WO2013090897A1 - Using adaptive immunity to detect drug resistance - Google Patents
Using adaptive immunity to detect drug resistance Download PDFInfo
- Publication number
- WO2013090897A1 WO2013090897A1 PCT/US2012/070092 US2012070092W WO2013090897A1 WO 2013090897 A1 WO2013090897 A1 WO 2013090897A1 US 2012070092 W US2012070092 W US 2012070092W WO 2013090897 A1 WO2013090897 A1 WO 2013090897A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- drug
- mtb
- cell
- resistant
- polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/5695—Mycobacteria
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2800/00—Detection or diagnosis of diseases
- G01N2800/44—Multiple drug resistance
Definitions
- Mycobacterium tuberculosis is a transmissible human pathogen that can cause either latent (asymptomatic) infection or active TB disease (TB). Nearly one third of the world's population is estimated to be infected with MTB (including both latent and active infections), and while progress is being made in terms of control of drug-susceptible TB (Lonnroth et al, 2010 Lancet 375: 1814-29), 9.4 million cases of TB were identified and treated world-wide in 2008 (WHO Global tuberculosis control: short update to 2009 report; In: Organization WH, editor.
- MDR-TB multi-drug resistant TB
- MDR-TB appears under control in some countries, in other settings rates of MDR-TB among all cases of TB are alarming. For example, in two provinces in China and in nine countries of the former Soviet Union, > 7% of all new cases of active TB disease were MDR-TB (Wright et al, 2009, Lancet 373(9678): 1861-73). Although drug sensitive active TB disease can be cured in 6 months, treatment of MDR-TB requires use of costly, toxic, and often ineffective second-line
- M/XDR-TB Multi-drug and extensively drug- resistant TB
- Drug resistance in MTB is due primarily to single nucleotide polymorphisms in genes encoding key mycobacterial enzymes (Blanchard, 1996, Annu Rev Biochem 65:215-39).
- the rpoB gene encodes the ⁇ -subunit of bacterial RNA polymerase, which is the target of rifampicin (Campbell et al, 2001, Cell 104:901-12; Jin and Gross, 1988, J Mol Biol 202:45-58). Mutations in this gene account for over 95% of clinical cases of rifampicin resistance (Telenti et al, 1993, Lancet 341 :647-50) and are commonly associated with the presence of MDR-TB (Geffen, 2010.
- rpoB mutation may have analogous effects on specific gene upregulation in MTB.
- the MTB genome has an extensive array of polyketide synthase genes (Cole, Set al, 1998, Nature 393 :537-44), which have been shown in other bacteria to be involved in the biosynthesis of secondary metabolites, including rifamycins (Gokhale et al, 2007, Nat Prod Rep 24:267-77).
- rpoB is an essential gene in MTB and clinically relevant rpoB mutations occur near the DNA-RNA channel of bacterial RNA polymerase (Campbell et al, 2001, Cell 104:901-12; Sassetti et al., 2003, Mol Microbiol 48:77-84).
- TST tuberculin skin test
- IFN- ⁇ interferon gamma
- the invention provides a method of detecting an immune response against any antigen that is expressed differentially between a drug-resistant strain compared to a corresponding drug-susceptible strain for the diagnosis of an infection with a drug resistant strain.
- the invention provides a method of assessing microbial infection in a mammal comprising: a) contacting at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain with a biological sample from the mammal; and b) measuring an immune response in the biological sample wherein an increase in the immune response to the at least one polypeptide that is differentially expressed in a drug- resistant strain compared to a corresponding drug-susceptible strain with a biological sample from the mammal indicates a past or present microbial infection with a drug- resistant strain.
- the microbial infection is M. tuberculosis infection.
- the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain is selected from the group consisting of SEQ ID NOs: 1-98 or a fragment thereof.
- the immune response is at least one selected from the group consisting of a cell-mediated response and a humoral response.
- the biological sample comprises at least one selected from the group consisting of whole blood, serum, plasma, and peripheral blood mononuclear cells.
- the cell-mediated response is a T cell response.
- the T cell response is measured by detecting expression of a marker for T cell activation or proliferation.
- the T cell response is measured by detecting secretion of a cytokine.
- the humoral response is measured by a) contacting the biological sample of the mammal with the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug- susceptible strain for a sufficient amount of time to allow complex formation between the at least one polypeptide with an antibody present in the biological sample, and b) detecting a complex formed between an antibody in the biological sample and the antigen, wherein detection of the complex is indicative of infection by the drug- resistant strain in the mammal.
- the mammal is a human.
- the mammal is receiving or has previously received a therapeutic intervention.
- the invention also provides a kit for use in determining the presence of a drug-resistant strain in a mammal.
- the kit comprises at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain.
- the drug-resistant strain is M. tuberculosis.
- the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain is selected from the group consisting of SEQ ID NOs: 1-98 or a fragment thereof.
- the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain is used to detect an immune response in a biological sample from a mammal.
- the biological sample comprises at least one selected from the group consisting of whole blood, serum, plasma, and peripheral blood mononuclear cells.
- the immune response is at least one selected from the group consisting of a cell-mediated response and a humoral response.
- the cell-mediated response is measured by detecting expression of a marker for T cell activation or proliferation. In one embodiment, the cell-mediated response is measured by detecting secretion of a cytokine.
- the humoral response is detected by detecting a complex formed between an antibody in the biological sample and the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain.
- Figure 1 is an image depicting a thin layer chromatography of lipid extracts obtained from M. tuberculosis clinical isolates in triplicate from independent cultures. rpoB mutants and wild type isolates for each genotype are shown. A PDIM standard is also shown.
- Figure 2 depicts a heat map of protein detection in rpoB mutant vs. wild-type MTB as determined by summary cell-associated spectral counts in 4 gene clusters detected as possibly involved in natural product biosynthesis by the program NPsearcher.
- the phthioceral dimycoserosate (PDIM) biosynthetic locus is Cluster 4.
- Figure 3 is a series of images demonstrating the effect of a common rpoB mutation, S450L, on MTB gene expression and fitness.
- Figure 3 A depicts the expression of the PDIM biosynthesis locus in the r/ja3-mutant Beijing strain relative to the rifampin-sensitive wild-type parent strain during logarithmic growth in nutrient-rich broth, as measured by RT- PCR.
- Figure 3B depicts gene expression of the same strains after 72 h of infection in activated murine macrophages.
- Figure 3C depicts growth and survival of the rpoB mutant (grey) relative to the Beijing wild-type parent strain (white) in activated murine macrophages.
- Figure 3D depicts RT-PCR analysis of gene expression in a laboratory-generated RpoB S450L mutant relative to the isogenic CDC 1551 wild-type strain during logarithmic growth in nutrient-rich broth.
- the cycle threshold value (CT) obtained for each gene of interest was normalized with that of the housekeeping gene sigA.
- Fold regulation of individual genes was calculated using the following formula: 2-(C(CT)-S(CT)), where C represents the wild-type (control) strain and S represents the rpoB mutant strain. This figure is useful for demonstrating that certain genes are expressed by rpoB mutant MTB differentially in macrophages, which is a natural environment of MTB during human infection.
- the present invention provides compositions and methods for identifying a gene and encoded protein thereof that is associated with drug resistance in a microbial strain (referred elsewhere herein as a drug resistant gene and encoded protein thereof from a drug-resistant microbial strain).
- the method includes identifying a gene in an infectious microbe that is in the process of undergoing transformation from drug sensitivity to drug resistance.
- the method includes identifying a gene in an infectious microbe that has already undergone transformation from a drug sensitive to drug resistant state.
- the invention relates to a method of identifying a gene in a microbe wherein the expression of the gene is modulated when the microbe is drug resistant as compared to the expression of the gene in an otherwise identical microbe not induced to become drug resistant.
- the identified gene can be isolated and accordingly, the invention includes variants, derivatives or fragments of the isolated gene and protein and peptide products, variants and derivatives encoded thereby.
- the drug resistant protein of the invention comprises the amino acid sequence of one or more of the sequences of SEQ ID NOs: 1-98. Also encompassed by the invention are antibodies or cellular immune responses that bind to or target the drug resistance proteins of the invention.
- the invention relates to the comparison of the proteomes and metabolomes of paired wild-type and rpoB- mutant MTB clinical isolates and the identification of compensatory mechanisms important to drug- resistant isolates of this pathogen.
- the products identified at significantly higher spectral counts in the cell wall fraction of a /po5-mutant, rifampicin resistant strain represent proteins that are transcriptionally coupled on a 50- kb region involved in the biosynthesis of PDIM in MTB, including but not limited to two type-I polyketide synthase genes (Rv2933 IppsC and Rv2935 / 'ppsE) and a probable daunorubicin imycoserosate (DIM) transport protein (Rv2936/ ' drr A).
- Other proteins identified in other cellular fractions besides the cell wall include a succinate semialdehyde dehydrogenase (Rv0234c), a putative integration host factor
- the protein and fragments thereof can be used to diagnose whether a mammal, preferably a human, is infected with a drug-resistant form of an infectious microbe.
- a mammal preferably a human
- the drug-resistant form of an infectious microbe is MTB.
- the present invention is based on the concept that the adaptive immune response of a mammal can be used to determine the presence or absence of drug resistance because the immune response is capable of responding to an antigen associated with drug resistance in a microbe.
- the method for identifying current infection by a drug resistant microbe in a mammal relies on detecting a cell-mediated or humoral memory immune response associated with a drug resistant protein of the invention. In other instances, detection of the memory immune response to proteins expressed during drug resistance allows for the identification of a prior drug resistant infection in the mammal.
- the invention includes a method of using immune responses against a drug resistant protein or otherwise a protein associated with drug resistance of the invention comprising the amino acid sequence of one or more of the sequences of SEQ ID NOs: 1-98 in an assay to detect microbial infection in a mammal.
- the method of detecting a microbial infection in a mammal includes isolating whole blood or peripheral blood mononuclear cells (PBMCs) from a mammal and exposing the whole blood or PBMCs to one or more drug resistant proteins of the invention to determine the presence or absence of an immune response against the drug resistant protein. Detection of an immune response against the drug resistant protein is an indication that the mammal is now or has been previously infected with a drug resistant microbe.
- the immune response against the drug resistant protein is a cell-mediated or humoral immune response.
- the invention includes an assay for measuring the magnitude of cellular immunologic responses to proteins upregulated by a drug resistant microbe (e.g., rpoB-mutant, rifampicin resistant MTB and other drug resistance mutations including those associated with aminoglycosides (amikacin, kanamycin), polypeptides (capreomycin, viomycin, enviomycin), Fluoroquinolones (ciprofloxacin, levofloxacin, moxifloxacin), thioamides (ethionamide,
- a drug resistant microbe e.g., rpoB-mutant, rifampicin resistant MTB and other drug resistance mutations including those associated with aminoglycosides (amikacin, kanamycin), polypeptides (capreomycin, viomycin, enviomycin), Fluoroquinolones (ciprofloxacin, levofloxacin, moxifloxacin), thioamides (ethi
- blood is drawn from a patient and the blood is incubated with one or more of the proteins upregulated by the drug resistant microbe. After a period of incubation time, the amount of cytokine is measured to determine the extent of the immune response directed to the one or more of the proteins upregulated by the drug resistant microbe, wherein detection of an immune response indicates that the patient is infected with a drug resistant microbe.
- the invention provides the use of any assay to assess for an immunological response against any antigen that is expressed differentially between a drug-resistant strain compared to a corresponding drug-susceptible strain.
- an element means one element or more than one element.
- “About” as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ⁇ 20% or ⁇ 10%, more preferably ⁇ 5%, even more preferably ⁇ 1%, and still more preferably ⁇ 0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
- abnormal when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the "normal” (expected) respective characteristic. Characteristics which are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type.
- antibody refers to an immunoglobulin molecule, which is able to specifically bind to a specific epitope on an antigen.
- Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules.
- the antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies.
- antigen or "Ag” as used herein is defined as a molecule that provokes an immune response, including both B and T cell responses. This immune response may involve either antibody production, or the activation of specific immunologically-competent cells, or both.
- antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response can encode an "antigen" as that term is used herein.
- an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences can be arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a "gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
- analyte as used herein may be a cell lysate or extract, a tissue lysate or extract, a cell culture supernatant, a tissue culture supernatant, or a body fluid.
- analyte refers to a proteome or a mixture of different proteomes.
- the term "assessing" includes; diagnosing mycobacterial infection manifesting as TB; diagnosing drug resistant latent mycobacterial infection which does not manifest as disease; differentiating between active and latent mycobacterial infection; and monitoring the progress or change in the status of mycobacterial infection over time. In some instances, the change may occur spontaneously or as a result of treatment with a drug or vaccine or a test drug or test vaccine.
- a "coding region" of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.
- a "coding region" of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anti-codon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon.
- the coding region may thus include nucleotide residues corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein export signal sequence).
- Encoding refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom.
- a gene encodes a protein if transcription and translation of mRNA
- both the coding strand the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings
- the non-coding strand used as the template for transcription of a gene or cDNA
- encoding the protein or other product of that gene or cDNA can be referred to as encoding the protein or other product of that gene or cDNA.
- nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
- a “disease” is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
- a disorder in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
- a disease or disorder is "alleviated” if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, is reduced.
- “Differentially increased expression” or “up regulation” refers to biomarker product levels which are at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% higher or more, and/or 1.1 fold, 1.2 fold, 1.4 fold, 1.6 fold, 1.8 fold, 2.0 fold higher or more, and any and all whole or partial increments therebetween than a control.
- “Differentially decreased expression” or “down regulation” refers to biomarker product levels which are at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% lower or less, and/or 2.0 fold, 1.8 fold, 1.6 fold, 1.4 fold, 1.2 fold, 1.1 fold or less lower, and any and all whole or partial increments therebetween than a control.
- an “effective amount” or “therapeutically effective amount” of a compound is that amount of compound which is sufficient to provide a beneficial effect to the subject to which the compound is administered.
- An “effective amount” of a delivery vehicle is that amount sufficient to effectively bind or deliver a compound.
- epitope as used herein is defined as the part of an antigen that elicits an immune response, inducing B and/or T cell responses.
- An antigen can have one or more epitopes. Most antigens have many epitopes; i.e., they are multivalent. In general, an epitope is roughly 8 to 1 1 amino acids and/or sugars in length (for MHC Class I epitopes) or longer (for MHC Class II epitopes).
- MHC Class I epitopes for MHC Class I epitopes
- MHC Class II epitopes for MHC Class II epitopes
- fragment refers to a subsequence of a larger nucleic acid.
- a “fragment” of a nucleic acid can be at least about 15 nucleotides in length; for example, at least about 50 nucleotides to about 100 nucleotides; at least about 100 to about 500 nucleotides, at least about 500 to about 1000 nucleotides, at least about 1000 nucleotides to about 1500 nucleotides; or about 1500 nucleotides to about 2500 nucleotides; or about 2500 nucleotides (and any integer value in between).
- fragment refers to a subsequence of a larger protein or peptide.
- a “fragment” of a protein or peptide can be at least about 20 amino acids in length; for example at least about 50 amino acids in length; at least about 100 amino acids in length, at least about 200 amino acids in length, at least about 300 amino acids in length, and at least about 400 amino acids in length (and any integer value in between).
- immunoglobulin or "Ig”, as used herein is defined as a class of proteins, which function as antibodies.
- the five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE.
- IgA is the primary antibody that is present in body secretions, such as saliva, tears, breast milk, gastrointestinal secretions and mucus secretions of the respiratory and genitourinary tracts.
- IgG is the most common circulating antibody.
- IgM is the main immunoglobulin produced in the primary immune response in most mammals. It is the most efficient immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in defense against bacteria and viruses.
- IgD is the immunoglobulin that has no known antibody function, but may serve as an antigen receptor.
- IgE is the immunoglobulin that mediates immediate hypersensitivity by causing release of mediators from mast cells and basophils upon exposure to allergen.
- infection and/or exposure includes such diverse conditions in a patient as mycobacterial infection resulting in active disease, clearance, or latency, response to anti mycobacterial vaccination, close contact with an individual having or suspected of having a mycobacterial infection or with a mycobacterium that causes disease in humans, including in immunocompromised humans.
- an "instructional material” includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of a compound, composition, vector, or delivery system of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein.
- the instructional material can describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal.
- the instructional material of the kit of the invention can, for example, be affixed to a container which contains the identified compound, composition, vector, or delivery system of the invention or be shipped together with a container which contains the identified compound, composition, vector, or delivery system.
- the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
- isolated means altered or removed from the natural state.
- a nucleic acid or a peptide naturally present in a living animal is not “isolated,” but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is “isolated.”
- An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
- “Naturally occurring” as used herein describes a composition that can be found in nature as distinct from being artificially produced. For example, a nucleotide sequence present in an organism, which can be isolated from a source in nature and which has not been intentionally modified by a person in the laboratory, is naturally occurring.
- nucleotide sequence encoding an amino acid sequence includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence.
- the phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
- nucleic acid as used herein is defined as a chain of nucleotides.
- nucleic acids are polymers of nucleotides.
- nucleic acids and polynucleotides as used herein are interchangeable.
- nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric "nucleotides.”
- the monomeric nucleotides can be hydro lyzed into nucleosides.
- polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.
- recombinant means i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCRTM, and the like, and by synthetic means.
- peptide As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds.
- a protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence.
- Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds.
- the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
- Polypeptides include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
- the polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
- "phenotypically distinct” is used to describe organisms, tissues, cells or components thereof, which can be distinguished by one or more characteristics, observable and/or detectable by current technologies. Each of such characteristics may also be defined as a parameter contributing to the definition of the phenotype. Wherein a phenotype is defined by one or more parameters an organism that does not conform to one or more of the parameters shall be defined to be distinct or distinguishable from organisms of the phenotype.
- patient refers to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein.
- the patient, subject or individual is a mammal, and more preferable, a human.
- proteome refers to the specific protein composition of a cell, tissue or organism. Depending on the individual cells contained therein, a culture of a cell or a tissue could, theoretically, contain as many proteomes as there are cells contained therein. For convenience, the proteomes of one cell culture or one tissue is regarded as representing one proteome. The proteomes of one type of organism may differ from another depending on the status and genomic background of its cells.
- a “reference level” of a marker means a level of the marker that is indicative of a particular disease state, phenotype, or lack thereof, as well as combinations of disease states, phenotypes, or lack thereof.
- a “positive" reference level of a marker means a level that is indicative of a particular disease state or phenotype.
- a “negative” reference level of a marker means a level that is indicative of a lack of a particular disease state or phenotype.
- tuberculosis comprises disease states usually associated with infections caused by mycobacteria species comprising the M. tuberculosis complex, including M. africanum, M. bovis, M. bovis BCG, M. microti,
- M. canetti M. pinnipedii
- M. mungi M. canetti, M. pinnipedii, and M. mungi.
- mycobacterial infection is also associated with mycobacterial infections caused by mycobacteria other than M. tuberculosis (MOTT), including M. avium-intracellular e, M. kansasii, M.fortuitum, M. chelonae, M.
- MOTT mycobacterial tuberculosis
- treatment as used within the context of the present invention is meant to include therapeutic treatment as well as prophylactic, or suppressive measures for the disease or disorder.
- treatment includes the administration of an agent prior to or following the onset of a disease or disorder thereby preventing, decreasing the future risk of, or removing all signs of the disease or disorder.
- administration of the agent after clinical manifestation of the disease to combat the symptoms of the disease comprises "treatment" of the disease.
- a “therapeutic” treatment is a treatment administered to a subject who exhibits symptoms or signs of disease or pathology, for the purpose of diminishing or eliminating those signs.
- treating a disease or disorder means reducing the frequency with which a symptom of the disease or disorder is experienced by a patient.
- Variant is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively. Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Changes in the sequence of peptide variants are typically limited or conservative, so that the sequences of the reference peptide and the variant are closely similar overall and, in many regions, identical. A variant and reference peptide can differ in amino acid sequence by one or more substitutions, additions, deletions in any combination.
- a variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally.
- Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.
- test and reference sequences are input into a computer, subsequent coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
- sequence comparison algorithm calculates the percentage sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
- vaccination is intended for prophylactic or therapeutic vaccination.
- ranges throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
- MTB mycobacteria
- MTB mycobacteria
- the present invention is based on the discovery that differentially expressed genes and encoded proteins thereof (e.g., a candidate antigen) between a drug-susceptible MTB strain and a corresponding drug-resistant MTB strain can be readily identified. Accordingly, the invention provides compositions and methods for identifying a novel drug-resistant antigen and, thereby, a drug resistant infection.
- a candidate antigen e.g., a candidate antigen
- the present invention also relates to a comprehensive comparison of proteomes and metabolomes between rpoB mutant, rifampicin resistant MTB with those of their paired wild-type, rifampicin susceptible parent strains which identified several genes, particularly those involved in secondary metabolism such as genes involved in the biosynthesis of cell wall lipids including phthiocerol dimycocerosate (PDIM), that are upregulated in rpoB mutants, both in broth culture and, in particular, when grown in murine macrophages.
- PDIM phthiocerol dimycocerosate
- the products identified at significantly higher spectral counts in the cell wall fraction of a rpoB mutant, rifampicin-resistant strain represent proteins that are transcriptionally coupled on a 50-kb region involved in the biosynthesis of phthiocerol dimycocerosate (PDIM) in Mtb, including two type-I polyketide synthase genes (including Rv2933 / 'ppsC and Rv2935/ppsE) and a probable daunorubicin imycoserosate (DIM) transport protein (Rv2936/ ' drr ⁇ ).
- PDIM phthiocerol dimycocerosate
- phosphorylase/polyadenylase (Rv2783c/g s/) involved in mRNA degradation.
- three products identified as (Rvl056, Rv3038c, and Rv3661) which are conserved hypotheticals of unknown function, are also included in the invention as examples of a drug-resistant protein.
- the invention includes a method of determining whether a drug- resistant mutant strain derived from a drug-susceptible strain expresses different genes and encoded proteins compared to the drug-susceptible strain. In one embodiment, the method identifies a gene and encoded protein that is present in the mutant drug- resistant strain but is absent in corresponding wild-type drug-susceptible strains. In another embodiment, the invention provides a method of distinguishing between a drug-susceptible and a drug-resistant strain of mycobacteria.
- the antigen can be used to diagnose, treat and prevent mycobacterial drug-resistant infection, whether latent or active.
- the gene and encoded protein associated with drug-resistance in mycobacteria of the invention can be used for diagnosing, treating and preventing mycobacterial drug-resistant infection (latent or active) in a mammal.
- the mammal is human.
- the invention includes a method of using the immune response against a protein that is differentially expressed in a drug resistant strain compared to a corresponding wild type strain.
- the differentially expressed protein in the drug resistant strain is considered to be a drug resistant antigen of the invention that can be assayed for the presence thereof in a biological sample from a mammal to detect microbial infection in the mammal.
- the invention includes a method of using an immune response against an antigen of the invention comprising the amino acid sequence of one or more of the sequences of SEQ ID NOs: 1-98 in an assay to detect microbial infection in a mammal.
- the method of detecting a microbial infection in a mammal includes isolating whole blood or specifically peripheral blood mononuclear cells (PBMCs) from a mammal and exposing the blood or PBMCs to one or more drug resistant proteins of the invention to determine the presence or absence of an immune response against the drug resistant protein.
- PBMCs peripheral blood mononuclear cells
- Detection of an immune response against the drug resistant protein is an indication that the mammal is now or has been previously infected with a drug resistant microbe.
- the immune response against the drug resistant protein is a cell-mediated or humoral immune response.
- the invention includes an assay for measuring the magnitude of cellular immunologic responses to proteins upregulated by a drug resistant microbe (e.g., rpoB mutant, rifampicin resistant MTB but can include resistance to any antibiotic used to treat TB infection).
- a drug resistant microbe e.g., rpoB mutant, rifampicin resistant MTB but can include resistance to any antibiotic used to treat TB infection.
- blood is drawn from a patient and the blood is incubated with one or more of the proteins, peptide pools, select antigenic peptides, or other methods used to deliver a protein for immunologic presentation, upregulated by the drug resistant microbe (i.e., a drug- resistant antigen of the invention).
- the amount of cytokine or the number of antigen-specific PBMCs secreting one or more cytokines is measured to determine the extent of the immune response directed to the one or more of the proteins upregulated by the drug resistant microbe, wherein detection of an immune response indicates that the patient is infected with a drug resistant microbe.
- one or more of the genes and encoded proteins associated with drug-resistance in mycobacteria of the invention can be used as an immunological composition.
- the protein or otherwise antigen of the present invention can be used as a vaccine for targeting drug-resistant mycobacteria in a mammal.
- Another example is use of the protein or otherwise antigen of the present invention to detect immune responses in a mammal, in order to determine if the mammal's infection is drug resistant.
- the invention includes compositions and methods for determining whether a drug-resistant progeny strain expresses different genes and encoded proteins compared to that of a corresponding drug-susceptible strain.
- the invention contemplates the identification of differentially expressed markers by whole genome nucleic acid microarray, to identify markers differentially expressed between a drug-resistant progeny strain and a corresponding drug-susceptible strain.
- the invention further contemplates using methods known to those skilled in the art to detect and to measure the level of differentially expressed marker expression products, such as RNA and protein, to measure the level of one or more differentially expressed marker expression products.
- Typical diagnostic methods focusing on nucleic acids include amplification techniques such as PCR and RT-PCR (including quantitative variants), and hybridization techniques such as in situ hybridization, microarrays, blots, and others.
- Typical diagnostic methods focusing on proteins include binding techniques such as ELISA, imunohistochemistry, microarray and functional techniques such as enzymatic assays.
- the genes identified as being differentially expressed may be assessed in a variety of nucleic acid detection assays to detect or quantify the expression level of a gene or multiple genes in a given sample.
- nucleic acid detection assays For example, traditional Northern blotting, nuclease protection, RT-PCR, microarray, and differential display methods may be used for detecting gene expression levels.
- Methods for assaying for mRNA include Northern blots, slot blots, dot blots, and hybridization to an ordered array of oligonucleotides. Any method for specifically and quantitatively measuring a specific protein or mRNA or DNA product can be used. However, methods and assays are most efficiently designed with array or chip hybridization-based methods for detecting the expression of a large number of genes. Any hybridization assay format may be used, including solution-based and solid support-based assay formats.
- the protein products of the genes identified herein can also be assayed to determine the amount of expression.
- Methods for assaying for a protein include Western blot, immunoprecipitation, and radioimmunoassay.
- the proteins analyzed may be localized intracellularly (most commonly an application of
- immunohistochemistry or extracellularly (most commonly an application of immunoassays such as ELISA).
- the method comprises screening for a drug- resistance gene and encoded protein from a MTB strain that is resistant to rifampicin (RFP, 3-(4-Methyl-l-piperaziny]imino]methyl)-rifamycin).
- RFP rifampicin
- the invention is not limited to rifampicin. That is, rifampicin is merely used as a non-limiting example. Therefore, any antitubercular drug resistance is applicable to the present invention.
- the method comprises culturing MTB isolates (e.g., a drug-susceptible parent isolate and a drug-resistance progeny isolate) under the same conditions with drug or without drug and comparing differentially expressed genes and encoded proteins.
- the proteome of each cell lysate from each MTB isolate culture is compared to identify differentially expressed proteins.
- a comparison of the in vitro proteome of the cell lysates derived from a drug-susceptible strain of MTB and a laboratory-derived rifampicin-resistant mutant strain derived from the parent strain cultured in the presence and absence of rifampicin can be obtained using a standardêteomic analysis methodology.
- the invention provides a method of screening for a drug-resistant protein in a microbe (e.g., MTB) using proteomic technology.
- a microbe e.g., MTB
- proteome characteristics of the microbe can be compared with each other to generate a comparative proteome profile.
- the comparative proteome profile can be used to determine differentially expressed proteins between the microbial strains. For example, using comparative proteome analysis, a protein in an infectious microbe that is undergoing or has undergone transformation from drug sensitivity to drug resistance can be identified.
- the invention also includes a method for mass spectrometry analysis for determining the proteome profile for the desired microbe.
- mass spectrometry encompasses any spectrometric technique or process in which molecules are ionized and separated and/or analyzed based on their respective molecular weights.
- mass spectrometry encompasses any type of ionization method, including without limitation electrospray ionization (ESI), atmospheric -pressure chemical ionization (APCI) and other forms of atmospheric pressure ionization (API), and laser irradiation.
- ESI electrospray ionization
- APCI atmospheric -pressure chemical ionization
- API atmospheric pressure ionization
- Mass spectrometers are commonly combined with separation methods such as gas chromatography (GC) and liquid chromatography (LC).
- GC or LC separates the components in a mixture, and the components are then individually introduced into the mass spectrometer; such techniques are generally called GC/MS and LC/MS, respectively.
- MS/MS is an analogous technique where the first-stage separation device is another mass spectrometer.
- the separation methods comprise liquid chromatography and MS. Any combination (e.g.,
- MS can refer to any form of mass spectrometry; by way of non-limiting example, “LC/MS” encompasses LC/ESI MS and LC/MALDI-TOF MS.
- mass spectrometry and “MS” include without limitation APCI MS; ESI MS; GC MS; MALDI-TOF MS; LC/MS combinations; LC/MS/MS combinations; MS/MS combinations; etc.
- MS MS-specific chromatography
- High-pressure liquid chromatography is a separative and quantitative analytical tool that is generally robust, reliable and flexible.
- Reverse- phase is a commonly used stationary phase that is characterized by alkyl chains of specific length immobilized to a silica bead support.
- RP-HPLC is suitable for the separation and analysis of various types of compounds including without limitation biomolecules, (e.g., glycoconjugates, proteins, peptides, and nucleic acids, and, with mobile phase supplements, oligonucleotides).
- biomolecules e.g., glycoconjugates, proteins, peptides, and nucleic acids, and, with mobile phase supplements, oligonucleotides.
- ESI electrospray ionization
- peptides and proteins are injected into a column, typically silica based C18.
- An aqueous buffer is used to elute the salts, while the peptides and proteins are eluted with a mixture of aqueous solvent (water) and organic solvent (acetonitrile, methanol, propanol).
- the aqueous phase is generally HPLC grade water with 0.1% acid and the organic solvent phase is generally an HPLC grade acetonitrile or methanol with 0.1% acid.
- the acid is used to improve the chromatographic peak shape and to provide a source of protons in reverse phase LC/MS.
- the acids most commonly used are formic acid, trifluoroacetic acid, and acetic acid.
- MALDI-TOF MS matrix-assisted laser desorption time-of- flight mass spectrometry
- MALDI-TOF MS matrix-assisted laser desorption time-of- flight mass spectrometry
- analyte matrix crystals.
- the crystals are irradiated by a nanosecond laser pulse. Most of the laser energy is absorbed by the matrix, which prevents unwanted fragmentation of the biomolecule. Nevertheless, matrix molecules transfer their energy to analyte molecules, causing them to vaporize and ionize.
- the ionized molecules are accelerated in an electric field and enter the flight tube. During their flight in this tube, different molecules are separated according to their mass to charge (m/z) ratio and reach the detector at different times. Each molecule yields a distinct signal.
- the method is used for detection and characterization of biomolecules, such as proteins, peptides, oligosaccharides and oligonucleotides, with molecular masses between about 400 and about 500,000 Da, or higher.
- MALDI-MS is a sensitive technique that allows the detection of low quantities of analyte in a sample.
- Partial amino acid sequences of proteins can be determined by enzymatic proteolysis followed by MS analysis of the product peptides. These amino acid sequences can be used for in silico examination of DNA and/or protein sequence databases. Matched amino acid sequences can indicate proteins, domains and/or motifs having a known function and/or tertiary structure. For example, amino acid sequences from an uncharacterized protein might match the sequence or structure of a domain or motif that binds a ligand. As another example, the amino acid sequences can be used in vitro as antigens to generate antibodies to the protein and other related proteins from other biological source material (e.g., from a different tissue or organ, or from another species). There are many additional uses for MS, particularly
- MALDI-TOF MS in the fields of genomics, proteomics and drug discovery.
- MALDI-TOF MS in the fields of genomics, proteomics and drug discovery.
- Tryptic peptides can be directly analyzed using MALDI-TOF.
- LC-MS/MS may be necessary to separate the peptides.
- a gradient of 5-45% (v/v) acetonitrile in 0.1% formic acid (or TFA, if MALDI MS/MS is available) over 45 min, and then 45-95%> acetonitrile in 0.1% formic acid (or TFA, if MALDI MS/MS is available) over 5 min can be used.
- Formic acid solution is used on the Q-TOF instrument and 0.1% TFA solution is used on the Dionex Probot fraction collector for off-line coupling between HPLC and MALDI-MS/MS analysis (carried out on the ABI 4700).
- TFA solution is used on the Dionex Probot fraction collector for off-line coupling between HPLC and MALDI-MS/MS analysis (carried out on the ABI 4700).
- For a complex sample a gradient of 5-45% (v/v) acetonitrile over 90 min, and then 45-95% acetonitrile over 30 min can be used.
- For a very complex sample a gradient of 5-45% (v/v) acetonitrile over 120 min, and then 45-95% acetonitrile over 60 min might be used.
- On the Q- TOF one survey scan and four MS/MS data channels are used to acquire CID data with 1.4 s scan time.
- the invention comprises any method known in the art to effectively detect an antigen, an antibody, or an antigen-antibody complex in a sample. Suitable methods include, but are not limited to, immunoassays, enzyme assays, mass spectrometry, biosensors, and chromatography. Thus, the invention includes the use of any type of instrumentality to detect a desired antigen, antibody, or antigen-antibody complex in a sample.
- an immunoassay can be an enzyme-linked immunosorbant immunoassay (ELISA), a sandwich assay, a competitive assay, a radioimmunoassay (RIA), a lateral flow immunoassay, a Western Blot, an enzyme-linked immunosorbant immunoassay (ELISA), a sandwich assay, a competitive assay, a radioimmunoassay (RIA), a lateral flow immunoassay, a Western Blot, an enzyme-linked immunosorbant immunoassay (ELISA), a sandwich assay, a competitive assay, a radioimmunoassay (RIA), a lateral flow immunoassay, a Western Blot, an enzyme-linked immunosorbant immunoassay (ELISA), a sandwich assay, a competitive assay, a radioimmunoassay (RIA), a lateral flow immunoassay, a Western Blot, an enzyme-linked immunosorbant immunoassay (ELISA), a sandwich assay, a
- the antigen may be used to diagnose, treat and prevent mycobacterial drug-resistant infection, whether active or latent.
- the invention provides compositions comprising a unique protein or proteins or otherwise an antigen or group of antigens preferentially expressed by a drug-resistant infected cell.
- the antigen or antigens of the present invention are recognized by the host's adaptive immune system.
- the antigen is recognized by a cell-mediated immune response, although the invention also includes approaches based on the humoral immune system as well.
- the antigen of the present invention is a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-98, or any combination thereof.
- the present invention provides a method for using the antigen or antigens of the present invention to detect drug resistance in a pathogenic microbe or infection of a pathogenic microbe.
- the microbe is MTB.
- the method includes detecting MTB exposure or infection in a test biological sample using an antigen or antigens of the invention or fragment(s) thereof. Other known MTB antigens may be used in combination with the antigens of the invention.
- Cellular immune-based assays have been developed and are used in the clinical setting. Measurement of cell-mediated immune responses is important for immune diagnosis of many infectious and autoimmune diseases, as a marker for detection of T-cell responses to an antigen.
- Current methods for detecting cell- mediated immune responses include skin tests measuring both immediate and delayed type hypersensitivity, lymphocyte proliferation assays and measurement of cytokines produced by purified mononuclear cells cultured with antigen.
- Most in vitro methods for detecting cell-mediated immune responses involve the purification of lymphocytes from whole blood, culturing these lymphocytes with an antigen for periods from 12 hours to 6 days and then detecting T-cell reactivity to the antigen.
- T-cells use the uptake of radioactive isotopes by dividing T-cells as a marker for cell mediated immune response reactivity. More recently, techniques such as a single cell assay (ELISpot) have been used to detect the number of T-cells producing certain cytokines in response to the antigenic stimulation.
- ELISpot single cell assay
- the present invention provides a method for measuring cell-mediated immune responses in a subject by incubating a sample from the subject which comprises T-cells or other cells of the immune system with an antigen. Production of IFN-gamma or other cytokine or immune effector molecule(s) is then detected. The presence or level of immune effector is then indicative of the level of cell mediated responsiveness of the subject.
- one aspect of the present invention contemplates a method for measuring a cell mediated immune response in a subject.
- the method comprises collecting a sample from the subject wherein the sample comprises cells of the immune system which are capable of producing immune effector molecules following stimulation by an antigen, incubating the sample with an antigen and then measuring the presence of or elevation in the level of an immune effector molecule wherein the presence or level of the immune effector molecule is indicative of the capacity of the subject to mount a cell-mediated immune response.
- the present invention provides a method for measuring a cell mediated immune response in a human subject, the method comprising collecting a sample from the human subject wherein the sample comprises cells of the immune system which are capable of producing immune effector molecules following stimulation by an antigen, incubating the sample with an antigen and then measuring the presence of or elevation in the level of an immune effector molecule wherein the presence or level of said immune effector molecule is indicative of the capacity of the human subject to mount a cell-mediated immune response.
- the immune effector molecules may be any of a range of molecules which are produced in response to cell activation or stimulation by an antigen.
- an interferon such as IFN- ⁇ is a particularly useful immune effector molecule
- others include a range of cytokines such as interleukins (IL), e.g. IL-2, IL- 4, IL-10 or IL-12, tumor necrosis factor alpha (TNF-alpha), a colony stimulating factor (CSF) such as granulocyte (G)-CSF or granulocyte macrophage (GM)-CSF amongst many others including chemokines, proteins associated with degranulation (CD 107a), and proteins associated with lysis (granzyme, perforin).
- IL interleukins
- IL-2 interleukins
- IL- 4 tumor necrosis factor alpha
- CSF colony stimulating factor
- G granulocyte
- GM granulocyte macrophage
- the present invention provides a method for measuring a cell-mediated immune response in a subject, said method comprising collecting a sample from the subject wherein the sample comprises cells of the immune system which are capable of producing IFN-gamma molecules following stimulation by an antigen, incubating the sample with an antigen and then measuring the presence of or elevation in the level of an IFN-gamma molecule wherein the presence or level of the IFN-gamma molecule is indicative of the capacity of said subject to mount a cell-mediated immune response.
- ELISpot enzyme-linked immunospot
- ELISA enzyme-linked immunoassay
- the invention is not limited to these assays, but rather, the protein antigens of the present invention can be used in any assay in the art for immunologically detecting an infectious agent that has developed drug resistance.
- the present invention provides assays for detecting drug resistance in MTB using adaptive immune responses.
- the assays of the invention can be integrated into existing "in-tube” cellular assays, for example, simply by adding the drug- resistance antigen(s) of the present invention in an additional tube. Because these "in- tube” assays have been shown to be cost effective in resource limited settings (Burgos et al, 2009, Int J Tuberc Lung Dis 13(8):962-8), the assays of the present invention relating to diagnosing drug resistance can translate into improved clinical care.
- the present invention provides an improvement to the existing cellular immune-based assays for identifying mycobacterial infection. This is because the antigens of the present invention are useful for identifying drug resistant infection as opposed to simply detecting infection.
- the assay involves the use of one or more polypeptides of SEQ ID NOs: 1- 98 immobilized on a solid support to bind to and remove the antibody or polypeptide from the sample.
- the bound polypeptide or antibody i.e., the formation of a polypeptide-antibody
- Suitable detection reagents include, but are not limited to antibodies that bind to the antibody/polypeptide complex and free polypeptide labeled with a reporter group (e.g., in a semi-competitive assay).
- a competitive assay may be utilized, in which an antibody that binds to the polypeptide is labeled with a reporter group and allowed to bind to the immobilized antigen after incubation of the antigen with the sample.
- the extent to which components of the sample inhibit the binding of the labeled antibody to the polypeptide is indicative of the reactivity of the sample with the immobilized polypeptide.
- the solid support may be any solid material known to those of ordinary skill in the art to which the polypeptide or polypeptide binding agent of the invention may be attached.
- the solid support may be a test well in a microtiter plate or a nitrocellulose membrane or other suitable membranes.
- the support may be a bead or disc, such as, but not limited to, glass, fiberglass, latex or a plastic material such as polystyrene or polyvinylchloride.
- the support may also be a magnetic particle or a fiber optic sensor.
- polypeptide or polypeptide binding agent of the invention may be bound to the solid support using a variety of techniques known to those of ordinary skill in the art, which are amply described in the patent and scientific literature.
- bound refers to both noncovalent association, such as adsorption, and covalent attachment (which may be a direct linkage between the polypeptide or the antigen-binding agent and functional groups on the support or may be a linkage by way of a cross-linking agent).
- the polypeptides or polypeptide binding agents of the invention may also be bound by adsorption to a well in a microtiter plate or to a membrane.
- adsorption may be achieved by contacting the polypeptides or polypeptide binding agents of the invention, in a suitable buffer, with the solid support for a suitable amount of time.
- the contact time varies with temperature, but is typically between about 1 hour and 1 day.
- contacting a well of a plastic microtiter plate such as polystyrene or
- the contact time is sufficient to achieve a level of binding that is at least 95% of that achieved at equilibrium between bound and unbound antibody.
- a level of binding that is at least 95% of that achieved at equilibrium between bound and unbound antibody.
- the time necessary to achieve equilibrium may be readily determined by assaying the level of binding that occurs over a period of time. At room temperature, an incubation time of about 30 minutes is generally sufficient.
- Unbound sample may then be removed by washing the solid support with an appropriate buffer, such as PBS containing 0.1% (v/v) Tween 20TM.
- Detection reagent may then be added to the solid support.
- An appropriate detection reagent is any compound that binds to the immobilized antibody -polypeptide complex and that can be detected by any of a variety of means known to those in the art. Suitable detection reagents include, but are not limited to binding agents such as, Protein A, Protein C, immunoglobulin, lectin or free antigen conjugated to a reporter group.
- Suitable reported groups include, but are not limited to, e.g., enzymes (such as horseradish peroxidase and alkaline phosphatase), substrates, cofactors, inhibitors, dyes, radionuclides, luminescent groups, fluorescent groups, biotin and colloidal particles, such as colloidal gold and selenium.
- enzymes such as horseradish peroxidase and alkaline phosphatase
- substrates such as horseradish peroxidase and alkaline phosphatase
- cofactors such as horseradish peroxidase and alkaline phosphatase
- the detection reagent is then incubated with the immobilized antibody- polypeptide complex for an amount of time sufficient to detect the bound antibody.
- An appropriate amount of time may generally be determined from the manufacturer's instructions or by assaying the level of binding that occurs over a period of time.
- Unbound detection reagent is then removed and bound detection reagent is detected using the reporter group.
- the method employed for detecting the reporter group depends upon the nature of the reporter group. For radioactive groups, scintillation counting or autoradiographic methods are generally appropriate. Spectroscopic methods may be used to detect dyes, luminescent groups and fluorescent groups. Biotin may be detected using avidin, coupled to a different reporter group (commonly a radioactive or fluorescent group or an enzyme). Enzyme reporter groups may generally be detected by the addition of substrate (generally for a specific period of time), followed by spectroscopic or other analysis of the reaction products.
- ELISA type assays may be used in the methods of the present technology, including but not limited to, e.g., indirect ELISA, sandwich EISA, competitive ELISA (see e.g., U.S. Pat. Nos. 5,908,781 and 7,393,843).
- radioimmunoassay see, e.g., Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, (March, 1986)
- the agent used to detect the polypeptide-antigen binding complex may be radioactively labeled.
- the radioactive isotope can be detected by means including, but not limited to, e.g., a gamma counter, a scintillation counter, or autoradiography.
- the invention provides compositions and methods of evaluating the relationship between infection with drug-resistant MTB and cellular immune responses to drug-resistance antigens differentially expressed by MTB during drug resistance.
- detection of a cellular immune response can be accomplished by detecting T cells or T cell responses specific for the antigens of the present invention.
- the invention provides an assay for distinguishing between MTB infection that is drug-susceptible and drug-resistant.
- the T cells are in the form of peripheral blood lymphocytes (PBLs).
- the T cells are in the form of peripheral blood mononuclear cells (PBMCs).
- PBLs are mature lymphocytes that are found circulating in the blood, as opposed to being located in organs such as lymph nodes, spleen, thymus, liver or bone marrow.
- T cells are isolated from body fluids taken from sites of active TB disease, for example bronchoalveolar lavage (BAL) (lung washings) or pleural effusions or cerebrospinal fluid or ascites.
- BAL bronchoalveolar lavage
- pleural effusions or cerebrospinal fluid or ascites.
- any body fluid containing T cells can be used in the methods of the current invention, which are not restricted to T cells from disease sites or blood.
- the envisaged body fluids include BAL, lung biopsy, sputum (including induced sputum), ascites, pleural fluid, pleural biopsy, lymph node biopsy, joint aspirate, cerebral spinal fluid, soft tissue abscess and any other affected part of the body.
- the cytokine is IFN gamma.
- cytokines for example TNF-alpha or IL-2
- chemokines for example RANTES, MCP-1 or MIP 1 -alpha
- the diagnostic assay according to the invention is performed on PBMCs obtained from a mammal.
- the in vitro immune diagnostic assay for drug-resistant TB infection is performed using a diagnostic kit comprising at least one antigen selected from the group consisting of SEQ ID NOs: 1-98 or any combination thereof.
- PBMCs are isolated from a mammal and the isolated PBMCs are contacted with one or more of the antigens of the invention in order to determine the reactivity of the PBMCs against the antigen.
- the number of PBMCs secreting IFN- ⁇ in response to stimulation (via cell culture) with a candidate antigen can be measured to quantify the immune response to the antigens of interest.
- PBMCs from patients or subjects requiring testing for MTB exposure or infection may be used to detect or diagnose infection by MTB.
- the PBMCs from test subjects or mammals are isolated and then cultured with one or more polypeptides, peptide pools or select peptides from the polypeptide, or nucleic acids (DNA or RNA and their derivatives) encoding the polypeptide, of the invention. After a period of time, cell culture supernatants are collected and cytokine production by the PBMCs is measured. In one embodiment, the amount of cytokine secreted by the PBMCs is compared to a control PBMC sample (e.g., from a patient who has not been exposed to MTB).
- a control PBMC sample e.g., from a patient who has not been exposed to MTB.
- cytokine present in the test sample is indicative of exposure to and/or infection by MTB. Similar assays are described in more detail in Dillon, et al, J. of Clinical Microbiol. 38:3285-3290 (2000) and in U.S. Pat. No. 7,387,882. Cytokines which can be measured in the
- PBMC assay described above include but are not limited to any cytokine which the PBMCs can produce (e.g., IFN-gamma, IL-12, IL-5, and IL-2).
- the assay of the invention measures the magnitude of cellular immunologic responses to proteins upregulated by a drug resistant microbe (e.g., rpoB mutant, rifampicin-resistant MTB).
- a drug resistant microbe e.g., rpoB mutant, rifampicin-resistant MTB.
- blood is drawn from a patient and equal amounts of blood are placed in multiple tubes, whereby one tube represents a negative control (e.g., in the absence of an antigen), another tube represents a positive control (e.g., in the presence of a universal antigen), and another tube coated with one or more of the proteins upregulated by the drug resistant microbe (e.g., rpoB mutant, rifampicin-resistant MTB).
- the amount of cytokine in each tube is compared, and samples showing strong reactions to proteins upregulated by the drug resistant microbe, in combination with minimal and strong reactions in the negative and positive control tubes, respectively, are deemed to be positive.
- a positive result indicates infection with a drug resistant microbe.
- another tube can be added with antigens used to detect MTB infection, such that the assay provides information on presence or absence of MTB infection and the presence or absence of rifampicin (or other drug) resistance in the infecting strain.
- numerous other assay protocols exist that are suitable for use in the methods of the present invention. The descriptions are intended to be illustrative only and in no way is considered to limit the invention.
- the antigens of the invention may be used in an assay to detect the reactivity of antibodies present in a biological sample from a mammal.
- the antigens of the invention are used as immunological probes to assess the pattern of humoral immunity driven by the presence of an infection.
- the antigens of the invention may be used in the assays described herein, either alone or in combination with one another.
- the use of single antigens or any combination of antigens may be suitable for use in the assays described herein provided the assay demonstrates the desired sensitivity and negative predictive values.
- the use of a combination of antigens may result in a sensitivity of approximately, 0.80, 0.85, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 with a negative predictive value of approximately 0.80, 0.85, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0.
- the values are significant.
- Comparisons may be performed and significance determined using any of the available statistical analysis tools, alone or in combination with one another, including, for example, student's T-test, chi-square test, Fisher's exact test, analysis of variance (A OVA), univariate statistical analyses, logistic regression analysis to calculate adjusted odds ratio (OR) and 95% confidence interval (CI).
- Conrols for any statistically significant demographic variables that might function as confounders (gender, etc) may also be utilized. Differences between values are typically considered significant at p ⁇ 0.05 or p ⁇ 0.01, for example. Other statistical analysis tools may also be used.
- the assays may be performed to detect antibodies immunoreactive to only one of the antigens of the invention (e.g., SEQ ID NOs 1-98), without assaying for antibodies reactive to any other antigen.
- the assay may be performed to detect antibodies immunoreactive to more than one of the antigens of the invention.
- the assays described herein may also be used with other antigens in combination with one another and/or one or more of the antigens of the invention.
- the invention includes a method of detecting the presence of and/or diagnosing a drug resistant strain in a subject comprising detecting in a biological sample from the subject antibodies against one or more antigens of the invention, wherein the presence of antibodies that bind to the antigen(s) is indicative of infection with a drug resistant strain.
- the method comprises contacting a biological sample derived from a subject with the isolated or purified antigens of the invention for a time and under conditions sufficient for an antigen-antibody complex to form and then detecting the formation of an antigen- antibody complex. Detection of the antigen-antibody complex may be achieved by detecting human immunoglobulin in the complex. In certain embodiments, detection of the antibody may be accomplished by contacting the antigen-antibody complex with a "second" antibody that is immunologically reactive with human
- immunoglobulin e.g., anti-human immunoglobulin antibody
- the second antibody is labeled with a detectable marker or reporter molecule.
- the present invention includes methods for stimulating a specific immunogenic TB response in an individual, in order to prevent or reduce the severity of the drug-resistant TB disease, by administering an amount of one or more of the polypeptide molecules or nucleic acid molecules described herein (e.g., in a carrier).
- the present invention includes compositions (e.g., vaccine compositions or pharmaceutical compositions) having the polypeptide molecules or nucleic acid molecules described herein, in a physiologically acceptable carrier.
- the composition can also include or can be co-administered with an immune response enhancer (e.g., an adjuvant, another TB antigen, immunostimulatory cytokine or chemokine).
- Additional immunological or nucleic acid assessments can be performed using methods known in the art. Assays, known in the art or those later developed can be used to assess the antigenic TB polypeptides in a sample.
- assays exist to determine the efficacy of a TB vaccine (e.g., the extent to which the immune response directed at antigens present during drug resistance is stimulated). These types of assays can be used together to fully assess a person's TB status. For example, an individual who has a TB-specific immunogenic response, but tests negative to the presence of one or more the antigenic TB polypeptides in a sample, is one who is less likely to have drug-resistant MTB infection. However, a person who has a TB-specific immunogenic response and tests positive to the presence of the antigenic TB polypeptides of the present invention is someone who likely has infection with a strain of MTB that is drug resistant.
- the efficacy of a TB vaccine at stimulating immune responses to antigens produced during drug resistance can be measured by determining the immunogenic response of the person who received the vaccine.
- the MTB antigens of the present invention (and immunogenic portions thereof) described herein have the ability to induce an immunogenic response. More specifically, the antigens have the ability to induce proliferation and/or cytokine production (i.e., IFN-gamma, IL-12, IL- 5, and IL-2) in T cells, NK cells, B cells and/or macrophages derived from an MTB- infected individual.
- An MTB-infected individual can be identified by virtue of having mounted a T cell response to antigens of MTB. Such individuals can be identified based on a strongly positive (i.e., greater than about 10 mm diameter induration) intradermal skin test response to MTB proteins using a Purified Protein Derivative (PPD). Individuals who have these responses and who do not have any signs or symptoms of active TB disease are considered latently infected with MTB.
- PPD Purified Protein Derivative
- T cells, NK cells, B cells and macrophages derived from MTB-infected individuals can be prepared using methods known to those of ordinary skill in the art.
- a preparation of PBMCs i.e., peripheral blood mononuclear cells
- PBMCs can generally be prepared, for example, using density centrifugation through Ficoll (Winthrop Laboratories, NY).
- T cells for use in the assays described herein can also be purified directly from PBMCs.
- an enriched T cell line reactive against mycobacterial proteins, or T cell clones reactive to individual mycobacterial proteins can be employed.
- T cell clones can be generated by, for example, culturing PBMCs from MTB-infected individuals with mycobacterial proteins for a period of 2-4 weeks. This allows expansion of only the mycobacterial protein-specific T cells, resulting in a line composed solely of such cells. These cells can then be cloned and tested with individual proteins, using methods known to those of ordinary skill in the art, to more accurately define individual T cell specificity.
- antigens that test positive in assays for proliferation and/or cytokine production i.e., IFN- ⁇ and/or IL-12 production
- T cells i.e., IFN- ⁇ and/or IL-12 production
- NK cells NK cells
- B cells and/or macrophages derived from an MTB -infected individual are considered immunogenic.
- assays can be performed, for example, using the representative procedures described below.
- Immunogenic portions of such antigens can be identified using similar assays, and can be present within the polypeptides described herein.
- the ability of a polypeptide (e.g., an immunogenic antigen, or a portion or other variant thereof) to induce cell proliferation can be evaluated by contacting the cells (e.g., T cells and/or NK cells) with the polypeptide and measuring the proliferation of the cells.
- the amount of polypeptide that is sufficient for evaluation of about 10 5 cells ranges from about 10 ng/niL to about 100 ⁇ g/mL and preferably is about 10 ⁇ g/mL.
- the incubation of polypeptide with cells may be performed at 37°C for about six days, although protocols vary.
- the cells are assayed for a proliferative response, which can be evaluated by methods known to those of ordinary skill in the art, such as exposing cells to a pulse of radiolabeled thymidine and measuring the incorporation of label into cellular DNA.
- a polypeptide that results in at least a three-fold increase in proliferation above background i.e., the proliferation observed for cells cultured without polypeptide is considered to be able to induce proliferation.
- the ability of a polypeptide to stimulate the production of IFN- ⁇ , TNF- a, and/or IL-2 in cells can be evaluated by contacting the cells with the polypeptide and measuring the level of IFN- ⁇ , TNF-a, or IL-2 produced by the cells.
- the amount of polypeptide that is sufficient for the evaluation of about 10 5 cells ranges from about 10 ng/niL to about 100 ⁇ g/mL and preferably is about 10 ⁇ g/mL.
- the polypeptide can, but need not, be immobilized on a solid support, such as a bead or a biodegradable microsphere, such as those described in U.S. Pat. Nos. 4,897,268 and 5,075,109.
- the incubation of polypeptide with the cells is typically performed at 37°C for about six days.
- the cells are assayed for IFN- ⁇ , TNF-a, and/or IL-2 (or other proteins made in response to specific antigen stimulation), which can be evaluated by methods known to those of ordinary skill in the art, such as an enzyme-linked immunosorbent assay (ELISA) or, in the case of IL- 12 P70 subunit, a bioassay such as an assay measuring proliferation of T cells.
- ELISA enzyme-linked immunosorbent assay
- bioassay such as an assay measuring proliferation of T cells.
- a polypeptide that results in the production of at least 50 pg of IFN- ⁇ per mL of cultured supernatant is considered able to stimulate the production of IFN- ⁇ .
- immunogenic antigens are those antigens that stimulate proliferation and/or cytokine production (i.e., IFN- ⁇ . and/or IL-12 production) in T cells, NK cells, B cells and/or macrophages derived from at least about 25% of MTB- infected individuals.
- polypeptides having superior therapeutic properties can be distinguished based on the magnitude of the responses in the above assays and based on the percentage of individuals for which a response is observed.
- antigens having superior therapeutic properties will not stimulate proliferation and/or cytokine production in vitro in cells derived from more than about 25% of individuals who are not MTB -infected, thereby eliminating responses that are not specifically due to MTB-responsive cells.
- Those antigens that induce a response in a high percentage of T cell, NK cell, B cell and/or macrophage preparations from MTB-infected individuals have superior therapeutic properties.
- the present invention is partly based on the discovery of differential expression of proteins by drug-resistant MTB isolates.
- one or more MTB proteins expressed at higher levels are available to the immune system and are immunogenic.
- the vaccine compositions and methods are designed to augment this immunity, and preferably, to induce it a stage wherein the drug-resistant infection can be prevented or controlled.
- the vaccine compositions are particularly useful in preventing and/or treating MTB infection in subjects at high risk of, or who already have, such a drug-resistant infection, respectively.
- the vaccine compositions and methods are also applicable to veterinary uses.
- Invention includes a vaccine composition for immunizing a subject against drug resistant MTB infection.
- Preferred antigens for use in a vaccine composition include any one or more of the antigens described elsewhere in the context of the diagnostic compositions.
- one or more of the sequences of SEQ ID NOs: 1-98 can be used for the vaccine.
- the vaccine comprises a fusion protein or peptide multimer which includes a drug-resistant antigen, e.g., a full length protein and/or one or more of the above peptides comprising one or more of SEQ ID NO: 1-98.
- a drug-resistant antigen e.g., a full length protein and/or one or more of the above peptides comprising one or more of SEQ ID NO: 1-98.
- polypeptides of the present invention can be used in the form of a vaccine or immunological composition designed to prevent or treat drug-resistant MTB infection.
- one or more of the polypeptides of the present invention can be in a form of a conjugate or a fusion protein, which can be manufactured by known methods.
- one or more of the sequences of SEQ ID NOs: 1-98 can be fused to one another, or with other proteins, to provide a more effective vaccine composition, and stimulate an improved immunogenic response.
- Other proteins that can be used to make such a fusion protein include, for example, MTB antigens that simulate the CD4+ T cell or CD1 cellular pathway (which present lipid antigens to T cells) of the immune response.
- the MTB polypeptides of the present invention were isolated from MHC class 1 molecules, molecules known for presenting antigens to CD8+ T cells. Although it is possible for these polypeptides to be also presented in the CD4+ pathway, fusing a CD4+ T-cell pathway antigen with one of the polypeptides of the present invention can serve to increase effectiveness of the TB vaccine. Fusion proteins can be manufactured according to known methods of recombinant DNA technology.
- fusion proteins can be expressed from a nucleic acid molecule comprising sequences which code for a biologically active portion of the TB polypeptides or the entire TB polypeptides set forth in SEQ ID NOs: 1-98 or combinations thereof, and its fusion partner, for example another sequence of the present invention, a portion of an immunoglobulin molecule, or another TB antigen from the CD4+ T cell pathway.
- some embodiments can be produced by the intersection of a nucleic acid encoding immunoglobulin sequences into a suitable expression vector, phage vector, or other commercially available vectors. The resulting construct can be introduced into a suitable host cell for expression.
- the fusion proteins can be isolated or purified from a cell by means of an affinity matrix.
- an affinity matrix By measurement of the alternations in the functions of transfected cells occurring as a result of expression of recombinant MTB proteins, either the cells themselves or MTB proteins produced from the cells can be utilized in a variety of screening assays.
- the inventive compositions comprise fusion proteins or DNA fusion molecules.
- Each fusion protein comprises a first and a second inventive polypeptide or, alternatively, a polypeptide of the present invention and a known MTB antigen, together with variants of such fusion proteins.
- the fusion proteins of the present invention can also include a linker peptide between the first and second polypeptides.
- the DNA fusion molecules of the present invention comprise a first and a second isolated DNA molecule, each isolated DNA molecule encoding either an inventive MTB antigen or a known MTB antigen.
- a DNA, or mRNA derived from the DNA sequence by translation using known methods and enzymes, sequence encoding a fusion protein of the present invention is constructed using known recombinant DNA techniques to assemble separate DNA sequences encoding the first and second polypeptides into an appropriate expression vector, as described in detail below.
- the 3' end of a DNA sequence encoding the first polypeptide is ligated, with or without a peptide linker, to the 5' end of a DNA sequence encoding the second polypeptide so that the reading frames of the sequences are in phase to permit mRNA translation of the two DNA sequences into a single fusion protein that retains the biological activity of both the first and the second polypeptides.
- a peptide linker sequence can be employed to separate the first and the second polypeptides by a distance sufficient to ensure that each polypeptide folds into its secondary and tertiary structures.
- Such a peptide linker sequence is incorporated into the fusion protein using standard techniques well known in the art.
- Suitable peptide linker sequences can be chosen based on the following factors: (1) their ability to adopt a flexible extended conformation; (2) their inability to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides; and (3) the lack of hydrophobic or charged residues that might react with the polypeptide functional epitopes.
- Preferred peptide linker sequences contain Gly, Asn and Ser residues.
- linker sequences which can be usefully employed as linkers include those disclosed in Maratea et al, Gene 40:39-46, 1985; Murphy et al, Proc. Natl. Acad. Sci. USA 83 :8258-8262, 1986; U.S. Pat. No.
- the linker sequence can be from 1 to about 50 amino acids in length. Peptide sequences are not required when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.
- the ligated DNA sequences are operably linked to suitable transcriptional or translational regulatory elements.
- the regulatory elements responsible for expression of DNA are located only 5' to the DNA sequence encoding the first polypeptides.
- stop codons require to end translation and transcription termination signals are only present 3' to the DNA sequence encoding the second polypeptide.
- Efficacy of a vaccine including the isolated sequences of the present invention can be determined based on the ability of the antigen to provide at least about a 50% (e.g., about a 60%, about a 70%, about a 80%, about a 90%, or about a 100%) reduction in bacterial numbers and/or at least about a 40% (e.g., about a 50%, about a 60%, about a 70%, about a 80%, about a 90%, or about a 100%) decrease in mortality following experimental infection in a challenge experiment.
- Suitable experimental animals include but are not limited to mice, guinea pigs, rabbits and primates.
- compositions of the present invention are preferably formulated as either pharmaceutical compositions or as vaccines for in the induction of therapeutic or preventive immunity against drug-resistant TB in a patient.
- a patient can be afflicted with a disease, or can be free of detectable disease and/or infection.
- protective immunity can be induced to prevent, reduce the severity of, or treat drug-resistant TB.
- compositions of the present invention comprise one or more of the above polypeptides, either present as a mixture or in the form of a fusion protein, and a physiologically acceptable carrier.
- vaccines comprise one or more the above polypeptides and a non-specific immune response enhancer, such as an adjuvant or a liposome (into which the polypeptide is incorporated).
- a pharmaceutical composition and/or vaccine of the present invention can contain one or more of the DNA molecules of the present invention, either present as a mixture or in the form of a DNA fusion molecule, each DNA molecule encoding a polypeptide as described above, such that the polypeptide is generated in situ.
- the DNA can be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid expression systems, bacterial and viral expression systems. Appropriate nucleic acid expression systems contain the necessary DNA sequences for expression in the patient (such as a suitable promoter and terminating signal).
- Bacterial delivery systems involve the administration of a bacterium (such as Bacillus-Calmette- Guerrin) that expresses an immunogenic portion of the polypeptide on its cell surface.
- the DNA can be introduced using a viral expression system (e.g., vaccinia or other pox virus, retrovirus, or adenovirus), which can involve the use of a non-pathogenic (defective), replication competent virus.
- vaccinia or other pox virus, retrovirus, or adenovirus e.g., vaccinia or other pox virus, retrovirus, or adenovirus
- Techniques for incorporating DNA into such expression systems are well known to those of ordinary skill in the art.
- the DNA can also be "naked,” as described, for example, in Ulmer et al, Science 259: 1745-1749, 1993 and reviewed by Cohen, Science 259: 1691-1692, 1993.
- the uptake of naked DNA can be increased by coating the DNA onto biodegradable beads, which are efficiently
- the antigenic MTB molecules of the present invention can be administered with or without a carrier.
- pharmaceutically acceptable carrier or a “carrier” refer to any generally acceptable excipient or drug delivery composition that is relatively inert and non-toxic.
- exemplary carriers include sterile water, salt solutions (such as Ringer's solution), alcohols, gelatin, talc, viscous paraffin, fatty acid esters, hydroxymethylcellulose, polyvinyl pyrolidone, calcium carbonate, carbohydrates (such as lactose, sucrose, dextrose, mannose, albumin, starch, cellulose, silica gel, polyethylene glycol (PEG), dried skim milk, rice flour, magnesium stearate, and the like.
- PEG polyethylene glycol
- Suitable formulations and additional carriers are described in Remington's Pharmaceutical Sciences, (17 th Ed., Mack Pub. Co., Easton, Pa.). Such preparations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, preservatives and/or aromatic substances and the like which do not deleteriously react with the active compounds.
- Typical preservatives can include, potassium sorbate, sodium metabisulfite, methyl paraben, propyl paraben, thimerosal, etc.
- the compositions can also be combined where desired with other active substances, e.g., enzyme inhibitors, to reduce metabolic degradation.
- a carrier e.g., a pharmaceutically acceptable carrier
- a carrier is preferred, but not necessary to administer the compound.
- the composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder.
- the method of administration can dictate how the composition will be formulated.
- the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
- Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
- the antigenic MTB molecules used in the invention can be administered intravenously, parenterally, intramuscular, subcutaneously, orally, nasally, topically, by inhalation, by implant, by injection, or by suppository.
- the composition can be administered in a single dose or in more than one dose over a period of time to confer the desired effect.
- an effective amount of the drug is an amount which reduces the number of bacteria. Dosages for a particular individual patient can be determined by one of ordinary skill in the art using conventional considerations, (e.g. by means of an appropriate, conventional pharmacological protocol).
- enteral or mucosal application including via oral and nasal mucosa
- a syrup, elixir or the like can be used wherein a sweetened vehicle is employed.
- Liposomes, microspheres, and microcapsules are available and can be used.
- Pulmonary administration to stimulate immune responses to drug- resistant MTB can be accomplished, for example, using any of various delivery devices known in the art such as an inhaler. See. e.g., S. P. Newman (1984) in Aerosols and the Lung, Clarke and Davis (eds.), Butterworths, London, England, pp. 197-224; PCT Publication No. WO 92/16192; PCT Publication No. WO 91/08760.
- injectable, sterile solutions preferably oily or aqueous solutions, as well as suspensions, emulsions, or implants, including suppositories.
- carriers for parenteral administration include aqueous solutions of dextrose, saline, pure water, ethanol, glycerol, propylene glycol, peanut oil, sesame oil, polyoxyethylene-polyoxypropylene block polymers, and the like. Ampules are convenient unit dosages.
- Biodegradable microspheres e.g., polylactic galactide
- Suitable biodegradable microspheres are disclosed, for example, in U.S. Pat. Nos. 4,897,268 and 5,075, 109.
- adjuvants can be employed in the vaccines of this invention to enhance the immune response to drug resistant antigens.
- Most adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a nonspecific stimulator of immune responses, such as lipid A, Bortadella pertussis or MTB.
- Suitable adjuvants are commercially available and include, for example, Freund's Incomplete Adjuvant and Freund's Complete Adjuvant (Difco Laboratories) and Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.).
- Other suitable adjuvants include alum, biodegradable microspheres, monophosphoryl lipid A and quil A.
- the adjuvant induces an immune response comprising Thl aspects.
- Suitable adjuvant systems include, for example, a combination of monophosphoryl lipid A, preferably 3-de-O-acylated monophosphoryl lipid A (3D-MLP) together with an aluminum salt.
- An enhanced system involves the combination of a monophosphoryl lipid A and a saponin derivative, particularly the combination of 3D-MLP and the saponin QS21 as disclosed in WO 94/00153, or a less reactogenic composition where the QS21 is quenched with cholesterol as disclosed in WO 96/33739.
- the administration of the antigenic MTB polypeptide molecules of the present invention and other compounds can occur simultaneously or sequentially in time.
- a DNA vaccine and/or pharmaceutical composition as described above can be administered simultaneously with or sequentially to an additional polypeptide of the present invention, a known MTB antigen, an immune enhancer, or other compound known in the art that would be administered with such a vaccine.
- the compound can be administered before, after or at the same time as the antigenic MTB molecules.
- co-administration is used herein to mean that the antigenic MTB molecules and the additional compound (e.g., immune stimulating compound) will be administered at times to achieve a specific MTB immune response to drug resistance antigens, as described herein.
- the methods of the present invention are not limited to the sequence in which the compounds are administered, so long as the compound is administered close enough in time to produce the desired effect.
- compositions and vaccines may or may not vary from individual to individual and might parallel those currently being used in immunization using the Bacille Calmette-Guerin (BCG) vaccine.
- BCG Bacille Calmette-Guerin
- the pharmaceutical compositions and vaccines can be administered by injection (e.g., intracutaneous, intramuscular, intravenous or subcutaneous), intranasally (e.g., by aspiration), intralung, or perhaps even orally.
- injection e.g., intracutaneous, intramuscular, intravenous or subcutaneous
- intranasally e.g., by aspiration
- intralung e.g., by aspiration
- a suitable dose is an amount of polypeptide or DNA that, when administered as described above, is capable of raising an immune response in an immunized patient sufficient to protect the patient from MTB infection for at least 1 -2 years.
- the amount of polypeptide present in a dose ranges from about 1 pg to about 100 mg per kg of host, typically from about 10 pg to about 1 mg, and preferably from about 100 pg to about 1 ⁇ g.
- Suitable dose sizes will vary with the size of the patient, but will typically range from about 0.1 mL to about 5 mL.
- Example 1 Using adaptive cellular immune function to diagnose drug resistance in active TB and latent Mycobacterium tuberculosis infection Drug resistance in MTB is primarily due to point mutations in genes encoding mycobacterial enzymes (Blanchard et al, 1996, Annu Rev Biochem 65:215- 39). For example, resistance to rifampicin, a key first-line anti-tubercular drug, results most commonly from a single nucleotide polymorphism (SNP) in rpoB.
- SNP single nucleotide polymorphism
- rpoB is an essential gene in MTB and mutated forms of RNA polymerase B plausibly are associated with changes in transcription that result in differential expression of proteins in the organism.
- Example 2 Upregulation of the phthiocerol dimycocerosate biosynthetic pathway by rifampicin-resistant rpqg-mutant Mycobacterium tuberculosis
- MDR-TB has emerged as a major threat to TB control.
- Phylogenetically related rifampicin-resistant actinomycetes with mutations mapping to clinically dominant MTB mutations in the rpoB gene show upregulation of gene networks encoding secondary metabolites.
- Experiments were conducted to compare the expressed proteomes and metabolomes of two fully drug-susceptible clinical strains of MTB (wild type) to that of their respective rifampicin-resistant, rpoB- mutant progeny strains with confirmed rifampicin monoresistance following antitubercular therapy.
- ppsA (Rv2931), ppsB (Rv2932) and ppsC (Rv2933) were also found to be upregulated greater than 10-fold in the Beijing rpoB mutant strain relative to its wild- type parent strain during infection of activated murine macrophages.
- metabolomics identified precursors of phthiocerol dimycocerosate, but not the intact molecule itself, in greater abundance in both rpoB mutant isolates.
- MTB strains were obtained from patients being treated for pulmonary TB. Isolates were sent to National Jewish Hospital, Denver, CO, for confirmation of drug susceptibility data that was initially obtained by the clinical labs where the patients were being treated.
- An MTB strain susceptible to all drugs tested (rifampicin, isoniazid, pyrazinamide, and ethambutol) was obtained from a patient living in Costa Rica prior to initiating antitubercular therapy.
- Another isolate was later obtained from the same patient after several weeks on treatment and was confirmed to be resistant to rifampicin by the Agar proportion test (MIC > 1 mg/L) but susceptible to the other 3 first line agents. These isolates were a parent-mutant pair by
- RFLP polymorphism
- Genomic DNA was purified from each culture, and the rpoB gene was amplified using primers 5 ' -AATATCTGGTCCGCTTGCAC-3 ' (SEQ ID NO: 99) and 5'- ACACGATCTCGTCGCTAACC-3 ' (SEQ ID NO: 100), and sequenced. Based on the sequencing results, a mutant containing a substitution of G for C at position 135 lbp in the rpoB gene (yielding the RpoB S450L mutation) was selected for further study (Table 1).
- CFP Culture filtrate proteins
- the filtrate was further concentrated to approximately 300 ⁇ using an Amicon Ultracell-15 with a 10 KDa MWCO by centrifugation at 3000 rpm at 4°C.
- Purified proteins were subjected to buffer exchange using 15 ml of 10 mM ammonium bicarbonate three times in the same filter unit. Protein quantification was performed by the BCA assay (Pierce).
- breaking buffer ImM EDTA-PBS supplemented with one tablet of protease inhibitor (Roche Diagnostics) per 50ml of buffer, 60 ⁇ 1 of DNAse (lmg/ml) and 60 ⁇ 1 of R Ase (lmg/ml)
- breaking buffer was added to a final volume of 40 ml and unbroken cells were removed by centrifugation at 3000 rpm for 5 min, 4°C.
- the protein pellet was resuspended in 10 mM ammonium bicarbonate and quantification was performed using the BCA assay (Pierce). Fifty ⁇ g of sample were subjected to trypsin digestion, as described elsewhere herein.
- peptides were purified and concentrated using an on-line enrichment column (Agilent Zorbax CI 8, 5 ⁇ , 5 x 0.3 mm). Subsequent chromatographic separation was performed on a reverse phase nanospray column (Agilent 1 100 nanoHPLC, Zorbax CI 8, 5 ⁇ , 75 ⁇ ID x 150 mm column) using a 60 minute linear gradient from 25%-55% buffer B (90% ACN, 0.1% formic acid) at a flow rate of 300 nanoliters/min.
- Peptides are eluted directly into the mass spectrometer (Thermo Scientific Linear Trap Quadrupole (LTQ) linear ion trap) and spectra are collected over a m/z range of 200-2000 Da using a dynamic exclusion limit of 2 MS/MS spectra of a given peptide mass for 30 s (exclusion duration of 90 s).
- LTQ Linear Trap Quadrupole
- Compound lists of the resulting spectra were generated using Bioworks 3.2 software (Thermo Scientific) with an intensity threshold of 5,000 and 1 scan/group.
- False discovery rates were calculated automatically by Scaffold (version 3.0) using the decoy database and reverse hits and the empirical method previously reported by Kail et al (Kail et al, 2008, J Proteome Res 7:29-34). Analysis of each dataset using these parameters resulted in a false discovery rate (FDR) of 0.2% at the protein level and less than 5.3% at the peptide level.
- spectral counts were assessed in multiple ways. First, after normalization, data was log transformed and a linear model analysis of variance (ANOVA) comparing spectral counts for each protein within subcellular fractions for each isogenic pair was applied to identify proteins that were differentially abundant between susceptible and resistant isolates (p-value ⁇ 0.05). Comparison of spectral counts was performed using DanteR (version 1.0.1.1. Pacific Northwest National Laboratory, http://omics.pnl.gov). Reproducibility of biological replicates was assessed by visual interpretation of each dataset using box plots and 3D scatter plots generated on DanteR.
- ANOVA linear model analysis of variance
- the mean spectral counts in the cell-associated fractions were added to produce a summary spectral count for each protein.
- CFP was not included in the summary spectral count given our interest in measuring differences in overall protein abundance and not secretion.
- This summary cell-associated spectral count was then used to calculate the fold change in detection for each protein by dividing the mean spectral count in an rpoB mutant by the mean spectral count in the paired wild-type parent isolate.
- the summary cell-associated spectral counts were also used to calculate the spectral index (Spl), which is a robust statistical measure of differential protein abundance useful in shotgun proteomics experiments (Fu et al, 2008, J Proteome Res 7:845-54).
- the Spl which ranges from -1 to +1, was then used to rank- order the proteins by degree of increased detection in mutants.
- the murine macrophage J774A.1 cell line was cultured in Roswell
- the cells were incubated for 3 hours with either wild-type MTB or the rpoB mutant at a multiplicity of infection (MOI) of 1 : 1.
- MOI multiplicity of infection
- the macrophages were then treated with 200 ng/ml streptomycin and washed three times with RPMI and cultured in media as described elsewhere herein.
- the cells were lysed with Triton X-100 at predetermined time points and the lysate was serially diluted and plated on 7H10 agar and incubated at 37°C for 28 days, as previously described (Thayil et al., 201 1, PLoS One 6:e28076).
- intracellular bacteria were recovered at 72 hr after infection by centrifugation at 3200 rpm for 5 min, and the bacterial pellet was resuspended in Trizol reagent (Invitrogen).
- control and mutant RNA (10 ng) were treated with RNase-free DNase (Invitrogen) and subjected to 36 cycles of PCR to ensure that all DNA had been removed, as assessed by ethidium bromide- stained agarose gel analysis.
- Fluorescently-labeled cDNA was generated using gene- specific primers (Table 2) and Superscript III (Invitrogen), as previously described (Thayil et al, 201 1, PLoS One 6:e28076). cDNA corresponding to each transcript was subjected to 40 cycles of PCR for quantification using the primers listed in Table 3 and an iCycler 5.0 (Bio-RAD).
- AnCT C(nCT) - S(nCT)
- C the wild-type (control) strain
- S the rpoB mutant strain.
- Fold regulation of individual genes was calculated using the following formula: 2-AnCT. The data are representative of three biological replicates, and the experiments were repeated twice.
- Mycobacteria were scraped at 4 weeks of culture and transferred to a glass tube. 10 ml of chloroform was added to each sample and then incubated at room temperature in agitation for 4 hours. Bacteria were pelleted at 3000 rpm for 30 min at 4°C and the supernatant corresponding to the chloroform fraction was dried in a nitrogen bath and stored at -20°C. Pelleted bacteria were dried under nitrogen and then resuspended in 15 ml of methanol. Samples were incubated at 37°C overnight in agitation and then centrifuged at 3000 rpm for one hour at 4°C. Supernatant corresponding to the methanol fraction was dried under nitrogen and then stored at - 20°C. Prior to mass spectrometry analysis, chloroform and methanol fractions were resuspended in 1 ml of the corresponding solvent. LC/MS for metabolomics
- Methanol fractions One ⁇ , of the sample was injected into a Waters Acquity UPLC system equipped with a Waters Acquity UPLC T3 column (1.8 ⁇ , 1.0 x 100 mm). Separation was achieved using a gradient from solvent A (95% water, 5% methanol, 0.1% FA) to solvent B (95% methanol, 5% water, 0.1% FA) as follows: 100% A held for 1 min; 100% B in 16 min; 100% B held for 3 min; 100% A in 0.1 min; re-equilibrate for 5.9 min (total run time of 26 min/sample).
- solvent A 95% water, 5% methanol, 0.1% FA
- solvent B 95% methanol, 5% water, 0.1% FA
- Chloroform fractions One ⁇ , of the sample was injected on a Waters Acquity Ultra Performance Liquid Chromatography (UPLC) system equipped with a Waters Acquity UPLC C8 column (1.8 ⁇ , 1.0 x 100 mm).
- UPLC Waters Acquity Ultra Performance Liquid Chromatography
- flow rate was maintained at 140 ⁇ 7 ⁇ for the duration of the run, the column was held at 50° C, and samples were held at 5° C.
- Column eluate was infused into a Waters Q-Tof Micro MS fitted with an electrospray source. Data was collected in positive ion mode, scanning from 50-1200 (methanol fraction) or 50-1800 (Chloroform fraction) at a rate of 0.9 seconds per scan with 0.1 second interscan delay. Calibration was performed prior to sample analysis via infusion of sodium formate solution, with mass accuracy within 5 ppm.
- the capillary voltage was held at 2200V, the source temp at 130°C, the desolvation temperature at 300°C, the desolvation gas flow rate of 400 L/hr N2(g), and the quadrupole was held at collision energy of 7 volts.
- MS/MS spectra of precursor ions 797.7 and 823.2 were collected using a Waters UPLC coupled to a Waters Xevo G2 Q-TOF MS. The LC conditions were the same as listed elsewhere herein, and the MS/MS collision energy was ramped from 15-30 volts to induce fragmentation.
- Raw data files were converted to .cdf format, and feature detection and alignment was performed using XCMS in the program R.
- Raw peak areas were normalized to total ion signal in R, and the normalized dataset was subjected to PCA in R using the pcaMethods package. Consistent with our focus on gene upregulation as a compensatory response to rpoB mutation, statistical analysis to determine peaks/features that were significantly more abundant in resistant strains was performed in DanteR as described for the proteomics section. Differential peaks
- lipid fractions were analyzed by Thin Layer Chromatography along with PDIM standard (10ug) using 98:2 petroleum ethenethyl acetate (v/v) three times. Lipids were visualized with CuS04 charring.
- proteins from four cellular fractions were extracted from late-log phase broth cultures.
- protein identification using shotgun proteomic analysis is greatly increased (Dreger, 2003, Mass Spectrom Rev 22:27-56; Huber, et al, 2003, Circ Res 92:962-8).
- this fraction is subjected to additional preparation prior to mass spectrometry analysis to increase solubility and the number of identified proteins.
- each fraction was analyzed independently in triplicate by LC-MS/MS.
- the spectra were searched against the MTB genome, and the total number of unique peptides identified in each cellular fraction of each biological replicate by strain type is shown in Table 4.
- a total of 452, 1,075, 807, and 735 proteins were confidently identified in the CFP, CW, MEM, and CYT, respectively, of the Haarlem isolates, and 455, 1,072, 760, and 704 proteins were confidently identified in the CFP, CW, MEM, and CYT fractions, respectively, of the Beijing isolates.
- Spectral counts for each biological replicate were normalized against the total signal as described previously (Carvalho et al, 2008, Genet Mol Res 7:342- 56). After normalization and log transformation of the data, a linear model ANOVA comparing spectral counts for each protein within subcellular fractions for each isogenic pair was applied to identify proteins that were differentially abundant between susceptible and resistant isolates (p-value ⁇ 0.05). Thirty -two, 44, 21, and 27 proteins were identified with significantly higher spectral counts (p ⁇ 0.05) relative to the wild-type isolate in the CFP, CW, MEM, and CYT, respectively, of the Haarlem rpoB mutant.
- Rv3038c, and Rv3661 are conserved hypotheticals of unknown function (Table 5). Spectral counts of recA and dnaE2 were specifically examined using qRT-PCR (Bergval et al, 2007, FEMS Microbiol Lett 275:338-43) but increased spectral counts for the corresponding proteins were not observed. Table 6 shows the number of proteins detected in the Haarlem, Beijing, and both rpoB mutants at summary (combined CW, MEM, and CYT) spectral counts at least 2-fold or higher compared to the wild-type isolates as well as the number of proteins detected in the mutant isolates alone (where fold change is set arbitrarily to 100).
- the chloroform extract was compared to a positive authentic PDIM standard that was obtained from MTB H37Rv and analyzed by LC-MS using identical parameters.
- the PDIM standard was obtained through the Tuberculosis Vaccine Testing and Research Material Contract
- Score 3: Putatively characterized compound classes. Based on spectral similarity to known compounds of a chemical class.
- rpoB mutation would lead to upregulation of MTB genes involved in secondary metabolism, given known relationships between rpoB mutation and upregulation of genes involved in natural product biosynthesis in other organisms (Hosaka et al, 2009, Nat Biotechnol 27:462-4; Hu et al, 2002, J Bacteriol 184:3984-91; Inaoka et al, 2004, J Biol Chem 279:3885-92).
- Proteins encoded by ppsA-E are involved in PDIM biosynthesis and the corresponding genes are grouped on a 50-kb fragment of the MTB chromosome (Camacho et al, 2001, J Biol Chem 276: 19845-54). Although evidence of higher levels of intact PDIM in the Haarlem rpoB mutant was not observed, levels of PDIM in the Beijing rpoB mutant isolate appear to be elevated when compared to its isogenic strain as evaluated by TLC ( Figure 1). However, metabolites with the same spectra as PDIM precursors were detected at higher levels in both rpoB mutant isolates compared to their wild-type progenitor isolates.
- PDIM is a long-chain ⁇ -diol (phthiocerol) esterified with two branched-chain mycocerosic acids located in the outer mycobacterial cell wall that has been implicated in MTB virulence (Camacho et al., 1999, Mol Microbiol 34:257- 67; Cox et al, 1999, Nature 402:79-83; Reed et al, 2004, Nature 431 :84-7).
- the genes ppsA-E encode a type I modular polyketide synthase responsible for biosynthesis of the phtiocerol backbone of PDIM, with PpsA-C sequentially loading ketide units onto long chain fatty acids and PpsD and PpsE subsequently extending the phthiocerol further by adding a 4-methyl branch and malonyl- or methylmalonyl-CoA, respectively (Azad et al, 1997, J Biol Chem
- MTB strains with defects in this pathway have been shown to have increased cell envelope permeability (Camacho et al., 2001, J Biol Chem 276: 19845- 54) and are more susceptible to IFN- ⁇ mediated and IFN-y-independent immunity (Kirksey et al, 2011, Infect Immun 79:2829-38; Murry, et al, 2009, J Infect Dis 200:774-82).
- PDIM deficiency appears to be particularly important to MTB growth in the host environment, as isolates with deficiencies in this pathway have pronounced growth defects in the spleens and lungs of infected mice (Kondo and Kanai, 1976, Jpn J Med Sci Biol 29: 199-210; Camacho et al, 1999, Mol Microbiol 34:257-67; Cox et al., 1999, Nature 402:79-83) and are more susceptible to the nitric - oxide-dependent killing of macrophages (Rousseau et al, 2004, Cell Microbiol 6:277- 87).
- PG related metabolites could be associated with an increase in the production of PG enzymes cannot be discarded, especially with those involved in the last steps of the biosynthetic pathway, such as MurG and MurX (a.k.a MraY). Nonetheless, peptidoglycan and PDIM are both significant components of the cell envelope, with peptidoglycan forming the inner cell wall layer and PDIM decorating the outer layer via non-covalent association with other cell envelope lipids (Brennan, 2003, Tuberculosis (Edinb) 83:91-7).
- rpoB mutant strains of saprophytic environmental mycobacteria have been found to cohabitate with rifamycin-producing organisms on marine sponges (Izumi et al., 2010, FEMS Microbiol Lett 313:33-40), indicating that ancestors of MTB faced rifamycin exposure long before this class of antibiotics was used to treat TB.
- upregulation of the PDIM biosynthetic pathway in rpoB mutants of MTB is a defense mechanism response to competition interference inherited from MTB's environmental ancestors.
- upregulation to the human pathogen MTB is unknown, it may be important to the survival of rifampicin-resistant mycobacteria in the setting of rifamycin or other antibiotic exposure.
- experiments can be designed to comprehensively investigate the degree to which various globally heterogenous strains of rpoB-mutant MTB upregulate PDIM, the mechanisms that result in PDIM upregulation, and the effect oirpoB mutation and PDIM upregulation on susceptibility to various stressors, including existing and novel antibiotics used to treat TB.
- the MTB genome contains an expansive repertoire of polyketide synthase genes that in related bacteria are involved in the biosynthesis of various secondary metabolites including erythromycin A and rifamycin B (Cole, Set al, 1998, Nature 393:537-44; Gokhale et al, 2007, Nat Prod Rep 24:267-77; Parish, T., and A. Brown. 2009. Mycobacterium: genomics and molecular biology. Caister Academic Press, Norfolk, UK.).
- the finding of upregulation of several genes encoding polyketide synthases in both rpoB mutants of MTB is of interest in that it suggests that the adaptive response of MTB to rpoB mutation may be analogous to responses observed in related model organisms.
- rpoB mutations lead to upregulation of otherwise dormant gene clusters resulting in increased abundance of specific secondary metabolites that are absent or minimally present in wild-type strains (Hosaka et al, 2009, Nat Biotechnol 27:462-4; Zazopoulos et al, 2003, Nat
- Biotechnol 21: 187-90 genes encoding protein enzymes involved in actinorhodin (Act) and undecylprodigiosin (Red) biosynthesis are found in
- Streptomyces lividans but normally are not expressed by the corresponding paired wild-type isolates from which they arose (Hu et al, 2002, J Bacteriol 184:3984-91).
- Certain rifampicin-resistant rpoB mutants of S. lividans however, produce both Act and Red in abundance, a phenomenon which can be reversed by replacing mutant with wild-type rpoB (Hu et al, 2002, J Bacteriol 184:3984-91).
- the genes ppsC, ppsE and drrA are located within the first transcriptional unit and in this study their corresponding PDIM precursor proteins were detected at statistically significantly higher levels in the rpoB mutants relative to their corresponding wild-type parent strains. Although the limited sensitivity of shotgun proteomics approaches hinders the ability to definitively conclude that proteins found in the other two downstream PDIM transcriptional units were not also upregulated, these findings, together with the metabolomics data, suggest that the first transcriptional unit of the PDIM biosynthetic locus, and not the others, may be specifically upregulated in rpoB mutant isolates of MTB. Comprehensive transcriptomics data can be used to confirm this hypothesis. PDIM production is characteristic of pathogenic, but not environmental,
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Hematology (AREA)
- Chemical & Material Sciences (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- Cell Biology (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a method of using adaptive immunity to detect drug resistance in infectious diseases. The invention provides novel antigens associated with drug resistant MTB infection.
Description
TITLE OF THE INVENTION
USING ADAPTIVE IMMUNITY TO DETECT DRUG RESISTANCE
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application
No. 61/576, 182, filed on December 15, 2011, which is hereby incorporated herein by reference in its entirety.
BACKGROUND OF THE INVENTION
Mycobacterium tuberculosis (MTB) is a transmissible human pathogen that can cause either latent (asymptomatic) infection or active TB disease (TB). Nearly one third of the world's population is estimated to be infected with MTB (including both latent and active infections), and while progress is being made in terms of control of drug-susceptible TB (Lonnroth et al, 2010 Lancet 375: 1814-29), 9.4 million cases of TB were identified and treated world-wide in 2008 (WHO Global tuberculosis control: short update to 2009 report; In: Organization WH, editor.
Geneva, Switzerland, 2009). Despite this progress, drug resistance in MTB, and particularly multi-drug resistant TB (MDR-TB, defined as TB due to MTB that is resistant to the first line drugs isoniazid and rifampicin) has emerged as a threat to control of TB both in the US and abroad (Gandhi et al, 2010, Lancet
375(9728): 1830-43). Global surveillance systems for drug-resistance in TB are inadequate, and therefore data are insufficient to inform whether the incidence of drug-res istant/MDR-TB TB is rising or falling. However, of the estimated 440,000 cases of MDR-TB occurring in 2008, only 7% were identified and reported to WHO and of these only a fifth were treated according to WHO standards (WHO. Global tuberculosis control: short update to 2009 report. In: Organization WH, editor.
Geneva, Switzerland, 2009.), suggesting that the problem is under-recognized and its true scope is unknown. The Global Project on Anti -Tuberculosis Drug Resistance, reporting on data collected from 83 countries, found the prevalence of drug resistance in new cases of active TB to be approximately 11% (Wright et al, 2009, Lancet 2009 373(9678): 1861-73). Furthermore, mathematical modeling suggests that population control of drug-sensitive TB disease does not imply control of drug-resistant strains. Rather, removal of patients with drug-susceptible disease from a population may replenish the pool of individuals who are fully susceptible to MTB infection with
minority circulating drug-resistant strains (Cohen et al, 2004, Nat Med 10(10): 1 117- 21). While MDR-TB appears under control in some countries, in other settings rates of MDR-TB among all cases of TB are alarming. For example, in two provinces in China and in nine countries of the former Soviet Union, > 7% of all new cases of active TB disease were MDR-TB (Wright et al, 2009, Lancet 373(9678): 1861-73). Although drug sensitive active TB disease can be cured in 6 months, treatment of MDR-TB requires use of costly, toxic, and often ineffective second-line
antimicrobials for >24 months (Shah et al, 2007, Emerge Infect Dis 13(3):380-7), is associated with high rates of morbidity and mortality, and has been described as both an international public health emergency (WHO. Multi-drug and extensively drug- resistant TB (M/XDR-TB): 2010 global report on surveillance and response, 2010) and a threat to the goal of TB elimination in the US.
Drug resistance in MTB is due primarily to single nucleotide polymorphisms in genes encoding key mycobacterial enzymes (Blanchard, 1996, Annu Rev Biochem 65:215-39). The rpoB gene encodes the β-subunit of bacterial RNA polymerase, which is the target of rifampicin (Campbell et al, 2001, Cell 104:901-12; Jin and Gross, 1988, J Mol Biol 202:45-58). Mutations in this gene account for over 95% of clinical cases of rifampicin resistance (Telenti et al, 1993, Lancet 341 :647-50) and are commonly associated with the presence of MDR-TB (Geffen, 2010. Cepheid Gene Xpert diagnostic technology for TB. HTB South; Shah et al, 2007, Emerg Infect Dis 13 :380-7). Although some rifampicin resistant strains demonstrate mild in vitro fitness losses compared to wild-type parent strains, the most common MTB clinical strains containing the most frequent rpoB mutations (e.g., such as the S531L mutation) tend to exhibit little or no fitness defects, suggesting that certain MTB isolates are capable of overcoming, at least to some extent, initial fitness deficiencies associated with antibiotic resistance (Gagneux, 2009, Clin Microbiol Infect 15 Suppl 1 :66-8; Gagneux et al, 2006, Science 312: 1944-6). Bergval et al. reported a two to five-fold induction of the stress response gene dnaE2 (but not recA) in four of six rpoB mutants of MTB when compared to their wild-type isogenic parent strains using RT-PCR (Bergval et al, 2007, FEMS Microbiol Lett 275:338-43). However, relatively little is known about MTB adaptive mechanisms to drug resistance, which may compensate for mutations in rpoB. Recently, compensatory mutations in RNA polymerase genes in /po5-mutant isolates of MTB have been identified by comparative genomics (Comas et al, 201 1, Nat Genet 44: 106-10).
Specific gene upregulation associated with rpoB mutation has been observed in numerous model organisms including Streptomyces spp, which are environmental organisms phylogenetically related to MTB (Hu et al, 2002, J Bacteriol 184:3984-91; Inaoka et al, 2004, J Biol Chem 279:3885-92; Tala et al, 2009, J Bacteriol 191 :805-14). Moreover, upregulation of certain gene clusters via rpoB mutation has been used in actinomycetes as a way to discover new secondary metabolites, including antibiotics (Hosaka et al, 2009, Nat Biotechnol 27:462-4). This suggests that rpoB mutation may have analogous effects on specific gene upregulation in MTB. The MTB genome has an extensive array of polyketide synthase genes (Cole, Set al, 1998, Nature 393 :537-44), which have been shown in other bacteria to be involved in the biosynthesis of secondary metabolites, including rifamycins (Gokhale et al, 2007, Nat Prod Rep 24:267-77). rpoB is an essential gene in MTB and clinically relevant rpoB mutations occur near the DNA-RNA channel of bacterial RNA polymerase (Campbell et al, 2001, Cell 104:901-12; Sassetti et al., 2003, Mol Microbiol 48:77-84).
Evaluation of drug resistance in MTB can be performed using culture with drug susceptibility testing (DST), via molecular tests, or via microscopy (Pai et al, 2006, Expert Rev Mol Diagn 6(3):423-32). These approaches all require access to the bacterium in clinical specimens such as sputum and are useful when these specimens can be obtained. However, such approaches are useless for detecting drug resistance when clinical samples containing the pathogen are difficult or impossible to collect. This situation arises in several types of active TB disease including "sputum- scarce" TB disease, extrapulmonary TB, and TB in children. Dependence on acquisition of clinical specimens for culture or molecular testing is also a problem in latent MTB infection because specimens containing the pathogen cannot be obtained during this stage of infection. Rather, diagnosis of latent MTB infection relies on detection of host memory cellular immune responses directed at MTB antigens. Examples of this approach include the 100-year old tuberculin skin test (TST) and a newer "in-tube" interferon gamma (IFN-γ) release assays, which are now
recommended by the US Center for Disease Control and Prevention (CDC) for diagnosis of latent MTB infection (Pai et al, 2007, Lancet Infect Dis 7(6):428-38). However, these tests do not provide information about whether the infection being detected is due to a drug-resistant strain. Because of this limitation, there is currently
no way to define the epidemiology of or identify individuals with drug-resistant latent MTB infection. This is of public health importance because standard treatment of latent MTB infection relies on drugs that do not work in drug resistant TB and treatment of latent MTB infection is a cornerstone of TB eradication efforts.
Thus, there is an urgent need in the art for new compositions and methods for determining whether MTB infection is due to a drug-resistance strain. The present invention addresses this need.
SUMMARY OF THE INVENTION
The invention provides a method of detecting an immune response against any antigen that is expressed differentially between a drug-resistant strain compared to a corresponding drug-susceptible strain for the diagnosis of an infection with a drug resistant strain.
In one embodiment, the invention provides a method of assessing microbial infection in a mammal comprising: a) contacting at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain with a biological sample from the mammal; and b) measuring an immune response in the biological sample wherein an increase in the immune response to the at least one polypeptide that is differentially expressed in a drug- resistant strain compared to a corresponding drug-susceptible strain with a biological sample from the mammal indicates a past or present microbial infection with a drug- resistant strain.
In one embodiment, the microbial infection is M. tuberculosis infection.
In one embodiment, the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain is selected from the group consisting of SEQ ID NOs: 1-98 or a fragment thereof.
In one embodiment, the immune response is at least one selected from the group consisting of a cell-mediated response and a humoral response.
In one embodiment, the biological sample comprises at least one selected from the group consisting of whole blood, serum, plasma, and peripheral blood mononuclear cells.
In one embodiment, the cell-mediated response is a T cell response.
In one embodiment, the T cell response is measured by detecting expression of a marker for T cell activation or proliferation.
In another embodiment, the T cell response is measured by detecting secretion of a cytokine.
In one embodiment, the humoral response is measured by a) contacting the biological sample of the mammal with the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug- susceptible strain for a sufficient amount of time to allow complex formation between the at least one polypeptide with an antibody present in the biological sample, and b) detecting a complex formed between an antibody in the biological sample and the antigen, wherein detection of the complex is indicative of infection by the drug- resistant strain in the mammal.
In one embodiment, the mammal is a human.
In one embodiment, the mammal is receiving or has previously received a therapeutic intervention.
The invention also provides a kit for use in determining the presence of a drug-resistant strain in a mammal. In one embodiment, the kit comprises at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain.
In one embodiment, the drug-resistant strain is M. tuberculosis.
In one embodiment, the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain is selected from the group consisting of SEQ ID NOs: 1-98 or a fragment thereof.
In one embodiment, the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain is used to detect an immune response in a biological sample from a mammal.
In one embodiment, the biological sample comprises at least one selected from the group consisting of whole blood, serum, plasma, and peripheral blood mononuclear cells.
In one embodiment, the immune response is at least one selected from the group consisting of a cell-mediated response and a humoral response.
In one embodiment, the cell-mediated response is measured by detecting expression of a marker for T cell activation or proliferation.
In one embodiment, the cell-mediated response is measured by detecting secretion of a cytokine.
In one embodiment, the humoral response is detected by detecting a complex formed between an antibody in the biological sample and the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain.
BRIEF DESCRIPTION OF THE DRAWINGS
The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
Figure 1 is an image depicting a thin layer chromatography of lipid extracts obtained from M. tuberculosis clinical isolates in triplicate from independent cultures. rpoB mutants and wild type isolates for each genotype are shown. A PDIM standard is also shown.
Figure 2 depicts a heat map of protein detection in rpoB mutant vs. wild-type MTB as determined by summary cell-associated spectral counts in 4 gene clusters detected as possibly involved in natural product biosynthesis by the program NPsearcher. The phthioceral dimycoserosate (PDIM) biosynthetic locus is Cluster 4. The other shown clusters are as follows: Cluster 1 = Rv0993 - Rvl017c; Cluster 2 = Rvl536 - Rvl551 ; Cluster 3 = Rvl661 - Rvl668c; Cluster 4 = Rv2930 - Rv2943. Genes are shown in increasing order of Rv number from top to bottom. The column on the left corresponds to the Haarlem strains, while the one on the right corresponds to the Beijing strains. This figure is useful for understanding the finding that genes preferentially expressed by drug-resistant MTB isolates are involved in secondary metabolism.
Figure 3, comprising Figures 3 A through 3D, is a series of images demonstrating the effect of a common rpoB mutation, S450L, on MTB gene expression and fitness. Figure 3 A depicts the expression of the PDIM biosynthesis locus in the r/ja3-mutant Beijing strain relative to the rifampin-sensitive wild-type parent strain during logarithmic growth in nutrient-rich broth, as measured by RT-
PCR. Figure 3B depicts gene expression of the same strains after 72 h of infection in activated murine macrophages. Figure 3C depicts growth and survival of the rpoB mutant (grey) relative to the Beijing wild-type parent strain (white) in activated murine macrophages. Figure 3D depicts RT-PCR analysis of gene expression in a laboratory-generated RpoB S450L mutant relative to the isogenic CDC 1551 wild-type strain during logarithmic growth in nutrient-rich broth. The cycle threshold value (CT) obtained for each gene of interest was normalized with that of the housekeeping gene sigA. Fold regulation of individual genes was calculated using the following formula: 2-(C(CT)-S(CT)), where C represents the wild-type (control) strain and S represents the rpoB mutant strain. This figure is useful for demonstrating that certain genes are expressed by rpoB mutant MTB differentially in macrophages, which is a natural environment of MTB during human infection.
Figure 4 is an image depicting a representative spectra for some of the significant features found at higher abundance in the chloroform fraction of rpoB mutant vs. wild-type susceptible MTB isolates, which also matched peaks found in the PDIM standard. Retention time for these peaks was 11.32 min. The main differentially significant peaks are shown by an arrow (m/z 797.7 and m/z 823.2). On the figure, CI22=Beijing rpoB mutant.
DETAILED DESCRIPTION
The present invention provides compositions and methods for identifying a gene and encoded protein thereof that is associated with drug resistance in a microbial strain (referred elsewhere herein as a drug resistant gene and encoded protein thereof from a drug-resistant microbial strain). In one embodiment, the method includes identifying a gene in an infectious microbe that is in the process of undergoing transformation from drug sensitivity to drug resistance. In another embodiment, the method includes identifying a gene in an infectious microbe that has already undergone transformation from a drug sensitive to drug resistant state.
In one embodiment, the invention relates to a method of identifying a gene in a microbe wherein the expression of the gene is modulated when the microbe is drug resistant as compared to the expression of the gene in an otherwise identical microbe not induced to become drug resistant. The identified gene can be isolated and accordingly, the invention includes variants, derivatives or fragments of the isolated gene and protein and peptide products, variants and derivatives encoded thereby. In
one embodiment, the drug resistant protein of the invention comprises the amino acid sequence of one or more of the sequences of SEQ ID NOs: 1-98. Also encompassed by the invention are antibodies or cellular immune responses that bind to or target the drug resistance proteins of the invention.
In one embodiment, the invention relates to the comparison of the proteomes and metabolomes of paired wild-type and rpoB- mutant MTB clinical isolates and the identification of compensatory mechanisms important to drug- resistant isolates of this pathogen. In one embodiment, the products identified at significantly higher spectral counts in the cell wall fraction of a /po5-mutant, rifampicin resistant strain represent proteins that are transcriptionally coupled on a 50- kb region involved in the biosynthesis of PDIM in MTB, including but not limited to two type-I polyketide synthase genes (Rv2933 IppsC and Rv2935 / 'ppsE) and a probable daunorubicin imycoserosate (DIM) transport protein (Rv2936/ 'drr A). Other proteins identified in other cellular fractions besides the cell wall include a succinate semialdehyde dehydrogenase (Rv0234c), a putative integration host factor
(Rvl388/mz7z ), a probable acyl-coA dehydrogenase (Rv3562/fadE31) involved in lipid degradation and a polynucleotide phosphorylase/polyadenylase (Rv2783c/g s/) involved in mRNA degradation. In addition, three products identified as (Rvl056, Rv3038c, and Rv3661) which are conserved hypotheticals of unknown function, are also included in the invention as examples of proteins expressed at higher levels (relative to wild-type isolates).
Following the identification of a drug-resistant protein following the methods of the invention, the protein and fragments thereof can be used to diagnose whether a mammal, preferably a human, is infected with a drug-resistant form of an infectious microbe. Preferably, the drug-resistant form of an infectious microbe is MTB.
The present invention is based on the concept that the adaptive immune response of a mammal can be used to determine the presence or absence of drug resistance because the immune response is capable of responding to an antigen associated with drug resistance in a microbe.
In some instances, the method for identifying current infection by a drug resistant microbe in a mammal relies on detecting a cell-mediated or humoral memory immune response associated with a drug resistant protein of the invention. In other instances, detection of the memory immune response to proteins expressed
during drug resistance allows for the identification of a prior drug resistant infection in the mammal.
In one embodiment, the invention includes a method of using immune responses against a drug resistant protein or otherwise a protein associated with drug resistance of the invention comprising the amino acid sequence of one or more of the sequences of SEQ ID NOs: 1-98 in an assay to detect microbial infection in a mammal. In one embodiment, the method of detecting a microbial infection in a mammal includes isolating whole blood or peripheral blood mononuclear cells (PBMCs) from a mammal and exposing the whole blood or PBMCs to one or more drug resistant proteins of the invention to determine the presence or absence of an immune response against the drug resistant protein. Detection of an immune response against the drug resistant protein is an indication that the mammal is now or has been previously infected with a drug resistant microbe. Preferably, the immune response against the drug resistant protein is a cell-mediated or humoral immune response.
In one embodiment, the invention includes an assay for measuring the magnitude of cellular immunologic responses to proteins upregulated by a drug resistant microbe (e.g., rpoB-mutant, rifampicin resistant MTB and other drug resistance mutations including those associated with aminoglycosides (amikacin, kanamycin), polypeptides (capreomycin, viomycin, enviomycin), Fluoroquinolones (ciprofloxacin, levofloxacin, moxifloxacin), thioamides (ethionamide,
prothionamide), rifabutin, macrolides (clarithromycin), linezolid, thioacetazone, thioridazine, arginine, vitamin D, R207910, and other new drugs being developed). In some instances, blood is drawn from a patient and the blood is incubated with one or more of the proteins upregulated by the drug resistant microbe. After a period of incubation time, the amount of cytokine is measured to determine the extent of the immune response directed to the one or more of the proteins upregulated by the drug resistant microbe, wherein detection of an immune response indicates that the patient is infected with a drug resistant microbe.
The invention provides the use of any assay to assess for an immunological response against any antigen that is expressed differentially between a drug-resistant strain compared to a corresponding drug-susceptible strain.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described.
As used herein, each of the following terms has the meaning associated with it in this section.
The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
"About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.
The term "abnormal" when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the "normal" (expected) respective characteristic. Characteristics which are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type.
The term "antibody" as used herein, refers to an immunoglobulin molecule, which is able to specifically bind to a specific epitope on an antigen.
Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies.
The term "antigen" or "Ag" as used herein is defined as a molecule that provokes an immune response, including both B and T cell responses. This immune response may involve either antibody production, or the activation of specific
immunologically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA. A skilled artisan will understand that any DNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an immune response can encode an "antigen" as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences can be arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a "gene" at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.
The term "analyte" as used herein may be a cell lysate or extract, a tissue lysate or extract, a cell culture supernatant, a tissue culture supernatant, or a body fluid. In some instances, "analyte" refers to a proteome or a mixture of different proteomes.
As used herein, the term "assessing" includes; diagnosing mycobacterial infection manifesting as TB; diagnosing drug resistant latent mycobacterial infection which does not manifest as disease; differentiating between active and latent mycobacterial infection; and monitoring the progress or change in the status of mycobacterial infection over time. In some instances, the change may occur spontaneously or as a result of treatment with a drug or vaccine or a test drug or test vaccine.
A "coding region" of a gene consists of the nucleotide residues of the coding strand of the gene and the nucleotides of the non-coding strand of the gene which are homologous with or complementary to, respectively, the coding region of an mRNA molecule which is produced by transcription of the gene.
A "coding region" of an mRNA molecule also consists of the nucleotide residues of the mRNA molecule which are matched with an anti-codon region of a transfer RNA molecule during translation of the mRNA molecule or which encode a stop codon. The coding region may thus include nucleotide residues
corresponding to amino acid residues which are not present in the mature protein encoded by the mRNA molecule (e.g., amino acid residues in a protein export signal sequence).
"Encoding" refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or an mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA
corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA.
Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. Nucleotide sequences that encode proteins and RNA may include introns.
A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate.
In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
A disease or disorder is "alleviated" if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, is reduced.
"Differentially increased expression" or "up regulation" refers to biomarker product levels which are at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% higher or more, and/or 1.1 fold, 1.2 fold, 1.4 fold, 1.6 fold, 1.8 fold, 2.0 fold higher or more, and any and all whole or partial increments therebetween than a control.
"Differentially decreased expression" or "down regulation" refers to biomarker product levels which are at least 10% or more, for example, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% lower or less, and/or 2.0 fold, 1.8 fold, 1.6 fold, 1.4 fold, 1.2 fold, 1.1 fold or less lower, and any and all whole or partial increments therebetween than a control.
An "effective amount" or "therapeutically effective amount" of a compound is that amount of compound which is sufficient to provide a beneficial effect to the subject to which the compound is administered. An "effective amount" of a delivery vehicle is that amount sufficient to effectively bind or deliver a compound.
The term "epitope" as used herein is defined as the part of an antigen that elicits an immune response, inducing B and/or T cell responses. An antigen can have one or more epitopes. Most antigens have many epitopes; i.e., they are multivalent. In general, an epitope is roughly 8 to 1 1 amino acids and/or sugars in length (for MHC Class I epitopes) or longer (for MHC Class II epitopes). One skilled in the art understands that generally the overall three-dimensional structure or the linear sequence of the molecule can be the main criterion of antigenic specificity distinguishing one epitope from another.
As used herein, the term "fragment," as applied to a nucleic acid, refers to a subsequence of a larger nucleic acid. A "fragment" of a nucleic acid can be at least about 15 nucleotides in length; for example, at least about 50 nucleotides to about 100 nucleotides; at least about 100 to about 500 nucleotides, at least about 500 to about 1000 nucleotides, at least about 1000 nucleotides to about 1500 nucleotides; or about 1500 nucleotides to about 2500 nucleotides; or about 2500 nucleotides (and any integer value in between).
As used herein, the term "fragment," as applied to a protein or peptide, refers to a subsequence of a larger protein or peptide. A "fragment" of a protein or peptide can be at least about 20 amino acids in length; for example at least about 50 amino acids in length; at least about 100 amino acids in length, at least about 200 amino acids in length, at least about 300 amino acids in length, and at least about 400 amino acids in length (and any integer value in between).
The term "immunoglobulin" or "Ig", as used herein is defined as a class of proteins, which function as antibodies. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody that is present in body secretions, such as saliva, tears, breast milk, gastrointestinal
secretions and mucus secretions of the respiratory and genitourinary tracts. IgG is the most common circulating antibody. IgM is the main immunoglobulin produced in the primary immune response in most mammals. It is the most efficient immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in defense against bacteria and viruses. IgD is the immunoglobulin that has no known antibody function, but may serve as an antigen receptor. IgE is the immunoglobulin that mediates immediate hypersensitivity by causing release of mediators from mast cells and basophils upon exposure to allergen.
As used herein, the phrase "infection and/or exposure" includes such diverse conditions in a patient as mycobacterial infection resulting in active disease, clearance, or latency, response to anti mycobacterial vaccination, close contact with an individual having or suspected of having a mycobacterial infection or with a mycobacterium that causes disease in humans, including in immunocompromised humans.
As used herein, an "instructional material" includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of a compound, composition, vector, or delivery system of the invention in the kit for effecting alleviation of the various diseases or disorders recited herein. Optionally, or alternately, the instructional material can describe one or more methods of alleviating the diseases or disorders in a cell or a tissue of a mammal. The instructional material of the kit of the invention can, for example, be affixed to a container which contains the identified compound, composition, vector, or delivery system of the invention or be shipped together with a container which contains the identified compound, composition, vector, or delivery system.
Alternatively, the instructional material can be shipped separately from the container with the intention that the instructional material and the compound be used cooperatively by the recipient.
"Isolated" means altered or removed from the natural state. For example, a nucleic acid or a peptide naturally present in a living animal is not "isolated," but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated." An isolated nucleic acid or protein can exist in substantially purified form, or can exist in a non-native environment such as, for example, a host cell.
"Naturally occurring" as used herein describes a composition that can be found in nature as distinct from being artificially produced. For example, a nucleotide sequence present in an organism, which can be isolated from a source in nature and which has not been intentionally modified by a person in the laboratory, is naturally occurring.
Unless otherwise specified, a "nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and that encode the same amino acid sequence. The phrase nucleotide sequence that encodes a protein or an RNA may also include introns to the extent that the nucleotide sequence encoding the protein may in some version contain an intron(s).
The term "polynucleotide" as used herein is defined as a chain of nucleotides. Furthermore, nucleic acids are polymers of nucleotides. Thus, nucleic acids and polynucleotides as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides, which can be hydrolyzed into the monomeric "nucleotides." The monomeric nucleotides can be hydro lyzed into nucleosides. As used herein polynucleotides include, but are not limited to, all nucleic acid sequences which are obtained by any means available in the art, including, without limitation, recombinant means, i.e., the cloning of nucleic acid sequences from a recombinant library or a cell genome, using ordinary cloning technology and PCR™, and the like, and by synthetic means.
As used herein, the terms "peptide," "polypeptide," and "protein" are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.
As used herein, "phenotypically distinct" is used to describe organisms, tissues, cells or components thereof, which can be distinguished by one or more characteristics, observable and/or detectable by current technologies. Each of such characteristics may also be defined as a parameter contributing to the definition of the phenotype. Wherein a phenotype is defined by one or more parameters an organism that does not conform to one or more of the parameters shall be defined to be distinct or distinguishable from organisms of the phenotype.
The terms "patient," "subject," "individual," and the like are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. Preferably, the patient, subject or individual is a mammal, and more preferable, a human.
The term "proteome" as used herein refers to the specific protein composition of a cell, tissue or organism. Depending on the individual cells contained therein, a culture of a cell or a tissue could, theoretically, contain as many proteomes as there are cells contained therein. For convenience, the proteomes of one cell culture or one tissue is regarded as representing one proteome. The proteomes of one type of organism may differ from another depending on the status and genomic background of its cells.
A "reference level" of a marker means a level of the marker that is indicative of a particular disease state, phenotype, or lack thereof, as well as combinations of disease states, phenotypes, or lack thereof. A "positive" reference level of a marker means a level that is indicative of a particular disease state or phenotype. A "negative" reference level of a marker means a level that is indicative of a lack of a particular disease state or phenotype.
As used herein, the term "tuberculosis" comprises disease states usually associated with infections caused by mycobacteria species comprising the M. tuberculosis complex, including M. africanum, M. bovis, M. bovis BCG, M. microti,
M. canetti, M. pinnipedii, and M. mungi.
The term "mycobacterial infection" is also associated with mycobacterial infections caused by mycobacteria other than M. tuberculosis (MOTT), including M. avium-intracellular e, M. kansasii, M.fortuitum, M. chelonae, M.
leprae, M. avium subspecies paratuberculosis, M. intracellular, M. scrofulaceum,
M. xenopi, M. abscessus, M. marinum, and M. ulcerans.
The term "treatment" as used within the context of the present
invention is meant to include therapeutic treatment as well as prophylactic, or suppressive measures for the disease or disorder. Thus, for example, the term treatment includes the administration of an agent prior to or following the onset of a disease or disorder thereby preventing, decreasing the future risk of, or removing all signs of the disease or disorder. As another example, administration of the agent after clinical manifestation of the disease to combat the symptoms of the disease comprises "treatment" of the disease.
A "therapeutic" treatment is a treatment administered to a subject who exhibits symptoms or signs of disease or pathology, for the purpose of diminishing or eliminating those signs.
As used herein, "treating a disease or disorder" means reducing the frequency with which a symptom of the disease or disorder is experienced by a patient.
"Variant" as the term is used herein, is a nucleic acid sequence or a peptide sequence that differs in sequence from a reference nucleic acid sequence or peptide sequence respectively. Changes in the sequence of a nucleic acid variant may not alter the amino acid sequence of a peptide encoded by the reference nucleic acid, or may result in amino acid substitutions, additions, deletions, fusions and truncations. Changes in the sequence of peptide variants are typically limited or conservative, so that the sequences of the reference peptide and the variant are closely similar overall and, in many regions, identical. A variant and reference peptide can differ in amino acid sequence by one or more substitutions, additions, deletions in any combination. A variant of a nucleic acid or peptide can be a naturally occurring such as an allelic variant, or can be a variant that is not known to occur naturally. Non-naturally occurring variants of nucleic acids and peptides may be made by mutagenesis techniques or by direct synthesis.
For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences may be compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequent coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percentage sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
As used herein, "vaccination" is intended for prophylactic or therapeutic vaccination.
Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Description
Infection with a microbe, such as mycobacteria (e.g. MTB), leads to an active disease state in a minority of individuals. Most individuals who become infected with MTB develop latent infection, which can be cleared by the host or which may persist for many years. In some individuals with latent MTB infection, MTB reactivates to cause active disease. The invention provides a strategy for controlling drug-resistant infection with MTB, whether latent or active, by detection of drug resistance in the microbe using adaptive immune responses to antigens expressed during the drug resistant state.
The present invention is based on the discovery that differentially expressed genes and encoded proteins thereof (e.g., a candidate antigen) between a drug-susceptible MTB strain and a corresponding drug-resistant MTB strain can be readily identified. Accordingly, the invention provides compositions and methods for identifying a novel drug-resistant antigen and, thereby, a drug resistant infection.
The present invention also relates to a comprehensive comparison of proteomes and metabolomes between rpoB mutant, rifampicin resistant MTB with those of their paired wild-type, rifampicin susceptible parent strains which identified several genes, particularly those involved in secondary metabolism such as genes involved in the biosynthesis of cell wall lipids including phthiocerol dimycocerosate (PDIM), that are upregulated in rpoB mutants, both in broth culture and, in particular, when grown in murine macrophages. In one embodiment, the products identified at
significantly higher spectral counts in the cell wall fraction of a rpoB mutant, rifampicin-resistant strain represent proteins that are transcriptionally coupled on a 50-kb region involved in the biosynthesis of phthiocerol dimycocerosate (PDIM) in Mtb, including two type-I polyketide synthase genes (including Rv2933 / 'ppsC and Rv2935/ppsE) and a probable daunorubicin imycoserosate (DIM) transport protein (Rv2936/ 'drr Ά). Other proteins identified in other cellular fractions besides the cell wall include a succinate semialdehyde dehydrogenase (Rv0234c), a putative integration host factor (Rvl388/mz7z ), a probable acyl-coA dehydrogenase
(Rv3562/fadE 31) involved in lipid degradation and a polynucleotide
phosphorylase/polyadenylase (Rv2783c/g s/) involved in mRNA degradation. In addition, three products identified as (Rvl056, Rv3038c, and Rv3661) which are conserved hypotheticals of unknown function, are also included in the invention as examples of a drug-resistant protein.
The invention includes a method of determining whether a drug- resistant mutant strain derived from a drug-susceptible strain expresses different genes and encoded proteins compared to the drug-susceptible strain. In one embodiment, the method identifies a gene and encoded protein that is present in the mutant drug- resistant strain but is absent in corresponding wild-type drug-susceptible strains. In another embodiment, the invention provides a method of distinguishing between a drug-susceptible and a drug-resistant strain of mycobacteria.
When armed with the drug-resistant antigen of the invention, the antigen can be used to diagnose, treat and prevent mycobacterial drug-resistant infection, whether latent or active. In one embodiment, the gene and encoded protein associated with drug-resistance in mycobacteria of the invention can be used for diagnosing, treating and preventing mycobacterial drug-resistant infection (latent or active) in a mammal. Preferably, the mammal is human.
In one embodiment, the invention includes a method of using the immune response against a protein that is differentially expressed in a drug resistant strain compared to a corresponding wild type strain. The differentially expressed protein in the drug resistant strain is considered to be a drug resistant antigen of the invention that can be assayed for the presence thereof in a biological sample from a mammal to detect microbial infection in the mammal. In one embodiment, the invention includes a method of using an immune response against an antigen of the invention comprising the amino acid sequence of one or more of the sequences of
SEQ ID NOs: 1-98 in an assay to detect microbial infection in a mammal. In one embodiment, the method of detecting a microbial infection in a mammal includes isolating whole blood or specifically peripheral blood mononuclear cells (PBMCs) from a mammal and exposing the blood or PBMCs to one or more drug resistant proteins of the invention to determine the presence or absence of an immune response against the drug resistant protein. Detection of an immune response against the drug resistant protein is an indication that the mammal is now or has been previously infected with a drug resistant microbe. Preferably, the immune response against the drug resistant protein is a cell-mediated or humoral immune response.
In one embodiment, the invention includes an assay for measuring the magnitude of cellular immunologic responses to proteins upregulated by a drug resistant microbe (e.g., rpoB mutant, rifampicin resistant MTB but can include resistance to any antibiotic used to treat TB infection). In some instances, blood is drawn from a patient and the blood is incubated with one or more of the proteins, peptide pools, select antigenic peptides, or other methods used to deliver a protein for immunologic presentation, upregulated by the drug resistant microbe (i.e., a drug- resistant antigen of the invention). After a period of incubation time, the amount of cytokine or the number of antigen-specific PBMCs secreting one or more cytokines is measured to determine the extent of the immune response directed to the one or more of the proteins upregulated by the drug resistant microbe, wherein detection of an immune response indicates that the patient is infected with a drug resistant microbe.
In one embodiment, one or more of the genes and encoded proteins associated with drug-resistance in mycobacteria of the invention can be used as an immunological composition. For example, the protein or otherwise antigen of the present invention can be used as a vaccine for targeting drug-resistant mycobacteria in a mammal. Another example is use of the protein or otherwise antigen of the present invention to detect immune responses in a mammal, in order to determine if the mammal's infection is drug resistant.
Identifying a Drug-Resistant Gene and Encoded Protein
In order to diagnose, treat and prevent mycobacterial drug-resistant infection, whether active or latent in a mammal, it is desirable to first identify a drug- resistant antigen. Accordingly, the invention includes compositions and methods for
determining whether a drug-resistant progeny strain expresses different genes and encoded proteins compared to that of a corresponding drug-susceptible strain.
Accordingly, the invention contemplates the identification of differentially expressed markers by whole genome nucleic acid microarray, to identify markers differentially expressed between a drug-resistant progeny strain and a corresponding drug-susceptible strain. The invention further contemplates using methods known to those skilled in the art to detect and to measure the level of differentially expressed marker expression products, such as RNA and protein, to measure the level of one or more differentially expressed marker expression products.
Typical diagnostic methods focusing on nucleic acids include amplification techniques such as PCR and RT-PCR (including quantitative variants), and hybridization techniques such as in situ hybridization, microarrays, blots, and others. Typical diagnostic methods focusing on proteins include binding techniques such as ELISA, imunohistochemistry, microarray and functional techniques such as enzymatic assays.
The genes identified as being differentially expressed may be assessed in a variety of nucleic acid detection assays to detect or quantify the expression level of a gene or multiple genes in a given sample. For example, traditional Northern blotting, nuclease protection, RT-PCR, microarray, and differential display methods may be used for detecting gene expression levels. Methods for assaying for mRNA include Northern blots, slot blots, dot blots, and hybridization to an ordered array of oligonucleotides. Any method for specifically and quantitatively measuring a specific protein or mRNA or DNA product can be used. However, methods and assays are most efficiently designed with array or chip hybridization-based methods for detecting the expression of a large number of genes. Any hybridization assay format may be used, including solution-based and solid support-based assay formats.
The protein products of the genes identified herein can also be assayed to determine the amount of expression. Methods for assaying for a protein include Western blot, immunoprecipitation, and radioimmunoassay. The proteins analyzed may be localized intracellularly (most commonly an application of
immunohistochemistry) or extracellularly (most commonly an application of immunoassays such as ELISA).
In one embodiment, the method comprises screening for a drug- resistance gene and encoded protein from a MTB strain that is resistant to rifampicin
(RFP, 3-(4-Methyl-l-piperaziny]imino]methyl)-rifamycin). However, the invention is not limited to rifampicin. That is, rifampicin is merely used as a non-limiting example. Therefore, any antitubercular drug resistance is applicable to the present invention. The method comprises culturing MTB isolates (e.g., a drug-susceptible parent isolate and a drug-resistance progeny isolate) under the same conditions with drug or without drug and comparing differentially expressed genes and encoded proteins. Preferably, the proteome of each cell lysate from each MTB isolate culture is compared to identify differentially expressed proteins. For example, a comparison of the in vitro proteome of the cell lysates derived from a drug-susceptible strain of MTB and a laboratory-derived rifampicin-resistant mutant strain derived from the parent strain cultured in the presence and absence of rifampicin can be obtained using a standard preoteomic analysis methodology.
In one embodiment, the invention provides a method of screening for a drug-resistant protein in a microbe (e.g., MTB) using proteomic technology.
Proteomic techniques allow for the representation of the proteome characteristics of the microbe in a high-throughput way. The proteome characteristics of each microbe can be compared with each other to generate a comparative proteome profile. The comparative proteome profile can be used to determine differentially expressed proteins between the microbial strains. For example, using comparative proteome analysis, a protein in an infectious microbe that is undergoing or has undergone transformation from drug sensitivity to drug resistance can be identified.
The invention also includes a method for mass spectrometry analysis for determining the proteome profile for the desired microbe. As used herein, the term "mass spectrometry" (or simply "MS") encompasses any spectrometric technique or process in which molecules are ionized and separated and/or analyzed based on their respective molecular weights. Thus, as used herein, the terms "mass spectrometry" and "MS" encompass any type of ionization method, including without limitation electrospray ionization (ESI), atmospheric -pressure chemical ionization (APCI) and other forms of atmospheric pressure ionization (API), and laser irradiation.
Mass spectrometers are commonly combined with separation methods such as gas chromatography (GC) and liquid chromatography (LC). GC or LC separates the components in a mixture, and the components are then individually introduced into the mass spectrometer; such techniques are generally called GC/MS and LC/MS, respectively. MS/MS is an analogous technique where the first-stage
separation device is another mass spectrometer. In LC/MS/MS, the separation methods comprise liquid chromatography and MS. Any combination (e.g.,
GC/MS/MS, GC/LC/MS, GC/LC/MS/MS, etc.) of methods can be used to practice the invention. In such combinations, "MS" can refer to any form of mass spectrometry; by way of non-limiting example, "LC/MS" encompasses LC/ESI MS and LC/MALDI-TOF MS. Thus, as used herein, the terms "mass spectrometry" and "MS" include without limitation APCI MS; ESI MS; GC MS; MALDI-TOF MS; LC/MS combinations; LC/MS/MS combinations; MS/MS combinations; etc.
It is often necessary to prepare samples comprising an analyte of interest for MS. Such preparations include without limitation purification and/or buffer exchange. Any appropriate method, or combination of methods, can be used to prepare samples for MS. One preferred type of MS preparative method is liquid chromatography (LC), including without limitation HPLC and RP-HPLC.
High-pressure liquid chromatography (HPLC) is a separative and quantitative analytical tool that is generally robust, reliable and flexible. Reverse- phase (RP) is a commonly used stationary phase that is characterized by alkyl chains of specific length immobilized to a silica bead support. RP-HPLC is suitable for the separation and analysis of various types of compounds including without limitation biomolecules, (e.g., glycoconjugates, proteins, peptides, and nucleic acids, and, with mobile phase supplements, oligonucleotides). One of the most important reasons that RP-HPLC has been the technique of choice amongst all HPLC techniques is its compatibility with electrospray ionization (ESI). During ESI, liquid samples can be introduced into a mass spectrometer by a process that creates multiple charged ions. However, multiple ions can result in complex spectra and reduced sensitivity.
In HPLC, peptides and proteins are injected into a column, typically silica based C18. An aqueous buffer is used to elute the salts, while the peptides and proteins are eluted with a mixture of aqueous solvent (water) and organic solvent (acetonitrile, methanol, propanol). The aqueous phase is generally HPLC grade water with 0.1% acid and the organic solvent phase is generally an HPLC grade acetonitrile or methanol with 0.1% acid. The acid is used to improve the chromatographic peak shape and to provide a source of protons in reverse phase LC/MS. The acids most commonly used are formic acid, trifluoroacetic acid, and acetic acid. In RP HPLC, compounds are separated based on their hydrophobic character. With an LC system coupled to the mass spectrometer through an ESI source and the ability to perform
data-dependant scanning, it is now possible in at least some instances to distinguish proteins in complex mixtures containing more than 50 components without first purifying each protein to homogeneity. Where the complexity of the mixture is very high, it is possible to couple ion exchange chromatography and RP-HPLC in tandem to identify proteins from mixtures containing in excess of 1,000 proteins.
A particular type of MS technique, matrix-assisted laser desorption time-of- flight mass spectrometry (MALDI-TOF MS) can also be used to analyze biological polymers for its desirable characteristics, such as relative ease of sample preparation, predominance of singly charged ions in mass spectra, sensitivity and high speed. MALDI-TOF MS is a technique in which a UV-light absorbing matrix and a molecule of interest (analyte) are mixed and co-precipitated, thus forming
analyte: matrix crystals. The crystals are irradiated by a nanosecond laser pulse. Most of the laser energy is absorbed by the matrix, which prevents unwanted fragmentation of the biomolecule. Nevertheless, matrix molecules transfer their energy to analyte molecules, causing them to vaporize and ionize. The ionized molecules are accelerated in an electric field and enter the flight tube. During their flight in this tube, different molecules are separated according to their mass to charge (m/z) ratio and reach the detector at different times. Each molecule yields a distinct signal. The method is used for detection and characterization of biomolecules, such as proteins, peptides, oligosaccharides and oligonucleotides, with molecular masses between about 400 and about 500,000 Da, or higher. MALDI-MS is a sensitive technique that allows the detection of low quantities of analyte in a sample.
Partial amino acid sequences of proteins can be determined by enzymatic proteolysis followed by MS analysis of the product peptides. These amino acid sequences can be used for in silico examination of DNA and/or protein sequence databases. Matched amino acid sequences can indicate proteins, domains and/or motifs having a known function and/or tertiary structure. For example, amino acid sequences from an uncharacterized protein might match the sequence or structure of a domain or motif that binds a ligand. As another example, the amino acid sequences can be used in vitro as antigens to generate antibodies to the protein and other related proteins from other biological source material (e.g., from a different tissue or organ, or from another species). There are many additional uses for MS, particularly
MALDI-TOF MS, in the fields of genomics, proteomics and drug discovery. For a
general review of the use of MALDI-TOF MS in proteomics and genomics, see Bonk et al. (2001 Neuroscientist 7: 12).
Tryptic peptides can be directly analyzed using MALDI-TOF.
However, where sample complexity is apparent, on-line or off-line LC-MS/MS or two-dimensional LC-MS/MS may be necessary to separate the peptides. For example, for simple digests, a gradient of 5-45% (v/v) acetonitrile in 0.1% formic acid (or TFA, if MALDI MS/MS is available) over 45 min, and then 45-95%> acetonitrile in 0.1% formic acid (or TFA, if MALDI MS/MS is available) over 5 min can be used. 0.1% Formic acid solution is used on the Q-TOF instrument and 0.1% TFA solution is used on the Dionex Probot fraction collector for off-line coupling between HPLC and MALDI-MS/MS analysis (carried out on the ABI 4700). For a complex sample, a gradient of 5-45% (v/v) acetonitrile over 90 min, and then 45-95% acetonitrile over 30 min can be used. For a very complex sample, a gradient of 5-45% (v/v) acetonitrile over 120 min, and then 45-95% acetonitrile over 60 min might be used. On the Q- TOF, one survey scan and four MS/MS data channels are used to acquire CID data with 1.4 s scan time.
In another embodiment, the invention comprises any method known in the art to effectively detect an antigen, an antibody, or an antigen-antibody complex in a sample. Suitable methods include, but are not limited to, immunoassays, enzyme assays, mass spectrometry, biosensors, and chromatography. Thus, the invention includes the use of any type of instrumentality to detect a desired antigen, antibody, or antigen-antibody complex in a sample.
In one embodiment, an immunoassay can be an enzyme-linked immunosorbant immunoassay (ELISA), a sandwich assay, a competitive assay, a radioimmunoassay (RIA), a lateral flow immunoassay, a Western Blot, an
immunoassay using a biosensor, an immunoprecipitation assay, an agglutination assay, a turbidity assay or a nephelometric assay.
Compositions for Diagnosis and Treatment
Following the identification of the drug-resistant antigen using the methods of the invention, the antigen may be used to diagnose, treat and prevent mycobacterial drug-resistant infection, whether active or latent.
In one embodiment, the invention provides compositions comprising a unique protein or proteins or otherwise an antigen or group of antigens preferentially
expressed by a drug-resistant infected cell. In general, the antigen or antigens of the present invention are recognized by the host's adaptive immune system. Preferably, the antigen is recognized by a cell-mediated immune response, although the invention also includes approaches based on the humoral immune system as well. In one embodiment, the antigen of the present invention is a polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-98, or any combination thereof.
In another aspect, the present invention provides a method for using the antigen or antigens of the present invention to detect drug resistance in a pathogenic microbe or infection of a pathogenic microbe. Preferably, the microbe is MTB. In one embodiment, the method includes detecting MTB exposure or infection in a test biological sample using an antigen or antigens of the invention or fragment(s) thereof. Other known MTB antigens may be used in combination with the antigens of the invention.
Cellular immune-based assays have been developed and are used in the clinical setting. Measurement of cell-mediated immune responses is important for immune diagnosis of many infectious and autoimmune diseases, as a marker for detection of T-cell responses to an antigen. Current methods for detecting cell- mediated immune responses include skin tests measuring both immediate and delayed type hypersensitivity, lymphocyte proliferation assays and measurement of cytokines produced by purified mononuclear cells cultured with antigen. Most in vitro methods for detecting cell-mediated immune responses involve the purification of lymphocytes from whole blood, culturing these lymphocytes with an antigen for periods from 12 hours to 6 days and then detecting T-cell reactivity to the antigen. Established methods, such as the proliferation assay, use the uptake of radioactive isotopes by dividing T-cells as a marker for cell mediated immune response reactivity. More recently, techniques such as a single cell assay (ELISpot) have been used to detect the number of T-cells producing certain cytokines in response to the antigenic stimulation.
The present invention provides a method for measuring cell-mediated immune responses in a subject by incubating a sample from the subject which comprises T-cells or other cells of the immune system with an antigen. Production of IFN-gamma or other cytokine or immune effector molecule(s) is then detected. The
presence or level of immune effector is then indicative of the level of cell mediated responsiveness of the subject.
The present invention provides an assay of the potential or capacity of a subject to mount a cell-mediated response. The assay is based on measuring immune effector molecule production by cells of the immune system in response to antigenic stimulation. The immune effectors may be detected using ligands such as antibodies specific for the effectors or by measuring the level of expression of genes encoding the effectors. The present invention provides, therefore, a means to determine the responsiveness of cell mediated immune response in a subject and, in turn, provides a means for the diagnosis of infectious diseases, pathological conditions, level of immunocompetence and a marker of T-cell responsiveness to endogenous or exogenous antigens.
Accordingly, one aspect of the present invention contemplates a method for measuring a cell mediated immune response in a subject. The method comprises collecting a sample from the subject wherein the sample comprises cells of the immune system which are capable of producing immune effector molecules following stimulation by an antigen, incubating the sample with an antigen and then measuring the presence of or elevation in the level of an immune effector molecule wherein the presence or level of the immune effector molecule is indicative of the capacity of the subject to mount a cell-mediated immune response.
In one embodiment, the present invention provides a method for measuring a cell mediated immune response in a human subject, the method comprising collecting a sample from the human subject wherein the sample comprises cells of the immune system which are capable of producing immune effector molecules following stimulation by an antigen, incubating the sample with an antigen and then measuring the presence of or elevation in the level of an immune effector molecule wherein the presence or level of said immune effector molecule is indicative of the capacity of the human subject to mount a cell-mediated immune response.
The immune effector molecules may be any of a range of molecules which are produced in response to cell activation or stimulation by an antigen.
Although an interferon such as IFN-γ is a particularly useful immune effector molecule, others include a range of cytokines such as interleukins (IL), e.g. IL-2, IL- 4, IL-10 or IL-12, tumor necrosis factor alpha (TNF-alpha), a colony stimulating
factor (CSF) such as granulocyte (G)-CSF or granulocyte macrophage (GM)-CSF amongst many others including chemokines, proteins associated with degranulation (CD 107a), and proteins associated with lysis (granzyme, perforin).
Accordingly, in another preferred embodiment, the present invention provides a method for measuring a cell-mediated immune response in a subject, said method comprising collecting a sample from the subject wherein the sample comprises cells of the immune system which are capable of producing IFN-gamma molecules following stimulation by an antigen, incubating the sample with an antigen and then measuring the presence of or elevation in the level of an IFN-gamma molecule wherein the presence or level of the IFN-gamma molecule is indicative of the capacity of said subject to mount a cell-mediated immune response.
As far as the preferred embodiment extends to humans is concerned, the present invention further provides a method for measuring a cell mediated immune response in a human subject, the method comprising collecting a sample from the subject wherein the sample comprises cells of the immune system which are capable of producing IFN-gamma molecules following stimulation by an antigen, incubating the sample with an antigen and then measuring the presence or elevation in level of an IFN-gamma molecule wherein the presence or level of said IFN-gamma molecule is indicative of the capacity of said human subject to mount a cell-mediated immune response.
Some of these assays measure ex vivo IFN-γ T cell responses from blood samples after overnight incubation with desired protein antigens which are present in M. tuberculosis. Broadly, two commercially available assay formats exist: enzyme-linked immunospot (ELISpot) and enzyme-linked immunoassay (ELISA). These assays are believed to be a significant advancement in the diagnosis of MTB infection. Accordingly, the antigens of the present invention can be added to similar assays in order to not only diagnose previous or current MTB infection (which present assays can do), but also detect any antitubercular drug resistance, such as rifampicin resistance in the infection as well. However, the invention is not limited to these assays, but rather, the protein antigens of the present invention can be used in any assay in the art for immunologically detecting an infectious agent that has developed drug resistance.
The present invention provides assays for detecting drug resistance in MTB using adaptive immune responses. The assays of the invention can be integrated into existing "in-tube" cellular assays, for example, simply by adding the drug- resistance antigen(s) of the present invention in an additional tube. Because these "in- tube" assays have been shown to be cost effective in resource limited settings (Burgos et al, 2009, Int J Tuberc Lung Dis 13(8):962-8), the assays of the present invention relating to diagnosing drug resistance can translate into improved clinical care.
In one embodiment, the present invention provides an improvement to the existing cellular immune-based assays for identifying mycobacterial infection. This is because the antigens of the present invention are useful for identifying drug resistant infection as opposed to simply detecting infection.
In addition to cell-mediated assays, the antigens of the present invention can be used in a variety of assay formats known to those of ordinary skill in the art for using polypeptides to detect antibodies in a sample or using an antigen binding agent to detect polypeptides in a sample. See, e.g., Harlow and Lane,
Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, 2001. In one example, the assay involves the use of one or more polypeptides of SEQ ID NOs: 1- 98 immobilized on a solid support to bind to and remove the antibody or polypeptide from the sample. The bound polypeptide or antibody (i.e., the formation of a polypeptide-antibody) may then be detected using a detection reagent that contains a reporter group. Suitable detection reagents include, but are not limited to antibodies that bind to the antibody/polypeptide complex and free polypeptide labeled with a reporter group (e.g., in a semi-competitive assay). Alternatively, a competitive assay may be utilized, in which an antibody that binds to the polypeptide is labeled with a reporter group and allowed to bind to the immobilized antigen after incubation of the antigen with the sample. The extent to which components of the sample inhibit the binding of the labeled antibody to the polypeptide is indicative of the reactivity of the sample with the immobilized polypeptide.
The solid support may be any solid material known to those of ordinary skill in the art to which the polypeptide or polypeptide binding agent of the invention may be attached. For example, the solid support may be a test well in a microtiter plate or a nitrocellulose membrane or other suitable membranes.
Alternatively, the support may be a bead or disc, such as, but not limited to, glass,
fiberglass, latex or a plastic material such as polystyrene or polyvinylchloride. The support may also be a magnetic particle or a fiber optic sensor.
The polypeptide or polypeptide binding agent of the invention may be bound to the solid support using a variety of techniques known to those of ordinary skill in the art, which are amply described in the patent and scientific literature. In the context of the present technology, the term "bound" refers to both noncovalent association, such as adsorption, and covalent attachment (which may be a direct linkage between the polypeptide or the antigen-binding agent and functional groups on the support or may be a linkage by way of a cross-linking agent). The polypeptides or polypeptide binding agents of the invention may also be bound by adsorption to a well in a microtiter plate or to a membrane. In such cases, adsorption may be achieved by contacting the polypeptides or polypeptide binding agents of the invention, in a suitable buffer, with the solid support for a suitable amount of time. The contact time varies with temperature, but is typically between about 1 hour and 1 day. In general, contacting a well of a plastic microtiter plate (such as polystyrene or
polyvinylchloride) with an amount of polypeptide or polypeptide binding agent ranging from about 10 ng to about 1 mg, and about 100 mg, is sufficient to bind an adequate amount of polypeptide or antibody.
In certain embodiments, the assay is an enzyme immunoassay (EIA) or enzyme-linked immunosorbent assay (ELISA). In these assays, an enzyme, which is bound to the polypeptide or antigen-binding agent will react with an appropriate substrate, e.g., a chromogenic substrate, in such a manner as to produce a chemical moiety which can be detected, for example, by spectrophotometric, fluorimetric or by visual means.
In some embodiments, in an EIA or ELISA, the assay is performed by first contacting a polypeptide antigen that has been immobilized on a solid support, commonly the well of a microtiter plate, with a test sample, such that antibodies to the polypeptide within the sample are allowed to bind to the immobilized polypeptide. Unbound sample is then removed from the immobilized polypeptide and a detection reagent capable of binding to the immobilized antibody -polypeptide complex is added. The amount of detection reagent that remains bound to the solid support is then determined using a method appropriate for the specific detection reagent.
More specifically, once the polypeptide is immobilized on the support as described above, the remaining protein binding sites on the support are typically
blocked. Any suitable blocking agent known to those of ordinary skill in the art, such as bovine serum albumin or Tween 20™ (Sigma Chemical Co., St. Louis, Mo., USA) may be employed. The immobilized polypeptide is then incubated with the sample, and antibody is allowed to bind to the polypeptide. The sample may be diluted with a suitable diluent, such as phosphate-buffered saline (PBS) prior to incubation. In some embodiments, an appropriate contact time (i.e., incubation time) is that period of time that is sufficient to detect the presence of antibody within a test biological sample. In some embodiments, the contact time is sufficient to achieve a level of binding that is at least 95% of that achieved at equilibrium between bound and unbound antibody. Those of ordinary skill in the art will recognize that the time necessary to achieve equilibrium may be readily determined by assaying the level of binding that occurs over a period of time. At room temperature, an incubation time of about 30 minutes is generally sufficient.
Unbound sample may then be removed by washing the solid support with an appropriate buffer, such as PBS containing 0.1% (v/v) Tween 20™. Detection reagent may then be added to the solid support. An appropriate detection reagent is any compound that binds to the immobilized antibody -polypeptide complex and that can be detected by any of a variety of means known to those in the art. Suitable detection reagents include, but are not limited to binding agents such as, Protein A, Protein C, immunoglobulin, lectin or free antigen conjugated to a reporter group. Suitable reported groups include, but are not limited to, e.g., enzymes (such as horseradish peroxidase and alkaline phosphatase), substrates, cofactors, inhibitors, dyes, radionuclides, luminescent groups, fluorescent groups, biotin and colloidal particles, such as colloidal gold and selenium. The conjugation of binding agent to reporter group may be achieved using standard methods known to those of ordinary skill in the art. Common binding agents may also be purchased conjugated to a variety of reporter groups from many commercial sources (e.g., Zymed Laboratories, San Francisco, Calif, USA, and Pierce, Rockford, 111., USA).
Enzymes which can be used to detectably label the polypeptide- antibody complex formed include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-5 -steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and
acetylcholinesterase. Additionally, the detection can be accomplished by colorimetric methods which employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
The detection reagent is then incubated with the immobilized antibody- polypeptide complex for an amount of time sufficient to detect the bound antibody. An appropriate amount of time may generally be determined from the manufacturer's instructions or by assaying the level of binding that occurs over a period of time. Unbound detection reagent is then removed and bound detection reagent is detected using the reporter group. The method employed for detecting the reporter group depends upon the nature of the reporter group. For radioactive groups, scintillation counting or autoradiographic methods are generally appropriate. Spectroscopic methods may be used to detect dyes, luminescent groups and fluorescent groups. Biotin may be detected using avidin, coupled to a different reporter group (commonly a radioactive or fluorescent group or an enzyme). Enzyme reporter groups may generally be detected by the addition of substrate (generally for a specific period of time), followed by spectroscopic or other analysis of the reaction products.
All known variants of ELISA type assays may be used in the methods of the present technology, including but not limited to, e.g., indirect ELISA, sandwich EISA, competitive ELISA (see e.g., U.S. Pat. Nos. 5,908,781 and 7,393,843).
Additionally other ELISA methods known in the art may be used in the methods of the present technology.
Other assays for use in the methods of the present technology include radioimmunoassay (RIA) (see, e.g., Weintraub, B., Principles of Radioimmunoassays, Seventh Training Course on Radioligand Assay Techniques, The Endocrine Society, (March, 1986)). The agent used to detect the polypeptide-antigen binding complex may be radioactively labeled. The radioactive isotope can be detected by means including, but not limited to, e.g., a gamma counter, a scintillation counter, or autoradiography.
In one embodiment, the invention provides compositions and methods of evaluating the relationship between infection with drug-resistant MTB and cellular immune responses to drug-resistance antigens differentially expressed by MTB during drug resistance. Preferably, detection of a cellular immune response can be accomplished by detecting T cells or T cell responses specific for the antigens of the
present invention. Thus, the invention provides an assay for distinguishing between MTB infection that is drug-susceptible and drug-resistant.
In one embodiment, the T cells are in the form of peripheral blood lymphocytes (PBLs). In another embodiment, the T cells are in the form of peripheral blood mononuclear cells (PBMCs). PBLs are mature lymphocytes that are found circulating in the blood, as opposed to being located in organs such as lymph nodes, spleen, thymus, liver or bone marrow.
In a further embodiment, T cells are isolated from body fluids taken from sites of active TB disease, for example bronchoalveolar lavage (BAL) (lung washings) or pleural effusions or cerebrospinal fluid or ascites.
However, it will be understood that any body fluid containing T cells can be used in the methods of the current invention, which are not restricted to T cells from disease sites or blood. The envisaged body fluids include BAL, lung biopsy, sputum (including induced sputum), ascites, pleural fluid, pleural biopsy, lymph node biopsy, joint aspirate, cerebral spinal fluid, soft tissue abscess and any other affected part of the body.
Preferably, the T cell response measured is secretion of one or more cytokines and/or chemokines or expression of one or more markers of T cell activation.
Preferably, the cytokine is IFN gamma. However, it will be apparent to the skilled person that other cytokines, for example TNF-alpha or IL-2, and/or chemokines, for example RANTES, MCP-1 or MIP 1 -alpha, could be employed alone or in combination in the method of the current invention.
It will be readily apparent to the skilled person that the cytokine or chemokine can be detected by any suitable technique known in the art, for example, ELISPOT or intracellular cytokine staining followed by flow cytometry, or cytokine secretion and capture assay or ELISA or whole-blood ELISA.
In one embodiment, the diagnostic assay according to the invention, is performed on PBMCs obtained from a mammal. The in vitro immune diagnostic assay for drug-resistant TB infection, according to the invention, is performed using a diagnostic kit comprising at least one antigen selected from the group consisting of SEQ ID NOs: 1-98 or any combination thereof. For example, PBMCs are isolated from a mammal and the isolated PBMCs are contacted with one or more of the antigens of the invention in order to determine the reactivity of the PBMCs against the
antigen. The number of PBMCs secreting IFN-γ in response to stimulation (via cell culture) with a candidate antigen can be measured to quantify the immune response to the antigens of interest.
PBMCs from patients or subjects requiring testing for MTB exposure or infection may be used to detect or diagnose infection by MTB. Generally, the PBMCs from test subjects or mammals are isolated and then cultured with one or more polypeptides, peptide pools or select peptides from the polypeptide, or nucleic acids (DNA or RNA and their derivatives) encoding the polypeptide, of the invention. After a period of time, cell culture supernatants are collected and cytokine production by the PBMCs is measured. In one embodiment, the amount of cytokine secreted by the PBMCs is compared to a control PBMC sample (e.g., from a patient who has not been exposed to MTB). A greater or lesser amount of cytokine present in the test sample is indicative of exposure to and/or infection by MTB. Similar assays are described in more detail in Dillon, et al, J. of Clinical Microbiol. 38:3285-3290 (2000) and in U.S. Pat. No. 7,387,882. Cytokines which can be measured in the
PBMC assay described above include but are not limited to any cytokine which the PBMCs can produce (e.g., IFN-gamma, IL-12, IL-5, and IL-2).
In one embodiment, the assay of the invention measures the magnitude of cellular immunologic responses to proteins upregulated by a drug resistant microbe (e.g., rpoB mutant, rifampicin-resistant MTB). In some instances, blood is drawn from a patient and equal amounts of blood are placed in multiple tubes, whereby one tube represents a negative control (e.g., in the absence of an antigen), another tube represents a positive control (e.g., in the presence of a universal antigen), and another tube coated with one or more of the proteins upregulated by the drug resistant microbe (e.g., rpoB mutant, rifampicin-resistant MTB). After a period of incubation time, the amount of cytokine in each tube is compared, and samples showing strong reactions to proteins upregulated by the drug resistant microbe, in combination with minimal and strong reactions in the negative and positive control tubes, respectively, are deemed to be positive. A positive result indicates infection with a drug resistant microbe. In addition, another tube can be added with antigens used to detect MTB infection, such that the assay provides information on presence or absence of MTB infection and the presence or absence of rifampicin (or other drug) resistance in the infecting strain.
Of course, numerous other assay protocols exist that are suitable for use in the methods of the present invention. The descriptions are intended to be illustrative only and in no way is considered to limit the invention.
In some instances, the antigens of the invention may be used in an assay to detect the reactivity of antibodies present in a biological sample from a mammal. For example, the antigens of the invention are used as immunological probes to assess the pattern of humoral immunity driven by the presence of an infection.
The antigens of the invention may be used in the assays described herein, either alone or in combination with one another. The use of single antigens or any combination of antigens may be suitable for use in the assays described herein provided the assay demonstrates the desired sensitivity and negative predictive values. In certain embodiments, the use of a combination of antigens may result in a sensitivity of approximately, 0.80, 0.85, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0 with a negative predictive value of approximately 0.80, 0.85, 0.90, 0.91, 0.92, 0.93, 0.94, 0.95, 0.96, 0.97, 0.98, 0.99, or 1.0. In some embodiments, the values are significant. Comparisons may be performed and significance determined using any of the available statistical analysis tools, alone or in combination with one another, including, for example, student's T-test, chi-square test, Fisher's exact test, analysis of variance (A OVA), univariate statistical analyses, logistic regression analysis to calculate adjusted odds ratio (OR) and 95% confidence interval (CI). Conrols for any statistically significant demographic variables that might function as confounders (gender, etc) may also be utilized. Differences between values are typically considered significant at p<0.05 or p<0.01, for example. Other statistical analysis tools may also be used.
For instance, the assays may be performed to detect antibodies immunoreactive to only one of the antigens of the invention (e.g., SEQ ID NOs 1-98), without assaying for antibodies reactive to any other antigen. Alternatively, the assay may be performed to detect antibodies immunoreactive to more than one of the antigens of the invention. The assays described herein may also be used with other antigens in combination with one another and/or one or more of the antigens of the invention.
Thus, the invention includes a method of detecting the presence of and/or diagnosing a drug resistant strain in a subject comprising detecting in a
biological sample from the subject antibodies against one or more antigens of the invention, wherein the presence of antibodies that bind to the antigen(s) is indicative of infection with a drug resistant strain. In certain embodiments, the method comprises contacting a biological sample derived from a subject with the isolated or purified antigens of the invention for a time and under conditions sufficient for an antigen-antibody complex to form and then detecting the formation of an antigen- antibody complex. Detection of the antigen-antibody complex may be achieved by detecting human immunoglobulin in the complex. In certain embodiments, detection of the antibody may be accomplished by contacting the antigen-antibody complex with a "second" antibody that is immunologically reactive with human
immunoglobulin (e.g., anti-human immunoglobulin antibody) for a time and under conditions sufficient for the second antibody to bind to the human immunoglobulin in the complex and then detecting the bound anti-human immunoglobulin. It is preferred that the second antibody is labeled with a detectable marker or reporter molecule.
Pharmaceutical
The present invention includes methods for stimulating a specific immunogenic TB response in an individual, in order to prevent or reduce the severity of the drug-resistant TB disease, by administering an amount of one or more of the polypeptide molecules or nucleic acid molecules described herein (e.g., in a carrier). In another aspect, the present invention includes compositions (e.g., vaccine compositions or pharmaceutical compositions) having the polypeptide molecules or nucleic acid molecules described herein, in a physiologically acceptable carrier. The composition can also include or can be co-administered with an immune response enhancer (e.g., an adjuvant, another TB antigen, immunostimulatory cytokine or chemokine).
Additional immunological or nucleic acid assessments can be performed using methods known in the art. Assays, known in the art or those later developed can be used to assess the antigenic TB polypeptides in a sample.
In addition to measuring the presence of antigenic TB polypeptides in a sample, assays exist to determine the efficacy of a TB vaccine (e.g., the extent to which the immune response directed at antigens present during drug resistance is stimulated). These types of assays can be used together to fully assess a person's TB status. For example, an individual who has a TB-specific immunogenic response, but
tests negative to the presence of one or more the antigenic TB polypeptides in a sample, is one who is less likely to have drug-resistant MTB infection. However, a person who has a TB-specific immunogenic response and tests positive to the presence of the antigenic TB polypeptides of the present invention is someone who likely has infection with a strain of MTB that is drug resistant.
The efficacy of a TB vaccine at stimulating immune responses to antigens produced during drug resistance can be measured by determining the immunogenic response of the person who received the vaccine. The MTB antigens of the present invention (and immunogenic portions thereof) described herein have the ability to induce an immunogenic response. More specifically, the antigens have the ability to induce proliferation and/or cytokine production (i.e., IFN-gamma, IL-12, IL- 5, and IL-2) in T cells, NK cells, B cells and/or macrophages derived from an MTB- infected individual.
The selection of cell type for use in evaluating an immunogenic response to an antigen will, of course, depend on the desired response. For example, IL-12 production is most readily evaluated using preparations containing B-cells and/or macrophages. An MTB-infected individual can be identified by virtue of having mounted a T cell response to antigens of MTB. Such individuals can be identified based on a strongly positive (i.e., greater than about 10 mm diameter induration) intradermal skin test response to MTB proteins using a Purified Protein Derivative (PPD). Individuals who have these responses and who do not have any signs or symptoms of active TB disease are considered latently infected with MTB. T cells, NK cells, B cells and macrophages derived from MTB-infected individuals can be prepared using methods known to those of ordinary skill in the art. For example, a preparation of PBMCs (i.e., peripheral blood mononuclear cells) can be employed without further separation of component cells. PBMCs can generally be prepared, for example, using density centrifugation through Ficoll (Winthrop Laboratories, NY). T cells for use in the assays described herein can also be purified directly from PBMCs. Alternatively, an enriched T cell line reactive against mycobacterial proteins, or T cell clones reactive to individual mycobacterial proteins, can be employed. Such T cell clones can be generated by, for example, culturing PBMCs from MTB-infected individuals with mycobacterial proteins for a period of 2-4 weeks. This allows expansion of only the mycobacterial protein-specific T cells, resulting in a line composed solely of such cells. These cells can then be cloned and tested with
individual proteins, using methods known to those of ordinary skill in the art, to more accurately define individual T cell specificity. In general, antigens that test positive in assays for proliferation and/or cytokine production (i.e., IFN-γ and/or IL-12 production) performed using T cells, NK cells, B cells and/or macrophages derived from an MTB -infected individual are considered immunogenic. Such assays can be performed, for example, using the representative procedures described below.
Immunogenic portions of such antigens can be identified using similar assays, and can be present within the polypeptides described herein.
The ability of a polypeptide (e.g., an immunogenic antigen, or a portion or other variant thereof) to induce cell proliferation can be evaluated by contacting the cells (e.g., T cells and/or NK cells) with the polypeptide and measuring the proliferation of the cells. In general, the amount of polypeptide that is sufficient for evaluation of about 105 cells ranges from about 10 ng/niL to about 100 μg/mL and preferably is about 10 μg/mL. The incubation of polypeptide with cells may be performed at 37°C for about six days, although protocols vary. Following incubation with polypeptide, the cells are assayed for a proliferative response, which can be evaluated by methods known to those of ordinary skill in the art, such as exposing cells to a pulse of radiolabeled thymidine and measuring the incorporation of label into cellular DNA. In general, a polypeptide that results in at least a three-fold increase in proliferation above background (i.e., the proliferation observed for cells cultured without polypeptide) is considered to be able to induce proliferation.
The ability of a polypeptide to stimulate the production of IFN-γ, TNF- a, and/or IL-2 in cells can be evaluated by contacting the cells with the polypeptide and measuring the level of IFN-γ, TNF-a, or IL-2 produced by the cells. In general, the amount of polypeptide that is sufficient for the evaluation of about 105 cells ranges from about 10 ng/niL to about 100 μg/mL and preferably is about 10 μg/mL. The polypeptide can, but need not, be immobilized on a solid support, such as a bead or a biodegradable microsphere, such as those described in U.S. Pat. Nos. 4,897,268 and 5,075,109. The incubation of polypeptide with the cells is typically performed at 37°C for about six days. Following incubation with polypeptide, the cells are assayed for IFN-γ, TNF-a, and/or IL-2 (or other proteins made in response to specific antigen stimulation), which can be evaluated by methods known to those of ordinary skill in the art, such as an enzyme-linked immunosorbent assay (ELISA) or, in the case of IL-
12 P70 subunit, a bioassay such as an assay measuring proliferation of T cells. In general, a polypeptide that results in the production of at least 50 pg of IFN-γ per mL of cultured supernatant (e.g., containing 105 T cells per mL) is considered able to stimulate the production of IFN-γ.
In general, immunogenic antigens are those antigens that stimulate proliferation and/or cytokine production (i.e., IFN-γ. and/or IL-12 production) in T cells, NK cells, B cells and/or macrophages derived from at least about 25% of MTB- infected individuals. Among these immunogenic antigens, polypeptides having superior therapeutic properties can be distinguished based on the magnitude of the responses in the above assays and based on the percentage of individuals for which a response is observed. In addition, antigens having superior therapeutic properties will not stimulate proliferation and/or cytokine production in vitro in cells derived from more than about 25% of individuals who are not MTB -infected, thereby eliminating responses that are not specifically due to MTB-responsive cells. Those antigens that induce a response in a high percentage of T cell, NK cell, B cell and/or macrophage preparations from MTB-infected individuals (with a low incidence of responses in cell preparations from other individuals) have superior therapeutic properties.
Vaccine Compositions, Mode and Manner of Administration
The present invention is partly based on the discovery of differential expression of proteins by drug-resistant MTB isolates. Thus one or more MTB proteins expressed at higher levels (relative to drug susceptible MTB) are available to the immune system and are immunogenic. Hence, the vaccine compositions and methods are designed to augment this immunity, and preferably, to induce it a stage wherein the drug-resistant infection can be prevented or controlled. The vaccine compositions are particularly useful in preventing and/or treating MTB infection in subjects at high risk of, or who already have, such a drug-resistant infection, respectively. The vaccine compositions and methods are also applicable to veterinary uses.
Invention includes a vaccine composition for immunizing a subject against drug resistant MTB infection. Preferred antigens for use in a vaccine composition, alone, in combination, or in linear multimers, include any one or more of the antigens described elsewhere in the context of the diagnostic compositions. For
example, one or more of the sequences of SEQ ID NOs: 1-98 can be used for the vaccine.
In one embodiment, the vaccine comprises a fusion protein or peptide multimer which includes a drug-resistant antigen, e.g., a full length protein and/or one or more of the above peptides comprising one or more of SEQ ID NO: 1-98.
One or more of the polypeptides of the present invention can be used in the form of a vaccine or immunological composition designed to prevent or treat drug-resistant MTB infection. In some instances, one or more of the polypeptides of the present invention can be in a form of a conjugate or a fusion protein, which can be manufactured by known methods. In particular, one or more of the sequences of SEQ ID NOs: 1-98 can be fused to one another, or with other proteins, to provide a more effective vaccine composition, and stimulate an improved immunogenic response. Other proteins that can be used to make such a fusion protein include, for example, MTB antigens that simulate the CD4+ T cell or CD1 cellular pathway (which present lipid antigens to T cells) of the immune response. The MTB polypeptides of the present invention were isolated from MHC class 1 molecules, molecules known for presenting antigens to CD8+ T cells. Although it is possible for these polypeptides to be also presented in the CD4+ pathway, fusing a CD4+ T-cell pathway antigen with one of the polypeptides of the present invention can serve to increase effectiveness of the TB vaccine. Fusion proteins can be manufactured according to known methods of recombinant DNA technology. For example, fusion proteins can be expressed from a nucleic acid molecule comprising sequences which code for a biologically active portion of the TB polypeptides or the entire TB polypeptides set forth in SEQ ID NOs: 1-98 or combinations thereof, and its fusion partner, for example another sequence of the present invention, a portion of an immunoglobulin molecule, or another TB antigen from the CD4+ T cell pathway. For example, some embodiments can be produced by the intersection of a nucleic acid encoding immunoglobulin sequences into a suitable expression vector, phage vector, or other commercially available vectors. The resulting construct can be introduced into a suitable host cell for expression. Upon expression, the fusion proteins can be isolated or purified from a cell by means of an affinity matrix. By measurement of the alternations in the functions of transfected cells occurring as a result of expression of recombinant MTB proteins, either the cells themselves or MTB proteins produced from the cells can be utilized in a variety of screening assays.
In certain aspects the inventive compositions comprise fusion proteins or DNA fusion molecules. Each fusion protein comprises a first and a second inventive polypeptide or, alternatively, a polypeptide of the present invention and a known MTB antigen, together with variants of such fusion proteins. The fusion proteins of the present invention can also include a linker peptide between the first and second polypeptides. The DNA fusion molecules of the present invention comprise a first and a second isolated DNA molecule, each isolated DNA molecule encoding either an inventive MTB antigen or a known MTB antigen.
A DNA, or mRNA derived from the DNA sequence by translation using known methods and enzymes, sequence encoding a fusion protein of the present invention is constructed using known recombinant DNA techniques to assemble separate DNA sequences encoding the first and second polypeptides into an appropriate expression vector, as described in detail below. The 3' end of a DNA sequence encoding the first polypeptide is ligated, with or without a peptide linker, to the 5' end of a DNA sequence encoding the second polypeptide so that the reading frames of the sequences are in phase to permit mRNA translation of the two DNA sequences into a single fusion protein that retains the biological activity of both the first and the second polypeptides.
A peptide linker sequence can be employed to separate the first and the second polypeptides by a distance sufficient to ensure that each polypeptide folds into its secondary and tertiary structures. Such a peptide linker sequence is incorporated into the fusion protein using standard techniques well known in the art. Suitable peptide linker sequences can be chosen based on the following factors: (1) their ability to adopt a flexible extended conformation; (2) their inability to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides; and (3) the lack of hydrophobic or charged residues that might react with the polypeptide functional epitopes. Preferred peptide linker sequences contain Gly, Asn and Ser residues. Other near neutral amino acids, such as Thr and Ala can also be used in the linker sequence. Amino acid sequences which can be usefully employed as linkers include those disclosed in Maratea et al, Gene 40:39-46, 1985; Murphy et al, Proc. Natl. Acad. Sci. USA 83 :8258-8262, 1986; U.S. Pat. No.
4,935,233 and U.S. Pat. No. 4,751, 180. The linker sequence can be from 1 to about 50 amino acids in length. Peptide sequences are not required when the first and second
polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.
The ligated DNA sequences are operably linked to suitable transcriptional or translational regulatory elements. The regulatory elements responsible for expression of DNA are located only 5' to the DNA sequence encoding the first polypeptides. Similarly, stop codons require to end translation and transcription termination signals are only present 3' to the DNA sequence encoding the second polypeptide.
Efficacy of a vaccine including the isolated sequences of the present invention can be determined based on the ability of the antigen to provide at least about a 50% (e.g., about a 60%, about a 70%, about a 80%, about a 90%, or about a 100%) reduction in bacterial numbers and/or at least about a 40% (e.g., about a 50%, about a 60%, about a 70%, about a 80%, about a 90%, or about a 100%) decrease in mortality following experimental infection in a challenge experiment. Suitable experimental animals include but are not limited to mice, guinea pigs, rabbits and primates.
The compositions of the present invention are preferably formulated as either pharmaceutical compositions or as vaccines for in the induction of therapeutic or preventive immunity against drug-resistant TB in a patient. A patient can be afflicted with a disease, or can be free of detectable disease and/or infection. In other words, protective immunity can be induced to prevent, reduce the severity of, or treat drug-resistant TB.
In one embodiment, pharmaceutical compositions of the present invention comprise one or more of the above polypeptides, either present as a mixture or in the form of a fusion protein, and a physiologically acceptable carrier. Similarly, vaccines comprise one or more the above polypeptides and a non-specific immune response enhancer, such as an adjuvant or a liposome (into which the polypeptide is incorporated).
In another embodiment, a pharmaceutical composition and/or vaccine of the present invention can contain one or more of the DNA molecules of the present invention, either present as a mixture or in the form of a DNA fusion molecule, each DNA molecule encoding a polypeptide as described above, such that the polypeptide is generated in situ. In such vaccines, the DNA can be present within any of a variety of delivery systems known to those of ordinary skill in the art, including nucleic acid
expression systems, bacterial and viral expression systems. Appropriate nucleic acid expression systems contain the necessary DNA sequences for expression in the patient (such as a suitable promoter and terminating signal). Bacterial delivery systems involve the administration of a bacterium (such as Bacillus-Calmette- Guerrin) that expresses an immunogenic portion of the polypeptide on its cell surface. In a preferred embodiment, the DNA can be introduced using a viral expression system (e.g., vaccinia or other pox virus, retrovirus, or adenovirus), which can involve the use of a non-pathogenic (defective), replication competent virus. Techniques for incorporating DNA into such expression systems are well known to those of ordinary skill in the art. The DNA can also be "naked," as described, for example, in Ulmer et al, Science 259: 1745-1749, 1993 and reviewed by Cohen, Science 259: 1691-1692, 1993. The uptake of naked DNA can be increased by coating the DNA onto biodegradable beads, which are efficiently transported into the cells.
The antigenic MTB molecules of the present invention can be administered with or without a carrier. The terms "pharmaceutically acceptable carrier" or a "carrier" refer to any generally acceptable excipient or drug delivery composition that is relatively inert and non-toxic. Exemplary carriers include sterile water, salt solutions (such as Ringer's solution), alcohols, gelatin, talc, viscous paraffin, fatty acid esters, hydroxymethylcellulose, polyvinyl pyrolidone, calcium carbonate, carbohydrates (such as lactose, sucrose, dextrose, mannose, albumin, starch, cellulose, silica gel, polyethylene glycol (PEG), dried skim milk, rice flour, magnesium stearate, and the like. Suitable formulations and additional carriers are described in Remington's Pharmaceutical Sciences, (17th Ed., Mack Pub. Co., Easton, Pa.). Such preparations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, preservatives and/or aromatic substances and the like which do not deleteriously react with the active compounds. Typical preservatives can include, potassium sorbate, sodium metabisulfite, methyl paraben, propyl paraben, thimerosal, etc. The compositions can also be combined where desired with other active substances, e.g., enzyme inhibitors, to reduce metabolic degradation. A carrier (e.g., a pharmaceutically acceptable carrier) is preferred, but not necessary to administer the compound.
The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The method of administration
can dictate how the composition will be formulated. For example, the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc.
The antigenic MTB molecules used in the invention can be administered intravenously, parenterally, intramuscular, subcutaneously, orally, nasally, topically, by inhalation, by implant, by injection, or by suppository. The composition can be administered in a single dose or in more than one dose over a period of time to confer the desired effect.
The actual effective amounts of compound or drug can vary according to the specific composition being utilized, the mode of administration and the age, weight and condition of the patient. For example, as used herein, an effective amount of the drug is an amount which reduces the number of bacteria. Dosages for a particular individual patient can be determined by one of ordinary skill in the art using conventional considerations, (e.g. by means of an appropriate, conventional pharmacological protocol).
For enteral or mucosal application (including via oral and nasal mucosa), particularly suitable are tablets, liquids, drops, suppositories or capsules. A syrup, elixir or the like can be used wherein a sweetened vehicle is employed.
Liposomes, microspheres, and microcapsules are available and can be used.
Pulmonary administration to stimulate immune responses to drug- resistant MTB can be accomplished, for example, using any of various delivery devices known in the art such as an inhaler. See. e.g., S. P. Newman (1984) in Aerosols and the Lung, Clarke and Davis (eds.), Butterworths, London, England, pp. 197-224; PCT Publication No. WO 92/16192; PCT Publication No. WO 91/08760.
For parenteral application, particularly suitable are injectable, sterile solutions, preferably oily or aqueous solutions, as well as suspensions, emulsions, or implants, including suppositories. In particular, carriers for parenteral administration include aqueous solutions of dextrose, saline, pure water, ethanol, glycerol, propylene glycol, peanut oil, sesame oil, polyoxyethylene-polyoxypropylene block polymers, and the like. Ampules are convenient unit dosages.
Biodegradable microspheres (e.g., polylactic galactide) can also be employed as carriers for the pharmaceutical compositions of this invention. Suitable
biodegradable microspheres are disclosed, for example, in U.S. Pat. Nos. 4,897,268 and 5,075, 109.
Any of a variety of adjuvants can be employed in the vaccines of this invention to enhance the immune response to drug resistant antigens. Most adjuvants contain a substance designed to protect the antigen from rapid catabolism, such as aluminum hydroxide or mineral oil, and a nonspecific stimulator of immune responses, such as lipid A, Bortadella pertussis or MTB. Suitable adjuvants are commercially available and include, for example, Freund's Incomplete Adjuvant and Freund's Complete Adjuvant (Difco Laboratories) and Merck Adjuvant 65 (Merck and Company, Inc., Rahway, N.J.). Other suitable adjuvants include alum, biodegradable microspheres, monophosphoryl lipid A and quil A.
In one embodiment, it is preferred that the adjuvant induces an immune response comprising Thl aspects. Suitable adjuvant systems include, for example, a combination of monophosphoryl lipid A, preferably 3-de-O-acylated monophosphoryl lipid A (3D-MLP) together with an aluminum salt. An enhanced system involves the combination of a monophosphoryl lipid A and a saponin derivative, particularly the combination of 3D-MLP and the saponin QS21 as disclosed in WO 94/00153, or a less reactogenic composition where the QS21 is quenched with cholesterol as disclosed in WO 96/33739. Previous experiments have demonstrated a clear synergistic effect of combinations of 3D-MLP and QS21 in the induction of both humoral and Thl type cellular immune responses. A particularly potent adjuvant formation involving QS21, 3D-MLP and tocopherol in an oil-in- water emulsion is described in WO 95/17210 and is a preferred formulation.
The administration of the antigenic MTB polypeptide molecules of the present invention and other compounds can occur simultaneously or sequentially in time. A DNA vaccine and/or pharmaceutical composition as described above can be administered simultaneously with or sequentially to an additional polypeptide of the present invention, a known MTB antigen, an immune enhancer, or other compound known in the art that would be administered with such a vaccine. The compound can be administered before, after or at the same time as the antigenic MTB molecules. Thus, the term "co-administration" is used herein to mean that the antigenic MTB molecules and the additional compound (e.g., immune stimulating compound) will be administered at times to achieve a specific MTB immune response to drug resistance antigens, as described herein. The methods of the present invention are not limited to
the sequence in which the compounds are administered, so long as the compound is administered close enough in time to produce the desired effect.
Routes and frequency of administration of the inventive pharmaceutical compositions and vaccines, as well as dosage, may or may not vary from individual to individual and might parallel those currently being used in immunization using the Bacille Calmette-Guerin (BCG) vaccine. In general, the pharmaceutical compositions and vaccines can be administered by injection (e.g., intracutaneous, intramuscular, intravenous or subcutaneous), intranasally (e.g., by aspiration), intralung, or perhaps even orally. Alternate protocols can be appropriate for individual patients. A suitable dose is an amount of polypeptide or DNA that, when administered as described above, is capable of raising an immune response in an immunized patient sufficient to protect the patient from MTB infection for at least 1 -2 years. In general, the amount of polypeptide present in a dose (or produced in situ by the DNA in a dose) ranges from about 1 pg to about 100 mg per kg of host, typically from about 10 pg to about 1 mg, and preferably from about 100 pg to about 1 μg.
Suitable dose sizes will vary with the size of the patient, but will typically range from about 0.1 mL to about 5 mL.
EXPERIMENTAL EXAMPLES
The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
Example 1 : Using adaptive cellular immune function to diagnose drug resistance in active TB and latent Mycobacterium tuberculosis infection
Drug resistance in MTB is primarily due to point mutations in genes encoding mycobacterial enzymes (Blanchard et al, 1996, Annu Rev Biochem 65:215- 39). For example, resistance to rifampicin, a key first-line anti-tubercular drug, results most commonly from a single nucleotide polymorphism (SNP) in rpoB. While the adaptive immune system is unlikely to specifically detect a mutant protein resulting from a SNP in rpoB, rpoB is an essential gene in MTB and mutated forms of RNA polymerase B plausibly are associated with changes in transcription that result in differential expression of proteins in the organism.
In vitro proteomics experiments were performed to determine if rifampicin resistant mutant progeny strains of drug-susceptible MTB expressed different proteins. In terms of creating a diagnostic assay specifically using memory immune responses to identify patients with rifampicin resistant MTB, experiments were focused on identifying proteins that were detected in the mutant drug resistant isolates but not in the wild-type drug-susceptible parent isolates or were found at higher levels in the resistant isolates.
The experiments disclosed herein were conducted to investigate whether the adaptive immune system can detect specific changes in the proteome of MTB that occur with the emergence of drug resistance. Without wishing to be bound by any particular theory, it is believed that immunologic assays can be used to identify drug resistance in MTB infection. This approach would be particularly useful when specimens containing the pathogen are difficult to be obtained (e.g., sputum scarce TB disease) or cannot be obtained (e.g., in latent MTB infection). Identification of drug-resistant strains of MTB facilitates more effective treatment regimens, which can improve both patient outcome and public health by minimizing the transmission of drug-resistant strains (Brown et al, 2006, J Microbiol Methods 65(2):294-300).
The results presented herein demonstrate that proteomic changes result from development of drug resistance in MTB, and prediction of antigenicity using bioinformatic approaches indicate that these proteins are likely recognized by the human adaptive immune system.
Without wishing to be bound by any particular theory, it is believed that the proof-of-concept results presented herein regarding of whether candidate antigens are differentially-recognized by the adaptive immune system supports the use of the diagnostic approach of the present invention to evaluate other infectious disease scenario including but not limited to patients with HIV, as well as in children and the
elderly. Strategies can also be investigated that facilitate triage of culture among patients with newly diagnosed active TB. It is believed that this line of investigation has the potential to increase the accurate identification of patients with drug resistant latent TB and therefore combat the ongoing epidemic of MDR-TB.
Example 2: Upregulation of the phthiocerol dimycocerosate biosynthetic pathway by rifampicin-resistant rpqg-mutant Mycobacterium tuberculosis
MDR-TB has emerged as a major threat to TB control. Phylogenetically related rifampicin-resistant actinomycetes with mutations mapping to clinically dominant MTB mutations in the rpoB gene show upregulation of gene networks encoding secondary metabolites. Experiments were conducted to compare the expressed proteomes and metabolomes of two fully drug-susceptible clinical strains of MTB (wild type) to that of their respective rifampicin-resistant, rpoB- mutant progeny strains with confirmed rifampicin monoresistance following antitubercular therapy. Each of these strains was also used to infect IFN-γ- and lipopolysaccharide-activated murine J774A.1 macrophages to analyze transcriptional responses in a physiologically-relevant model. Both rpoB mutants showed significant upregulation of the polyketide synthase gene cluster ppsA-E and drrA, which constitute an operon encoding multifunctional enzymes involved in the biosynthesis of phthiocerol dimycocerosate and other lipids in MTB but also of various secondary metabolites in related organisms, including antibiotics such as erythromycin and rifamycins. ppsA (Rv2931), ppsB (Rv2932) and ppsC (Rv2933) were also found to be upregulated greater than 10-fold in the Beijing rpoB mutant strain relative to its wild- type parent strain during infection of activated murine macrophages. In addition, metabolomics identified precursors of phthiocerol dimycocerosate, but not the intact molecule itself, in greater abundance in both rpoB mutant isolates. These data suggest that rpoB mutation in MTB triggers compensatory transcriptional changes in genes, such as secondary metabolism genes, analogous to those observed in related
Actinobacteria. These findings assist in developing novel methods to diagnose and treat drug resistant MTB infections.
The materials and methods employed in these experiments are now described.
Materials and Methods
Mtb strains
All MTB strains were obtained from patients being treated for pulmonary TB. Isolates were sent to National Jewish Hospital, Denver, CO, for confirmation of drug susceptibility data that was initially obtained by the clinical labs where the patients were being treated. An MTB strain susceptible to all drugs tested (rifampicin, isoniazid, pyrazinamide, and ethambutol) was obtained from a patient living in Costa Rica prior to initiating antitubercular therapy. Another isolate was later obtained from the same patient after several weeks on treatment and was confirmed to be resistant to rifampicin by the Agar proportion test (MIC > 1 mg/L) but susceptible to the other 3 first line agents. These isolates were a parent-mutant pair by
spoligotyping and insertion sequence (IS)61 10 restriction fragment length
polymorphism (RFLP) pattern. Spoligotyping analysis determined these isolates belong to the Beijing family. Analysis of genomic DNA from these strains revealed an H445D mutation in the rpoB gene of the rifampicin-resistant isolate. Both isolates also had an A463G mutation in katG but were both confirmed susceptible to isoniazid (MIC < 0.2 mg/L) and these mutations were considered clinically silent (Haas et al, 1997, Antimicrob Agents Chemother 41 : 1601-3; Rouse et al, 1995, Antimicrob Agents Chemother 39:2472-7). Similarly, an Mtb strain susceptible to all drugs tested (rifampicin, isoniazid, pyrazinamide, and ethambutol) was obtained from a patient in San Francisco prior to initiating standard- first line anti-tubercular therapy. After several weeks on therapy, another isolate was obtained from the same patient and was confirmed to be resistant to rifampicin by Agar proportion test but susceptible to the other 3 first-line agents. These isolates were also confirmed as paired by
spoligotyping and (IS)6110 RFLP, and were determined to belong to the Haarlem family. Analysis of genomic DNA from these two Haarlem isolates revealed that the rifampicin resistant isolate had an S450L mutation in the rpoB gene. Both isolates also had a mutation at position 103 of the rpoB gene, and the wild-type strain had an additional mutation at position 108 of oryR. The rpoB mutations present in the resistant isolates are two of the most common rifampicin-resistance mutations encountered clinically in adults with TB (Telenti et al, 1993, Lancet 341 :647-50).
For laboratory-based rpoB mutant generation used in confirmatory experiments, an exponentially-growing culture of Johns Hopkins University wild-type
lab reference strain MTB CDC1551 (Ahmad et al, 2009, J Infect Dis 200: 1136-43) was inoculated onto 7H10 agar containing 1 μg/ml of rifampicin and incubated at 37°C for 21 days. Individual colonies were inoculated separately in Middlebrook 7H9 broth containing ^g/ml of rifampicin and grown at 37°C to OD600 ~1.0. Genomic DNA was purified from each culture, and the rpoB gene was amplified using primers 5 ' -AATATCTGGTCCGCTTGCAC-3 ' (SEQ ID NO: 99) and 5'- ACACGATCTCGTCGCTAACC-3 ' (SEQ ID NO: 100), and sequenced. Based on the sequencing results, a mutant containing a substitution of G for C at position 135 lbp in the rpoB gene (yielding the RpoB S450L mutation) was selected for further study (Table 1).
Culture conditions
For proteomics studies, a glycerol stock of each strain was plated in Middlebrook 7H11 (Difco), supplemented with Oleic Acid Albumin Dextrose
(OADC). After incubation for 2 weeks at 37°C, colonies were inoculated in 100ml of Middlebrook 7H9 (Difco) supplemented with OADC and 0.05% Tween. The mycobacteria were further cultured at 37°C in agitation for two weeks, and then were washed twice with sterile PBS (Invitrogen) and inoculated in 1L of GAS media (Glycerol, Alanine, Salts) (Takayama et al, 1972, Antimicrob Agents Chemother 2:29-35), a traditional Mycobacterium spp. medium used to process cells and spent filtrate for downstream proteomics applications (Barnes et al, 1989, J Immunol 143:2656-62), (Mehaffy et al, 2010, Proteomics 10: 1966-84), (Sartain et al, 2006, Mol Cell Proteomics 5:2102-13). Cultures were then incubated at 37°C in agitation for 4 weeks. All cultures were prepared in triplicate for proteomics analyses. For metabolomics studies, a glycerol stock of each strain was plated in Middlebrook 7H1 1 (Difco), supplemented with OADC. Cultures were incubated at 37°C for 4 weeks. Five replicates per strain were prepared for metabolomics studies. Culture filtrate proteins (CFP)
Proteomics data were obtained within specific cellular fractions, consisting of culture filtrate (CFP), membrane-associated (MEM), cell wall (CW), and cytoplasm (CYT) proteins. CFP was purified as described elsewhere (Mehaffy et al, 2010, Proteomics 10: 1966-84). Briefly, each culture was filtered using a 0.2um zap-cap filter, Whatman (GE Healthcare, Piscataway, NJ). Secreted proteins were recovered from the culture filtrate as follows: 1 L culture filtrates were concentrated to approximately 25 ml of volume using a 10 KDa MWCO membrane (Millipore). Then, the filtrate was further concentrated to approximately 300 μΐ using an Amicon Ultracell-15 with a 10 KDa MWCO by centrifugation at 3000 rpm at 4°C. Purified proteins were subjected to buffer exchange using 15 ml of 10 mM ammonium bicarbonate three times in the same filter unit. Protein quantification was performed by the BCA assay (Pierce).
Subcellular fractions
Cells were pelleted by centrifugation at 3000 rpm and washed twice with 10 ml of sterile PBS (Invitrogen). Harvested cells were inactivated with 2.4 Mrad of cesium γ-irradiation for 24 hr and death was confirmed by Alamar Blue assay (Invitrogen). Cells were resuspended in 10 ml of breaking buffer (ImM EDTA-PBS supplemented with one tablet of protease inhibitor (Roche Diagnostics) per 50ml of buffer, 60μ1 of DNAse (lmg/ml) and 60μ1 of R Ase (lmg/ml)) and broken by sonication on 50% duty cycle (12 times, 60sec with intervals of 90 sec on ice). After sonication, breaking buffer was added to a final volume of 40 ml and unbroken cells were removed by centrifugation at 3000 rpm for 5 min, 4°C. Supernatant was further centrifuged for one hour at 27,000 x g 4°C to separate the cell wall pellet from cytosol and membrane fractions (supernatant). The cell wall pellet was resuspended in 10 mM ammonium bicarbonate and stored at -80°C. Finally, membrane proteins were harvested by ultracentrifugation at 100,000 x g for 8 hours (2x 4 h). The cytosol fraction (supernatant) was concentrated by centrifugation using Amicon Ultra- 15 centrifugal filter units with a 10 KDa MWCO. Buffer exchange using 15 ml of 10 mM ammonium bicarbonate was performed three times using the same filter unit.
Membrane fraction was resuspended in 10 mM ammonium bicarbonate and stored at - 20° C. All subcellular fractions were quantified using the BCA assay (Pierce).
In-solution protein digestion
Fifty micrograms of CFP, MEM, and CYT fractions were precipitated with acetone following standard protocols. Protein pellets were resuspended in 15 μΐ of 8 M urea followed by addition of 20 μΐ of 0.2% ProteaseMAX Surfactant
(Promega) in 50 mM ammonium bicarbonate. After vortexing for 5 min, 58.5μ1 of 50 mM ammonium bicarbonate were added to each sample. Proteins were reduced after incubation at 50° C for 20 min with 5 mM DTT. Alkylation was performed with 15 mM iodoacetamide followed by incubation at RT for 15 min in the dark. Samples were digested for 3 hr at 37°C with Ι μΐ of 1% ProteaseMAX™Surfactant (Promega) in 50 mM ammonium bicarbonate and 1.8 μg of trypsin. Reactions were stopped with 0.5% trifloroacetic acid (TFA). All samples were desalted with Pierce PepClean C18 spin columns per manufacture's protocol and eluted with 70% ACN, 0.1% formic acid (FA). Samples were dried in a speedvac and resupended in 5% ACN, 0.1% FA prior to mass spectrometry analysis. Biological replicates within each cellular fraction were randomized and injected in triplicate. Mass spectrometry analysis was performed at the Proteomics and Metabolomics Facility, Colorado State University, CO. CW proteins were subjected to a delipidation protocol before digestion as follows: 10 μg of lysosyme was added to 1 mg of CWP and incubated for 30 min at 37°C. Samples were dried in a speedvac and resuspended in 7 ml of chloroform: methanol (2: 1 v/v) followed by incubation at room temperature for 1 hr and centrifugation at 3000 rpm for 30 min at 4°C. Pelleted proteins were dried and resuspended in 7 ml of chloroform:methanol:water (10: 10:3) followed by incubation in agitation at room temperature for 1 hr and centrifugation at 3000 rpm for 2 h at 4° C. Finally, pelleted proteins were precipitated with 2 ml of cold acetone and incubated overnight at -20°C. After centrifugation at 13000 rpm for 30 min, the protein pellet was resuspended in 10 mM ammonium bicarbonate and quantification was performed using the BCA assay (Pierce). Fifty μg of sample were subjected to trypsin digestion, as described elsewhere herein.
Liquid chromatography/tandem mass spectrometry (LC/MS/MS) for proteomics studies
All samples were randomized and analyzed in triplicate by liquid chromatography coupled with tandem mass spectrometry. Briefly, peptides were purified and concentrated using an on-line enrichment column (Agilent Zorbax CI 8, 5μιη, 5 x 0.3 mm). Subsequent chromatographic separation was performed on a
reverse phase nanospray column (Agilent 1 100 nanoHPLC, Zorbax CI 8, 5 μιη, 75 μιη ID x 150 mm column) using a 60 minute linear gradient from 25%-55% buffer B (90% ACN, 0.1% formic acid) at a flow rate of 300 nanoliters/min. Peptides are eluted directly into the mass spectrometer (Thermo Scientific Linear Trap Quadrupole (LTQ) linear ion trap) and spectra are collected over a m/z range of 200-2000 Da using a dynamic exclusion limit of 2 MS/MS spectra of a given peptide mass for 30 s (exclusion duration of 90 s). Compound lists of the resulting spectra were generated using Bioworks 3.2 software (Thermo Scientific) with an intensity threshold of 5,000 and 1 scan/group. Spectra were subjected to interrogation against the MTB genome (including reverse strand) (Genbank accession #AL123456, R9, 7,982 entries) using SORCERER (Sage-N Research, version 2.0) and SEQUEST (Thermo Fisher Scientific, Release 27, rev 12). All searches were performed assuming trypsin digestion, 4 missed cleavages, fragment ion mass tolerance of 1.00 Da, and a parent ion tolerance of 1.5 Da. Carbamidomethyl (C) and Oxidation (M) were specified as variable modifications. Analyses (per subcellular fraction) were compiled in Scaffold (version 3.00.04, Proteome Software Inc, Portland, OR) in order to validate MS/MS based peptide and protein identification. Search results for triplicate injections of each biological replicate were summed together upon compilation within the Scaffold software. In addition, the X! Tandem database search algorithm (version
2007.01.01.2, The Global Proteome Machine, www.thegpm.org) was used to verify and complement the peptide identifications from Sequest. Peptide identifications were filtered by database search engine thresholds, such that Sequest identifications required deltaCn scores greater than 0.10 and XCorr scores greater than 1.0, 2.0, 3.0 and 3.0 for singly, doubly, triply, and quadruply charged peptides, respectively. X! Tandem identifications required -Log(Expect Scores) scores greater than 2.0. Protein identifications were accepted if they could be established at greater than 99.0% probability (Protein Prophet algorithm) and contained at least 1 unique peptide (Keller et al, 2002, Anal Chem 74:5383-92). False discovery rates (FDR) were calculated automatically by Scaffold (version 3.0) using the decoy database and reverse hits and the empirical method previously reported by Kail et al (Kail et al, 2008, J Proteome Res 7:29-34). Analysis of each dataset using these parameters resulted in a false discovery rate (FDR) of 0.2% at the protein level and less than 5.3% at the peptide level. After statistical analysis, differential proteins that were identified by only one unique peptide were subjected to manual spectral validation using the following
criteria: (1) minimum of 80% coverage of theoretical y or b ions (at least 5 in consecutive order), (2) absence of prominent unassigned peaks greater than 10% of the maximum intensity, and (3) indicative residue-specific fragmentation, such as intense ions proximal (N-terminal) to proline and immediately distal (C-terminal) to aspartate and glutamate. Data, exported as Mascot generic files and containing all MS/MS spectra, are available on the Proteomics IDEntifications database for review (Vizcaino et al, 2010, Nucleic Acids Res 38:D736-42).
Proteomic data analysis
Each subcellular fraction dataset was subjected to spectral count analysis using Scaffold (version 3.00.04, Proteome Software Inc, Portland, OR). Technical replicates for each biological replicate were summed within the Scaffold software and each subcellular fraction data set was analyzed independently. Prior to all analyses of differential protein detection, spectral counts were normalized against the total signal (per biological replicate) as described previously (Carvalho et al,
2008, Genet Mol Res 7:342-56). Using spectral counts, differential protein detection was assessed in multiple ways. First, after normalization, data was log transformed and a linear model analysis of variance (ANOVA) comparing spectral counts for each protein within subcellular fractions for each isogenic pair was applied to identify proteins that were differentially abundant between susceptible and resistant isolates (p-value <0.05). Comparison of spectral counts was performed using DanteR (version 1.0.1.1. Pacific Northwest National Laboratory, http://omics.pnl.gov). Reproducibility of biological replicates was assessed by visual interpretation of each dataset using box plots and 3D scatter plots generated on DanteR. In addition, to ascertain global differences in protein detection between r o5-mutant and wild-type isolates, the mean spectral counts in the cell-associated fractions (CW, MEM, CYT) were added to produce a summary spectral count for each protein. CFP was not included in the summary spectral count given our interest in measuring differences in overall protein abundance and not secretion. This summary cell-associated spectral count was then used to calculate the fold change in detection for each protein by dividing the mean spectral count in an rpoB mutant by the mean spectral count in the paired wild-type parent isolate. The summary cell-associated spectral counts were also used to calculate the spectral index (Spl), which is a robust statistical measure of differential protein abundance useful in shotgun proteomics experiments (Fu et al, 2008, J
Proteome Res 7:845-54). The Spl, which ranges from -1 to +1, was then used to rank- order the proteins by degree of increased detection in mutants. Spl values of or near 0 indicate that the relative peptide abundance is approximately the same in the rifampicin-resistant and rifampicin susceptible cultures, whereas positive or negative values indicate enrichment in the rifampicin-resistant or rifampicin-susceptible cultures, respectively (Fu et al, 2008, J Proteome Res 7:845-54). With this ranking, Gene Set Enrichment Analysis (GSEA) at the functional class level was then applied to identify significantly upregulated gene sets in the resistant strains (Subramanian et al, 2005, Proc Natl Acad Sci USA 102: 15545-50). Because rpoB mutation appears to significantly upregulate genes specifically involved in biosynthesis of natural product/secondary metabolites in other organisms (Carata et al, 2009, Microb Cell Fact 8: 18; Hosaka et al, 2009, Nat Biotechnol 27:462-4; Hu et al, 2002, J Bacteriol 184:3984-91; Inaoka et al., 2004, J Biol Chem 279:3885-92), an automated approach was also used to search the Mtb genome for gene clusters potentially associated with natural product biosynthesis (NP. searcher, http://dna.sherman.lsi.umich.edu/) (Li et al, 2009, BMC Bioinformatics 10: 185) and compared the expression of these gene clusters by mutants and wild-type MTB using GSEA.
Macrophage studies
The murine macrophage J774A.1 cell line was cultured in Roswell
Park Memorial Institute (RPMI) media supplemented with 0.2 mM L-glutamine (Invitrogen) and 10% heat- inactivated fetal bovine serum (FBS) (Sigma) in a humidified 37°C, 5% CO2 incubator. After growth to a confluent monolayer, the cells were harvested using a sterile rubber scraper and a single cell suspension was prepared and cultured in a 75 cm2 cell culture flask (Costar). A total of 103 cells were activated by addition of 50 ng/ml IFN-γ (Roche) overnight and 200 ng/ml lipopolysaccharide (LPS) (from Escherichia coli 026:B6, <5% protein (Lowry), Sigma) for 3 hours prior to infection. After removal of the media, the cells were incubated for 3 hours with either wild-type MTB or the rpoB mutant at a multiplicity of infection (MOI) of 1 : 1. The macrophages were then treated with 200 ng/ml streptomycin and washed three times with RPMI and cultured in media as described elsewhere herein. For bacterial enumeration for comparison of growth rates of mutant and WT-isolates, the cells were lysed with Triton X-100 at predetermined time points
and the lysate was serially diluted and plated on 7H10 agar and incubated at 37°C for 28 days, as previously described (Thayil et al., 201 1, PLoS One 6:e28076). For mycobacterial gene expression studies, intracellular bacteria were recovered at 72 hr after infection by centrifugation at 3200 rpm for 5 min, and the bacterial pellet was resuspended in Trizol reagent (Invitrogen).
Mtb gene expression studies
Macrophage and mycobacterial membranes were disrupted using 0.1 mm zirconia/silica beads in a bead beater, and RNA was recovered by centrifugation, chloroform extraction, and isopropyl alcohol precipitation, as previously described (Karakousis et al, 2008, J Antimicrob Chemother 61 :323-31; Karakousis et al, 2004, J Exp Med 200:647-57). Prior to reverse transcription, control and mutant RNA (10 ng) were treated with RNase-free DNase (Invitrogen) and subjected to 36 cycles of PCR to ensure that all DNA had been removed, as assessed by ethidium bromide- stained agarose gel analysis. Fluorescently-labeled cDNA was generated using gene- specific primers (Table 2) and Superscript III (Invitrogen), as previously described (Thayil et al, 201 1, PLoS One 6:e28076). cDNA corresponding to each transcript was subjected to 40 cycles of PCR for quantification using the primers listed in Table 3 and an iCycler 5.0 (Bio-RAD). The cycle threshold value (CT) obtained for each gene of interest (GOI) was normalized with that of sigA, a housekeeping gene (HKG) with constant expression under different experimental conditions (Manganelli et al, 1999, Mol Microbiol 31 :715-24), in order to obtain the normalized CT (nCT = (GOI CT) - (HKG CT)). The change in normalized CT (AnCT) for each gene was calculated using the following formula: (AnCT = C(nCT) - S(nCT)), where C represents the wild-type (control) strain and S represents the rpoB mutant strain. Fold regulation of individual genes was calculated using the following formula: 2-AnCT. The data are representative of three biological replicates, and the experiments were repeated twice.
Gene name Primer name Primer sequence SEQ ID
ppsA dl93 TCCGGATCTGTACCGAAATC 107
dl94 ATTCGCCTAAGTCGTCGTTG 108 ppsB dl77 GACTACCCGCAGGTGACAGT 109
dl78 GTGGAGATGATTCCGATGGT 110 ppsC dl79 CCTCGACCTGAATCTCAAGC 111
dl80 ATCTTGCCGGTGTGTTTACC 112
Rv0799c dl71 GACATCGAACTCGACGACAA 113
dl72 CGGTGGAAAAGTCAAGCACT 114
Rv0496 T- v0496-F AGAGGACCCTAACGGCAAAT 115
RT-Rv0496-R TTTCCACCGCTTCTATCGAC 116 sigA sigA-F CTACGCTACGTGGTGGATTC 117
sigA-R GGTGATGTCCATCTCTTTGG 118
Extraction of MTB metabolites
Mycobacteria were scraped at 4 weeks of culture and transferred to a glass tube. 10 ml of chloroform was added to each sample and then incubated at room temperature in agitation for 4 hours. Bacteria were pelleted at 3000 rpm for 30 min at 4°C and the supernatant corresponding to the chloroform fraction was dried in a nitrogen bath and stored at -20°C. Pelleted bacteria were dried under nitrogen and then resuspended in 15 ml of methanol. Samples were incubated at 37°C overnight in agitation and then centrifuged at 3000 rpm for one hour at 4°C. Supernatant corresponding to the methanol fraction was dried under nitrogen and then stored at - 20°C. Prior to mass spectrometry analysis, chloroform and methanol fractions were resuspended in 1 ml of the corresponding solvent. LC/MS for metabolomics
Methanol fractions: One μΐ, of the sample was injected into a Waters Acquity UPLC system equipped with a Waters Acquity UPLC T3 column (1.8 μΜ, 1.0 x 100 mm). Separation was achieved using a gradient from solvent A (95% water, 5% methanol, 0.1% FA) to solvent B (95% methanol, 5% water, 0.1% FA) as follows: 100% A held for 1 min; 100% B in 16 min; 100% B held for 3 min; 100% A in 0.1 min; re-equilibrate for 5.9 min (total run time of 26 min/sample).
Chloroform fractions: One μΐ, of the sample was injected on a Waters Acquity Ultra Performance Liquid Chromatography (UPLC) system equipped with a Waters Acquity UPLC C8 column (1.8 μΜ, 1.0 x 100 mm). Separation was achieved using a gradient from solvent A (89% water, 5% ACN, 5% isopropanol, 1% 500 mM
ammonium acetate) to solvent B (49.5% ACN, 49.5% isopropanol, 1% 500 mM ammonium formate) as follows: 100% A held for 0.1 min; 40% B in 0.9 min; 100% B in 10 min; 100% B held for 3 min; 100% A in 0.1 min; re-equilibrate for 5.9 minutes (total run time of 20 min/sample). MS/MS spectra of precursor ions 797.7 and 823.2 were collected using a Waters UPLC coupled to a Waters Xevo G2 Q-TOF MS. The LC conditions were the same as listed above, and the MS/MS collision energy was ramped from 15-30 volts to induce fragmentation.
For both fractions, flow rate was maintained at 140 μΙ7ηιίη for the duration of the run, the column was held at 50° C, and samples were held at 5° C. Column eluate was infused into a Waters Q-Tof Micro MS fitted with an electrospray source. Data was collected in positive ion mode, scanning from 50-1200 (methanol fraction) or 50-1800 (Chloroform fraction) at a rate of 0.9 seconds per scan with 0.1 second interscan delay. Calibration was performed prior to sample analysis via infusion of sodium formate solution, with mass accuracy within 5 ppm. During analysis, the capillary voltage was held at 2200V, the source temp at 130°C, the desolvation temperature at 300°C, the desolvation gas flow rate of 400 L/hr N2(g), and the quadrupole was held at collision energy of 7 volts. MS/MS spectra of precursor ions 797.7 and 823.2 were collected using a Waters UPLC coupled to a Waters Xevo G2 Q-TOF MS. The LC conditions were the same as listed elsewhere herein, and the MS/MS collision energy was ramped from 15-30 volts to induce fragmentation.
Metabolomics data analysis
Raw data files were converted to .cdf format, and feature detection and alignment was performed using XCMS in the program R. Raw peak areas were normalized to total ion signal in R, and the normalized dataset was subjected to PCA in R using the pcaMethods package. Consistent with our focus on gene upregulation as a compensatory response to rpoB mutation, statistical analysis to determine peaks/features that were significantly more abundant in resistant strains was performed in DanteR as described for the proteomics section. Differential peaks
(ANOVA p value <0.05) were grouped by retention time and then manually validated using MassLynx (Waters Corporation). Peaks with the same retention time and peak shape were considered to belong to the same compound. Retention time and the inferred molecular weight of each differential peak were used to interrogate public
databases including METLI (http://metlin.scripps.edu) (Smith et al, 2005, Ther Drug Monit 27:747-51), KEGG (http://www.genome.jp/kegg/), Lipid Maps
(http://www.lipidmaps.org), and MassBank (http://www.massbanks.jp) (Herrera et al., 2003, Int J Antimicrob Agents 21 :403-8). Given the proteomics and metabolomics results, a PDIM standard was subjected to tandem mass spectrometry analysis to gain insight into the structure of the m/z 797.74 ion.
Thin Layer Chromatography
200ug of lipid fractions were analyzed by Thin Layer Chromatography along with PDIM standard (10ug) using 98:2 petroleum ethenethyl acetate (v/v) three times. Lipids were visualized with CuS04 charring.
The results of the experiments are now described. Proteomic analysis of rpqg-mutant strains of MTB
To compare the proteomes of Beijing and Haarlem strains oi rpoB- mutant, rifampicin resistant MTB to those of their wild-type progenitor isolates, proteins from four cellular fractions were extracted from late-log phase broth cultures. By separating the sample into less complex parts, such as subcellular fractions, protein identification using shotgun proteomic analysis is greatly increased (Dreger, 2003, Mass Spectrom Rev 22:27-56; Huber, et al, 2003, Circ Res 92:962-8). In addition, because of the insoluble nature of cell wall proteins, this fraction is subjected to additional preparation prior to mass spectrometry analysis to increase solubility and the number of identified proteins. After digestion into tryptic peptides, each fraction was analyzed independently in triplicate by LC-MS/MS. The spectra were searched against the MTB genome, and the total number of unique peptides identified in each cellular fraction of each biological replicate by strain type is shown in Table 4. A total of 452, 1,075, 807, and 735 proteins were confidently identified in the CFP, CW, MEM, and CYT, respectively, of the Haarlem isolates, and 455, 1,072, 760, and 704 proteins were confidently identified in the CFP, CW, MEM, and CYT fractions, respectively, of the Beijing isolates.
Table 4. Number of unique peptides identified for each biological replicate within cellular fractions by MTB strain type. H=Haarlem; R=rifampicin resistant; B=Beijing;
S=rifamipcin susceptible
Haarlem RIF- Haarlem RIF- Beijing RIF- Beijing RIF- resistant
M. tuberculosis susceptible M. resistant M. susceptible M.
tuberculosis tuberculosis tuberculosis
Biological 1 2 3 1 2 3 1 2 3 1 2 3 replicate
Cytosol 2021 2120 2204 2033 1995 2180 2167 2031 1951 2052 1985 2165
Membrane 1572 1650 1359 1354 1409 1115 1560 1301 1454 1050 1353 1339
Cell wall 1944 1888 1921 2104 1343 1801 1943 1995 1921 1943 1850 1403
Culture 991 1082 973 1057 1053 963 1214 1072 1084 739 921 903 filtrate
Spectral counts for each biological replicate were normalized against the total signal as described previously (Carvalho et al, 2008, Genet Mol Res 7:342- 56). After normalization and log transformation of the data, a linear model ANOVA comparing spectral counts for each protein within subcellular fractions for each isogenic pair was applied to identify proteins that were differentially abundant between susceptible and resistant isolates (p-value <0.05). Thirty -two, 44, 21, and 27 proteins were identified with significantly higher spectral counts (p<0.05) relative to the wild-type isolate in the CFP, CW, MEM, and CYT, respectively, of the Haarlem rpoB mutant. Similarly, there were 45, 44, 43, and 31 proteins detected with significantly higher spectral counts in the CFP, CW, MEM, and CYT fractions, respectively, of the Beijing rpoB mutant isolate relative to its wild-type progenitor isolate. A comparison of both rpoB mutants against their respective wild-type, rifampicin-susceptible parent revealed 10 proteins with statistically significantly (p <0.05) higher normalized spectral counts (Table 5). All of the products identified at significantly higher spectral counts in the cell wall fraction of both rpoB mutant, rifampicin-resistant strains represented proteins that are transcriptionally coupled on a 50-kb region involved in the biosynthesis of PDIM in MTB (Camacho et al, 2001, J Biol Chem 276: 19845-54; Trivedi et al, 2005, Mol Cell 17:631-43), including two type-I polyketide synthase genes (Rv2933/ppsC and ~Ry2935/ppsE) and a probable daunorubicin imycoserosate (DIM) transport protein (Rv2936/drrA). Other proteins identified in other cellular fractions besides the cell wall included a succinate semialdehyde dehydrogenase (Rv0234c), a putative integration host factor
(Rvl388/mz7z ), a probable acyl-coA dehydrogenase (Rv3562/fadE31) involved in lipid degradation and a polynucleotide phosphorylase/polyadenylase (Rv2783c/g s/) involved in mRNA degradation. The final three products identified (Rvl056,
Rv3038c, and Rv3661) are conserved hypotheticals of unknown function (Table 5).
Spectral counts of recA and dnaE2 were specifically examined using qRT-PCR (Bergval et al, 2007, FEMS Microbiol Lett 275:338-43) but increased spectral counts for the corresponding proteins were not observed. Table 6 shows the number of proteins detected in the Haarlem, Beijing, and both rpoB mutants at summary (combined CW, MEM, and CYT) spectral counts at least 2-fold or higher compared to the wild-type isolates as well as the number of proteins detected in the mutant isolates alone (where fold change is set arbitrarily to 100). There were 25 proteins detected in neither wild-type isolate and in both rpoB mutants (Table 6). Five of these proteins were detected in at least 2 replicates in both rpoB mutants, as shown in Table 7. Table 7 lists the Rv numbers, spectral counts, fold changes, replicate raw data, and p values for the comparison of the two strains for the 90 cell-asociated proteins detected > 2 fold higher in both rpoB mutants isolates compared to wild-type, including proteins only detected in the mutant strains. Of the 10 proteins identified at statistically significantly higher counts in specific cellular fractions of both rpoB mutants (Table 5), 3 also had summary cell-associated (e.g., combined spectral counts of all fractions but CFP) spectral counts at least 2-fold higher in both mutant versus wild-type isolates and of these, 2 of 3 involved the PDIM biosynthetic locus (ppsC and drrA). The fold increased detection in the rpoB mutant Haarlem and Beijing isolates for ppsC and drrA were 3.6 and 10.2 and 100 (detected in mutant but not wild-type) and 4.7, respectively. The fold change values for ppsE were 3.07 and 1.97 for Haarlem and Beijing strains, respectively.
*Protein identified by only 1 unique peptide in all biological replicates.
* Summary of spectral counts correspond to the sum of the mean of 3 biological replicates for CYT, CW and MEM fractions for each isolate. Fold change values are rounded upwards at 0.5. WT=wild-type MTB.
Rv2024c 7.47 2.16 3.45 0.04 4.14 0.45 9.10 0.07 3.45
Rv2554c 1.30 0.00 100.00 0.21 2.13 0.64 3.31 0.17 3.31
Rv0180c 2.41 0.74 3.27 0.23 3.65 0.71 5.13 0.08 3.27
Rv3290c 5.05 1.63 3.09 0.01 1.45 0.48 3.04 0.20 3.04
Rv3223c 1.01 0.33 3.03 0.19 9.57 1.94 4.94 0.10 3.03
Rv3794 1.88 0.64 2.95 0.09 2.19 0.71 3.09 0.08 2.95
Rv0638 1.43 0.37 3.88 0.17 3.93 1.37 2.88 0.12 2.88
Rvl391 20.88 5.57 3.75 0.14 11.34 3.98 2.85 0.15 2.85
Rvl638 4.03 0.37 10.94 0.07 14.15 5.15 2.75 0.03 2.75
Rvl701 4.47 1.64 2.73 0.03 4.25 1.43 2.97 0.09 2.73
Rv2858c 4.51 1.71 2.65 0.08 7.02 2.44 2.87 0.07 2.65
Rv2334 7.73 2.15 3.59 0.03 8.06 3.09 2.61 0.03 2.61
Rvl 882c 4.66 1.80 2.59 0.16 1.44 0.00 100.00 0.12 2.59
Rv3661 20.61 5.48 3.76 0.01 19.65 7.67 2.56 0.04 2.56
Rv3498c 10.24 4.02 2.55 0.10 8.60 1.39 6.20 0.08 2.55
Rv2131c 16.32 3.38 4.82 0.04 31.03 12.30 2.52 0.00 2.52
Rv3075c 2.79 1.12 2.50 0.14 4.60 0.99 4.66 0.03 2.50
Rvl527c 6.79 1.62 4.19 0.13 14.57 5.89 2.47 0.01 2.47
Rv2203 1.68 0.37 4.57 0.18 4.99 2.03 2.46 0.20 2.46
Rv3915 3.81 1.56 2.45 0.18 9.70 3.68 2.63 0.08 2.45
Rv0383c 1.72 0.72 2.41 0.15 1.35 0.00 100.00 0.11 2.41
Rv2927c 7.39 2.24 3.30 0.06 6.17 2.60 2.38 0.08 2.38
Rv2931 16.45 0.72 23.00 0.05 71.16 30.15 2.36 0.06 2.36
Rv0409 1.36 0.37 3.71 0.17 4.24 1.80 2.36 0.13 2.36
Rv2737c 1.72 0.73 2.36 0.16 4.02 1.55 2.59 0.05 2.36
Rv3512 4.69 1.64 2.85 0.14 2.40 1.02 2.35 0.26 2.35
Rv3586 11.10 4.74 2.34 0.01 8.24 3.25 2.54 0.17 2.34
Rv0251c 3.80 1.64 2.32 0.23 26.15 8.81 2.97 0.11 2.32
Rv2739c 0.85 0.37 2.31 0.22 1.40 0.00 100.00 0.00 2.31
Rv2166c 2.44 1.06 2.31 0.31 6.57 1.14 5.76 0.19 2.31
Rv2074 5.29 1.72 3.07 0.11 9.95 4.42 2.25 0.06 2.25
Rv3792 1.74 0.00 100.00 0.09 0.99 0.45 2.18 0.33 2.18
Rv3423c 7.11 3.02 2.36 0.08 16.30 7.47 2.18 0.08 2.18
Rv2921c 7.59 2.19 3.47 0.04 8.48 3.90 2.18 0.11 2.18
Rv0496 2.54 1.17 2.17 0.20 9.73 2.84 3.42 0.09 2.17
Rv3818 4.94 1.18 4.19 0.06 3.76 1.74 2.16 0.10 2.16
Rv2606c 28.51 13.08 2.18 0.03 32.39 15.02 2.16 0.01 2.16
Rv3281 2.11 0.33 6.35 0.11 2.23 1.03 2.16 0.29 2.16
Rv2110c 20.00 9.45 2.12 0.11 9.64 4.15 2.32 0.04 2.12
Rv2062c 4.87 0.70 6.96 0.03 1.35 0.64 2.11 0.26 2.11
Rvl260 1.45 0.69 2.10 0.21 1.13 0.34 3.32 0.18 2.10
Rv3273 28.11 6.95 4.04 0.05 52.01 24.80 2.10 0.00 2.10
Rv0129c 9.92 4.74 2.09 0.02 4.29 0.93 4.60 0.14 2.09
Rv2586c 1.70 0.82 2.08 0.10 1.44 0.64 2.24 0.25 2.08
Rvl769 1.11 0.00 100.00 0.21 2.94 1.42 2.07 0.20 2.07
Rv0576 6.20 2.81 2.20 0.05 4.39 2.12 2.07 0.05 2.07
Rv2289 16.92 7.57 2.24 0.02 22.59 11.00 2.05 0.09 2.05
Rv2192c 0.75 0.37 2.05 0.34 3.25 0.00 100.00 0.01 2.05
Rv3777 4.25 2.08 2.04 0.11 2.68 0.36 7.34 0.12 2.04
Rvl340 11.73 3.78 3.11 0.00 8.28 4.08 2.03 0.02 2.03
Rv2184c 5.94 2.94 2.02 0.27 6.00 1.10 5.46 0.09 2.02
Table 7B. Summary spectral counts for cell-associated proteins upregulated by 2-fold or greater in rpoB-mutant MTB isolates
CW+CYT+MEM Haarlem isolate CW+CYT+MEM Beijing isolate Replicate spectral counts Replicate spectral counts
Rv3794 1.67 1.48 2.50 0.00 1.91 0.00 1.35 2.83 2.41 0.00 0.00 2.13
Rv0638 2.98 1.30 0.00 1.10 0.00 0.00 1.80 7.03 2.98 0.00 1.97 2.13
Rvl391 6.93 14.84 40.86 9.92 0.00 6.79 20.18 12.34 1.49 4.09 5.73 2.13
16.1
Rvl638 6.93 3.91 1.25 1.10 0.00 0.00 16.61 9.69 2.73 2.86 9.85
7
Rvl701 4.30 5.38 3.75 2.21 0.00 2.71 2.69 4.11 5.96 0.00 4.30 0.00
Rv2858c 7.03 3.47 3.04 2.13 0.00 2.99 5.48 10.82 4.75 1.03 1.09 5.20
Rv2334 9.20 7.89 6.08 0.00 1.12 5.35 5.98 8.42 9.80 2.40 1.09 5.79
Rvl 882c 2.63 2.60 8.74 1.10 4.29 0.00 1.35 0.00 2.98 0.00 0.00 0.00
11.0 11.7 10.2
Rv3661 26.50 16.32 19.03 0.00 5.43 25.14 22.11 4.83 7.92
2 0 5
14.9
Rv3498c 11.83 3.91 14.98 6.62 0.00 5.43 4.04 6.86 2.73 1.43 0.00
0
26.0 14.5 13.5
Rv2131c 7.64 20.57 20.75 5.52 1.91 2.71 30.97 36.08 8.88
2 0 1
Rv3075c 2.34 3.99 2.03 0.00 3.35 0.00 2.44 6.01 5.35 1.03 0.00 1.93
11.3
Rvl527c 2.98 3.91 13.50 0.00 2.15 2.71 14.38 18.00 5.82 3.94 7.92
5
Rv2203 0.00 1.30 3.75 1.10 0.00 0.00 5.38 9.60 0.00 2.73 1.43 1.93
Rv3915 2.63 1.30 7.49 3.31 0.00 1.36 14.83 8.31 5.96 8.19 2.86 0.00
Rv0383c 1.31 2.60 1.25 0.00 2.15 0.00 2.69 1.37 0.00 0.00 0.00 0.00
Rv2927c 3.94 10.89 7.33 2.21 2.15 2.35 8.92 3.95 5.66 2.40 5.39 0.00
66.8 58.1 30.8
Rv2931 27.71 11.89 9.75 0.00 2.15 0.00 56.14 90.50 1.43
6 6 7
Rv0409 1.31 2.78 0.00 1.10 0.00 0.00 1.80 7.03 3.90 3.42 1.97 0.00
Rv2737c 1.31 2.60 1.25 2.19 0.00 0.00 4.04 4.11 3.90 2.73 0.00 1.93
Rv3512 8.81 2.78 2.50 1.10 1.12 2.71 1.80 5.40 0.00 0.00 0.00 3.07
Rv3586 13.15 10.41 9.75 5.52 1.91 6.79 8.07 15.17 1.49 5.46 4.30 0.00
15.0
Rv0251c 7.89 0.00 3.51 2.21 0.00 2.71 29.17 41.82 7.45 7.16 4.26
1
Rv2739c 0.00 1.30 1.25 1.10 0.00 0.00 1.35 1.37 1.49 0.00 0.00 0.00
Rv2166c 0.00 0.00 7.33 1.06 1.12 1.00 3.60 16.12 0.00 3.42 0.00 0.00
Rv2074 3.52 2.99 9.36 2.17 0.00 2.99 12.70 11.50 5.66 3.10 4.38 5.79
Rv3792 2.63 2.60 0.00 0.00 0.00 0.00 0.00 0.00 2.98 1.36 0.00 0.00
18.3 14.9
Rv3423c 6.32 4.25 10.76 4.42 1.91 2.71 20.68 9.85 4.09 3.40
6 1
13.1
Rv2921c 5.97 5.55 11.24 3.30 1.91 1.36 4.04 8.23 5.46 4.30 1.93
9
Rv0496 1.31 1.30 4.99 0.00 2.15 1.36 16.14 4.11 8.94 1.36 7.16 0.00
Rv3818 5.26 2.30 7.26 1.06 1.12 1.36 2.69 4.11 4.47 1.36 0.00 3.86
10.6 18.0 10.4 29.5 17.4 14.4 13.1
Rv2606c 22.55 37.96 25.03 29.49 38.15
8 8 7 4 6 5 5
Rv3281 0.00 3.30 3.04 0.00 0.00 1.00 5.48 1.20 0.00 3.10 0.00 0.00
10.9
Rv2110c 31.80 10.97 17.23 9.58 7.81 10.95 12.03 5.93 4.13 2.19 6.14
7
Rv2062c 6.57 5.55 2.50 1.10 0.00 1.00 2.69 1.37 0.00 0.00 0.00 1.93
Rvl260 2.34 1.99 0.00 1.06 0.00 1.00 2.19 1.20 0.00 0.00 0.00 1.02
11.0 46.4 32.0 16.8 25.4
Rv3273 12.54 35.76 36.03 5.74 4.07 52.95 56.65
4 4 8 3 8
Rv0129c 8.92 12.10 8.74 7.61 3.26 3.35 7.82 0.00 5.05 1.36 1.43 0.00
Rv2586c 1.31 1.30 2.50 1.10 0.00 1.36 1.35 0.00 2.98 0.00 0.00 1.93
Rvl769 3.34 0.00 0.00 0.00 0.00 0.00 3.60 2.83 2.41 0.00 0.00 4.26
Rv0576 5.19 5.29 8.11 5.32 1.12 2.00 3.29 6.01 3.86 1.03 3.28 2.05
12.0 22.4 21.3
Rv2289 16.59 20.92 13.26 3.83 6.79 21.55 23.74 9.55 2.13
9 8 1
Rv2192c 0.00 0.00 2.26 1.10 0.00 0.00 3.14 4.20 2.41 0.00 0.00 0.00
Rv3777 4.69 2.99 5.07 4.26 0.00 2.00 3.29 0.00 4.75 0.00 1.09 0.00
10.2
Rvl340 9.48 12.15 13.57 5.38 2.23 3.71 8.02 6.60 5.46 2.53 4.26
1
Rv2184c 6.57 0.00 11.24 8.83 0.00 0.00 4.04 10.97 2.98 1.36 0.00 1.93
Gene set enrichment analysis of proteins upregulated in both rpoB mutants
The distribution of functional classes among genes upregulated > 2 fold in both rpoB mutants vs. genes not upregulated in both mutants was not
5 statistically significantly different when comparing the proportion of genes in each Functional Categorization of Gene Products (COG) class (chi square tests all p >0.05). Among the four gene loci identified as possibly involved in natural product biosynthesis in MTB by NP. searcher, the polyketide synthase gene cluster ppsA-E and drrA was significantly upregulated in both rpoB mutants (Figure 2).
0
Selected expression of genes in the PDIM biosynthetic locus in the Beijing rpoB mutant MTB during active infection of murine macrophages
In order to determine if increased expression of proteins involved in PDIM biosynthesis correlated with increased transcription of the corresponding genes,5 qRT-PCR was performed. Consistent with the proteomic analysis, the ppsA gene was found to be upregulated > 2-fold in the Beijing rpoB mutant relative to the parental strain (Figure 3A). Next, using qRT-PCR, experiments were performed to determine the effect of rpoB mutation on expression levels of selected PDIM biosynthesis genes during Mtb infection of activated murine macrophages. The genes ppsA, ppsC, and0 ppsE were each found to have >10-fold increased expression in the rpoB mutant relative to the rifampicin-sensitive parent strain, while expression of the control gene Rv0496 was not different between the two strains (Figure 3B). A comparison of upregulation in Figure 3A and 3B indicates that the upregulation was more striking in activated macrophages than when grown in nutrient rich media. Consistent with the5 proteomic data, Rv0799c, which encodes a conserved hypothetical protein, also was found to be mildly upregulated in the rpoB mutant relative to the parent strain in activated murine macrophages. The rpoB mutation did not appear to confer a fitness cost as the rpoB mutant and the WT -parent strain showed nearly equivalent growth
rates and survival in activated macrophages (Figure 3C). Finally, in order to confirm that the gene expression profile observed in the rpoB mutant was attributable to the RpoB S450L mutation in the rpoB gene, a mutant strain containing the RpoB S450L mutation in the background of the laboratory strain MTB CDC 1551 was
experimentally generated. The genes ppsA, ppsB, ppsC, and Rv0799c were each upregulated in this RpoB S450L mutant relative to the isogenic CDC1551 wild-type strain during logarithmic growth in nutrient-rich broth (Figure 3D).
Metabolomics analysis
In addition to the proteomics experiments described elsewhere herein, metabolomic analyses were performed in order to determine
mutations also might lead to changes in the MTB metabolome. Because of the great complexity of the sample, two sequential extractions were performed to separate cell wall associated lipids and other non-polar metabolites from more polar metabolites. This analysis revealed 99 molecular features in the chloroform fraction that were significantly more abundant (p <0.05) in both rifampicin resistant MTB strains when compared to their susceptible pairs (Table 8). A search performed against the LipidMaps database suggested that several of these significant features correspond to diacylglycerol phosphocholines (Table 9). Since the proteomics and GSEA findings suggested that the polyketide synthase genes involved in phenolpthiocerol biosynthesis are upregulated in the rpoB mutant isolates of MTB, the chloroform extract was compared to a positive authentic PDIM standard that was obtained from MTB H37Rv and analyzed by LC-MS using identical parameters. The PDIM standard was obtained through the Tuberculosis Vaccine Testing and Research Material Contract
(TVTRMC). The 797.7 m/z and 823.2 m/z signals, observed to increase in the resistant strains relative to their respective parent strains (Figure 4 and Table 9), were also found in an authentic PDIM standard. When MS/MS analysis was performed on the 797.7 m/z ion, a fragment of 523.47 m/z and neutral loss of 274.27 was observed (data not shown). The difference in 2Da from the expected 525.5 m/z of phthiocerol (Jain et al., 2007, Proc Natl Acad Sci USA 104:5133-8) suggests desaturation by loss of the methyl group and therefore most likely corresponds to phthiodiolone. Without wishing to be bound by any particular theory, these data are consistent with accumulation of PDIM precursors in the rifampicin-resistant isolates, likely due to elevated levels of polyketide synthase-related proteins.
Table 8. Molecular features of metabolites identified in the chloroform fraction as statistically significantly more abundant in both rpoB mutant MTB isolates compared to both wild-type MTB parent strains. WT=wild-type
993.7/582 3.091 2.069 0.048 8.795 4.359 0.014
890.7/595 32.886 23.706 0.019 64.686 15.270 0.000
617.9/601 1.718 1.184 0.032 1.276 0.487 0.001
295.2/610 14.901 11.049 0.031 8.816 5.006 0.024
119.1/611 12.300 9.179 0.036 7.171 4.720 0.018
632.6/615 8.035 3.727 0.031 92.126 3.992 0.000
777.7/643 4.649 2.950 0.017 21.838 7.850 0.007
776.7/644 11.359 6.732 0.027 42.342 31.766 0.014
688.6/647 21.297 10.520 0.028 111.529 23.667 0.000
781.2/663 0.730 0.299 0.017 2.185 0.777 0.005
455.4/668 5.810 4.224 0.020 10.455 6.376 0.003
819.4/675 5.034 4.061 0.048 17.534 10.332 0.004
761.7/678 31.403 26.199 0.047 23.715 12.486 0.000
523.5/679 77.313 62.012 0.008 320.738 151.609 0.000
797.7/679 291.565 236.479 0.043 1281.437 607.982 0.000
823.2/679 6.644 4.660 0.043 34.537 21.806 0.008
824.2/680 6.264 4.224 0.012 19.055 11.641 0.004
826.2/680 5.944 3.691 0.001 12.524 6.447 0.001
829.2/680 3.268 1.981 0.022 8.904 6.040 0.024
831.3/683 2.226 1.503 0.015 9.058 3.774 0.000
844.3/684 3.969 2.506 0.008 12.483 6.862 0.003
836.4/685 2.717 1.478 0.035 11.895 4.570 0.000
838.2/685 4.679 3.059 0.043 14.631 6.595 0.001
841.2/685 4.335 2.313 0.040 12.465 4.792 0.003
828.2/688 3.455 2.177 0.037 9.281 4.870 0.005
844.5/688 6.114 4.747 0.043 11.946 7.215 0.018
846.3/688 12.634 8.818 0.002 17.950 11.332 0.008
847.3/688 10.830 7.871 0.026 17.088 11.647 0.012
849.5/689 15.165 11.151 0.032 21.787 12.963 0.006
852.2/689 14.537 10.814 0.049 33.914 18.303 0.001
553.8/690 0.388 0.225 0.046 1.199 0.534 0.001
861.2/690 6.711 4.961 0.031 15.058 7.493 0.005
565.5/693 100.772 80.472 0.004 204.541 92.075 0.000
566.5/693 39.328 33.550 0.036 81.626 36.813 0.000
864.8/693 3945.021 3202.000 0.007 5929.751 3489.109 0.000
865.8/693 2079.054 1681.559 0.008 4001.476 2100.497 0.000
867.3/695 15.922 11.511 0.022 25.184 14.119 0.003
875.5/698 17.329 12.054 0.016 25.906 16.047 0.019
873.8/701 77.890 65.743 0.036 99.600 60.112 0.001
889.4/702 8.571 6.363 0.046 12.340 7.861 0.012
902.4/707 9.185 6.558 0.018 13.074 9.086 0.012
893.5/709 9.112 7.473 0.023 9.793 5.171 0.000
936.9/721 2861.443 2538.379 0.034 4129.703 3004.694 0.002
961.5/722 9.735 8.319 0.006 14.031 9.051 0.025
964.4/722 11.570 9.613 0.002 16.950 11.860 0.002
962.5/723 5.029 3.273 0.036 11.102 4.655 0.000
974.2/725 7.348 4.571 0.048 9.649 4.384 0.000
1010.2/734 6.351 3.665 0.039 6.389 2.950 0.034
1034.5/736 1.885 1.174 0.030 3.263 1.339 0.002
1047.1/740 7.367 3.291 0.022 8.676 3.534 0.025
966/787 2.070 1.495 0.035 6.085 2.021 0.000
991.1/806 2.239 1.188 0.044 6.804 1.033 0.003
977/859 0.648 0.308 0.045 5.580 0.736 0.010
577/908 2.999 2.475 0.010 3.001 1.743 0.004
653/908 5.337 4.547 0.023 5.173 2.691 0.001
899/908 2.788 1.953 0.041 3.623 1.136 0.000
345.2 1061 10.419 5.687 0.034 14.349 5.727 0.019
363.2 1061 74.866 49.437 0.014 63.242 44.048 0.003
389.3 1061 53.262 34.879 0.024 46.866 31.877 0.017
531.5 1061 151.562 91.939 0.036 109.917 56.560 0.015
532.5 1061 56.525 36.064 0.028 42.000 20.758 0.012
636.5 1061 47.548 23.712 0.004 38.509 17.748 0.009
699.6 1061 33.271 18.839 0.023 24.653 12.342 0.021
717.6 1061 6257.378 3655.220 0.033 4529.182 1897.650 0.007
718.6 1061 2867.806 1806.767 0.045 2124.351 1002.772 0.008
735.6 1061 799.634 409.858 0.034 546.444 249.317 0.014
736.6 1061 83.305 52.974 0.030 249.131 128.015 0.011
753.6 1061 170.532 104.240 0.038 123.990 62.392 0.007
754.6 1061 94.545 61.712 0.036 71.979 43.733 0.031
771.6 1061 198.991 117.007 0.014 131.692 70.860 0.007
772.6 1061 107.522 67.597 0.009 80.007 42.733 0.016
773.6 1061 31.654 18.005 0.015 22.130 11.537 0.025
789.6 1061 247.516 151.338 0.036 177.175 94.146 0.015
790.6 1061 124.074 79.885 0.024 91.662 53.478 0.013
791.6 1061 37.056 23.549 0.046 27.228 15.857 0.012
807.6 1061 296.842 176.814 0.033 201.738 97.621 0.008
808.6 1061 166.267 93.964 0.015 109.848 52.227 0.022
809.6 1061 52.777 30.453 0.030 36.652 20.813 0.017 identified by analysis in LipidMaps or Massbank
**Identified by comparison of MS spectra produced by analysis of purified PDIM from MTB
** identified by query of published reports of MTB PG mass spectra
Scoring system based on metabolite identification guidelines (Sumner et al, 2007).
Score=l : Identified compound. Retention time and mass spectrum of interest matches a purified standard.
Score=2: Putatively annotated compound. Based on spectral similarity to public spectral libraries or published data.
Score=3: Putatively characterized compound classes. Based on spectral similarity to known compounds of a chemical class.
Eighty-seven molecular features from the methanol fraction were significantly more abundant (p <0.05) in both resistant strains when compared to their susceptible pairs (Table 8). A large portion of these molecular features were observed in two clusters at a retention time of 16.9 minutes suggesting that they may be derived from a common parent compound (Table 9). Each cluster of peaks was searched against the Massbank spectral database and both returned matches to hexose-N acetyl- hexosamine-fucose-N-acetyl-hexosamine (Table 9). To determine if this compound originated from peptidoglycan, an MTB petidoglycan standard, obtained through the TVTRMC, was analyzed by LC-MS using identical conditions. Comparison of the
standard peptidoglycan spectrum did not correlate with the molecular features observed in the methanol sample fraction. However, this was not entirely unexpected given the extensive cross-linking in mature PG and stability of the mature product. An analysis of the literature for mass spectra of partially hydro lyzed PG demonstrated reports of PG MurNac-tetra and penta peptides, and MurNac of Mtb PG that do match the molecular features observed in the spectra from our methanol sample fractions. Specifically, the molecular features at 808.6 m/z (790.6 m/z; minus water), 736.6 m/z (718.6 m/z; minus water), and 531.5 m/z correspond to these three PG derivatives (Lavollay et al, 2008, J Bacteriol 190:4360-6; Mahapatra et al, 2005, J Bacteriol 187:2341-7). An examination of the gene cluster associated with peptidoglycan biosynthesis in Mtb (Rv2158c-2152c) did not however reveal significantly increased spectral counts in the rpoB mutant isolates using GSEA. A previous reported scoring system of 1-4 (1 high, 4 low) was used to determine the level of confidence in metabolite identification.
PDIM locus upregulation by rpoB mutant MTB
It is hypothesized that rpoB mutation would lead to upregulation of MTB genes involved in secondary metabolism, given known relationships between rpoB mutation and upregulation of genes involved in natural product biosynthesis in other organisms (Hosaka et al, 2009, Nat Biotechnol 27:462-4; Hu et al, 2002, J Bacteriol 184:3984-91; Inaoka et al, 2004, J Biol Chem 279:3885-92). This study, which is the first to comprehensively compare the proteomes and metabolomes of rpoB mutant, rifampicin-resistant MTB with those of their paired wild-type, rifampicin susceptible parent strains, demonstrates that several genes, particularly those involved in the biosynthesis of cell wall lipids including PDIM, are upregulated in rpoB mutants, both in broth culture and, in particular, when grown in murine macrophages. Using the program NP. searcher, it was discovered that 4 gene loci possibly related to natural product biosynthesis in MTB, and the GSEA indicated that of these four, the proteins encoded by ppsA-E and drrA were more abundant in the cell wall of both rpoB mutants relative to their wild-type parent strains. Furthermore, 'in situ' over-expression of several pps genes were confirmed using a CDC1551 strain as well as a macrophage model for the Beijing isolate, indicating the changes in expression oippsA-E are unlikely to be due to inherent characteristics of the two clinical strains used or the in vitro culture system. The present study is different from
previous studies demonstrating that exposure to rifampicin induces several changes in rifampicin resistant MTB gene expression, including marked up-regulation of drug efflux-pump related genes (Gupta et al, 2010, Microb Drug Resist 16:21-8; Louw et al, 201 1, Am J Respir Crit Care Med 184:269-76). Specifically, in this study the impact of rpoB mutations on the proteome and metabolome of rifampicin-resistant and susceptible strains was performed in the absence of rifampicin in order to determine protein and metabolite abundance changes that are associated with rpoB mutations independent of drug exposure.
Proteins encoded by ppsA-E are involved in PDIM biosynthesis and the corresponding genes are grouped on a 50-kb fragment of the MTB chromosome (Camacho et al, 2001, J Biol Chem 276: 19845-54). Although evidence of higher levels of intact PDIM in the Haarlem rpoB mutant was not observed, levels of PDIM in the Beijing rpoB mutant isolate appear to be elevated when compared to its isogenic strain as evaluated by TLC (Figure 1). However, metabolites with the same spectra as PDIM precursors were detected at higher levels in both rpoB mutant isolates compared to their wild-type progenitor isolates. While only two strains were evaluated, the finding of remarkably similar changes in protein abundance in a Beijing and Haarlem strain of MTB with different rpoB mutations grown in the absence of drug exposure suggests that rpoB mutation and rifampicin resistance in MTB lead to a pattern of differential protein and metabolite abundance that is conserved across both mutations and strains,.
PDIM is a long-chain β-diol (phthiocerol) esterified with two branched-chain mycocerosic acids located in the outer mycobacterial cell wall that has been implicated in MTB virulence (Camacho et al., 1999, Mol Microbiol 34:257- 67; Cox et al, 1999, Nature 402:79-83; Reed et al, 2004, Nature 431 :84-7). The genes ppsA-E (Rv2931-Rv2935) encode a type I modular polyketide synthase responsible for biosynthesis of the phtiocerol backbone of PDIM, with PpsA-C sequentially loading ketide units onto long chain fatty acids and PpsD and PpsE subsequently extending the phthiocerol further by adding a 4-methyl branch and malonyl- or methylmalonyl-CoA, respectively (Azad et al, 1997, J Biol Chem
272: 16741-5; Trivedi et al, 2005, Mol Cell 17:631-43). The genes drrA-C (Rv2936- Rv2938) are located adjacent to ppsE (Rv2935) and are thought to encode proteins involved in the transport and localization of PDIM across the cell membrane (Braibant et al, 2000, FEMS Microbiol Rev 24:449-67; Camacho et al, 2001, J Biol
Chem 276: 19845-54). Others have demonstrated upregulation of genes in this pathway in response to acid exposure (Golby et al, 2007, Microbiology 153:3323-36; Rustad et al, 2008, PLoS One 3:el502), hypoxia (Park et al, 2003, Mol Microbiol 48:833-43; Rustad et al, 2008, PLoS One 3:el502), and treatment with antibiotics such as clofazamine and rifapentine (Boshoff et al, 2004, J Biol Chem 279:40174- 84). Furthermore, MTB strains with defects in this pathway have been shown to have increased cell envelope permeability (Camacho et al., 2001, J Biol Chem 276: 19845- 54) and are more susceptible to IFN-γ mediated and IFN-y-independent immunity (Kirksey et al, 2011, Infect Immun 79:2829-38; Murry, et al, 2009, J Infect Dis 200:774-82). Importantly, PDIM deficiency appears to be particularly important to MTB growth in the host environment, as isolates with deficiencies in this pathway have pronounced growth defects in the spleens and lungs of infected mice (Kondo and Kanai, 1976, Jpn J Med Sci Biol 29: 199-210; Camacho et al, 1999, Mol Microbiol 34:257-67; Cox et al., 1999, Nature 402:79-83) and are more susceptible to the nitric - oxide-dependent killing of macrophages (Rousseau et al, 2004, Cell Microbiol 6:277- 87). More recently, PDIM has been shown to play a role in MTB's interaction with the host macrophage cell envelope, inducing changes that favor receptor-mediated phagocytosis of the bacterium (Astarie-Dequeker et al, 2009, PLoS Pathog
5:el000289). In this study, it was observed that the upregulation of PDIM by rpoB mutants relative to wild-type isolates, initially identified by proteomics experiments on MTB isolates grown in broth, was more dramatic when these comparisons were performed in activated murine macrophages. Thus, although the physiologic importance of PDIM upregulation by rpoB mutants cannot be discerned from these data, it is possible that upregulation of the PDIM pathway is related to an increased pressure for rpoB mutants to maintain or remodel the cell wall, particularly during host cell infection. Of note, certain other bacteria have been shown to increase lipid abundance in association with rpoB mutations, which suggests that this may be a conserved response to development of drug resistance (Vitali et al, 2008, Int J Antimicrob Agents 31:555-60).
The finding of increased peptidoglycan precursors in the rpoB mutants in the metabolomics data is also supportive of this hypothesis. Peptidoglycan biosynthesis is a multi-enzyme process that involves the MurA-G cluster in addition to MurX and a putative flippase (Cole, S. T. 2005. TB and the tubercle bacillus. ASM
Press, Washington, DC). The instant proteomic analysis identified three of the seven Mur proteins (MurD-F) in the cell wall, membrane and cytosol, which did not show significant differences in their abundance between resistant vs susceptible strains. However, given the lack of data on the relative abundance of the other peptidoglycan biosynthetic enzymes and the complex nature of peptidoglycan precursor
biosynthesis, the idea that the increase amount of PG related metabolites could be associated with an increase in the production of PG enzymes cannot be discarded, especially with those involved in the last steps of the biosynthetic pathway, such as MurG and MurX (a.k.a MraY). Nonetheless, peptidoglycan and PDIM are both significant components of the cell envelope, with peptidoglycan forming the inner cell wall layer and PDIM decorating the outer layer via non-covalent association with other cell envelope lipids (Brennan, 2003, Tuberculosis (Edinb) 83:91-7).
Peptidoglycan interacts (at least indirectly) with PDIM to form the mature mycobacterial cell envelope, in that PDIIM translocates across peptidoglycan via mmpl7 to reside in the outer layer of the cell envelope (Jain and Cox, 2005, PLoS Pathog l :e2). Thus, it is plausible that changes in PG ultrastructure combined with changes in PDIM biosynthesis synergize to affect the overall integrity of the mycobacterial cell envelope together in response to rpoB mutation.
rpoB mutant strains of saprophytic environmental mycobacteria have been found to cohabitate with rifamycin-producing organisms on marine sponges (Izumi et al., 2010, FEMS Microbiol Lett 313:33-40), indicating that ancestors of MTB faced rifamycin exposure long before this class of antibiotics was used to treat TB. Rifamycin resistant, rpoB mutant environmental mycobacteria antagonized by antibiotics secreted by surrounding competitor organisms conceivably would have experienced a survival advantage if they were able to maintain the integrity of their cell wall. Thus, it is possible that upregulation of the PDIM biosynthetic pathway in rpoB mutants of MTB, as demonstrated here both in broth and macrophage culture, is a defense mechanism response to competition interference inherited from MTB's environmental ancestors. Although the physiologic relevance of this gene
upregulation to the human pathogen MTB is unknown, it may be important to the survival of rifampicin-resistant mycobacteria in the setting of rifamycin or other antibiotic exposure. In particular, experiments can be designed to comprehensively investigate the degree to which various globally heterogenous strains of rpoB-mutant MTB upregulate PDIM, the mechanisms that result in PDIM upregulation, and the
effect oirpoB mutation and PDIM upregulation on susceptibility to various stressors, including existing and novel antibiotics used to treat TB.
The MTB genome contains an expansive repertoire of polyketide synthase genes that in related bacteria are involved in the biosynthesis of various secondary metabolites including erythromycin A and rifamycin B (Cole, Set al, 1998, Nature 393:537-44; Gokhale et al, 2007, Nat Prod Rep 24:267-77; Parish, T., and A. Brown. 2009. Mycobacterium: genomics and molecular biology. Caister Academic Press, Norfolk, UK.). The finding of upregulation of several genes encoding polyketide synthases in both rpoB mutants of MTB is of interest in that it suggests that the adaptive response of MTB to rpoB mutation may be analogous to responses observed in related model organisms. In such, rpoB mutations lead to upregulation of otherwise dormant gene clusters resulting in increased abundance of specific secondary metabolites that are absent or minimally present in wild-type strains (Hosaka et al, 2009, Nat Biotechnol 27:462-4; Zazopoulos et al, 2003, Nat
Biotechnol 21: 187-90). For example, genes encoding protein enzymes involved in actinorhodin (Act) and undecylprodigiosin (Red) biosynthesis are found in
Streptomyces lividans, but normally are not expressed by the corresponding paired wild-type isolates from which they arose (Hu et al, 2002, J Bacteriol 184:3984-91). Certain rifampicin-resistant rpoB mutants of S. lividans, however, produce both Act and Red in abundance, a phenomenon which can be reversed by replacing mutant with wild-type rpoB (Hu et al, 2002, J Bacteriol 184:3984-91). Similarly, specific rpoB mutations in Bacillus subtilis lead to dramatic auto-induction of the antibiotic 3,3'-neotrehalosadiame (NTD), which wild-type strains do not produce (Inaoka et al, 2004, J Biol Chem 279:3885-92). Remarkably, while only certain rpoB mutations are associated with gene upregulation in model organisms, the specific mutations most commonly associated with induced gene expression in non-mycobacterial organisms (Carata et al, 2009, Microb Cell Fact 8:18; Hu et al, 2002, J Bacteriol 184:3984-91; Inaoka et al, 2004, J Biol Chem 279:3885-92) align to mutations most commonly found in clinical rifampicin resistant MTB strains (i.e., positions 445 and 450 in Mtb) (Cavusogluet al., 2002, J Clin Microbiol 40:4435-8; Herrera et al, 2003, Int J
Antimicrob Agents 21:403-8; Mani et al, 2001, J Clin Microbiol 39:2987-90; Telenti et al, 1993, Lancet 341 :647-50; Yue et al, 2003, J Clin Microbiol 41 :2209-12). This suggests that those rpoB mutations that trigger upregulation of genes involved in biosynthesis of secondary metabolites are evolutionarily advantageous.
Camacho et al demonstrated that the PDIM locus is divided into three transcriptional units, one spanning fadD26 to papA5 (which includes the genes ppsA- E and drrA), another containing only the mas gene, and a third including fadD28 and mmpL7 (Camacho et al, 2001, J Biol Chem 276: 19845-54). The transcription of all three units appears to be required for the correct biosynthesis and placement of intact PDIM in the cell (Camacho et al, 2001, J Biol Chem 276: 19845-54). The genes ppsC, ppsE and drrA are located within the first transcriptional unit and in this study their corresponding PDIM precursor proteins were detected at statistically significantly higher levels in the rpoB mutants relative to their corresponding wild-type parent strains. Although the limited sensitivity of shotgun proteomics approaches hinders the ability to definitively conclude that proteins found in the other two downstream PDIM transcriptional units were not also upregulated, these findings, together with the metabolomics data, suggest that the first transcriptional unit of the PDIM biosynthetic locus, and not the others, may be specifically upregulated in rpoB mutant isolates of MTB. Comprehensive transcriptomics data can be used to confirm this hypothesis. PDIM production is characteristic of pathogenic, but not environmental,
mycobacterial strains (Daffe and Laneelle, 1988, J Gen Microbiol 134:2049-55). This indicates that PDIM production is not important for survival of environmental mycobacteria and, to the extent that the responses of MTB to rpoB mutation may have been inherited from MTB's saprophytic environmental ancestors, provides one speculative explanation for the observation that intact PDIM was not found in greater amounts in rpoB mutant isolates in this study.
The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.
Claims
1. A method of assessing microbial infection in a mammal, the method comprising:
a) contacting at least one polypeptide that is differentially expressed in a drug- resistant strain compared to a corresponding drug-susceptible strain with a biological sample from the mammal; and
b) measuring an immune response in the biological sample, wherein an increase in the immune response to the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain in the biological sample of the mammal indicates a past or present microbial infection with a drug-resistant strain.
2. The method of claim 1, wherein the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug- susceptible strain is selected from the group consisting of SEQ ID NOs: 1-98 or a fragment thereof.
3. The method of claim 1, wherein the immune response is at least one selected from the group consisting of a cell-mediated response and a humoral response.
4. The method of claim 1 , wherein the biological sample comprises at least one selected from the group consisting of whole blood, serum, plasma, and peripheral blood mononuclear cells.
5. The method of claim 1, wherein the microbial infection is M.
tuberculosis infection.
6. The method of claim 3, wherein the cell-mediated response is a T cell response.
7. The method of claim 6, wherein the T cell response is measured by detecting expression of a marker for T cell activation or proliferation.
8. The method of claim 7, wherein the T cell response is measured by detecting secretion of a cytokine.
9. The method of claim 3, wherein the humoral response is measured by a) contacting the biological sample of the mammal with the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain for a sufficient amount of time to allow complex formation between the at least one polypeptide with an antibody present in the biological sample, and
b) detecting a complex formed between an antibody in the biological sample and the antigen, wherein detection of the complex is indicative of infection by the drug-resistant strain in the mammal.
10. The method of claim 1, wherein the mammal is a human.
11. The method of claim 1 , wherein the mammal is receiving or has previously received a therapeutic intervention.
12. A kit for use in determining the presence of a drug-resistant strain in a mammal, the kit comprising at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain.
13. The kit of claim 12, wherein the drug-resistant strain is M.
tuberculosis.
14. The kit of claim 12, wherein the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug- susceptible strain is selected from the group consisting of SEQ ID NOs: 1-98 or a fragment thereof.
15. The kit of claim 12, wherein the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug- susceptible strain is used to detect an immune response in a biological sample from a mammal.
16. The kit of claim 15, wherein the biological sample comprises at least one selected from the group consisting of whole blood, serum, plasma, and peripheral blood mononuclear cells.
17. The kit of claim 15, wherein the immune response is at least one selected from the group consisting of a cell-mediated response and a humoral response.
18. The kit of claim 17, wherein the cell-mediated response is measured by detecting expression of a marker for T cell activation or proliferation.
19. The kit of claim 17, wherein the cell-mediated response is measured by detecting secretion of a cytokine.
20. The kit of claim 17, wherein the humoral response is detected by detecting a complex formed between an antibody in the biological sample and the at least one polypeptide that is differentially expressed in a drug-resistant strain compared to a corresponding drug-susceptible strain.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US14/365,479 US20140349320A1 (en) | 2011-12-15 | 2012-12-17 | Using Adaptive Immunity to Detect Drug Resistance |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201161576182P | 2011-12-15 | 2011-12-15 | |
| US61/576,182 | 2011-12-15 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2013090897A1 true WO2013090897A1 (en) | 2013-06-20 |
Family
ID=48613269
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2012/070092 Ceased WO2013090897A1 (en) | 2011-12-15 | 2012-12-17 | Using adaptive immunity to detect drug resistance |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20140349320A1 (en) |
| WO (1) | WO2013090897A1 (en) |
Cited By (26)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8664194B2 (en) | 2011-12-16 | 2014-03-04 | Moderna Therapeutics, Inc. | Method for producing a protein of interest in a primate |
| US8710200B2 (en) | 2011-03-31 | 2014-04-29 | Moderna Therapeutics, Inc. | Engineered nucleic acids encoding a modified erythropoietin and their expression |
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US20140349320A1 (en) * | 2011-12-15 | 2014-11-27 | The Trustees Of The University Of Pennsylvania | Using Adaptive Immunity to Detect Drug Resistance |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| US8999380B2 (en) | 2012-04-02 | 2015-04-07 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9334328B2 (en) | 2010-10-01 | 2016-05-10 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9428535B2 (en) | 2011-10-03 | 2016-08-30 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US10077439B2 (en) | 2013-03-15 | 2018-09-18 | Modernatx, Inc. | Removal of DNA fragments in mRNA production process |
| US10138507B2 (en) | 2013-03-15 | 2018-11-27 | Modernatx, Inc. | Manufacturing methods for production of RNA transcripts |
| US10286086B2 (en) | 2014-06-19 | 2019-05-14 | Modernatx, Inc. | Alternative nucleic acid molecules and uses thereof |
| US10323076B2 (en) | 2013-10-03 | 2019-06-18 | Modernatx, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| US10385088B2 (en) | 2013-10-02 | 2019-08-20 | Modernatx, Inc. | Polynucleotide molecules and uses thereof |
| US10407683B2 (en) | 2014-07-16 | 2019-09-10 | Modernatx, Inc. | Circular polynucleotides |
| US10590161B2 (en) | 2013-03-15 | 2020-03-17 | Modernatx, Inc. | Ion exchange purification of mRNA |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US11027025B2 (en) | 2013-07-11 | 2021-06-08 | Modernatx, Inc. | Compositions comprising synthetic polynucleotides encoding CRISPR related proteins and synthetic sgRNAs and methods of use |
| CN114019055A (en) * | 2021-11-09 | 2022-02-08 | 中国科学院城市环境研究所 | Kit for evaluating drug resistance effect of bacterial aminoglycoside antibiotics and application thereof |
| US11377470B2 (en) | 2013-03-15 | 2022-07-05 | Modernatx, Inc. | Ribonucleic acid purification |
| US11434486B2 (en) | 2015-09-17 | 2022-09-06 | Modernatx, Inc. | Polynucleotides containing a morpholino linker |
| US12109274B2 (en) | 2015-09-17 | 2024-10-08 | Modernatx, Inc. | Polynucleotides containing a stabilizing tail region |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10210312B2 (en) * | 2013-02-03 | 2019-02-19 | Youscript Inc. | Systems and methods for quantification and presentation of medical risk arising from unknown factors |
| CN117169207A (en) * | 2022-05-26 | 2023-12-05 | 苏州国科医工科技发展(集团)有限公司 | Rapid drug susceptibility testing method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090324503A1 (en) * | 2006-03-14 | 2009-12-31 | Lewinsohn David M | Methods for detecting a mycobacterium tuberculosis infection |
| WO2011106536A2 (en) * | 2010-02-24 | 2011-09-01 | The Broad Institute, Inc | Methods of diagnosing infectious disease pathogens and their drug sensitivity |
Family Cites Families (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0499003A1 (en) * | 1991-02-14 | 1992-08-19 | N.V. Innogenetics S.A. | Polypeptides and peptides, particularly recombinant polypeptides and peptides, nucleic acids coding for the same and use of these polypeptides and peptides in the diagnosis of tuberculosis |
| US5834279A (en) * | 1996-03-07 | 1998-11-10 | Trustees Of The University Of Pennsylvania | Methods of identifying compounds that inhibit DNA synthesis in mycobacterium tuberculosis and compositions, reagents and kits for performing the same |
| US5968524A (en) * | 1997-12-23 | 1999-10-19 | Genesis Research & Development Corp. | Methods and compounds for the treatment of immunologically-mediated psoriasis |
| WO2002004018A2 (en) * | 2000-07-10 | 2002-01-17 | Colorado State University Research Foundation | Mid-life vaccine and methods for boosting anti-mycobacterial immunity |
| US20040121322A9 (en) * | 2001-02-22 | 2004-06-24 | Cole Stewart T. | Comparative mycobacterial genomics as a tool for identifying targets for the diagnosis, prophylaxis or treatment of mycobacterioses |
| JP2005508613A (en) * | 2001-07-04 | 2005-04-07 | ヘルス プロテクション エージェンシー | Mycobacterial antigens expressed during incubation |
| US7074559B2 (en) * | 2002-03-06 | 2006-07-11 | Refents of the University of Minnesota | Mycobacterial diagnostics |
| US20060075522A1 (en) * | 2004-07-31 | 2006-04-06 | Jaclyn Cleveland | Genes and uses for plant improvement |
| DK2457926T3 (en) * | 2005-04-29 | 2015-01-05 | Glaxosmithkline Biolog Sa | New method for the prevention or treatment of M. tuberculosis infection |
| BRPI0809926B8 (en) * | 2007-04-04 | 2021-05-25 | Infectious Disease Res Inst | composition comprising antigens from mycobacterium tuberculosis, isolated fusion polypeptide, isolated polynucleotide encoding said polypeptide, and use of said composition to stimulate a protective immune response |
| US20100015171A1 (en) * | 2008-07-15 | 2010-01-21 | Statens Serum Institute | Vaccines comprising tb 10.4 |
| CA2731549C (en) * | 2008-07-25 | 2018-07-17 | Glaxo Group Limited | Compositions and methods for treating tuberculosis |
| WO2010010178A1 (en) * | 2008-07-25 | 2010-01-28 | Glaxosmithkline Biologicals S.A | The tuberculosis rv2707c protein, compositions and uses thereof |
| AU2009273132B2 (en) * | 2008-07-25 | 2015-09-03 | Glaxo Group Limited | The tuberculosis Rv2386c protein, compositions and uses thereof |
| WO2013090897A1 (en) * | 2011-12-15 | 2013-06-20 | The Trustees Of The University Of Pennsylvania | Using adaptive immunity to detect drug resistance |
| EP2812704A4 (en) * | 2012-02-07 | 2016-03-23 | Intuitive Biosciences Inc | KOCH BACILLUS SPECIFIC PEPTIDES FOR THE DETECTION OF INFECTION OR IMMUNIZATION IN NON-HUMAN PRIMATES |
| GB201213567D0 (en) * | 2012-07-31 | 2012-09-12 | Proteinlogic Ltd | Biomarkers |
| US8877452B2 (en) * | 2013-02-27 | 2014-11-04 | Council Of Scientific And Industrial Research | Nitrite-reductase (NIRB) as potential anti-tubercular target and a method to detect the severity of tuberculosis disease |
-
2012
- 2012-12-17 WO PCT/US2012/070092 patent/WO2013090897A1/en not_active Ceased
- 2012-12-17 US US14/365,479 patent/US20140349320A1/en not_active Abandoned
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090324503A1 (en) * | 2006-03-14 | 2009-12-31 | Lewinsohn David M | Methods for detecting a mycobacterium tuberculosis infection |
| WO2011106536A2 (en) * | 2010-02-24 | 2011-09-01 | The Broad Institute, Inc | Methods of diagnosing infectious disease pathogens and their drug sensitivity |
Non-Patent Citations (2)
| Title |
|---|
| COLE, ST ET AL.: "Deciphering The Biology Of Mycobacterium Tuberculosis From The Complete Genome Sequence.", NATURE., vol. 393, 11 June 1998 (1998-06-11), pages 537 - 544, XP002149766 * |
| CONTENT, J ET AL.: "The Genes Coding For The Antigen 85 Complexes Of Mycobacterium Tuberculosis And Mycobacterium Bovis BCG Are Members Of A Gene Family: Cloning, Sequence Determination, And Genomic Organization Of The Gene Coding For Antigen 85-C Of M. Tuberculosis.", INFECTION AND IMMUNITY., vol. 59, no. 9, 11 June 1991 (1991-06-11), pages 3205 - 3212, XP000572205 * |
Cited By (78)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9447164B2 (en) | 2010-08-06 | 2016-09-20 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US8822663B2 (en) | 2010-08-06 | 2014-09-02 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9937233B2 (en) | 2010-08-06 | 2018-04-10 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9181319B2 (en) | 2010-08-06 | 2015-11-10 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US10064959B2 (en) | 2010-10-01 | 2018-09-04 | Modernatx, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9334328B2 (en) | 2010-10-01 | 2016-05-10 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US9657295B2 (en) | 2010-10-01 | 2017-05-23 | Modernatx, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US12502431B2 (en) | 2011-03-31 | 2025-12-23 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9950068B2 (en) | 2011-03-31 | 2018-04-24 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US12364763B2 (en) | 2011-03-31 | 2025-07-22 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US11911474B2 (en) | 2011-03-31 | 2024-02-27 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US10898574B2 (en) | 2011-03-31 | 2021-01-26 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US8710200B2 (en) | 2011-03-31 | 2014-04-29 | Moderna Therapeutics, Inc. | Engineered nucleic acids encoding a modified erythropoietin and their expression |
| US12419957B2 (en) | 2011-03-31 | 2025-09-23 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US9533047B2 (en) | 2011-03-31 | 2017-01-03 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US12409226B2 (en) | 2011-03-31 | 2025-09-09 | Modernatx, Inc. | Delivery and formulation of engineered nucleic acids |
| US10022425B2 (en) | 2011-09-12 | 2018-07-17 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US10751386B2 (en) | 2011-09-12 | 2020-08-25 | Modernatx, Inc. | Engineered nucleic acids and methods of use thereof |
| US9464124B2 (en) | 2011-09-12 | 2016-10-11 | Moderna Therapeutics, Inc. | Engineered nucleic acids and methods of use thereof |
| US9428535B2 (en) | 2011-10-03 | 2016-08-30 | Moderna Therapeutics, Inc. | Modified nucleosides, nucleotides, and nucleic acids, and uses thereof |
| US20140349320A1 (en) * | 2011-12-15 | 2014-11-27 | The Trustees Of The University Of Pennsylvania | Using Adaptive Immunity to Detect Drug Resistance |
| US9186372B2 (en) | 2011-12-16 | 2015-11-17 | Moderna Therapeutics, Inc. | Split dose administration |
| US8754062B2 (en) | 2011-12-16 | 2014-06-17 | Moderna Therapeutics, Inc. | DLIN-KC2-DMA lipid nanoparticle delivery of modified polynucleotides |
| US8664194B2 (en) | 2011-12-16 | 2014-03-04 | Moderna Therapeutics, Inc. | Method for producing a protein of interest in a primate |
| US9295689B2 (en) | 2011-12-16 | 2016-03-29 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US9271996B2 (en) | 2011-12-16 | 2016-03-01 | Moderna Therapeutics, Inc. | Formulation and delivery of PLGA microspheres |
| US8680069B2 (en) | 2011-12-16 | 2014-03-25 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of G-CSF |
| US9675668B2 (en) | 2012-04-02 | 2017-06-13 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding hepatitis A virus cellular receptor 2 |
| US9878056B2 (en) | 2012-04-02 | 2018-01-30 | Modernatx, Inc. | Modified polynucleotides for the production of cosmetic proteins and peptides |
| US9303079B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9283287B2 (en) | 2012-04-02 | 2016-03-15 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of nuclear proteins |
| US9255129B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding SIAH E3 ubiquitin protein ligase 1 |
| US9254311B2 (en) | 2012-04-02 | 2016-02-09 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins |
| US9233141B2 (en) | 2012-04-02 | 2016-01-12 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9220755B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of proteins associated with blood and lymphatic disorders |
| US9572897B2 (en) | 2012-04-02 | 2017-02-21 | Modernatx, Inc. | Modified polynucleotides for the production of cytoplasmic and cytoskeletal proteins |
| US9587003B2 (en) | 2012-04-02 | 2017-03-07 | Modernatx, Inc. | Modified polynucleotides for the production of oncology-related proteins and peptides |
| US10703789B2 (en) | 2012-04-02 | 2020-07-07 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9220792B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aquaporin-5 |
| US9221891B2 (en) | 2012-04-02 | 2015-12-29 | Moderna Therapeutics, Inc. | In vivo production of proteins |
| US9782462B2 (en) | 2012-04-02 | 2017-10-10 | Modernatx, Inc. | Modified polynucleotides for the production of proteins associated with human disease |
| US9814760B2 (en) | 2012-04-02 | 2017-11-14 | Modernatx, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9828416B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9827332B2 (en) | 2012-04-02 | 2017-11-28 | Modernatx, Inc. | Modified polynucleotides for the production of proteins |
| US9107886B2 (en) | 2012-04-02 | 2015-08-18 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding basic helix-loop-helix family member E41 |
| US9216205B2 (en) | 2012-04-02 | 2015-12-22 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding granulysin |
| US9192651B2 (en) | 2012-04-02 | 2015-11-24 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9149506B2 (en) | 2012-04-02 | 2015-10-06 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding septin-4 |
| US9114113B2 (en) | 2012-04-02 | 2015-08-25 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding citeD4 |
| US8999380B2 (en) | 2012-04-02 | 2015-04-07 | Moderna Therapeutics, Inc. | Modified polynucleotides for the production of biologics and proteins associated with human disease |
| US9050297B2 (en) | 2012-04-02 | 2015-06-09 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding aryl hydrocarbon receptor nuclear translocator |
| US9061059B2 (en) | 2012-04-02 | 2015-06-23 | Moderna Therapeutics, Inc. | Modified polynucleotides for treating protein deficiency |
| US9089604B2 (en) | 2012-04-02 | 2015-07-28 | Moderna Therapeutics, Inc. | Modified polynucleotides for treating galactosylceramidase protein deficiency |
| US10385106B2 (en) | 2012-04-02 | 2019-08-20 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US9095552B2 (en) | 2012-04-02 | 2015-08-04 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding copper metabolism (MURR1) domain containing 1 |
| US9301993B2 (en) | 2012-04-02 | 2016-04-05 | Moderna Therapeutics, Inc. | Modified polynucleotides encoding apoptosis inducing factor 1 |
| US10501512B2 (en) | 2012-04-02 | 2019-12-10 | Modernatx, Inc. | Modified polynucleotides |
| US10577403B2 (en) | 2012-04-02 | 2020-03-03 | Modernatx, Inc. | Modified polynucleotides for the production of secreted proteins |
| US10772975B2 (en) | 2012-04-02 | 2020-09-15 | Modernatx, Inc. | Modified Polynucleotides for the production of biologics and proteins associated with human disease |
| US9597380B2 (en) | 2012-11-26 | 2017-03-21 | Modernatx, Inc. | Terminally modified RNA |
| US10858647B2 (en) | 2013-03-15 | 2020-12-08 | Modernatx, Inc. | Removal of DNA fragments in mRNA production process |
| US11377470B2 (en) | 2013-03-15 | 2022-07-05 | Modernatx, Inc. | Ribonucleic acid purification |
| US8980864B2 (en) | 2013-03-15 | 2015-03-17 | Moderna Therapeutics, Inc. | Compositions and methods of altering cholesterol levels |
| US10077439B2 (en) | 2013-03-15 | 2018-09-18 | Modernatx, Inc. | Removal of DNA fragments in mRNA production process |
| US10138507B2 (en) | 2013-03-15 | 2018-11-27 | Modernatx, Inc. | Manufacturing methods for production of RNA transcripts |
| US10590161B2 (en) | 2013-03-15 | 2020-03-17 | Modernatx, Inc. | Ion exchange purification of mRNA |
| US11845772B2 (en) | 2013-03-15 | 2023-12-19 | Modernatx, Inc. | Ribonucleic acid purification |
| US11027025B2 (en) | 2013-07-11 | 2021-06-08 | Modernatx, Inc. | Compositions comprising synthetic polynucleotides encoding CRISPR related proteins and synthetic sgRNAs and methods of use |
| US10815291B2 (en) | 2013-09-30 | 2020-10-27 | Modernatx, Inc. | Polynucleotides encoding immune modulating polypeptides |
| US10385088B2 (en) | 2013-10-02 | 2019-08-20 | Modernatx, Inc. | Polynucleotide molecules and uses thereof |
| US10323076B2 (en) | 2013-10-03 | 2019-06-18 | Modernatx, Inc. | Polynucleotides encoding low density lipoprotein receptor |
| US10286086B2 (en) | 2014-06-19 | 2019-05-14 | Modernatx, Inc. | Alternative nucleic acid molecules and uses thereof |
| US10407683B2 (en) | 2014-07-16 | 2019-09-10 | Modernatx, Inc. | Circular polynucleotides |
| US11434486B2 (en) | 2015-09-17 | 2022-09-06 | Modernatx, Inc. | Polynucleotides containing a morpholino linker |
| US12071620B2 (en) | 2015-09-17 | 2024-08-27 | Modernatx, Inc. | Polynucleotides containing a morpholino linker |
| US12109274B2 (en) | 2015-09-17 | 2024-10-08 | Modernatx, Inc. | Polynucleotides containing a stabilizing tail region |
| CN114019055A (en) * | 2021-11-09 | 2022-02-08 | 中国科学院城市环境研究所 | Kit for evaluating drug resistance effect of bacterial aminoglycoside antibiotics and application thereof |
| CN114019055B (en) * | 2021-11-09 | 2024-03-01 | 中国科学院城市环境研究所 | Kit for evaluating bacterial aminoglycoside antibiotic resistance and its application |
Also Published As
| Publication number | Publication date |
|---|---|
| US20140349320A1 (en) | 2014-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20140349320A1 (en) | Using Adaptive Immunity to Detect Drug Resistance | |
| Bisson et al. | Upregulation of the phthiocerol dimycocerosate biosynthetic pathway by rifampin-resistant, rpoB mutant Mycobacterium tuberculosis | |
| US9040233B2 (en) | Methods for detecting a Mycobacterium tuberculosis infection | |
| US6506384B1 (en) | Early detection of mycobacterial disease | |
| US20200148729A1 (en) | Compositions and Methods for Treating Secondary Tuberculosis and Nontuberculosis Mycobacterium Infections | |
| Yorozu et al. | Propionibacterium acnes catalase induces increased Th1 immune response in sarcoidosis patients | |
| US7745141B2 (en) | Mycobacterial proteins as early antigens for serodiagnosis and vaccines | |
| Alvarez-Corrales et al. | Differential cellular recognition pattern to M. tuberculosis targets defined by IFN-γ and IL-17 production in blood from TB+ patients from Honduras as compared to health care workers: TB and immune responses in patients from Honduras | |
| JP6698530B2 (en) | Diagnostic reagents for improving in vivo or in vitro cell-mediated immunological diagnosis of tuberculosis | |
| Wen et al. | Involvement of methylated HBHA expressed from Mycobacterium smegmatis in an IFN-γ release assay to aid discrimination between latent infection and active tuberculosis in BCG-vaccinated populations | |
| Xiao et al. | Adenylate kinase: a novel antigen for immunodiagnosis and subunit vaccine against tuberculosis | |
| US8105797B2 (en) | Diagnostic test | |
| Tan et al. | High level of IFN-γ released from whole blood of human tuberculosis infections following stimulation with Rv2073c of Mycobacterium tuberculosis | |
| Burns et al. | The novel duodenal isolate streptococcus salivarius AGIRA0003 promotes barrier dysfunction and IgG responses in functional dyspepsia | |
| Chedid | Novel Immune Biomarkers for Pulmonary Tuberculosis Treatment Monitoring: a Multicentered study in Moderate-and High-Incidence Settings | |
| Alnwaisri | Inflammation, infections and immunity | |
| Fitzgerald | Characterization and quantification of urinary metabolic biomarkers for early response to anti-tuberculosis treatment | |
| CN106442983A (en) | Application of antigen protein Rv3793 of mycobacterium tuberculosis and T-cell epitope peptide thereof | |
| Zhang et al. | Serodiagnostic value of 23 Mycobacterium tuberculosis proteins and a novel protein combination | |
| Zhang et al. | Proteomic progress in studying tuberculosis from 2010 to 2011 | |
| Coppola et al. | General introduction and thesis outline | |
| Petruccioli | Translational tuberculosis research: immune profile as biomarker of tuberculosis infection | |
| KATO et al. | USEFULNESS OF MYCOBACTERIUM TUBERCULOSIS-SPECIFIC ENZYME-LINKED IMMUNOSPOT ASSAY FOR THE DIAGNOSIS OF TUBERCULOUS PLEURISY | |
| Pickering | Identification of Chlamydia trachomatis Immune Targets through Immunological and Population-Genomic Screens and Elucidation of Potential Roles in Bacterial Pathogenesis. | |
| Mehaffy | Proteomic and biological diversity of closely related clinical isolates of Mycobacterium tuberculosis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 12857318 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 12857318 Country of ref document: EP Kind code of ref document: A1 |








