR治疗上市公司Ⅱ | The purposes being related in the genetic disease of trinucleotide repeat disease is being prevented or treated to single stranded antisense oligonucleotides |
| JP2018533975A (en) * | 2015-10-05 | 2018-11-22 | プロキューアール セラピューティクス ツー ベスローテン フェンノートシャップ | Use of single-stranded antisense oligonucleotides in the prevention or treatment of genetic diseases involving trinucleotide repeat extension |
| US10760076B2 (en) | 2015-10-05 | 2020-09-01 | Proqr Therapeutics Ii B.V. | Use of single-stranded antisense oligonucleotide in prevention or treatment of genetic diseases involving a trinucleotide repeat expansion |
| AU2016335032B2 (en) * | 2015-10-05 | 2022-04-14 | Proqr Therapeutics Ii B.V. | Use of single-stranded antisense oligonucleotide in prevention or treatment of genetic diseases involving a trinucleotide repeat expansion |
| JP7089763B2 (en) | 2015-10-05 | 2022-06-23 | プロキューアール セラピューティクス ツー ベスローテン フェンノートシャップ | Use of single-stranded antisense oligonucleotides in the prevention or treatment of genetic disorders involving trinucleotide repeat elongation |
| CN108291225B (en) * | 2015-10-05 | 2022-07-12 | ProQR治疗上市公司Ⅱ | Use of single-stranded antisense oligonucleotides for preventing or treating genetic diseases involving repeated amplification of trinucleotide |
| US20190142972A1 (en) * | 2016-04-22 | 2019-05-16 | Intellia Therapeutics, Inc. | Compositions and Methods for Treatment of Diseases Associated with Trinucleotide Repeats in Transcription Factor Four |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gillespie et al. | Personalized diagnosis and management of congenital cataract by next-generation sequencing | |
| Pasutto et al. | Variants in ASB10 are associated with open-angle glaucoma | |
| Schmid et al. | U1 snRNA‐mediated gene therapeutic correction of splice defects caused by an exceptionally mild BBS mutation | |
| Miyamoto et al. | Identification of a novel splice site mutation of the CSPG2 gene in a Japanese family with Wagner syndrome | |
| Garcia et al. | Comparative study of limbal stem cell deficiency diagnosis methods: detection of MUC5AC mRNA and goblet cells in corneal epithelium | |
| Bykhovskaya et al. | Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus | |
| Farzadfard et al. | Screening for MIR184 mutations in Iranian patients with keratoconus | |
| Gupta et al. | Association of ZEB1 and TCF4 rs613872 changes with late onset Fuchs endothelial corneal dystrophy in patients from northern India | |
| Skorodumova et al. | CTG18. 1 expansion is the best classifier of late-onset Fuchs' corneal dystrophy among 10 biomarkers in a cohort from the European part of Russia | |
| US20200190587A1 (en) | Methods for Detecting Alleles Associated with Keratoconus | |
| Paliwal et al. | Congenital hereditary endothelial dystrophy-mutation analysis of SLC4A11 and genotype-phenotype correlation in a North Indian patient cohort | |
| KR102495060B1 (en) | Biomarkers for diagnosis and prognosis of corneal ectasia | |
| Vincent et al. | Phenotypic characterisation and ZEB1 mutational analysis in posterior polymorphous corneal dystrophy in a New Zealand population | |
| Bykhovskaya et al. | TSC1 mutations in keratoconus patients with or without tuberous sclerosis | |
| WO2013101711A1 (en) | Assessing likelihood of developing fuchs' corneal dystrophy | |
| US20060024688A1 (en) | Alterations of fibulin genes in macular degeneration | |
| Lagona et al. | Skin biopsy for the diagnosis of Alport syndrome | |
| US10822657B2 (en) | Method for successful retrieval of sperm | |
| CN115896141A (en) | Application of PRSS56 protein expression and enzyme activity regulation in myopia treatment | |
| CN114836530A (en) | Application of FKBP5 gene mutation site in early screening and diagnosis of high myopia | |
| Vatti et al. | A cohort study of multiple families with FBN1 p. R650C variant, ectopia lentis, and low but not absent risk for aortopathy | |
| Liu et al. | The role of lysyl oxidase-like 1 DNA copy number variants in exfoliation glaucoma | |
| Siddiqui | Genetic analysis of corneal dystrophies | |
| Muthusamy | Genotype-phenotype correlations in Fuchs corneal endothelial dystrophy | |
| Vincent et al. | Exclusion of known corneal dystrophy genes in an autosomal dominant pedigree of a unique anterior membrane corneal dystrophy |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12863248 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12863248 Country of ref document: EP Kind code of ref document: A1 |