WO2013093170A1 - Methods and compositions for determining the diversity of the t-lymphocyte repertoire of an individual - Google Patents

Abstract

The present invention relates to the field of biotechnology. Specifically, the invention relates to a method for determining the diversity of the T-lymphocyte repertoire of an individual. The invention also relates to a method for monitoring the progress of a disease in a patient in response to a treatment. Likewise, the invention also relates to compositions for carrying out said method, which include a plurality of sense primers, which hybridise specifically with a V gene segment that encodes a β chain of the TCR, and an antisense primer marked with a first detectable tag, which hybridises specifically with the C gene segment that encodes the β chain of the TCR and a second antisense primer that hybridises specifically with the same region as the first antisense primer and is marked with a second detectable tag.

Description

 METHODS AND COMPOSITIONS FOR THE DETERMINATION OF THE DIVERSITY OF THE REPERTORY OF LYMPHOCYTES OF AN INDIVIDUAL

FIELD OF THE INVENTION

The invention relates to a method for determining the diversity of the repertoire of T lymphocytes of an individual, as well as to compositions for carrying out said method. BACKGROUND OF THE INVENTION

The T-cell receptor (TCR) is the molecule that is involved in antigen recognition and that gives these cells their ability to discriminate. The variability in the TCR chains is centralized in the binding region of the antigenic peptide, which is encoded by the gene segments V and J in the α chain, or V, D and J in the β chain. During the somatic recombination process the structural diversity of the TCR repertoire is generated, which is further increased by deletion in said segments and by insertion of non-germinal nucleotides. The resulting gene regions code for the CDR3 loops, which will be of varying length and that form the center of the antigen binding site. TCRs, unlike immunoglobulins, do not suffer somatic hypermutation and, therefore, all diversity is concentrated in CDR3.

Disturbances in the repertoire of TCR have been observed in subjects infected with HIV-1, possibly reflecting responses of cytotoxic T lymphocytes (in English cytotoxic T lymphocyte, CTL) energetic but not completely effective, mainly composed of CD8 T cells resulting from a oligoclonal expansion that share common antigenic determinants. These disturbances frequently occur either by clonal expansion of T cells or by deletion in one or more families of νβ. Multiple or persistent clonal expansions of CD8 T cells have been observed in individuals with chronic or progressive HIV-1 infections. HIV-1 infection induces disturbances in the repertoire of peripheral T-cell receptors during primary infection. It has been postulated that disturbances are due to clonal expansion and depletion of HIV-1-specific T cell clones during initial viremia after acute infection (Pantaleo et al, 1994, Nature 370: 463-7). Although there is controversy in this regard, some studies have observed that an effective antiretroviral therapy does not completely reconstitute the repertoire of T cells that has been disturbed (Yin et al., 2008, Clin Vaccine Immunol 2009; 1293-1301; Yin et al., 2008 , J. Allergy Clin. Immunol 122: 166-72). Epitope-specific responses are the sum of individual responding clones of T cells and a repertoire of structurally diverse TCRs is likely necessary for optimal elimination of viremia in infections capable of rapidly developing escape mutations. A varied matrix of TCRs could reduce the likelihood of CTL escape due to cross recognition of mutated epitopes and is more likely to contain high affinity T cell clones capable of recognizing specific epitopes efficiently and, therefore, mediate Better control of virus replication.

Oligoclonal expansions and deletions within subpopulations of T cells can be measured by analysis of the CDR3 hypervariable region of the TCR (Raaphorst et al., 2002, Hum. Immunol. 63: 51-60). Variation in CDR3 length reflects changes in the TCRVP repertoire during HIV-1 infection

The variation in the length of the CDR3 is the basis of the spectratypin ^ technique where said region is amplified and the distribution of the different lengths is an indicator of the variety of the TCR repertoire. This technique is useful to detect clonal expansions in response to certain pathological situations, such as with tumor-infiltrated T cells (Puisieux et al, 1994, J. Immunol. 153: 2807-2818), or to analyze variations that may occur in the repertoire during the course of certain diseases, such as immunodeficiencies or autoimmune diseases. A difficulty associated with this technique is the high number of necessary reactions and a complicated interpretation of the results. In Monteiro et al. (Monteiro et al, 1995, Mol. Med. 1: 614-624) describes a method of spectratyping the CDR3 of the TCR by PCR in multiplex format consisting of 26 primers specific for the families of νβ genes and a specific primer for CP constant region, this one radiolabelled. The combination of 2 or 3 primers of νβ genes with the CP primer in a single tube allows the analysis of the 26 families of νβ genes in 12 PCR reactions. In a different approach, the use of 27 primers specific for the families of νβ genes and a specific primer for the CP constant region labeled with a fluorochrome, makes the PCR reactions carried out individually for each family of Vp genes (Chen et al, 2005, Blood 105: 886-93).

In US 2007/0117134 a method for detecting clonal expansions of T lymphocytes from genomic DNA is described. It is based on the use of 118 unique, highly specific and non-overlapping primers, which include 22 specific primers for νβ regions, 13 specific primers for Ιβ and CP regions, and nested primers for both human and murine TCR genes.

A method of analyzing the diversity of the repertoire of T and / or B lymphocytes by multiplex PCR is described in US 2011/0003291. The total number of primers defined is 119, which are specific for regions of the V or D genes, and J, so that they allow the detection of V (D) J or D-J rearrangements.

In order to reduce the number of PCR reactions, Fernandes et al. they developed a system for spectratyping by multiplex PCR for the evaluation of the repertoire of the β chain of the TCR (Fernandes et al, 2005, Clin. Diagn. Lab. Immunol.

12: 477-83). Its system consists of 24 specific primers for each of the genes of the most important νβ variable regions, which are labeled with a fluorochrome

(chosen from three fluorochromes), and a specific primer for the unlabeled Cβ constant region. This method offers the advantage of reducing the number of reactions of

PCR at 7, of the 12 required with the method using the labeled Cβ primer

(Monteiro et al, supra.). There is, therefore, in the art the need for methods and compositions that allow reducing the number of reactions necessary for the evaluation of the T lymphocyte repertoire and the interpretation of the results.

SUMMARY OF THE INVENTION

In one aspect, the invention relates to a composition or kit for analyzing the repertoire of T cells in a sample comprising:

 (i) a plurality of sense primers, where each of said primers specifically hybridizes with segment V of a gene encoding a β chain of the TCR,

 (ii) a first antisense primer labeled with a first detectable label, wherein said hybrid primer specifically with segment C of the gene encoding the β chain of the TCR and,

 (iii) a second antisense primer that hybridizes specifically with the same region as primer (ii), which is labeled with a second detectable label. In another aspect, the invention relates to a method for analyzing the repertoire of T cells in a sample comprising the steps of

 (i) amplifying a cDNA preparation obtained from RNA isolated from said sample using a multiplicity of sense primers, where each of said primers specifically hybridizes with the V segment of the gene encoding the TCR β chain and two antisense primers that specifically hybridize with the CP constant region of the TCR where each of said sense primers is marked with a distinct detectable label, and

(ii) analyze the number of amplification products obtained in the previous stage. In another aspect, the invention relates to the use of the composition or kit, or of the method of the above aspects in the diagnosis of a pathology.

In a final aspect, the invention relates to a method for monitoring the evolution of a pathology in a patient in response to a treatment comprising determining the complexity of the repertoire of T cells in a sample of said patient after being subjected to said treatment, where an increase in the complexity of said repertoire with respect to complexity before starting treatment is indicative that the patient responds to said treatment.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 describes the expression ratios of each of the TCRVP families at different points in time. Families with a significantly disturbed expression rate at the time of treatment discontinuation are highlighted.

Figure 2 describes the proportion of the expression of disturbed families of TCRVP. (A) The expression of TCRVplO, TCRVpl4 and TCRVpl5 was increased at the time of treatment discontinuation, and (B) the expression of TCRVP20, TCRVP28 and TCRVP29 was decreased. Black lines represent average values.

Figure 3 describes the proportion of the expression of families of TCRVP disturbed according to the time of antiretroviral treatment. Empty tables, patients with <100 months of antiretroviral treatment; full pictures, patients with> 100 months of antiretroviral treatment. Black lines represent average values.

Figure 4 describes the proportion, cell activation and apoptosis levels of Vpl4, Vp20 and Vp2 cells.

Figure 5 describes recent recent thymus migration cells and memory effector cells of Υβ14, Υβ20 and Υβ2 cells. DETAILED DESCRIPTION OF THE INVENTION

The inventors have developed a new CDR3 spectratyping technique to simplify the study of the νβ repertoire of T cells. This technique is a new approach to the study of the cell repertoire in the first place due to the original design of a group of primers that amplify the sequences representative of the wide cellular repertoire, unlike previous works that focused their analysis in other regions of the TCRp. The design of the test that facilitates and simplifies both the obtaining of the data is also novel, thanks to the different size ranges of the amplification products and the two markers used, which allows the products to be summarized in only three PCR reactions in format multiplex, as well as the interpretation of the same without the need to amplify internal controls to which to refer the results as in previous works.

Compositions or kits to analyze the repertoire of T cells

In a first aspect, the invention relates to a composition or kit for analyzing the repertoire of T cells in a sample, hereinafter composition or kit of the invention, comprising

 (i) a plurality of sense primers, where each of said primers is specifically hybridized with segment V of a gene encoding a β chain of the TCR,

 (ü) a first antisense primer labeled with a first detectable label, wherein said hybrid primer specifically with segment C of the gene encoding the β chain of the TCR and

(iii) a second antisense primer that hybridizes specifically with the same region as primer (ii), which is labeled with a second detectable label. As used in the present invention, the term "T cell" or "T lymphocyte" refers to those leukocytes that have ovoid-shaped nuclei that occupy most of the intracellular space. T lymphocytes are responsible for coordinating the cellular immune response, making up 70% of the total lymphocytes that secrete proteins or cytokines. They also deal with the cooperation to develop all forms of immune responses, such as the production of antibodies by B lymphocytes. They differ from B lymphocytes and killer cells (natural killer or K) by having a special receptor in the membrane surface, the T cell receptor (called TCR by T cell receptor). They express in turn the co-receptor of CD3 T lymphocytes, which is associated with TCR to generate the activation signal in the T lymphocyte. However, in a microscopic blood smear it is not possible to distinguish T lymphocytes from B to simple sight

T lymphocytes that can be analyzed according to the present invention include, without limitation, the following subtypes:

 • "Cooperative T lymphocytes" or "helper T cells (Th)", also called "CD4 + lymphocytes" for expressing the surface CD4 marker. They are responsible for initiating the cascade of the coordinated immune response by interacting with the "peptide-CMH-Π" complex, which is expressed on the surface of antigen presenting cells. When activated, CD4 + lymphocytes specialize, differentiating themselves into effector lymphocytes, which are distinguished by the type of cytokines they produce:

 - Thl, which migrate to infected tissues and assist in the activation of macrophages, since Thl fundamentally secrete γ interferon; Thl are important in defense against intracellular microbes and inflammation;

- Th2, which remain primarily in lymphoid tissues and assist in the activation of B lymphocytes; mainly secrete IL-4 (which stimulates the secretion of IgE, which in turn activates mast cells) and IL-5 (which activates eosinophils); Th2 are important in allergic reactions and in defense against parasites; - Thl 7, so named because they secrete IL-17, in addition to IL-22; They are the main mediators in some allergic reactions, and appear to be involved in the development of diseases such as multiple sclerosis, rheumatoid arthritis and inflammatory bowel disease.

The differentiation in Thl, Th2 or Thl7 is not random, but depends on the stimuli received by the virgin T4 lymphocyte when it contacts a foreign antigen.

"Cytotoxic T lymphocytes" (CTL), also called "CD8 + lymphocytes" for expressing the surface CD8 marker. They are responsible for the effector functions of cellular immunity, through interaction with a "peptide-CMH-I" complex; CTLs recognize the cells infected by the pathogen for which they are specific or tumor cells, and destroy them by secreting a series of molecules (perforin, granzymes, FasL) that activate apoptosis of the target cell.

"Memory T lymphocytes": are cells that are generated after activation of T lymphocytes, by exposure to a foreign antigen (a pathogen). Memory cells can be both CD4 + and CD8 +, and typically express the CD45RO cell surface protein. They have a long life, are functionally inactive, and can circulate for months or years, prepared to respond to new exposures to the same antigen. The re-exposure to the antigen they recognize causes a rapid expansion of effector T cells, thus providing the immune system with "memory" against past infections.

"Regulatory T lymphocytes (Treg cells)", formerly known as suppressor T cells: express the surface CD4 marker and are distinguished from CD4 + lymphocytes by the presence of the FoxP3 intracellular marker. Its main function is to eliminate cell-mediated immunity at the end of the immune reaction and eliminate self-reactive T cells that escaped the thymus negative selection process. Two main classes of CD4 ⁺ Treg cells have been described: - "natural Treg cells" or "CD4 ⁺ CD25 ⁺ FoxP3 ⁺ Treg cells" arise in the thymus and have been related to the interactions between developing T cells and dendritic cells, both myeloid (CDl lc +) and plasmocytoid (CD123 +);

- "Treg adaptation cells" or "Th3 cells" or "Trl cells", which can be generated during a normal immune response.

"Gamma / delta T cells": are a small group of T cells that have a specific TCR on their surface. Most lymphocytes have a TCR composed of two glycoprotein chains called α and β. However, in gamma / delta cells, the TCR is formed by a γ chain and a δ chain. This group of lymphocytes is very rare (2% of the total), but they are abundant in the intestinal mucosa, forming part of a lymphocyte population called intraepithelial lymphocytes. A "T lymphocyte receptor" or "TCR" (for T cell receptor in English) is a cellular receptor associated with an intracellular signaling pathway characterized by belonging to the family of receptors with intrinsic enzymatic activity and having peptide ligands small associated with CMH molecules in the plasma membrane of macrophages and other antigen presenting cells. The molecular characteristics of said receptor comprise the possession of an individual transmembrane α helix, although there are several kinase proteins associated with cytosolic domains (present only in T lymphocytes), and their signal transduction pathway involves the activation of cytosolic tyrosine kinase proteins. , via PI-3 kinase, via IP3 / DAG and via Ras / MAPK. In this way, its activation by means of an external stimulus causes a cascade of internal enzymatic reactions that facilitates the adaptation of the cell to its environment, by means of second messengers.

The TCR is made up of two chains similar to immunoglobulins, but associated with the cell membrane. The two chains are called TCRa and TCRP, they are arranged side by side joined by disulfide bonds. Certain molecules on the surface of T cells stabilize both interactions mediated by TCR as well as intracellular communication, including CD3, CD4 and CD8. Like the immunoglobulins, the TCR chains comprise a constant domain (C) and a variable domain (V), which is located in the apical region of the extracellular portion. The variable domain has 3 small hypervariable regions (CDRs) that are directly responsible for the interaction with the peptide complex: CMH, in a highly complementary way. The most specific is CDR3. However, the binding between the peptide: CMH and the TCR has a very high dissociation constant.

The α and β chains (and in rare cases the alternative combination of γ: δ chains) are associated on the cell membrane with a group of molecules without morphological variability called together CD3. That TCR: CD3 membrane complex is required for the stable interaction of T cells with antigen presenting cells and is responsible for much of the intracellular communication mediated by TCR. The CD3 complex is composed of three monomers called γ, δ and ε spatially bound but not covalently. The CD3 complex further comprises an intracellular portion composed of two ζ chains, which is responsible for transmitting the signals resulting from the TCR: CMH-antigen binding.

Bone marrow hematopoietic stem cells, as well as early lymphoid progenitor cells that will give rise to lymphocytes (T and B) contain genes for immunoglobulins (Ig) and for T-cell receptors in germinal configuration ( or inherited), which is different from the configuration found in mature lymphocytes.

In the germinal configuration, both the loci for the Ig (heavy and light chains) and the loci for the TCRs (α and β chains) each contain multiple genes for the variable region (V), up to several hundred, and one or few genes for the constant region (C). Between the V genes and the C genes there are small nucleotide sequences, which are called gene segments of union (J, by joining) and diversity (D). All loci contain V, J and C genes; Ds are only found in the locus of the Ig heavy chain and in the TCR β chain. The decision of a progenitor lymphoid cell to become a T lymphocyte is associated with recombination in the locus of the TCR α chain (located on chromosome 14) of a specific V segment gene with a specific J segment gene, to form a single exon VJ. The selection of a specific segment V and J is random. The VJ exon is linked by the splicing mechanism with the C region. In the case of the β chain locus (located on chromosome 7), a segment V, one D and one J are also randomly selected. then a VDJ exon that then binds to the C region. This DNA recombination and RNA splicing sequence generates the α and β chains of the TCR of mature lymphocytes.

The diversity of the antigen receptors is due to the use of different combinations of segments V, D and J in different lymphocyte clones, called combinatorial diversity, which is also increased by introducing changes in the nucleotide sequence at the junctions of segments V , D and J, called diversity of unions. In humans there are 52 segments V, 2 segments D and 13 segments J for the TCR-β chain, and 70 segments V and 61 segments J for the TCRa chain, giving rise to 5.8 x 10 ⁶ different α: β combinations. While combinatorial diversity is limited to the number of sequences available for each segment, but the diversity of the unions is almost unlimited. This diversity of unions can be produced by three types of mechanisms:

 - exonuclease-mediated nucleotide removal during recombination;

- random addition of nucleotides by specific lymphocyte enzymes called deoxyribonucleotidyl transferases (TdT), which generate the so-called N regions;

 - during one of the intermediate steps of recombination, cohesive ends are generated in the cutting areas, which can be filled with "P nucleotides".

As a consequence of all these changes, the nucleotide sequence in the V (D) J zone of a TCR and the length of it in a lymphocyte clone is very different from the same zone of any other clone. The junction zones constitute the most variable zone of the CDR3, and it is the most important for antigen recognition. The term "repertoire of T cells", as used in the present invention, refers to the set of T lymphocytes that express TCRs with different specificities and that are present in a subject at a given time. The term "sample", as used in the present invention, refers to any biological sample capable of containing T lymphocytes that can be obtained from a subject; Illustrative, non-limiting examples of said biological sample include biopsy samples, tissues, cells or fluids, for example blood, milk, plasma, saliva, serum, etc.

In a particular embodiment, said biological sample is peripheral blood, preferably peripheral blood enriched in CD4 + and CD8 + T lymphocytes. As one skilled in the art can understand, various methods are available for obtaining enrichment in CD4 + and CD8 + T lymphocytes. Thus, said methods can be based on a positive selection, where T cells are isolated through antibodies specific for CD2 or CD3, or on a negative selection, where unwanted cells are removed from the sample by the use of antibodies specific for markers of other cell types, including, but not limited to, CD14, CD16, CD19, CD20, CD36, CD56, CD57, CD66b, CD94, CD123, CD244 and / or glycophorin A. They are available to those skilled in the art. Various commercial kits for positive or negative enrichment of T cells by gradient, columns, magnetic particles, etc. Non-limiting examples of kits include RosetteSep Human T Cell Enrichment Cocktail (StemCell Technologies), EasySep human T cell Enrichment Kit (StemCell Technologies), BioMag SelectaPure Human CD3 + T cell Enrichment System (Polysciences, Inc.), BioMag® SelectaPure Human T cell Enrichment System (Polysciences, Inc.), Pan T Cell Isolation Kit human (Miltenyi Biotec), CD2 MicroBeads human (Miltenyi Biotec), Whole Blood CD3 MicroBeads human (Miltenyi Biotec), Dynabeads CD2 Pan T (Invitrogen), Dynabeads CD3 (Invitrogen) , Dynabeads Untouched Human T Cells (Invitrogen), and Human CD3 + T Cell Enrichment Column (R&D Systems). The term "primer" or "first" or "oligonucleotide"("oligo"), as used in the present invention, refers to a nucleotide sequence that is complementary to a nucleotide sequence of the genes encoding for the β chain of the TCR. Each hybrid primer specifically with its target nucleotide sequence and acts as a starting point from which DNA polymerase begins the polymerization of DNA. The primers are short nucleotide sequences, approximately 15-24 nucleotides in length that can be aligned with a strand of target DNA thanks to the complementarity of bases to form a hybrid between the primer and the target strand of DNA. Then, the DNA polymerase enzyme can extend the primer along the DNA strand.

The primers can be prepared by any suitable method, including, for example, but not limited to direct chemical synthesis. Methods for preparing and using primers are described, for example, in Sambrook et al., 2001. "Molecular cloning: a Laboratory Manual", 3rd ed., Cold Spring Harbor Laboratory Press, NY, Vol. 1-3. Preferably, the primer is a deoxyribose oligonucleotide, but may also comprise at least one modified sugar moiety selected from the group that includes but is not limited to arabinose, 2-fluoroarabinous, xylulose and hexose. The oligonucleotide may also comprise at least one modified phosphate main structure. Non-limiting examples of modified oligonucleotides include oligodeoxyribonucleotide selenoate, oligodeoxyribonucleotide phosphorothioate (TPO), oligodeoxyribonucleotide phosphoramidate, oligodeoxyribonucleotide methylphosphonate, peptide nucleic acid (PNA). The term "sense primer", as used in the present invention, refers to a primer that hybridizes with a specific sequence of one of the 24 families of V segments encoding the β chain of the TCR, in the 5 ′ direction -3' . The term "antisense primer", as used in the present invention, refers to a primer that hybridizes with a specific sequence of the constant segment C segment of the gene encoding the β chain of the TCR, in the 3'-5 sense '. The term "hybridization", as used in the present invention, refers to the process by which two chains of antiparallel nucleic acids and complementary base sequences are associated, in a single double-chain molecule where the nitrogenous bases remain hidden inside. Hybridization can be carried out under conditions of high, medium or low stringency allowing the association of chains with high, medium or low homology, respectively. In a preferred embodiment, the hybridization is carried out under high or medium stringency conditions. For example, hybridization under conditions of high stringency can be carried out in 6xSSC at approximately 45 ° C followed by one or more washes in 0.1 x SSC / 0.2% SDS at approximately 68 ° C. Other conditions of high stringency include, for example, washings in 6xSSC / 0.05% sodium pyrophosphate at 37 ° C, 48 ° C, 55 ° C and 60 ° C, depending on the particular primer. As used in the present invention, "moderate conditions" is used for hybridization carried out in 6x SSC at approximately 45 ° C followed by one, preferably 3-5 washes in 0.2xSSC / 0.1% SDS at approximately 42-65 ° C. A common formula for calculating the stringency conditions required to achieve hybridization between nucleic acid molecules of a specified sequence homology is (Sambrook et al., 1989): Tm = 81.5 ° C + 16.6Log [Na +] + 0.41 (% G + C) - 0.63 (% formamide) -600 / # of bp in the duplex. As an illustration of the above formula, using [Na +] = [0.368] and 50% formamide, with a GC content of 42% and an average probe size of 200 bases, the Tm is 57 ° C. The Tm of a DNA duplex decreases by 1-1.5 ° C with each 1% decrease in homology. Therefore, targets with a sequence identity greater than 75% would be observed using a hybridization temperature of 42 ° C. "Tm" or "melting temperature" means that temperature at which 50% of the DNA molecules are dissociated.

The term "detectable label" or "probe" or "marking", as used in the present invention, refers to a molecular label whose purpose is to allow the visualization or detection of the molecules to which it is anchored by proper procedures and equipment for the detection of tide. The marking of amplification products can be carried out by conventional methods. Said marking can be direct, for which fluorophores can be used, for example, Cy3, Cy5, fluorescein, alexa, etc., enzymes, for example, alkaline phosphatase, peroxidase, etc., radioactive isotopes, for example, 33P, 1251, etc., or any other marker known to the person skilled in the art. Alternatively, said marking can be indirect through the use of chemical, enzymatic methods, etc .; by way of illustration, the amplification product may incorporate a member of a specific binding pair, for example, avidin or streptavidin conjugated with a fluorochrome (locus), and the probe binds to the other member of the specific binding pair, for example, biotin (indicator), the reading being carried out by fluorimetry, etc., or the amplification product may incorporate a member of a specific binding pair, for example, an anti-digoxigenin antibody conjugated to an enzyme (locus), and the The probe binds to the other member of the specific binding pair, for example, digoxigenin (indicator), etc., the enzyme substrate is transformed into a luminescent or fluorescent product and the reading is carried out by chemo-luminescence, fluorimetry, etc. Thus, in a particular embodiment, the detectable labels are fluorophores. Examples of fluorescent materials that can be used in oligonucleotide mapping include, but are not limited to, 5-carboxyfluorescein (5-FAM), 6-FAM, t-FAM tetrachlorinated analog (TET), 6-FAM hexachlorinated analog (HEX) ), 6-carboxytetramethylrodamine (TAMRA), 6-carboxy-X-rhodamine (ROX), 6-carboxy-4 ', 5'-dichloro-2', 7'-dimethoxyfluorescein (JOE), ED, Cy-3, Cy -5, Cy-5.5, fluorescein-6-isothiocinate (FITC) and tetramethylrodamine-5-isothiocinate (TRITC).

In a preferred embodiment, the detectable labels can be distinguished based on the emission wavelength. In a preferred embodiment, the detectable labels are 5-FAM and TAMRA. In a particular embodiment, the composition or kit according to the first aspect of the invention comprises 24 sense primers, each of said sense primers hybridizing with a specific sequence of one of the 24 families of V segments that are part of the gene coding for the β chain of the TCR. The TCR is an α and β chain homodimer, each of which is encoded by a gene formed by gene segments V, D, J and C. There are multiple variants of said gene segments distributed in clusters, the corresponding segments being located at the β chain on chromosome 7. The number of V segments of the TCR β chain in the human beings are between 64 and 67 segments in 30 families, called TCRpVl to TCRpV30.

In a preferred embodiment, each of the 24 sense primers specifically hybridizes with a segment V that are part of the gene that codes for the β chain of TCRs 2, 3.1, 4.1, 5.1, 6.1, 7.1, 9, 10.1, 11, 12.3, 13, 14, 15, 16, 18, 19, 20, 23 24, 25, 27, 28, 29 and 30.

In a preferred embodiment, the 24 sense primers comprise variants of the sequences identified in SEQ ID NO: 24 (Table 1) that retain the ability to specifically hybridize each of said sense primers with a specific sequence from one of the 24 families of V segments that are part of the gene that codes for the β chain of the TCR, where the variants have an identity with the sequences SEQ ID NO: 24 of at least 99%, at least 98%, at least 97% ), at least 96%>, at least 95%>, at least 90%>, at least 85%>, at least 80%), at least 75%>, at least 70%> , at least 65%>, at least 60%>, at least 55%>, at least 50%>, at least 45%>, at least 40%>, at least 35%>, at least 30%>. In a preferred embodiment, the 24 sense primers comprise the sequences identified in SEQ ID NO: 1 to 24 (Table 1).

In another particular embodiment, the composition or kit of the invention further comprises a first antisense primer labeled with a first detectable label, wherein said hybrid primer specifically with segment C of the gene encoding the β chain of the TCR, and a second antisense primer that hybrid specifically with the same region as said first antisense primer labeled with a first detectable label, which is marked with a second detectable label different from the first detectable label.

In a preferred embodiment, said first antisense primer labeled with a first detectable label comprises the sequence identified in SEQ ID NO: 25 or a variant thereof that retain the ability to hybridize with the same region of a specific sequence of the constant C segment segment of the gene encoding the β chain of the TCR as the sequence identified in SEQ ID NO: 25. Such variants may have an identity with the sequence SEQ ID NO: 25 of at least 99%, at least 98%, at least 97%, at least 96%, at least 95%, at least 90% at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50%, at minus 45%, at least 40%, at least 35%, at least 30%. In another preferred embodiment, the sequence of said first antisense primer labeled with a first detectable label comprises the sequence identified with SEQ ID NO: 25 (Table 1). In a preferred embodiment, said first antisense primer is labeled with 5-FAM or TAMRA, preferably 5-FAM. In another preferred embodiment, said second antisense primer that hybridizes specifically with the same region as said first antisense primer, which is labeled with a second detectable tag different from the first detectable tag, comprises variants of the sequence identified in SEQ ID NO: 25 ( Table 1), which retain the ability to hybridize with a specific sequence of the constant segment C segment of the gene encoding the β chain of the TCR, where the variants have an identity with the sequence SEQ ID NO: 25 of at least 99 %, at least 98%, at least 97%, at least 96%, at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%), at least 55%, at least 50%, at least 45%, at least 40%, at least 35%, at minus 30%

In another preferred embodiment, the sequence of said second antisense primer labeled with a second detectable label comprises the sequence identified with SEQ ID NO: 25 (Table 1). In a preferred embodiment, said second antisense primer is labeled with 5-FAM or TAMRA, preferably TAMRA. In another particular embodiment, the composition or kit of the invention further comprises at least one additional primer that hybridizes with the segment C constant region of the gene encoding the β chain of the TCR. In a preferred embodiment, the two antisense primers comprise variants of the sequences identified in SEQ ID NO: 26 and SEQ ID NO: 27 (Table 1) that retain the ability to hybridize each of said antisense primers with a region specific sequence. constant segment C of the gene encoding the β chain of the TCR, where the variants have an identity with the sequences SEQ ID NO: 26 and SEQ ID NO: 27 of at least 99%, at least 98%, at least 97%, at least 96%), at least 95%, at least 90%, at least 85%, at least 80%, at least 75%), at least 70%, at least 65%>, at least 60%>, at least 55%, at least 50%, at least 45%, at least 40%, at least 35%, at least 30%. In a preferred embodiment of the invention, the first antisense primer comprises the sequence SEQ ID NO: 26 and / or the second antisense primer comprises the sequence SEQ ID NO: 27 (Table 1). Sense first specific for segment family V3 of the gene encoding the TCRbeta Table 1: Examples of sense and antisense primers of the invention.

 Molecular Weight 1 (70-90 bp)

 νβ 2: CCACAAGCTGGAGGACTC (SEQ ID NO: 1)

 νβ 3: GCT TGGTGACTCTGCTGTG (SEQ ID NO: 2)

 νβ 4: G C C AG AAG AC TCAGCCCTG (SEQ ID NO: 3)

 νβ 5: ATGTGAGCACCT TGGAGGTGG (SEQ ID NO: 4)

 νβ 16: GCT TGAGGAT TCAGCAGTG (SEQ ID NO: 5)

 νβ 18: GTAGTGCGAGGAGAT TCGGCAG (SEQ ID NO: 6)

 νβ 19: GCCCAAAAGAACCCGACAGC (SEQ ID NO: 7)

 νβ 29: GTCTGACTGTGAGCAACATGAGCCCTGAAG (SEQ ID NO: 8)

 Molecular Weight 2 (120-160 bp)

 νβ 6: CT TCTGAGGGTACCACTGACA (SEQ ID NO: 9)

 νβ 12: ATGCCCGAGGATCGAT TCTCA (SEQ ID NO: 10)

 νβ 15: T T AAC AAT GAAG C AGAC AC C (SEQ ID NO: l l)

28β 28: GGGT AC AG TGTCTCT AGAGAGAAG (SEQ ID NO: 12) νβ 10: AGTCTCAGATGGCTACAGTGTC (SEQIDNO: 13) νβ 13: GAG C GAT AAAG GAAG C AT CC (SEQIDNO: 14)

 νβ 14: AAACAGGATGAGTCCGGTATGC (SEQIDNO: 15)

 νβ 20: CATACGAGCAAGGCGTCGAG (SEQ ID NO: 16)

 Molecular Weight 3 (180-210 bp)

 νβ 11: CAAT CC TATAT C T GGCCAT GC TAC (SEQIDNO: 17)

 νβ24: AGGGTCCATGGATGCTGATGT (SEQIDNO: 18)

 νβ25: AAGATCACTCTGGAATGTTCTC (SEQIDNO: 19)

 νβ 27: C AAG T GAC C C AGAAC C AAGA (SEQ ID NO: 20)

 νβ 7: CAATTTCAGGTCATAATGC (SEQIDNO: 21)

 νβ 9: T AT AAT G GAGAAGAGAGAG C (SEQIDNO: 22)

 νβ23: ATTGGTAT C AAC AGAAT C AG (SEQIDNO: 23)

 νβ 30: CCCAACCTATACTGGTACC (SEQIDNO: 24)

 Antisense primers marked

 Cl 5-FAM - TTCTGATGGCTCAAACACAGC (SEQ ID NO: 25)

 C2 TAMRA - TTCTGATGGCTCAAACACAGC (SEQ ID NO: 25)

 Unmarked antisense primers

 DI TTCCCATTCACCCACCAGC (SEQIDNO: 26)

 D2 TGTGGCCAGGCATACCAGTG (SEQIDNO: 27)

In another particular embodiment, the composition or kit of the invention further comprises the reagents necessary to carry out the cDNA amplification reaction and / or the reagents necessary to perform RNA reverse transcription reactions, including but not limited to a, deoxynucleotides triphosphate (dNTPs), divalent and / or monovalent ions, a buffer solution (buffer) that maintains the proper pH for the functioning of DNA polymerase, DNA polymerase or mixture of different polymerases, reverse transcriptase or mixture of different reverse transcriptases , etc. However, if the kit of the invention does not comprise the reagents necessary to practice the method of the invention, these are commercially available and can be found as part of a kit. Any commercially available kit containing the reagents necessary to carry out an amplification reaction can be used successfully in the practice of the method of the invention. Methods to analyze the repertoire of T cells

In a second aspect, the invention relates to a method for analyzing the repertoire of T cells in a sample, hereinafter the first method of the invention, comprising the steps of

 (i) amplifying a cDNA preparation obtained from RNA isolated from said sample using a multiplicity of sense primers, where each of said primers specifically hybridizes with the V segment of the gene encoding the TCR β chain and two antisense primers that specifically hybridize with the CP constant region of the TCR where each of said antisense primers is labeled with a distinct detectable label, and

 (ii) analyze the number of amplification products obtained in step (i). As the person skilled in the art understands, if the first method of the invention is directed to analyze the repertoire of T cells in a sample, said sample will be any biological sample capable of containing T lymphocytes that can be obtained from a subject. Illustrative, non-limiting examples of said biological sample include biopsy samples, tissues, cells or fluids, for example blood, milk, plasma, saliva, serum, etc.

In a particular embodiment, the sample is a peripheral blood sample. The term "peripheral blood", as used in the present invention, relates to the volume of circulating blood distant from the heart, that is, the blood circulating through the organism of a subject. In a preferred embodiment, said peripheral blood sample is enriched in CD4 + or CD8 + cells. As one skilled in the art can understand, various methods are available for obtaining enrichment in CD4 + and CD8 + T lymphocytes. Various commercial kits are available to the person skilled in the art for positive or negative enrichment of CD4 + or CD8 + T cells by gradient, columns, magnetic particles, etc. Non-limiting examples of kits include StemSep® Human CD4 Positive Selection Kit (StemCell Technologies), StemSep® Human CD4 + T Cell Enrichment Kit (StemCell Technologies), RosetteSep ™ Human CD4 + T Cell Enrichment Cocktail (StemCell Technologies), StemSep® Human CD8 Positive Selection Kit (StemCell Technologies), StemSep® Human CD8 + T Cell Enrichment Kit (StemCell Technologies), RosetteSep ™ Human CD8 + T Cell Enrichment Cocktail (StemCell Technologies) , CD4 + T Cell Isolation Kit II, human (Miltenyi Biotec), CD8 + T Cell Isolation Kit II, human (Miltenyi Biotec), Dynal® CD4 Positive Isolation Kit (Invitrogen), Dynal® CD8 Positive Isolation Kit (Invitrogen), Human CD4 + T Cell Enrichment Column (R&D Systems), Human CD8 + T Cell Enrichment Column (R&D Systems), BD IMag ™ CD4 T Lymphocyte Enrichment Set - DM (BD Biosciences), and BD IMag ™ CD8 T Lymphocyte Enrichment Set - DM (BD Biosciences).

The term "RNA", as used in the present invention, refers to the mRNA or messenger RNA. The mRNA is the ribonucleic acid that contains the genetic information from the DNA to be used in protein synthesis, that is, it determines the order in which the amino acids will bind.

Prior to the extraction of the RNA from the biological sample, it can be treated physically or mechanically to break the tissue or cellular structures and release the intracellular components to an aqueous or organic solution to prepare the nucleic acids for extraction.

RNA extraction can be performed by any of the procedures known to those skilled in the art, including, but not limited to, Trizol, guanidinium salts, phenol chloroform, etc. Such procedures can be found, for example, in Sambrook et al., 2001. "Molecular cloning: a Laboratory Manual", 3rd ed., Cold Spring Harbor Laboratory Press, NY, Vol. 1-3. There are also commercial kits that allow the extraction of RNA from a sample, such as the Qiagen RNA extraction kit. As the person skilled in the art knows, when working with RNA, maximum precautions must be taken to avoid contamination with RNAs and the degradation of RNA. After obtaining the RNA, a reverse transcription (RT) reaction of the mRNA is carried out followed by amplification by polymerase chain reaction (PCR) [RT-PCR] to obtain the double helix cDNA corresponding to the RNA present in the sample. In a particular embodiment, the cDNA preparation has been obtained using a primer that hybridizes with the constant C segment segment of the gene encoding the β chain of the TCR. In a preferred embodiment, the sequence of said at least one additional primer comprises SEQ ID NO: 26 and / or SEQ ID NO: 27.

The term "cDNA" or "complementary DNA", as used in the present invention, refers to single stranded DNA that is synthesized from a single strand of RNA. As one skilled in the art can understand, there are several methods of cDNA synthesis, the most common being the use of the enzyme reverse transcriptase or retrotranscriptase. Sambrook et al, 2001, cited ad supra, describes methods for carrying out cDNA synthesis.

Once the RNA has been isolated and the cDNA obtained therefrom, the method of the invention comprises a first stage where at least one amplification reaction of said cDNA is carried out by using specific sense primers of the DNA, where each one of said hybrid primers specifically with segment V of the gene encoding the β chain of the TCR and two antisense primers that specifically hybridize with the CP constant region of the TCR where each of said antisense primers is labeled with a distinct detectable label.

The term "amplify" or "amplification", as used in the present invention, refers to the use of techniques or methods to increase the number of copies of a specific nucleic acid segment. The term "amplification product" refers to the nucleic acid generated as a result of an amplification. Many amplification methods are based on chain enzymatic reactions, such as a polymerase chain reaction or PCR, a ligase chain reaction, or self-sustained sequence replication, rolling circle amplification assays, invasive excision assays , primer extension assay, enzymatic breakdown methods, NASBA, hybridization methods in sandwich, methods in which molecular markers are employed, and the like. Sambrook et al, 2001, cited ad supra, and patent application US2007 / 0105128 describe methods for carrying out nucleic acid amplification. Real-time PCR, also called RT-PCR, quantitative PCR, quantitative real-time PCR or RTQ-PCR, is a method that allows the amplification and quantification of DNA simultaneously (Expert Rev. Mol. Diagn. 2005 (2 ): 209-19). The DNA is specifically amplified by a polymerase chain reaction. DNA is quantified after each round of amplification. Common methods of quantification include the use of fluorescent markers that are interspersed with double stranded DNA and modified DNA oligonucleotides (called probes) capable of emitting fluorescence when hybridizing with a complementary DNA. Alternatively, amplification can be carried out by appropriately labeled primers, and products amplified by primer extension can be detected by suitable procedures and equipment for the detection of the marking. Preferably, the probes of the present invention are labeled with at least one detectable residue, wherein the residue or detectable residues are selected from the group consisting of: conjugates, branched detection system, chromophores, fluorophores, labels (spin label), radioisotopes, enzymes, haptens, an acridinium ester and luminescent compounds. In an illustrative, non-limiting example of the method of the invention, the primers are labeled with a fluorophore.

In a particular embodiment of the first method of the invention, the amplification of step (i) is carried out in several reactions using in each of the pairs reactions of sense-antisense primers that give rise to amplification products that are distinguishable from the other amplification products obtained in the same reaction based on size and / or based on the detectable label. In a particular embodiment of the method of the invention, the multiplicity of sense primers comprises 24 primers.

In a preferred embodiment, each of the 24 sense primers hybridizes specifically with a segment V that is part of the gene that codes for the β chain of TCRs 2, 3.1, 4.1, 5.1, 6.1, 7.1, 9, 10.1, 1 1, 12.3, 13, 14, 15, 16, 18, 19, 20, 23 24, 25, 27, 28, 29 and 30.

In a preferred embodiment, the 24 sense primers comprise variants of the sequences identified in SEQ ID NO: 24 (Table 1) that retain the ability to specifically hybridize each of said sense primers with a specific sequence from one of the 24 families of V segments that are part of the gene that codes for the β chain of the TCR, where the variants have an identity with the sequences SEQ ID NO: 24 of at least 99%, at least 98%, at least 97% ), at least 96%>, at least 95%>, at least 90%>, at least 85%>, at least 80%), at least 75%>, at least 70%> , at least 65%>, at least 60%>, at least 55%>, at least 50%>, at least 45%>, at least 40%>, at least 35%>, at least 30%>. In a more preferred embodiment, the 24 sense primers comprise the sequences identified in SEQ ID NO: 1 to 24 (Table 1).

In another particular embodiment of the method of the invention, the two antisense primers that specifically hybridize with the constant CP region of the TCR where each of said antisense primers is labeled with a distinct detectable label, comprises variants of the sequence identified in SEQ ID NO: 25 (Table 1), which retain the ability to hybridize with a specific sequence of the constant segment C segment of the gene encoding the β chain of the TCR, where the variants have an identity with the sequences SEQ ID NO: 25 of at least 99%>, at least 98%>, at least 97%>, at least 96%>, at least 95%>, at least 90%>, at least 85% or, at at least 80%>, at least 75%>, at least 70%>, at least 65%>, at least 60%, at least 55%, at least 50%, at least 45%, at least 40%, at least 35%, at least 30%.

In a preferred embodiment, said two antisense primers comprise the sequence identified as SEQ ID NO: 25 (Table 1). In a preferred embodiment, said two antisense primers are labeled with 5-FAM or TAMRA. In an even more preferred embodiment, said first antisense primer is labeled with 5-FAM and said second antisense primer is labeled with TAMRA. In a preferred embodiment, cDNA amplification is performed for 24 νβ families using eight RT-PCR reactions in multiplex format (R1 to R8), taking at least one primer corresponding to a 70-90 bp molecular weight amplification product ( SEQ ID NO: 1-8), or variants thereof that retain the ability to specifically hybridize each of corresponding V segments that are part of the gene encoding the β chain of the TCR; at least one primer corresponding to a 120-160 bp molecular weight amplification product (SEQ ID NO: 9-16), or variants thereof that retain the ability to specifically hybridize each of corresponding V segments that are part of the gene coding for the β chain of the TCR; at least one primer corresponding to a 180-210 bp molecular weight amplification product (SEQ ID NO: 17-24), or variants thereof that retain the ability to specifically hybridize each of corresponding V segments that are part of the gene coding for the β chain of the TCR; and at least one labeled antisense primer (SEQ ID NO: 25), or variants thereof that retain the ability to hybridize with a specific sequence of the constant C segment segment of the gene encoding the β chain of the TCR.

In a preferred embodiment, the eight RT-PCR reactions in multiplex format are performed following the primer mixtures of Table 2, that is, the following combinations of primers:

- Rl: SEQ ID NO: l + SEQ ID NO: 11 + SEQ ID NO: 17 + SEQ ID NO: 25 marked with 5-FAM; - R2: SEQ ID N05 + SEQ ID NO: 13 + SEQ ID NO: 22 + SEQ ID NO: 25 marked with TAMRA;

 - R3: SEQ ID NO: 2 + SEQ ID NO: 9 + SEQ ID NO: 20 + SEQ ID NO: 25 marked with 5-FAM;

 - R4: SEQIDNO: 6 + SEQIDNO: 14 + SEQIDNO: 24 + SEQIDNO: NO: 25 marked with TAMRA;

 - R5: SEQ ID NO: 3 + SEQ ID NO: 10 + SEQ ID NO: 19 + SEQ ID NO: 25 marked with 5-FAM;

 - R6: SEQ ID NO: 7 + SEQ ID NO: 15 + SEQ ID NO: 23 + SEQ ID NO: NO: 25 marked with TAMRA;

 - R7: SEQ ID NO: 4 + SEQ ID NO: 12 + SEQ ID NO: 18 + SEQ ID NO: 25 marked with 5-FAM;

 - R8: SEQIDNO: 8 + SEQIDNO: 16 + SEQIDNO: 21 + SEQ ID NO: NO: 25 marked with TAMRA,

or variants of said primers that retain the ability to hybridize specifically with each of corresponding V or C segments that are part of the gene encoding the β chain of the TCR.

Table 2: Example of mixtures of sense-antisense primers.

 Sense-antisense primers reaction Sense-antisense primers reaction

Rl Vp2 (SEQ ID NO: 1) R5 Vp4 (SEQIDNO: 3)

 Vpl5 (SEQ ID NO: 11) Vpl2 (SEQIDNO: 10) Vpll (SEQ ID NO: 17) Vp25 (SEQ ID NO: 19) Cl (SEQIDNO: 25) Cl (SEQIDNO: 25)

R2 Vpl6 (SEQIDNO: 5) R6 Vpl9 (SEQIDNO: 7)

 Vpl0 (SEQIDNO: 13) Vpl4 (SEQIDNO: 15) Vp9 (SEQIDNO: 22) Vp23 (SEQIDNO: 23) C2 (SEQ ID NO: 25) C2 (SEQ ID NO: 25)

R3 Vp3 (SEQIDNO: 2) R7 Vp5 (SEQIDNO: 4)

Vp6 (SEQ ID NO: 9) Vp28 (SEQ ID NO: 12) Vp27 (SEQIDNO: 20) Vp24 (SEQ ID NO: 18) Cl (SEQIDNO: 25) Cl (SEQIDNO: 25) R4 Vpl8 (SEQ ID NO: 6) R8 Vp29 (SEQ ID NO: 8)

 Vpl3 (SEQ ID NO: 14) Vp20 (SEQ ID NO: 16)

Vp30 (SEQ ID NO: 24) Vp7 (SEQ ID NO: 21)

 C2 (SEQ ID NO: 25) C2 (SEQ ID NO: 25)

The nomenclature of the sense and antisense primers is shown in Table 1.

The PCR is carried out in a thermocycler that performs the cycles in the exact times and temperatures programmed, such as the hybridization temperature, which depends on the melting temperature of each of the primers used in the reaction or the temperature of extension.

As the person skilled in the art understands, the amplification of the different TCRVP segments requires specific reaction conditions and procedures for each of the pairs of primers used, which can be achieved by systematic variation of each parameter. The number of cycles and the alignment temperature used in the PCR reaction must be suitable for obtaining reliable results by using each of the pairs of sense-antisense primers of the invention. Parameters such as the concentration of primers are specific to each primer and have been adjusted in the validation of the primer set.

In another particular embodiment, the high temperature multiplex RT-PCR reactions are performed in 20 μΐ of reaction mixture containing 100 ng mRNA template, 1 μΜ dNTP (Roche Applied Science), 5x buffer [Roche Applied Science], 20 U of RNase inhibitor (Protector, Roche Applied Science), 10 U reverse transcriptase (Transcriptor, Roche Applied Science), and 1 μΜ of each primer (three sense primers and one antisense primer). The first reaction cycle consists of an incubation at 42 ° C for 45 min, followed by an inactivation step at 85 ° C for 5 min and 35 cycles consisting of 15 s at 94 ° C, 15 s at 58 ° C and 30 s at 72 ° C, with a final extension stage of 7 min at 72 ° C.

Next, the first method of the invention comprises a second stage of analysis of the number of amplification products obtained in the first stage. This It is carried out by separating the amplification products or amplicons. Virtually any conventional method can be used within the scope of the invention to separate the amplification products. Techniques for separating amplification products are widely described in the state of the art, such as in Sambrook et al., 2001 (cited ad supra). Techniques for separating amplification products are, for example, submerged electrophoresis with Methafor gels, polyacrylamide gels electrophoresis, capillary electrophoresis, etc.

Following the separation of the amplification products, the size of the separated fragments is identified, for which any of the methods of identification of amplification fragments known in the state of the art can be used, such as hybridization with labeled probes ( for example with a fluorophore) which will be detected by a detector and processed by a computer system, staining, for example, with ethidium bromide, silver staining, etc. As the person skilled in the art understands, if this whole process is integrated into a computer system, a graph called electropherogram can be generated where the size of the amplified fragments can be identified. There are numerous systems on the market that allow this analysis, such as the GeneScan (Genetic Analysis System CEQ 8000, GenomeLab, Beckman Coulter). The area under the curve calculated for each CDR3 length in a νβ family in a probability distribution. In this way, the distribution of the TCR lengths provides a percentage of the perturbations of the TCR repertoire.

In another particular embodiment, the analysis of the amplification products obtained in step (ii) is carried out by determining the size and / or the marking of each of the amplification products in each of the amplification reactions.

In a preferred embodiment, the analysis of the molecular spectrum of each νβ family is performed by combinations of amplifications of different molecular weight and different tides. In an even more preferred embodiment, said combinations are carried out from the amplification products obtained from the Rl and R2 reactions, the amplification products obtained from the R3 and R4 reactions, the products of amplification obtained from reactions R5 and R6 and the amplification products obtained from reactions R7 and R8 (according to Table 2), which are separated into their corresponding four electrophoresis strokes. In another preferred embodiment, said combinations are carried out from the amplification products obtained from the Rl and R2 reactions, the amplification products obtained from the R3 and R4 reactions, the amplification products obtained from the R5 and R8 reactions, and the amplification products obtained from reactions R7 and R6 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R2 reactions, the amplification products obtained from the R3 and R6 reactions, the amplification products obtained from the R5 and R4 reactions, and amplification products obtained from reactions R7 and R8 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R2 reactions, the amplification products obtained from the R3 and R6 reactions, the amplification products obtained from the R5 and R8 reactions, and amplification products obtained from reactions R7 and R4 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R2 reactions, the amplification products obtained from the R3 and R8 reactions, the amplification products obtained from the R5 and R4 reactions, and amplification products obtained from reactions R7 and R6 (according to Table 2), which are separated into their corresponding four electrophoresis strokes. In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R2 reactions, the amplification products obtained from the R3 and R8 reactions, the amplification products obtained from the R5 and R6 reactions, and amplification products obtained from reactions R7 and R4 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R4 reactions, the amplification products obtained from the R3 and R2 reactions, the amplification products obtained from the R5 and R6 reactions, and amplification products obtained from reactions R7 and R8 (according to Table 2), which are separated into their corresponding four electrophoresis strokes. In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R4 reactions, the amplification products obtained from the R3 and R2 reactions, the amplification products obtained from the R5 and R8 reactions, and amplification products obtained from reactions R7 and R6 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R4 reactions, the amplification products obtained from the R3 and R6 reactions, the amplification products obtained from the R5 and R2 reactions, and amplification products obtained from reactions R7 and R8 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R4 reactions, the amplification products obtained from the R3 and R8 reactions, the amplification products obtained from the R5 and R2 reactions, and amplification products obtained from R7 and R6 reactions (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R4 reactions, the amplification products obtained from the R3 and R8 reactions, the amplification products obtained from the R5 and R6 reactions, and amplification products obtained from reactions R7 and R2 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R4 reactions, the amplification products obtained from the R3 and R6 reactions, the amplification products obtained from the R5 and R8 reactions, and amplification products obtained from reactions R7 and R2 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R6 reactions, the amplification products obtained from the R3 and R2 reactions, the amplification products obtained from the R5 and R4 reactions, and amplification products obtained from reactions R7 and R8 (according to Table 2), which are separated into their corresponding four electrophoresis strokes. In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R6 reactions, the amplification products obtained from the R3 and R2 reactions, the amplification products obtained from the R5 and R8 reactions, and amplification products obtained from reactions R7 and R4 (according to Table 2), which are separated into their corresponding four electrophoresis strokes. In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R6 reactions, the amplification products obtained from the R3 and R4 reactions, the amplification products obtained from the R5 and R2 reactions, and amplification products obtained from reactions R7 and R8 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R6 reactions, the amplification products obtained from the R3 and R8 reactions, the amplification products obtained from the R5 and R2 reactions, and amplification products obtained from reactions R7 and R4 (according to Table 2), which are separated into their corresponding four electrophoresis strokes. In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R6 reactions, the amplification products obtained from the R3 and R8 reactions, the amplification products obtained from the R5 and R4 reactions, and amplification products obtained from reactions R7 and R2 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R6 reactions, the amplification products obtained from the R3 and R4 reactions, the amplification products obtained from the R5 and R8 reactions, and amplification products obtained from reactions R7 and R2 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R8 reactions, the amplification products obtained from the R3 and R2 reactions, the amplification products obtained from the R5 and R6 reactions, and amplification products obtained from R7 and R4 reactions (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R8 reactions, the amplification products obtained from the R3 and R2 reactions, the amplification products obtained from the R5 and R4 reactions, and amplification products obtained from reactions R7 and R6 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R8 reactions, the amplification products obtained from the R3 and R4 reactions, the amplification products obtained from the R5 and R2 reactions, and amplification products obtained from reactions R7 and R6 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R8 reactions, the amplification products obtained from the R3 and R6 reactions, the amplification products obtained from the R5 and R2 reactions, and amplification products obtained from reactions R7 and R4 (according to Table 2), which are separated into their corresponding four electrophoresis strokes. In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R8 reactions, the amplification products obtained from the R3 and R4 reactions, the amplification products obtained from the R5 and R6 reactions, and amplification products obtained from reactions R7 and R2 (according to Table 2), which are separated into their corresponding four electrophoresis strokes. In another preferred embodiment, said combinations are carried out from the amplification products obtained the Rl and R8 reactions, the amplification products obtained from the R3 and R6 reactions, the amplification products obtained from the R5 and R4 reactions, and amplification products obtained from reactions R7 and R2 (according to Table 2), which are separated into their corresponding four electrophoresis strokes.

In another particular embodiment of the method, said method further comprises additional amplification of the cDNA using at least one additional primer that hybridizes with the C segment of the gene encoding the β chain of the TCR. In a preferred embodiment, the sequence of said at least one additional primer comprises SEQ ID NO: 26 and / or SEQ ID NO: 27, or variants of said primers that retain the ability to hybridize specifically with the corresponding region of segment C of the gene which codes for the constant region of the β chain of the TCR.

In another particular embodiment of the method, the sample is a peripheral blood sample. In a preferred embodiment, the sample is a peripheral blood sample enriched in CD4 + or CD8 + cells. Uses of the invention

In a third aspect, the invention relates to the use of the composition or kit of the first aspect, or of the method of the second aspect, in the diagnosis of a pathology. The term "diagnosis", as used in the present invention, refers to the procedure by which a disease, nosological entity, syndrome or any health condition is identified.

The term "pathology", as used in the present invention, refers to a process in which the lymphocyte repertoire is altered. These pathological processes include infectious processes, tumor processes and immunodeficiencies. In a particular embodiment, said pathology is an immunodeficiency. Examples no Limitations of immunodeficiencies include immunodeficiencies caused by diabetes mellitus, liver failure, hepatitis, intestinal lymphangiectasia, aplastic anemia, cancer, host-versus-graft disease, chemotherapeutic drugs, immunosuppressive drugs, corticosteroids, radiotherapy, cytomegalovirus, Epstein-Barr virus, HIV, measles virus, varicella-zoster virus, alcoholism, malnutrition, nephrotic syndrome, renal failure, uremia, rheumatoid arthritis, systemic lupus erythematosus, burns and chromosomal abnormalities.

As the person skilled in the art will understand, the diagnosis of a pathology comprises a first stage (i), in which the repertoire of T cells in a subject as described in the first method of the invention is analyzed, and a second stage (ii), in which the result of the analysis performed in stage (i) is compared with that obtained for a control sample. If these results differ substantially from each other, then it is indicative that the subject undergoes a pathology, as understood in the present invention. If these results do not differ substantially from each other, then it is indicative that the subject does not suffer a pathology, as is understood in the present invention.

The term "control sample", as used in the present invention, refers to a sample obtained from a healthy subject.

The term "subject", as used in the present invention, includes any mammal; Non-limiting examples are domestic animals and livestock, primates and humans. Preferably, the subject is a human being, male or female, of any age or race. Virtually any subject can be analyzed according to the present invention to analyze its repertoire of T cells. However, in a particular embodiment, said subject is a subject on which it is desired to diagnose a pathology. In another particular embodiment, said subject is a patient on whom one wants to monitor the evolution of a pathology in response to a treatment. The term "patient", as used herein, refers to a subject suffering from pathology, although said subject has not yet been diagnosed. The term "healthy subject", as used in the present invention, includes any subject that does not have a pathology where the lymphocyte repertoire is altered. Preferably, the healthy subject is a human being, male or female, of any age or race.

In a particular embodiment, the pathology is diagnosed by checking the alterations in the TCR repertoire in CD8 + cells. In a preferred embodiment, said alterations in the repertoire of the TCR in CD8 + cells are checked during HIV-1 infection in infected patients.

Preferably, patients who can be analyzed with the method of the present invention include, without limitation, those patients suffering from acquired immunodeficiency syndrome. The term "acquired immunodeficiency syndrome (AIDS)", as used in the present invention, refers to a disease that affects HIV-infected humans. It is said that a person suffers from AIDS when their organism, due to the immunodeficiency caused by HIV, is not able to offer an adequate immune response against infections. Note the difference between being infected with HIV and suffering from AIDS. An HIV-infected person is HIV positive and goes on to develop an AIDS picture when their level of CD4 + T cells, cells that attack the virus, drops below 200 cells per milliliter of blood. HIV specifically attacks CD4 + T cells and enters them. Once inside, the virus transforms its single-stranded genetic material (RNA) to a double-stranded (DNA) one to incorporate it into the host's own genetic material (infected person) and uses it to replicate or make copies of itself. The new copies of the virus leave the cells, which they lysate, into the blood to infect other CD4 + T cells. This cycle is repeated again and again.

HIV infection is classified into different categories, according to the symptoms and conditions that the patient has:

 . Category A: patients with primary or asymptomatic infection.

Category B: patients who present or have presented symptoms that do not belong to category C, but are related to HIV infection. These include bacillary angiomatosis, vulvo-vaginal candidiasis, or treatment-resistant oral candidiasis, uterine cervix dysplasia or non-invasive cervical carcinoma, pelvic inflammatory disease (PID), fever less than 38.5 ° C or diarrhea, of more than one Month-long, shingles (more than one episode, or an episode with more than one dermatome), hairy oral leukoplakia, peripheral neuropathy, idiopathic thrombocytopenic purpura.

 Category C: patients who present or have presented some complications included in the WHO definition of AIDS of 1987:

 a) Opportunistic infections:

 Bacterial infections: recurrent Salmonella septicemia (other than Salmonella typhy), tuberculosis, Mycobacterium avium complex infection (MAI), atypical mycobacterial infections.

 Viral infections: cytomegalovirus infection (retinitis or disseminated), herpes simplex virus infection (HSV types 1 and 2), can be chronic or in the form of bronchitis, pneumonitis or esophagitis.

 Fungal infections: aspergillosis, candidiasis, both disseminated and of the esophagus, trachea or lungs, coccidiodomycosis, extrapulmonary or disseminated, extrapulmonary cryptococcosis, histoplasmosis, either disseminated or extrapulmonary.

 Protozoal infections: Pneumocystis jiroveci pneumonia, neurological toxoplasmosis, chronic intestinal cryptosporidiosis, chronic intestinal isosporiasis.

b) Chronified processes: bronchitis and pneumonia.

 c) Processes directly associated with HIV: HIV-related dementia

(HIV encephalopathy), progressive multifocal leukoencephalopathy, wasting syndrome or wasting syndrome.

 d) Tumor processes: Kaposi's sarcoma, Burkitt lymphoma, other non-lymphomas

Hodgkin, especially immunoblastic lymphoma, primary brain lymphoma or B-cell lymphoma, invasive carcinoma of the cervix. Not all patients infected with the HIV virus have AIDS. The criteria for diagnosing AIDS may vary from region to region, but the diagnosis typically requires:

 an absolute count of CD4 + T cells less than 200 per cubic millimeter, or - the presence of any of the typical opportunistic infections, caused by agents unable to cause disease in healthy people.

Antiretroviral therapy includes, but is not limited to, HAART (High Activity Antiretroviral Therapy), protease inhibitors, fusion inhibitors, integrase inhibitors, specific co-receptor agents, 3TC, AZT, nevirapine, transcriptase inhibitors Reverse non-nucleoside analogs and reverse transcriptase inhibitors nucleoside analogues. TARGA is a combination of three or more antiretroviral drugs. The term "HAART", as used in the present invention, refers to a combination of highly active antiretroviral agents and usually comprises three drugs. Non-limiting examples of reverse transcriptase inhibitors include nucleoside analog reverse transcriptase inhibitors such as zidovudine (AZT, Retrovir), didanosine (ddl, Videx), stavudine (d4T, Zerit), lamivudine, (3TC, Epivir), abacavir ( ABC, Ziagen), tenofovir (TDF, Viread), combivir (CBV, combination of AZT and 3TC), and non-nucleoside reverse transcriptase inhibitors such as nevirapine (NVP, Viramune), delavirdine (DLV, rescriptor), efavirenz ( EFV, substitute,). Non-limiting examples of protease inhibitors include saquinavir (SQV, Invirase), ritonavir (RTV, Norvir), indinavir (IDV, Crixivan), nelfinavir (NFV, Viracept), fosamprenivir (FPV, Lexiva), kaletra (lopinavir and ritonavir) and fortovase (saquinavir in soft gelatin formulation).

The term "HIV", as used in the present invention, is intended to include HIV-1 and HIV-2. "HIV-1" refers to the human immunodeficiency virus type-1. HIV-1 includes but is not limited to extracellular virus particles and forms of HIV-1 associated with HIV-1 infected cells. The '' HIV-2 ' ¹ , calls the human immunodeficiency virus type-2. HIV-2 includes but is not limited to extracellular virus particles and forms of HIV-2 associated with HIV-2 in infected cells. The HIV-1 virus can include the M group with the main known subtypes (A, B, C, D, E, F, G and H), group O, group N, and recombinant forms, including laboratory strains and primary isolates.

Methods for monitoring the evolution of a pathology in a patient

In a fourth aspect, the invention relates to a method for monitoring the evolution of a pathology in a patient in response to a treatment, hereinafter second method of the invention, which comprises determining the complexity of the repertoire of T cells in a sample of said patient after being subjected to said treatment using a method of the second aspect of the invention, wherein an increase in the complexity of said repertoire with respect to complexity before starting treatment is indicative that the patient responds to said treatment. .

The term "subject", as used in the present invention, includes any mammal; Non-limiting examples are domestic animals and livestock, primates and humans. Preferably, the subject is a human being, male or female, of any age or race. Virtually any subject can be analyzed according to the present invention to analyze its repertoire of T cells. However, in a particular embodiment, said subject is a subject on which it is desired to diagnose a pathology. In another particular embodiment, said subject is a patient on whom one wants to monitor the evolution of a pathology in response to a treatment. The term "patient", as used herein, refers to a subject suffering from pathology, although said subject has not yet been diagnosed. The term "pathology", as used in the present invention, refers to a process in which the lymphocyte repertoire is altered. These pathological processes include infectious processes, tumor processes and immunodeficiencies. In a particular embodiment, said pathology is an immunodeficiency. Non-limiting examples of immunodeficiencies include immunodeficiencies caused by diabetes mellitus, liver failure, hepatitis, intestinal lymphangiectasia, aplastic anemia, cancer, host-versus-graft disease, chemotherapeutic drugs, immunosuppressive drugs, corticosteroids, radiotherapy, cytomegalovirus, viruses Epstein-Barr, HIV, measles pathway, varicella-zoster virus, alcoholism, malnutrition, nephrotic syndrome, renal failure, uremia, rheumatoid arthritis, systemic lupus erythematosus, burns and chromosomal abnormalities. Preferably, patients who can be analyzed with the method of the present invention include, without limitation, those patients suffering from acquired immunodeficiency syndrome.

In a preferred embodiment, the pathology is acquired immunodeficiency syndrome (AIDS) or a pathology associated with HIV infection. In another preferred embodiment of the method, the therapy is HAART.

The terms "acquired immunodeficiency syndrome (AIDS)", "HIV infection" and "HIV", as used in the present invention, are described in detail in the third aspect of the invention.

The invention is described through the following examples that are purely illustrative and not limiting of the invention. EXAMPLES

Materials and methods

Patients

The group of patients with HAART interruption has been described in Vallejo et al, 2005 (Vallejo et al, 2005, Viral Immunol 18: 740-6). Until February 2006, 55 Mediterranean white patients with plasma HIV-1 viral load of less than 50 copies / ml for at least the last 12 months, and with a CD4 T cell count above 500 cells / mm ³ At the time of treatment interruption, they participated in the study. TARGA resumed well when the CD4 T cell count reached 250 cells / mm ³ , by clinical progression, or by choice. Ten patients had samples of peripheral blood mononuclear cells (in English, peripheric blood mononuclear cells, PBMCs) available to carry out this study. Informed consent for the collection and analysis of blood samples was obtained from all of them. Their clinical characteristics are shown in Table 3. Table 3: Characteristics of the patients at the beginning of the study.

Code Gender Age Risk Count time CD4 Treatment time (cells / mm ³ ) ^since (months) diagnosis

BL IT RT BL IT TR

 1 M 43 Homo 153 33 40 1083 556 640 161

2 M 41 IDU 33 18 35 1000 331 847 157

3 F 35 Hete 40 22 29 984 418 253 40

4 M 21 Hete 24 39 12 1231 519 827 24

5 M 31 Homo 27 24 22 704 315 765 27

6 M 41 IDU 113 25 20 774 620 720 189

7 M 43 Hete 145 23 25 1169 198 784 155

8 M 41 Homo 176 20 31 1207 471 806 195

9 M 44 IDU 67 14 33 406 295 338 67

10 M 40 UDI 132 16 34 844 123 401 143

BL, start of the study (in English, baseline); IT, treatment interruption; TR, resumption of treatment; Homo, homosexual; Hete, heterosexual; IDU, injecting drug user. The CD4 T cell count was determined in fresh samples by flow cytometry. Plasma HIV-1 RNA was determined by quantitative PCR assay (HIV Monitor ™ Test Kit, Roche Molecular System, Hoffman-La Roche, Basel, Switzerland), following the manufacturer's instructions. This assay has a detection limit of less than 50 copies of HIV-1 / mL RNA. Twenty-four families of TCRVP genes were analyzed in each patient at three different time points, after at least 12 months of effective antiretroviral treatment (referral), at least twelve months of treatment interruption (IT), and at least twelve months after the resumption of treatment (RT). Subset analysis of T cells was performed by flow cytometry at the three time points.

Isolation of the subset of CD8 T cells

PBMCs were isolated from heparinized blood samples and cryopreserved in liquid nitrogen. The subset of CD8 T cells was isolated by immunomagnetic separation technique (Dynabeads, Dynal, Paisley, United Kingdom), using Anti-CD3 and anti-CD8 monoclonal antibodies for positive cell isolation (Dynabeads, CD8 positive cell isolation kit, Dynal), according to the manufacturer's instructions. The cell fraction contained at least 5.1 x 10 ⁶ cells with a purity greater than 98%.

Measurement of CDR3 length variation by multiplex RT-PCR

Total RNA was extracted from the subset of CD8 + T cells using the QIAamp viral RNA Kit (Qiagen Diagnostics, Barcelona, Spain), following the manufacturer's instructions, and the RNA concentration was determined by spectrophotometry (NanoDrop ND-1000).

The CDR3 region of 24 TCRVP families was amplified using a new multiplex RT-PCR strategy to minimize the number of reactions. First, the inventors designed sense primers for 24 νβ families that amplify three different ranges of molecular size (Table 1). The inventors also designed an antisense primer labeled with two different fluorochromes (Cl and C2). To avoid an artificially distorted distribution of CDR3 lengths due to insufficient mRNA, optimization was performed with purified cord blood cells from a healthy donor. It was found that an amount of 100 ng guarantees the production of a Gaussian distribution of the CDR3 length repertoires of the three νβ families amplified in each RT-PCR reaction (Figure 1). To normalize and ensure good mRNA template quality, a region of the GAPDH gene was amplified. In addition, a missing length was repeated twice to confirm the results.

Only eight RT-PCR reactions in multiplex format (R1 to R8) of 24 νβ families were performed with the following primer mixing strategy:

 - Rl: Cl + Vp2 + Vpl5 + Vpl l;

 - R2: C2 + Vpl6 + Vpl0 + Vp9;

 - R3: Cl + Vp3 + Vp6 + Vp27;

- R4: C2 + Vpl8 + Vpl3 + Vp30; - R5: C 1 + Vp4 + Vp 12 + νβ25;

 - R6: C2 + Vpl9 + Vpl4 + Vp23;

 - R7: Cl + Vp5 + Vp28 + Vp24;

 - R8: C2 + Vp29 + Vp20 + Vp7.

High temperature multiplex RT-PCR reactions were carried out in 20 μΐ of reaction mixture containing 100 ng mRNA template, 1 μΜ dNTP (Roche Applied Science), 5x buffer (Roche Applied Science), 20 U inhibitor of RNase (Protector, Roche Applied Science), 10 U reverse transcriptase (Transcriptor, Roche Applied Science), and 1 μΜ of each primer (three primers sense νβ and one antisense primer C). The first reaction cycle was carried out at 42 ° C for 45 min, followed by an inactivation step at 85 ° C for 5 min and 35 cycles consisting of 15 s at 94 ° C, 15 s at 58 ° C and 30 s at 72 ° C, with final extension stage of 7 min at 72 ° C. To analyze the molecular weight spectrum of each νβ family, different amplifications of molecular weight and pigments were combined as follows: Rl + R2, R3 + R4, R5 + R6, and R7 + R8. In just four races using GeneScan-based spectratyping (Genetic Analysis System CEQ 8000, GenomeLab, Beckman Coulter), the entire spectrum of νβ families can be analyzed. 6 μΐ of each reaction was mixed with a sample loading solution and the Standard-400 size marker (GenomeLab, Beckman Coulter), separated by electrophoresis in four runs and analyzed using the Genetic Analysis System CEQ 8000 (GenomeLab, Beckman Coulter) The area under the curve calculated for each CDR3 length in a νβ family was translated into a probability distribution. In general, the length of TCR provides a percentage of the disturbances of the TCR profile (Fig. IB).

Cytometry flow analysis of T cell subsets

The peripheral blood mononuclear cells (PBMCs) of the subjects were incubated with the respective combinations of antibodies for 30 min in phosphate buffer, with 2% albumin and 0.1% sodium azide. The cells were washed and fixed with 1% paraformaldehyde, and analyzed with a multiparameter flow cytometer (Gallios, Beckman Coulter). Subsets of T cells were defined as follows way: CD8, CD3 + CD8 + CD45RA + CCR7 + naive cells; memory effector cells (MS), CD3 + CD8 + CD45RA-CCR7- cells, and CD3 + CD8 + CD45RA-CCR7 + central memory (CM) cells. Also, activation levels were analyzed by co-expression of CD38 and HLA-DR, recent thymus production by expression of CD31 in naive CD8 cells (CD45RA + CCR7 +), and apoptosis by PD-1. These parameters were analyzed in CD8 cells with three different TCR families, that is, Vpl4, Vp20 and Vp2.

Statistic analysis

The Friedman test was used to detect significant differences during follow-up, and the Wilcoxon sign test was applied to examine statistically significant differences in the percentage of expression of νβ families and CDR3 fragments between cell subpopulations. T CD8. Statistical analysis was performed using the statistical package for the Statistical Package for the Social Sciences software package (SPSS 16.0, Chicago, Illinois, USA).

Results

CDR3 profile of the TCR of the Υβ families during follow-up

Figure 1C shows the overall mean proportion of the expression of each TCRVP family of all patients at baseline (BL), treatment interruption (IT) and treatment resumption (RT) is shown in Figure 1C .

As shown in Figure 2, the expression of the TCRVpiO families, νβ14 and νβ15 increased significantly in IT compared to BL (p = 0.0017, p = 0.047 and p = 0.007, respectively). Their expressions were restored in the RT, without statistically significant differences with respect to baseline. The same profile was observed with the families νβ9 and νβΐ 1, although without statistical significance (results not shown). On the other hand, the expression of the νβ20, νβ28 and νβ29 families decreased significantly in IT with respect to the BL (p = 0.007, p = 0.007, p = 0.006, respectively), while the restoration was observed in its expression in RT , without a statistical difference compared to the baseline value (Figure 2). A similar trend was observed in the νβ5 and νβ24 families during follow-up, with no statistical significance (not shown). The differences in the proportion of the expression of the rest of the νβ families were not significant in IT or in RT with respect to baseline.

TCRVP expression according to the duration of antiretroviral treatment

The expression of the νβ families was analyzed according to the duration of the patients' antiretroviral treatment. Patients with a longer initial period of antiretroviral treatment (BL, greater than average) showed significant differences between IR and RT, compared to BL, while patients with a longer initial period of antiretroviral treatment (below the mean) showed no significant differences in these time points with respect to the BL (Figure 3). In addition, the νβ9 and νβΐ ΐ families increased significantly in IT only in those patients with a longer initial period of antiretroviral treatment, compared to BL (data not shown).

Analysis of subpopulations of CD8 + T cells in the disturbed familiasβ families To study the possible mechanisms that could explain the evolution of the disturbed νβ families, we analyzed the proportion of subpopulations of CD8 + T cells, recent thymic production, cell activation, apoptosis and memory cells within the TCR \ ^ 14 and TCR \ ^ 20 families disturbed. In addition, all these parameters were analyzed in CD8 + T cells with TCR \ ^ 2 family as control.

As shown in Figure 4, the proportion of CD8 + νβ14 cells increased significantly (p = 0.023) in IT, while it decreased in CD8 + νβ20 cells (p = 0.04), compared to baseline. In contrast, no differences were observed in the proportion of CD8 + νβ2 cells. These proportions were not different in RT from baseline. Cellular activation increased significantly in the three subpopulations of CD8 + T cells studied in IT, although the activation levels of these populations were significantly different, showing Υβ20 cells the highest level and cells νβ14 the lowest level (Figure 4). This correlated with the level of PD-1 expression in activated cells and, therefore, this level was increased in IT, both in νβ20 and νβ2 cells, but no significant differences were found in νβ14 cells. Again, the level of PD-1 in activated cells νβ20 was higher than in activated cells νβ2, although not significantly. In RT, these levels were only significantly different compared to the baseline values in νβ20 cells (Figure 4).

Recent thymic production decreased in IT compared to baseline in νβ20 and νβ2 cells (only in νβ20 cells was statistically significant), and no changes were observed in νβ14 cells. The restoration of RT levels with respect to baseline was achieved in the three subpopulations of CD8 + T cells (Figure 5).

The proportion of memory effector cells in these three subpopulations of CD8 + T cells increased in IT significantly, although this increase was smaller compared to Υβ14, Υβ20 and Υβ2 cells (Figure 5).

Claims

1. Composition or kit for analyzing the repertoire of T cells in a sample comprising

 i) a plurality of sense primers, where each of said primers hybridizes specifically with segment V of a gene encoding a β chain of the TCR,

 ii) a first antisense primer labeled with a first detectable label, wherein said hybrid primer specifically with segment C of the gene encoding the β chain of the TCR and,

 iii) a second antisense primer that hybridizes specifically with the same region as primer (ii), which is labeled with a second detectable label. 2. Composition or kit according to claim 1 wherein the plurality of sense primers comprises 24 primers.

3. Composition or kit according to claim 2 wherein each of the 24 sense primers hybridizes specifically with a segment V that is part of the gene that codes for the β chain of TCRs 2, 3.1, 4.1, 5.1, 6.1, 7.1, 9, 10.1, 11, 12.3,

13, 14, 15, 16, 18, 19, 20, 23 24, 25, 27, 28, 29 and 30.

4. Composition or kit according to claim 3 wherein the primers comprise the sequences identified in SEQ ID NO: the 24 or variants of said sequences that retain the ability to specifically hybridize with each of the V segments that are part of the gene encoding for the β chain of the TCR with which they hybridize the sequences identified in SEQ ID NO: 24.

5. Composition or kit according to any one of claims 1 to 4, wherein the first and second antisense primers comprise the sequence SEQ ID NO: 25 or variants of said primers that retain the ability to hybridize specifically with each of corresponding C segments that are part of the gene that codes for the TCR β chain.

Composition or kit according to any of the preceding claims wherein the primers are grouped in 8 different containers, wherein the different containers contain

 (i) the primers comprising the sequences SEQ ID NO: 1, SEQ ID NO: 11 and SEQ ID NO: 17 and the primer comprising the sequence SEQ ID NO: 25 labeled with 5-FAM or variants of said primers that retain the ability to hybridize specifically with each of the corresponding V or C segments that are part of the gene that codes for the β chain of the TCR;

 (ii) the primers comprising the sequences SEQ ID NO: 5, SEQ ID NO: 13 and SEQ ID NO: 22 and the primer comprising the sequence SEQ ID NO: 25 labeled with TAMRA or variants of said primers that retain capacity to specifically hybridize with each of the corresponding V or C segments that are part of the gene that codes for the TCR β chain;

 (iii) the primers comprising the sequences SEQ ID NO: 2, SEQ ID NO: 9 and SEQ ID NO: 20 and the primer comprising the sequence SEQ ID NO: 25 labeled with 5-FAM or variants of said primers that retain the ability to hybridize specifically with each of the corresponding V or C segments that are part of the gene that codes for the β chain of the TCR;

 (iv) primers comprising the sequences SEQ ID NO: 6, SEQ ID NO: 14 and SEQ ID NO: 24 and the primer comprising the sequence SEQ ID NO: 25 labeled with TAMRA or variants of said primers that retain capacity to specifically hybridize with each of the corresponding V or C segments that are part of the gene that codes for the TCR β chain;

(v) the primers comprising the sequences SEQ ID NO: 3, SEQ ID NO: 10 and SEQ ID NO: 19 and the primer comprising the sequence SEQ ID NO: labeled with 5-FAM or variants of said primers that retain the ability to hybridize specifically with each of the corresponding V or C segments that are part of the gene encoding the β chain of the TCR;

 (vi) primers comprising the sequences SEQ ID NO: 7, SEQ ID

NO: 15 and SEQ ID NO: 23 and the primer comprising the sequence SEQ ID NO: 25 labeled with TAMRA or variants of said primers that retain the ability to specifically hybridize with each of the corresponding V or C segments that are part of the gene coding for the β chain of the TCR;

 (vii) the primers comprising the sequences SEQ ID NO: 4, SEQ ID NO: 12 and SEQ ID NO: 18 and the primer comprising the sequence SEQ ID NO: 25 labeled with 5-FAM or variants of said primers that retain the ability to hybridize specifically with each of the corresponding V or C segments that are part of the gene that codes for the TCR β chain and

 (viii) the primers comprising the sequences SEQ ID NO: 8, SEQ ID NO: 16 and SEQ ID NO: 21 and the primer comprising the sequence SEQ ID NO: 25 labeled with TAMRA or variants of said primers that retain capacity to specifically hybridize with each of the corresponding V or C segments that are part of the gene that codes for the β chain of the TCR.

Composition or kit according to any of the preceding claims, further comprising at least one additional primer that hybridizes with the C segment of the gene encoding the β chain of the TCR.

8. Composition or kit according to claim 7, wherein the sequence of said at least one additional primer comprises SEQ ID NO: 26 and / or SEQ ID NO: 27 or variants of said primers that retain the ability to specifically hybridize with said constant regions segment C of the gene encoding the β chain of the TCR. Composition or kit according to any one of claims 1 to 8, further comprising

 the reagents necessary to amplify cDNA, and / or

 the reagents necessary to perform reverse RNA transcription reactions.

10. Method for analyzing the repertoire of T cells in a sample comprising the steps of

 (i) amplifying a cDNA preparation obtained from RNA isolated from said sample using a multiplicity of sense primers, where each of said primers specifically hybridizes with the V segment of the gene encoding the TCR β chain and two antisense primers that specifically hybridize with the CP constant region of the TCR where each of said antisense primers is labeled with a distinct detectable label, and

 (ii) analyze the number of amplification products obtained in step (i).

11. The method according to claim 10 wherein the amplification of step (i) is carried out in several reactions using in each of the pairs reactions of sense-antisense primers that give rise to amplification products that are distinguishable from the rest of amplification products obtained in the same reaction based on size and / or based on the detectable label.

12. Method according to claim 11 wherein the pairs of sense-antisense primers are grouped into 8 multiplex PCR reactions.

13. A method according to any of claims 10 to 12 wherein the plurality of sense primers comprises 24 primers. 14. A method according to claim 13 wherein each of the 24 sense primers specifically hybridizes with a segment V that is part of the gene encoding the β chain of TCRs 2, 3.1, 4.1, 5.1, 6.1, 7.1, 9, 10.1, 11, 12.3, 13, 14, 15, 16, 18, 19, 20, 23 24, 25, 27, 28, 29 and 30.

15. Method according to claim 14 wherein the primers comprise the sequences identified in SEQ ID NO: the 24 or variants of said sequences that retain the ability to specifically hybridize with each of the V segments that are part of the gene encoding the β chain of the TCR with which they hybridize the sequences identified in SEQ ID NO: 24.

16. The method of claim 15 wherein each of the multiplex PCR reactions comprises

 - at least one sense primer with sequence identified in SEQ ID NO: 1 to 8, or variants thereof that retain the ability to specifically hybridize each of corresponding V segments that are part of the gene encoding the β chain of the TCR,

 at least one sense primer with sequence identified in SEQ ID NO: 9 to 16, or variants thereof that retain the ability to specifically hybridize each of corresponding V segments that are part of the gene encoding the TCR β chain,

 at least one sense primer with sequence identified in SEQ ID NO: 17 to 24, or variants thereof that retain the ability to specifically hybridize each of corresponding V segments that are part of the gene encoding the TCR β chain, and

 - an antisense primer with sequence identified in SEQ ID NO: 25 marked with 5-FAM or SEQ ID NO: 25 marked with TAMRA. 17. Method according to claim 16 wherein each of the multiplex PCR reactions is carried out using the following primer combinations

 - Rl: SEQ ID NO: l + SEQ ID NO: 11 + SEQ ID NO: 17 + SEQ ID NO: 25 marked with 5-FAM;

 - R2: SEQ ID NO: 5 + SEQ ID NO: 13 + SEQ ID NO: 22 + SEQ ID NO: 25 marked with TAMRA;

- R3: SEQ ID NO: 2 + SEQ ID NO: 9 + SEQ ID NO: 20 + SEQ ID NO: 25 marked with 5-FAM; - R4: SEQ ID NO: 6 + SEQ ID NO: 14 + SEQ ID NO: 24 + SEQ ID NO: NO: 25 marked with TAMRA;

 - R5: SEQ ID NO: 3 + SEQ ID NO: 10 + SEQ ID NO: 19 + SEQ ID NO: 25 marked with 5-FAM;

 - R6: SEQ ID NO: 7 + SEQ ID NO: 15 + SEQ ID NO: 23 + SEQ ID NO: NO: 25 marked with TAMRA;

 - R7: SEQ ID NO: 4 + SEQ ID NO: 12 + SEQ ID NO: 18 + SEQ ID NO: 25 marked with 5-FAM;

 - R8: SEQ ID NO: 8 + SEQ ID NO: 16 + SEQ ID NO: 21 + SEQ ID NO: NO: 25 marked with TAMRA,

 or variants of said primers that retain the ability to hybridize specifically with each of corresponding V or C segments that are part of the gene encoding the β chain of the TCR. 18. Method according to any of claims 10 to 17 wherein the analysis of the amplification products obtained from step (ii) is carried out by determining the size and / or the marking of each of the amplification products obtained in each of the amplification reactions. 19. Method according to claim 18 wherein the amplification products obtained in each of the amplification reactions are combined according to the size and / or the marking.

20. Method according to claim 19 wherein said combination is carried out from the amplification products obtained from the Rl and R2 reactions, the amplification products obtained from the R3 and R4 reactions, the amplification products obtained from the reactions R5 and R6 and the amplification products obtained from reactions R7 and R8. 21. Method according to any of the preceding claims, further comprising additional amplification of the cDNA using at least one additional primer that hybridizes with the C segment of the gene encoding the β chain of the TCR. In a preferred embodiment,

22. The method of claim 21, wherein the sequence of said at least one additional primer comprises SEQ ID NO: 26 and / or SEQ ID NO: 27, or variants of said primers that retain the ability to hybridize specifically with the corresponding region of the segment C of the gene that codes for the constant region of the β chain of the TCR.

23. Method according to any of claims 10 to 22 wherein the sample is a peripheral blood sample. 24. A method according to claim 23 wherein said sample is a peripheral blood sample enriched in CD4 + or CD8 + cells.

Use of the composition or kit according to any of claims 1 to 9, or of the method according to any of claims 10 to 24, in the diagnosis of a pathology.

Method for monitoring the evolution of a pathology in a patient in response to a treatment comprising determining the complexity of the repertoire of T cells in a sample of said patient after being subjected to said treatment using a method according to any of claims 10 to 24, where an increase in the complexity of said repertoire with respect to complexity before starting treatment is indicative that the patient responds to said treatment. 27. Method according to claim 26 wherein said pathology is an immunodeficiency.

28. A method according to claim 27 wherein said immunodeficiency is acquired immunodeficiency syndrome (AIDS) or a pathology associated with HIV infection.

29 Method according to claims 26 or 27 wherein the therapy is HAART.