WO2013082487A1 - Afsc based therapies - Google Patents

Abstract

The present invention relates generally to amniotic fluid stem cells and methods of isolating and uses thereof. The invention is further directed to preventing and treating lung diseases and CCL2/CCR2 mediated diseases.

Description

AFSC BASED THERAPIES

Priority Application(s)

This applicatior! claims the benefit of priority under 35 U.S.C. § 1 19(e) to U.S. Provisional Application No. 61,565,217, filed November 30, 201 1, entitled "Lung Progenitor Cell Based Therapy " which is incorporated herein by reference in its entirety.

Government Funding

The invention described herein was developed with support from the National Institutes of Health grant number NiGMS 3R01 GM096195. The U.S. Government has certain rights in the invention.

Field of the Invention

This invention relates to the field of stem ceils obtained from amniotic fluid and methods of isolation, culture, differentiation and use thereof,

B¾ekgro md of the Invention

When you breathe, your lungs take in oxygen from the air and deliver it to the bloodstream. The cells in your body need oxygen to work and grow. During a normal day, you breathe nearly 25,000 times. People with lung disease have difficulty breathing. Millions of people in the U.S. have lung disease. If all types of lung disease were to be lumped together, then lung disease is the number three killer in the United States.

The term lung disease refers to many disorders affecting the lungs, such as asthma, chronic obstructive pulmonary disease, infections like influenza, pneumonia and tuberculosis, lung cancer, and many other breathing problems.

Many diseases, including some lung diseases and psoriasis, rheumatoid arthritis and atherosclerosis, can be characterized as CC cliemokine receptor- 2/CC chemokine ligand 2 (CCL2/CCR2) mediated inflammatory syndromes and/or diseases. CCR2 belongs to the G-protein-coupled seven-transmembrane receptor superfamily. Summary of the Invention

Applicants have characterized the amniotic fluid total cell population focusing on cells from the three germ layers and on stem and progenitor cells for organs by following their presence over time and investigating the variations in cellular amniotic composition occurring during pregnancy.

One embodiment provides a method to treat a CCL2. and/or a CCR2 mediated disease (increased CCL2 expression, as compared to a control subject, promotes various diseases states (i.e. fibrosis, macrophage activation, increased inflammation). Increased CCL2 concentrations can be predictive of disease state and severity in many CCL2 associated diseases.) administering to a subject in need thereof an effective amount of amniotic fluid stem cells (AFSCs) effective to treat the CCL2 and/or CCR2 mediated disease, wherein the AFSCs are positive for e-kit. In one embodiment, the CCL2. and/or CCR2 mediated disease is rheumatoid arthritis (RA), multiple sclerosis (MS), chronic obstructive pulmonary disorder (COPD), atherosclerosis, delayed type hypersensitivity, autoimmune encephalomyelitis, inflammatory arthritis, lupus nephritis, chronic inflammatory diseases, metabolic disease, neuropathic pain, insulin resistance, autoimmune disease, inflammatory disease (such as vascular restenosis), HIV, transplant rejection, and/or cardiovascular disease.

Another embodiment provides a method to treat lung disease or injury comprising administering to a subject in need thereof an effective amount of amniotic fluid stem cells (AFSCs) effective to treat the lung disease or injury, wherein the AFSCs are positive for e-kit. In one embodiment, the lung disease comprises acute respiratory distress syndrome (ARDS), infant respiratory distress syndrome (TRDS), asbestosis, asthma, bronchiectasis, bronchiolitis, bronchopulmonary dysplasia, chronic bronchitis, coccidiodomycosis (Cocci), emphysema, acute and/or chronic bronchitis, cystic fibrosis, diffuse interstiiial fibrosis, hantavirus pulmonary syndrome, histoplasmosis, human

metapneumovirus, hypersensitivity pneumonitis , influenza, lung cancer, lymphangiomatosis, nontuberculosis mycobacterium, pertussis, pneumoconiosis, pneumonia, primary ciliary dyskinesia, primary pulmonary hypertension, pulmonary arterial hypertension, cavitary pneumonia, pulmonary fibrosis, pulmonary vascular disease, respiratory syncytial virus, sarcoidosis, severe acute respiratory syndrome, silicosis, sleep apnea, sudden infant death syndrome, tuberculosis, and/or chronic obstructive pulmonary disease (COPD).

In one embodiment, the injury is a result of physical trauma, accident, surgery, smoking, inhaling of harmful chemicals or contaminants, or injury caused by a pathogen (e.g., bacterial or viral).

One embodiment provides an isolated and purified population of amniotic fluid stem cells positive for c-kit for use in treating lung disease or a CCL2 and^'or a CCR2 mediated disease. Another embodiment provides an isolated and purified population of amniotic fluid stems cells positive for c-kit to prepare a medicament for treating lung disease or CCL2. and/or a CCR2 mediated disease, in one embodiment, the medicament includes a

physiologically acceptable carrier and'or cell culture medium.

In one embodiment, the subject is a mammal, such as a human. In another embodiment, the cells are administered by local or systemic injection.

Figures I A-E depict qPCR characterization of five distinct mouse amniotic fluid cell lines, identified as mAF 1 -5, for alveolar epithelial cell markers. Pulmonaiy epithelial ceil markers test for: SP-A, SP-B, SP-C, SP-D, TTF-1/NKX2-1, CC10, AQP5 and Tl a/PDPN. 18s was used as an internal control/housekeeping gene. All five fines were positive for Tl a PDPN, TTF- 1/NKX2-1 and AQP5, indicative of type I pulmonaiy epithelial cell lineage. All five lines were negative for SP-A, SP-B, SP-C, SP-D and CC10, indicative of type II pulmonary epithelial and clara cell lineages. Low levels of SP-B were detected. Figure F depicts ACT calculated based on 18s gene expression. Lower values indicate higher expression.

Figure 2. Agarose gel electrophoresis of qPCR results demonstrates Tl a/PDPN and AQP5 presence and absence of SP-B and SP-C expression in all 5 mAF cell lines. All gels: lane 1 -mAFl , lane 2-mAF2, lane 3-mAF3, lane 4- mAF4, lane 5-mAF5, lane 6-positive control (+).

Figure 3 depicts 20X and 40X magnification of all five mAF lines which were stained for type Ϊ pulmonary alveolar epithelial cell markers TTF-I/NKX2- l, Ti /PDPN and AQP5 and type II pulmonary alveolar epithelial cell marker Pro SP-C. All five liens stamed positive for TTF-1/NKX2-1, Tla/PDP and AQP5 and negative for Pro SP-C.

Figures 4A-D depict 4X magnification of adult mouse lung tissue embedded in paraffin stained with Sirius red for collagen visualization. All collagen types-red; noneollagenous tissue-green/biue. A) Areas of subpieural fibrosis at day 28-post bleomycin induced fibrosis marked with arrows. B) Saline injected lung with 1 x 10⁶ AFSC transplanted via intravenous 0 days post saline injection. Histological analysis performed on day 28 post saline injection. No fibrosis from saline or AFSC transplant visualized. C) Bleomycin injected lung with AFSC transplant 2 hours post bleomycin treatment. Sacrificed at day 28-post bleomycin treatment. No fibrosis visualized. D) Bleomycin injected lung with AFSC transplant 14 days post bleomycin treatment. Small area of subpieural fibrosis is visualized (arrow).

Figure 5 depicts 10X and 40X magnification of adult mouse lung tissue embedded in paraffin and stained DAPL Transplanted AFSC labeled with CM- Dil are shown in red. When examined via immunofluorescence, lungs exhibiting fibrotic lesions displayed a higher retention of AFSC. Furthermore, transplanted CM-Dil labeled AFSC demonstrated a higher retention in tissue when transplanted two hours post bleomycin, 0.58% CM-Dil positive cells per section vs. 0.17% CM-Dil positive ceils per section in cohorts transplanted at 14 days post bleomycin injury (not pictured).

Figures 6A-D demonstrates that IV administration of AFSC inhibits fibrotic alveolar and parenchymal remodeling when injected during either acute or chronic periods following bleomycin induced lung injury. (A) IV AFSC injection was administered during either the acute period, 2 hours post- bieomycin injury, or during the chronic fibrotic remodeling period, 14 days posibieomycin injury. Lungs were studied at day 28 post -.-bleomycin injury to visualize the full extent of fibrotic remodeling. (B) Histological analysis of adult mouse lung tissue embedded in paraffin stained with Sirius Red/FCF Green, for collagen visualization examined at 10X and 20X. Ail collagen types-red: noneollagenous tissue-greeiv bJue. (C) Ashcroft scoring of histological sections from bieomycin-injured mice. Distributions are presented as box plots with lines at the lower quartile, median and upper quartile, whiskers are representative of the minimum and maximums excluding outliers, dots are representative of outliers. (D) The measurement of total collagen content, as quantified by the

hydroxyproline a ssay, was used to determine the amount of collagen present within the total lungs of the experimental cohorts. Distributions are presented as dot plots with fines indicating median values,

Figures 7A-D demonstrate that IV administration of AFSC attenuates loss of pulmonary function when injected during either acute or chronic periods following bleomycin induced lung injury. (A) Pressure-volume loops, describing the mechanical behavior of the lungs and chest wall during inflation and deflation (B) Area of hysteresis as calculated v ia the Saiazar-Knowies equation, (C) Forced vital capacity. (D) Quasi-static compliance.

Figures 8A-G demonstrate that IV AFSC treatment modulates the acute inflammatory cytokine milieu in both BAL and tissue following bleomycin induced lung injur . Samples from BAL extracts (A) and whole lung homogenates (B) were analyzed via protein array to determine their acute inflammatory profiles. (C) CCL2 concentration in BAL quantified by ELISA during acute inflammation, 3 days post-bleomycin injury. (D) CCL2 concentration in BAL quantified by ELISA. during the chronic injury period, 28 days post-bleomycin injury. (E) In vitro assay to determine the direct effect of varying concentrations of recombinant CCL2 on 3T3 fibroblast collagen synthesis. (F) Collagen synthesis induced in 3T3 fibroblasts following exposure to in vivo acute BAL samples. (G) Collagen synthesis induced in 3T3 fibroblasts following exposure to in vivo chronic BAL samples.

Figures 9A-E demonstrate that AFSC modulate AECII secreted CCL2 in BAL through proteolytic cleavage by transient MMP2 expression. (A-B) Representative Western blots of 2Cu.g B L and AECII cellular protein from control, day 3 and day 28 post-bleomycin injury lungs. (C) Representative Bis- Tris SDS-PAGE analysis of AECII fractions from control, bleomycin- injured and bleomycin-injured with AFSC treatment at 2 hours post-bleomycin, harvested at day 3, demonstrated a subtle 0.4 KDa shift of CCL2 to a putative inhibitory form. (D) Representative gelatin zymography of 20,ug BAL fluid from control, bleomycin-injured and bleomycin-injured with AFSC treatment at 2 hours post-bleomycin, harvested at day 3 (E) Representative gelatin zymography of l0μg control, bleomycin-injured and bleomycin-injured with AFSC treatment harvesied at day three as compared to BAL fractions from animals harvested at 28 days postbleomycin injury (receiving AFSC at either day 0 or day 14 post- bieomyein injury), demonstrates transient nature of MMP2 increase.

Figures 10A-F demonstrate that AFSC are retained within fibrotic lesions and migrate toward increased CCL2 concentrations. (A) Sections from lungs injured with bleomycin and injected with CM-Dil labeled AFSC, stained with Sirius Red/FCF Green and DAP! and visualized at lOx show increased retention of AFSC within fibrotic lesions (arrows). (B) Cultured murine AFSC express CCR2, the cognate receptor for CCL2, visualized by immunofluorescence, prior to injection. (C) Murine AFSC migrate toward a recombinant CCL2 gradient. (D) Migration elicited by CCL2 in human AFSC toward recombinant CCL2. (E) AFSC migration toward BAL harvested at day 3 from control, bleomycin- injured versus bleomycin-injured with AFSC treatment at day 0, assayed for the ability to chemoattract AFSC (gray boxes). Migration toward BAL with CCL2 neutralized using a neutralizing antibody (Nab) elicited a diminished migratory response in AFSC (hashed boxes). Distributions are presented as box plots with lines at the lower quartile, median and upper quartile, whiskers are representative of the minimum and maximums excluding outliers, dots are representative of outliers. (F) AFSC migration toward BAL samples harvested at the 28 day time point having either received no treatment, or treatment at days 0 or 14.

Distributions are presented as box plots with lines at the lower quartile, median and upper quartile, whiskers are representative of the minimum and maximums excluding outliers, dots are representative of outliers.

Figures 1 1A-D demonstrate that in vitro AFSC co-culture with in vivo injured AECII recapitulates in vivo CCL2 regulation. (A) Bright field microscopy of in vivo sham and bleomycin-injured AECII at 3 days post-injury cultured with and without AFSC. Scale bar =200um. (B) Phase contrast microscopy of in vivo injured AECII co-cultured with CM-Dil stained (red) AFSC visualized via fluorescence microscopy. Scale bar =1 OGum. (C) In vitro levels of CCL2 in conditioned media as measured by ELISA. (D) Effect of conditioned media from in vitro AFSC co-culture experiments on induction of 3T3 collagen synthesis. (E) CCL2 and CCR2 cellular mR A levels as determined by qPCR. (F) MMP2 cellular mRNA levels as determined by qPCR, Figures 12A-C demonstrate that inhibition of MMP2 in vitro inhibits the ability of AFSC to reduce CCL2 levels following AECII bleomycin injury. (A) CCL2 ELISA of conditioned media from in vitro injury of AECII with 100 mU/nil of bleomycin with AF^'SC co-culture with and without the addition of an MMP2 inhibitor, (B) qPCR analysis of CCL2 and CCR2 cellular mRNA, (C) qPCR analysis of MMP2 cellular mRNA levels.

Figures 13A-D depict AFSC modulation of the acute inflammatory cytokine milieu in both BAL and tissue following bleomycin induced lung injury, (A) Table of all cytokine modulations detected in BAL. (B) Graph of samples from BAL extracts that were moderately, but not statistically significantly modulated. (C) Table containing all cytokine modulations detected in tissue homogenates. (D) Graph of samples from tissue homogenates that were moderately, but not statistically significantly modulated.

Figures 14A-D depict AFSC modulation of the acute inflammatory cellular populations in BAL following bleomycin induced lung injury. (A) Total cell count modulations detected in BAL. (B) Differential BAL macrophage analysis. (C) Differential BAL lymphocyte analysis. (D) Differential BAL neutrophil analysis. Distributions for B-D are presented as box plots with lines at the lower quartile, median and upper quartile, whiskers are representative of the minimum and maximum excluding outliers.

Figure 15 depicts in vitro AFSC co-culture with in vivo injured AECII ΉΜΡ cellular mRNA levels as determined by qPCR.

Figure 16 depicts the effect of MMP2 inhibition in vitro AFSC co-culture with in vitro injured AECII TIMP cellular mRNA levels as determined by qPCR.

Figure 17: qPCR analysis expressed as relative mRNA. expression for lineage markers in all 5 hAFSC lines. Aliquots of clones derived from a single samples of amniotic fluid, as described previously, from 5 different hAFSC isolations were tested for various markers characteristic of lung epithelial development, type I alveolar epithelia, type II alveolar epithelia, stem and Clara cell lineages. Expression profiles indicate the presence of pulmonary epithelial and stem cell lineages as demonstrated by expression of FoxPI (A), FoxA2 (B), ABCA3 (C), AQP5 (D), PDPN/Tl (E), Sca-1 (F). Lines 14, 6, 1 and 13 expressed FoxPI mRNA at comparable levels, with increased expression in line 21. Fox A2 was mRNA expression was low in all lines except line 13 which demonstrated high levels of FoxA2 mRNA expression. ABCA3 mRNA expression increased as the age of gestation at cell harvest increased. AQP5 was expressed ai low levels in all lines except line 1 , which demonstrated markedly increased AQP5 mRNA. PDPN/ Tl a mR A expression was increased in lines 6 and 21. Finally, Sca- 1 mRNA expression was expressed at comparable levels in all lines examined.

Figures 18A-B: Western blot analysis of lung lineage markers. (A) Western blot analysis for FoxP l demonstrates characteristic staining at 70 kDa and -90 kDa (Cell Signaling 1 : 000), FoxA2 48 kDa (Seven Flills 1 :5000), AQP5 28 kDa (ABCAM 1 : 1000) (B) ABCA3 191 kDa (Seven Hills 1 : 1000), PDPN 25 kDa (ABCAM 1 : 1000) and Actin 42 kDA (Cell Signaling i : 1000). Protein analysis via western blot of all 5 hAFSC lines demonstrated comparable expression of FoxPl protein in hAFSC lines 1 , 6 and 21 , increased expression in hAFSC lines 13 and 14. FoxA2, AQP5, ABCA3 and PDPN/T1 a protein levels in all 5 hAFSC lines were expressed at comparable levels when normalized against total protein concentration as demonstrated by actin staining.

Figure 19: Immuno fluorescent staining of lung lineage markers within all 5 hAFSC lines. PDPN (red), FoxPl (green), FoxA2 (green), Sca- 1 (pink, denoted by white arrowhead), AQP5 (green), ABCA3 (green), negative control.

Applicants have characterized the amniotic fluid total cell population focusing on cells from the three germ layers and on stem and progenitor ceils for organs by following their presence over time and investigating the variations in cellular amniotic composition occurring during pregnancy.

Amniotic fluid stem cell (AFSC) treatment inhibits the progression of lung disease which is demonstrated herein by the inhibitions of the progression of bleomycin- induced pulmonary fibrosis, both during acute and chronic fibrotic remodeling events, by preserving pulmonary function and inhibiting excessive collagen deposition. Treatment with AFSCs results in reducing increased levels of CCL2 in bronchoalveolar lavage (BAL) following injury. Furthermore, AFSC chemotaxis toward increased CCL2 concentrations and localization of AFSC with fibrotic tissue were observed, demonstrating that AFSC treatment is therapeutic. Chemokme (C-C motif) ligand 2 (CCL2; Accession Numbers

NM_002982.3 (human mRNA): M_01 1331 ,2 (mouse mRNA); NP_002973.1 (human protein); NP_035461.2 (mouse protein)) is a small cytokine that belongs to the CC chemokine family. CCL2 recruits monocytes, memory T cells, and dendritic ceils to the sites of inflammation produced by either tissue injury or infection. CCL2 is a monomelic polypeptide, with a molecular weight of approximately 13 kDa. CCL2 is anchored in the plasma membrane of endothelial cells by glycosaminoglycan side chains of proteoglycans. CCL2 is primarily secreted by monocytes, macrophages and dendritic cells. CCR2 (Accession Nos. NM_001 123041.2 (human m^'R A) ; NM_009915.2 (mouse mRNA); NP_001 1 16513.2 (human protein); NP_034045.1 (mouse protein)) and

CCR4 are two cell surface receptors that bind CCL2.

Definitions

As used herein, the terms below are defined by the following meanings: The terms "isolated" or an "enriched population" refers to a ceil or cells which are not associated with one or more cells or one or more cellular components that are associated with the cell or cells in vivo.

A "subject" is a vertebrate, such as a mammal, including a human. Mammals include, but are not limited to, humans, farm animals, sport animals and companion animals. Included in the term "animal" is dog, cat, fish, gerbil, guinea pig, hamster, horse, rabbit, swine, mouse, monkey (e.g., ape, gorilla, chimpanzee, and orangutan) rat, sheep, goat, cow and bird. Subjects that can benefit from the ceils and methods of the invention include, but are not limited to, those suffering from a loss of function of lung cells as a result of physical, genetic or disease related damage.

An "effective amount" generally means an amount which provides the desired local or systemic effect and/or performance, particularly for treating a condition of interest. For example, an effective dose is an amount sufficient to affect a beneficial or desired clinical result. Said dose could be administered in one or more administrations and could include any preselected amount of ceils. The precise determination of what would be considered an effective dose may be based on factors individual to each subject, including their size, age, size of the damage, and amount of time since the damage occurred or the disease began. One skilled in the art, specifically a physician, would be able to determine the number of cells that would constitute an effective dose.

"Expansion" refers to the propagation of ceils without differentiation. "Lung function" generally refers to a physiological property of the lung - how well the lungs are working. Lung function tests (also called pulmonary function tests, or PFTs) check ho well lungs work. The tests determine ho much air lungs can hold, how quickly one can move air in and out of lungs (e.g., spirometry), and how well the lungs put oxygen into and remove carbon dioxide from blood. The tests can diagnose lung diseases, measure the severity of lung problems, and check to see how well treatment for a lung disease is working. Other tests-such as residual volume, gas diffusion tests (e.g., aterial blood gases), body plethysmography, inhalation challenge tests, and exercise stress tests-may also be done to determine lung function.

"Self-renewal" refers to the ability to produce replicate daughter ceils having differentiation potential that is identical to those from which they arose. A similar term used in this context is "proliferation."

As used herein, "treat," "treating" or "treatment" includes treating, reversing, preventing, ameliorating, or inhibiting an injury or disease-related condition or a symptom of an injury or disease-related condition.

"Co-administer" can include simultaneous and/or sequential

administration of two or more agents/cell types.

The terms "comprises," "comprising," and the like can have the meaning ascribed to them in U.S. Patent Law and can mean "includes," "including" and the like. As used herein, "including" or "includes" or the like means including, without limitation.

Isolation, Growth and Characterization of Amniotic Fluid Stem Cells

The present invention relates to an isolated and purified population of amniotic fluid stem cells (AFSC) and methods of their use in treating, diseases, including lung disease and CCL2/CCR2 mediated diseases. AFSCs are characterized by the expression of the receptor for stem cell factor c-kit. AFSC are multipotent, showing the ability to differentiate into lineages belonging to all three germ layers, can be propagated easily in vitro without the need of a feeder layer. The ceils may also express CD29, CD44, CD90, CD 105, CD73, Oct-4, SSEA-4 or a combination thereof. The cells are negative for CD45, CD34 and CD133. Further isolation, growth and characterization of are discussed in detail in the Examples below.

In addition to the information provided in the Examples, during and after isolation, the amniotic fluid stem cells of the invention can be cultured in culture medium that is well established in the art and commercially available from the American Type Culture Collection (A^'T^'CC). Such media include, but are not limited to, Dulbec o's Modified Eagle's Medium (DMEM), DMEM F12 medium, Eagle's Minimum Essential Medium, F-12K medium, Iscove's Modified Dulbeceo's Medium, or RPMI-1640 medium. It is within ihe skill of one in the art to modify or modulate concentrations of media and/or media supplements as needed for the cells used. It will also be apparent that many media are available as low-glucose formulations, with or without sodium pyruvate.

Also contemplated is supplementation of cell culture medium with mammalian sera. Sera often contain cellular factors and components that are necessary for viability and expansion. Examples of sera include fetal bovine serum (FBS), bovine serum (BS), calf serum (CS), fetal calf serum (FCS), newborn calf serum (NCS), goat serum (GS), horse serum (HS), human serum, chicken serum, porcine serum, sheep serum, rabbit serum, rat serum (RS), serum replacements, and bovine embryonic fluid. It is understood that sera can be heat- inactivated at 55-65°C if deemed necessary to inactivate components of the complement cascade. Modulation of serum concentrations, or withdrawal of serum from the culture medium can also be used to promote survival of one or more desired cell types. In one embodiment, the amniotic fluid progenitor cells are cultured in the presence of FBS /or serum specific for the species cell type. For example, amniotic fluid progenitor cells can be isolated and/or expanded with total serum (e.g., FBS) concentrations of about 0.5% to about 5% or greater including about 5% to about 15%. Concentrations of serum can be determined empirically.

Additional supplements can also be used to supply the cells with trace elements for optimal growth and expansion. Such supplements include insulin, transferrin, sodium selenium, and combinations thereof. These components can be included in a salt solution such as, but not limited to, Hanks' Balanced Salt Solution® (HBSS), Earle's Salt Solution©, antioxidant supplements, MCDB- 201© supplements, phosphate buffered saline (PBS), N-2- hydroxyethylpiperazine-N'-ethanesulfonic acid (HEPES), nicotinamide, ascorbic acid and/or ascorbic acid- 2 -phosphate, as well as additional amino acids. Many cell culture media already contain amino acids; however some require supplementation prior to culturing cells. Such amino acids include, but are not limited to, L-alanine, L-arginine, L-aspartic acid, L-asparagme, L-cysteine, L- cystine, L -glutamic acid, L-glutamine, L-glyeine, L-histidine, L-inositol, L- isoieucine, L-leucine, L-lysine, L-methionine, L-phenylalanine, L-proline, L- serine, L-threonine, L-tryptophan, L-tyrosine, and L-valine.

Antibiotics are also typically used in ceil culture to mitigate bacterial, mycoplasmal, and fungal contamination. Typically, antibiotics or anti-mycotic compounds used are mixtures of penicillin/streptomycin, but can also include, but are not limited to, amphotericin (Fungizone©), ampicillin, geniarnicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tylosin, and zeocin.

Hormones can also be advantageously used in cell culture and include, but are not limited to, D-aldosterone, dietliyistiibestrol (DES), dexametliasone, β-estradioi, hydrocortisone, insulin, prolactin, progesterone, somatostat n/human growth hormone (HGH), thyrotropin, thyroxine, and L-thyronine. β- mercaptoethanol can also be supplemented in cell culture media.

Lipids and lipid carriers can also be used to supplement cell culture media, depending on the type of cell and the fate of the differentiated ceil Such lipids and carriers can include, but are not limited to cyclodextrin (α, β, γ), cholesterol, linoleic acid conjugated to albumin, linoieic acid and oleic acid conjugated to albumin, unconjugated linoleic acid, linoleic-oleic-araehidonic acid conjugated to albumin, oleic acid unconjugated and conjugated to albumin, among others. Albumin can similarly be used in fatty-acid free formulation.

Cells in culture can be maintained either in suspension or attached to a solid support, such as extracellular matrix components and synthetic or biopolymers. Cells often require additional factors that encourage their attachment to a solid support (e.g., attachment factors) such as type I, type II, and type IV collagen, concanavalin A, chondroitin sulfate, fibronectin, "superfibronectin" and/or fibronectin-like polymers, gelatin, laminin, poly-D and poly-L- lysine, Matrigel™, thrombospondin, and/or vitronectin.

The maintenance conditions of ceils can also contain cellular factors that allow cells, such as the amniotic fluid derived lung progenitor cells of the invention, to remain in an undifferentiated form, it may be advantageous under conditions where the cell must remain in an undifferentiated state of self-renewal for the mediu to contain epidermal growth factor (EGF), platelet derived growth factor (PDGF), leukemia inhibitor}/ factor (LIF), basic fibroblast growth factor (bFGF) and combinations thereof. It is apparent to those skilled in the art ihai supplements ihai allo the cell to self-renew (e.g., to produce replicate daughter cells having differentiation potential that is identical to those fro which they arose; a similar term used in this context is "proliferation"), but not differentiate should be removed from the culture medium prior to differentiation, it is also apparent that not all cells will require these factors. In fact, these factors may elicit unwanted effects, depending on the cell type.

Amniotic fluid stem cells of the invention can be selected based on the markers (gene and/or protein) described herein. Accordingly, positive selection methods can be used, either alone or together with the methods described above, to identify and/or isolate the cells of the invention. Methods of positive selection can include visual selection, using microscopy and/or other means of detection, including, but not limited to, immunobiotting, immunofluorescence, and/or enzyme-linked immunosorbent assay. Other methods of positive selection can also include, but are not limited to, additional selective culture techniques (e.g., variable ceil densities or amounts of CO?), flow cytometry, RT-PCR, and/or microchip-based methods of cell separation. Negative selection methods may also be used. inducing Amniotic Fluid Stem cells to Differentiate

Using appropriate growth factors, chemokines and/or cytokines, amniotic fluid stem cells of the invention can be induced to differentiate to form a number of cells. The cells can differentiate in vitro or in vivo after transplantation/administration. Uses for Amniotic Fluid Stem Cells

Amniotic fluid stem cells of the invention can be used for the generation of lung lineages, including but not limited to, non-ciliated bronchiolar cells or Clara Cells, squamous cells (Type 1 cells), great alveolar cells (Type 2 cells) and alveolar macrophages.

Therefore, one embodiment provides methods for providing lung cells, which can include, but are not limited to, non-ciliated bronchiolar cells or Clara Ceils, squamous cells (Type 1 cells), great alveolar cells (Type 2 cells) and alveolar macrophages, comprising differentiating amniotic fluid stem cells of the invention in the presence of differentiation factors and isolating the cells.

Differentiation can occur in vitro, in vivo or ex vivo.

Amniotic fluid stem cells of the invention can benefit from co-culturing with another cell type. Such co-culturing methods arise from the observation that certain cells can supply yet-unidentified cellular factors that allow the cell to differentiate into a specific lineage or cell type. These cellular factors can also induce expression of cell-surface receptors, some of which can be readily identified by monoclonal antibodies. Generally, cells for co-culturing can be selected based on the type of lineage one skilled in the art wishes to induce, and it is within the abilities of the skilled artisan to select the appropriate cells for co- culture.

Methods of identifying and subsequently isolating differentiated cells from their undifferentiated counterparts can be carried out by methods well known in the art. Cells that have been induced to differentiate can be identified by selectively culturing cells under conditions whereby differentiated cells outnumber undifferentiated cells. These conditions include, for example, extending the amount of time that cells are grown in culture, such that survival of a desired cell type is encouraged. Many primary ceils achieve senescence, and fail to divide, or die, after a period of time. Other conditions comprise modulating the type and concentration of serum, or culturing the cells in the presence or absence of growth factors and/or cytokines that induce

differentiation to another cell type. Differentiation can also be advantageously achieved by modulation of serum concentrations, or withdrawal of serum from the culture. Other methods of inducing differentiation can include, but are not limited to, modulating the acidity of the culture medium, as well as the oxygen and carbon dioxide levels during culture.

Similarly, differentiated cells can be identified by morphological changes and characteristics that are not present on their undifferentiated counterparts, such as cell size, the number of cellular processes, and the complexity of intracellular organelle distribution. Also contemplated are methods of identifying differentiated cells by their expression of specific cell-surface markers such as cellular receptors and transmembrane proteins. Monoclonal antibodies against these cell-surface markers can be used to identify

differentiated cells. Detection of these cells can be achieved through fluorescence activated cell sorting (FACS), and/or enzyme-linked

immunosorbent assay (ELISA). From the standpoint of transcriptional upregulaiion of specific genes, differentiated ceils often display le vels of gene expression that are different from undifferentiated cells. Reverse-transcription polymerase chain reaction (RT-PCR) can also be used to monitor changes in gene expression in response to differentiation. In addition, whole genome analysis using microarray technology can be used to identify differentiated cells.

Accordingly, once differentiated cells are identified, they can be separated from their undifferentiated counterparts, if necessary. The methods of identification detailed above also provide methods of separation, such as FACS, preferential cell culture methods, ELISA, magnetic beads, and combinations thereof. One embodiment of the invention envisions the use of FACS to identify and separate ceils based on cell-surface antigen expression. It is understood that the methods of identification and separation are not limited to analysis of differenti ted cell types, but can also be used to identify undifferentiated cell types.

Amniotic fluid stem cells of the invention can also be used in ceil replacement therapies. Amniotic fluid stem cells of the invention can be administered to a tissue of interest in a subject to supplement functioning cells or replace cells, which have lost function (e.g., reduced function as compared to a control cell). Alternatively, methods of providing differentiated cells are also contemplated, wherein the amniotic fluid stem cells of the invention are differentiated in the presence of differentiation factors, isolated, and administered into or upon the body of a subject. In one embodiment, the differentiated cells are cells of a lung lineage.

Disease states characterized by loss of lung mass and/or function, and that could benefit from amniotic fluid stem cells and methods of the invention include, but are not limited to, lung disease or injury. For example, one therapeutic use of the cells of the invention is for treating a subject with a lung disease, promoting growth of new tissue in a subject, or promoting survival of damaged tissue in a subject. The lung disease can be, for example, a result or a consequence of any change, damage, or trauma to any portion of the lung. The lung disease can be acute or chronic.

In one embodiment, the lung disease includes acute respiratory distress syndrome (ARDS), infant respiratory distress syndrome (IRDS), asbestosis, asthma, bronchiectasis, bronchiolitis, bronchopulmonary dysplasia, byssinosis, chronic bronchitis, coccidiodomycosis (Cocci), emphysema, acute and/or chronic bronchitis, cystic fibrosis, diffuse interstitial fibrosis, hantavirus pulmonary syndrome, histoplasmosis, human metapneumovirus, hypersensitivity pneumonitis , influenza, lung cancer (e.g., small cell lung cancer, non-small cell lung cancer, lymphoma, head and neck cancer, mesothelioma, cancer metastases from other locations in the body ), lymphangiomatosis, nontuberculosis mycobacterium, pertussis, pneumoconiosis, pneumonia, primary ciliary dyskinesia, primary pulmonary hypertension, pulmonary arterial hypertension, cavitary pneumonia, pulmonary fibrosis, pulmonary vascular disease, respiratory syncytial virus, sarcoidosis, se vere acute respiratory syndrome, silicosis, sleep apnea, sudden infant death syndrome, tuberculosis, chronic obstructive pulmonary disease (CQPD), or injury such as from surgery, accident, asbestos, smoking, inhaling of harmful chemicals or contaminants, or injury caused by a pathogen (e.g., bacterial or viral). In one embodiment, the damage/disease to the lung is not caused by hypoxia, scratch wound damage, and/or napthalene. In one embodiment, the disease is not pulmonary hypertension. In another embodiment, the disease is not idiopathic pulmonary fibrosis. In another embodiment, the disease is not diffuse parenchymal lung disease (DPLD).

CCL2/CCR2 mediated inflammatory syndromes or diseases that could benefit from amniotic fluid stem ceils and methods of the invention include, but are not limited to, rheumatoid arthritis (RA), multiple sclerosis (MS), chronic obstructive pulmonary disorder (COPD), atherosclerosis, delayed type hypersensitivity; autoimmune encephalomyelitis, inflammatory arthritis, lupus nephritis, chronic inflammatory diseases, metabolic diseases, neuropathic pain and insulin resistance in diabetic patients, autoimmune disease, inflammatory disease, HIV infection, AIDS, transplant rejection, inflammatory conditions (such as vascular restenosis) and/or cardiovascular diseases.

Amniotic fluid stem cells of the invention can be used for many diverse clinical and pre-clinicai applications, which can include, but are not limited to, use in toxicological or genomic screening methods, determination of levels of enzymes, as well as treatment of the diseases disclosed herein. Amniotic fluid derived progenitor cells of the invention can provide a variety of differentiated cultured cell types for high-throughput toxicological or genomic screening. The cells can be cultured in, for example, 96-well or other multi-well culture plates to provide a system for high-throughput screening of, for example, target cytokines, chemokines, growth factors, or pharmaceutical compositions in

pharmacogenomics or pharmacogenetics.

Thus, the present invention provides for use of amniotic fluid stem cells of the invention to detect cellular responses (e.g., toxicity) to bioactive (biologic or pharmacologic) agents, comprising contacting a culture of ceils, or the differentiated progeny thereof, with one or more biologic or pharmacologic agents, identifying one or more cellular response to the one or more biologic or pharmacologic agents, and comparing the cellular responses of the cell cultures to the cellular responses of control cultures.

The invention also envisions a tissue-engineered organ, or portion, or specific section thereof, a tissue engineered device comprising a tissue of interest and optionally, cytokines, growth factors, or differentiation factors that induce differentiation into a desired cell type, wherein the amniotic fluid stem cells of the invention are used to generate lung tissue. Tissue-engineered organs can be used with a biocompatible scaffold to support cell growth in a three-dimensional configuration, which can be biodegradable. Tissue-engineered organs generated from the amniotic fluid stem cells of the invention can be implanted into a subject in need of a replacement organ, portion, or specific section thereof. The present invention also envisions the use of the amniotic fluid derived lung progenitor cells of the invention or cells differentiated therefrom as part of a bioreaetor.

Homogenous organs, portions, or sections derived from the amniotic fluid stem cells of the invention can be implanted into a host. Likewise, heterogeneous organs, portions, or sections derived from amniotic fluid stem cells of the invention induced to differentiate into multiple tissue types can be implanted into a subject in need thereof. The transplantation can be autologous, such that the donor of the cells from which organ or organ units are derived is the recipient of the engineered tissue. The transplantation can be heterologous, such that the donor of the cel ls from which organ or organ units are derived is not that of the recipient of the engineered-tissue (e.g., allogeneic or xenogenic).

Once transferred into a host, the tissue-engineered organs can recapitulate the function and architecture of the native host tissue. The tissue - engineered organs will benefit subjects in a wide variety of applications, including the treatment of cancer and other diseases disclosed herein, congenital defects, or damage due to surgical resection.

Administration of Amniotic Fluid Stem Cells

For the purposes described herein, either autologous, allogeneic or xenogeneic amniotic fluid stem cells of the invention can be administered to a subject, either in differentiated or undifferentiated form, genetically altered or unaltered, by direct injection to a tissue site, systemicaliy, on or around the surface of an acceptable matrix, encapsulated or in combination with a pharmaceutically acceptable carrier.

Amniotic fluid stem cells of the invention can be administered to a subject by a variety of methods known in the art. Amniotic stem cells of the invention can be administered to a subject by localized or systemic injection.

In one embodiment, a cell suspension is drawn up into a syringe and administered to a subject. Multiple injections may be made using this procedure. The use of such cellular suspension procedures provides many advantages. For example, these methods direct cells to any predetermined site and are relatively non-traumatic.

Typically, the number of cells transplanted into a subject will be a "therapeutically effective amount." As used herein, a "therapeutically effective amount" refers to the number of transplanted cells that are required to effect treatment of the particular injury, or disease for which treatment is sought. For example, where the treatment is for tissue injury, transplantation of a therapeutically effective amount of cells will typically produce a reduction in the amount and/or severity of the symptoms associated with the injury. Persons of skill in the art will understand how to determine proper cell dosages.

As desired, amniotic stem cells of the invention and their differentiated progeny can be induced to proliferate and/or differentiate in vivo by

administering to the host, any growth factor(s), cytokine(s) or pharmaceutical composition(s) that will induce proliferation and differentiation of the cells. These growth factor(s), cytokine(s) or pharmaceutical composition^) include any growth factor, cytokine or pharmaceutical composition known in the art, including (he growth factors and cytokines described herein for in vitro proliferation and differentiation.

Exogenous factors (e.g., cytokines, differentiation factors and other factors) can be administered prior to, after or concomitantly with the amniotic fluid stem cells of the invention. For example, a form of concomitant administration would comprise combining a factor of interest in the culture media and/or pharmaceutically acceptable carrier prior to administration. Doses for administrations are variable, may include an initial administration followed by subsequent administrations; but nonetheless, can be ascertained by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art.

A parameter involved in the therapeutic use of amniotic fluid stem cells of the invention is the quantity of cells necessary to achieve an optimal effect. Different scenarios may require optimization of the amount of cells injected into a tissue of interest. For example, the quantity of ceils to be administered will vary for the subject being treated, in one embodiment, between IQ to 10^s, more preferably 10⁵ to 10', and most preferably 3 x 10^? cells and optionally, 50 to 500 ^sg/kg per day of a cytokine can be administered to a human subject. However, the precise determination of what would be considered an effective dose may be based on factors individual to each patient, including their size, age, size tissue damage, and amount of time since the damage occurred. Therefore, dosages can be readily ascertained by those skilled in the art from this disclosure and the knowledge in the art.

Another parameter invol ved in the use of amniotic stem cells of the invention is the purity of the population. Amniotic fluid, for example, comprise mixed populations of cells, which can be purified to a degree sufficient to produce a desired effect, Those skilled in the art can readily determine the percentage of amniotic fluid derived lung progenitor cells of the invention in a population using various well-known methods, such as fluorescence activated cell sorting (FACS). Preferable ranges of purity in populations comprising amniotic fluid stem cells of the invention are about 1 to about 5%, about 5 to about 10%, about 10 to about 15%, about 15 to about 20%, about 20 to about 25%, about 25 to about 30%, about 30 to about 35%, about 35 to about 40%, about 40 to about 45%, about 45 to about 50%, about 50 to about 55%, about 55 to about 60%, about 60 to about 65%, about 65 to about 70%, about 70 to about 75%, about 75 to about 80%, about 80 to about 85%, about 85 to about 90%, about 90% to about 95% or about 95 to about 100%. Purity of the cells can be determined according to the cell surface marker profile within a population. Dosages can be readily adjusted by those skilled in the art (e.g., a decrease in purity may require an increase in dosage).

When administering a therapeutic composition of the present invention, it will generally be formulated in a unit dosage injectable form (solution, suspension, emulsion). The pharmaceutical formulations suitable for injection include sterile aqueous solutions and dispersions. The carrier can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol, and the like) and suitable mixtures thereof.

Additionally, various additives which enhance the stability, sterility, and isotonicity of the compositions, including antimicrobial preservatives, antioxidants, chelating agents, and buffers, can be added. Prevention of the action of microorganisms can be ensured by v arious antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. In many cases, it will be desirable to include isotonic agents, for example, sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delay ing absorption, for example, aluminum monostearate and gelatin. According to the present invention, however, any vehicle, diluent, or additive used would have to be compatible with the cells.

Sterile injectable solutions can be prepared by incorporating the cells utilized in practicing the present invention in the required amount of the appropriate solvent with various amounts of the other ingredients, as desired. Examples of compositions comprising progenitor cells of the invention include liquid preparations for administration, including suspensions; and, preparations for intramuscular or intravenous administration (e.g., injectable administration), such as sterile suspensions or emulsions. Such compositions may be in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like. The compositions can also be lyophilized. The compositions can contain auxiliary substances such as wetting or emulsifying agents, pH buffering agents, gelling or viscosity enhancing additives, preservatives, flavoring agents, colors, and the like, depending upon the route of administration and the preparation desired.

Standard texts, such as "REMINGTON'S PHARMACEUTICAL SCIENCE", 17th edition, 1985, which is incorporated herein by reference, may be consulted to prepare suitable preparations, without undue experimentation.

Compositions of the invention are conveniently provided as liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions or viscous compositions, which may be buffered to a selected pH. Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues.

The choice of suitable carriers and other additives will depend on the exact route of administration and the nature of the particular dosage form, e.g., liquid dosage form (e.g., whether the composition is to be formulated into a solution, a suspension, gel or another liquid form, such as a time release form or liquid-filled form).

Solutions, suspensions and gels normally contain a major amount of water (e.g., purified, sterilized water) in addition to the cells. Minor amounts of other ingredients such as pH adjusters (e.g., a base such as NaOH), emulsifiers or dispersing agents, buffering agents, preservatives, wetting agents and jelling agents (e.g., methylceliulose), may also be present. The compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and lacrimal fluid.

The desired isotonicity of the compositions of this invention may be accomplished using sodium chloride, or other pharmaceutically acceptable agents such as dextrose, boric acid, sodium tartrate, propylene glycol or other inorganic or organic solutes.

Viscosity of the compositions, if desired, can be maintained at the selected level using a pharmaceutically acceptable thickening agent.

Methylceliulose is readily and economically available and is easy to work with. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropy! cellulose, carbomer, and the like. The concentration of the thickener will depend upon the agent selected. The point is to use an amount, which will achieve the selected viscosity. Viscous compositions are normally prepared from solutions by the addition of such thickening agents.

A pharmaceutically acceptable preservative or cell stabilizer can be employed to increase the life of the compositions. If preservatives are used, it is well within the purview of the skilled artisan to select compositions that will not affect the viability or efficacy of the amniotic fluid derived lung progenitor cells as described herein.

Those skilled in the art will recognize that the components of the compositions should be selected to be chemically inert. This will present no problem to those skilled in chemical and pharmaceutical principles, or problems can be readily avoided by reference to standard texts or by simple experiments (not involving undue experimentation), from this disclosure and the documents cited herein.

Compositions can be administered in dosages and by techniques well known to those skilled in the medical and veterinary arts taking into consideration such factors as the age, sex, weight, and condition of the particular patient, and the composition form used for administration (e.g., solid vs. liquid). Dosages for humans or other mammals can be determined without undue experimentation by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art.

Suitable regimes for initial administration and further doses or for sequential administrations also are variable and may include an initial administration followed by subsequent administrations; but nonetheless, can be ascertained by the skilled artisan, from this disclosure, the documents cited herein, and the knowledge in the art.

Genetically-Modified Amniotic Fluid Stem Cells of the Invention

Amniotic fluid stem cells of the invention or differentiated progeny derived therefrom can be genetically altered. Amniotic fluid stem cells described herein or their differentiated progeny can be genetically modified by introducing heterologous DNA or RNA into the cell by a variety of recombinant methods known to those of skill in the art. These methods are generally grouped into four major categories: (1) viral transfer, including the use of DNA or RNA viral vectors, such as retroviruses, including lentiviruses, Simian virus 40 (SV40), adenovirus, alpha vims, including Sindbis vims, and bovine papillomavirus, for example; (2) chemical transfer, including calcium phosphate transfection and DEAE dextran transfection methods; (3) membrane fusion transfer, using DNA-Ioaded membranous vesicles such as liposomes, red blood cell ghosts and protoplasts, for example; and (4) physical transfer techniques, such as microinjection, microprojectile, electroporation, nucleofection or direct "naked" DNA transfer.

Cells can be genetically altered by insertion of pre-selected isolated DNA, by substitution of a segment of the cellular genome with pre-selected isolated DNA, or by deletion of or iriactivation of at least a portion of the cellular genome of the cell. Deletion or inactivation of at least a portion of the cellular genome can be accomplished by a variety of means, including but not limited to genetic recombination, by antisense technology (which can include the use of peptide nucleic acids or PNAs), or by ribozyme technology, for example.

Insertion of one or more pre-selected DNA sequences can be accomplished by homologous recombination or by viral integration into the host cell genome. Methods of non-homologous recombination are also known, for example, as described in U.S. Patent Nos. 6,623,958, 6,602,686, 6,541,221, 6,524,824, 6,524,818, 6,410,266, 6,361,972.

The desired gene sequence can also be incorporated into the cell, particularly into its nucleus, using a plasmid expression vector and a nuclear localization sequence. Methods for directing polynucleotides to the nucleus have been described in the art. For example, signal peptides can be attached to plasmid DNA to direct the DNA to the nucleus for more efficient expression.

The genetic material can be introduced using promoters that will allow for the gene of interest to be positiv ely or negatively induced using certain chemicals/drugs, to be eliminated following administration of a given drug/chemical, or can be tagged to allow induction by chemicals (including but not limited to the tamoxifen responsive mutated estrogen receptor) in specific cell compartments (including, but not limited to, the cell membrane).

Any of the transfection or transduction techniques can also be applied to introduce a transcriptional regulatory sequence into the cells of the invention or progeny to activate a desired endogenous gene. This can be done by both homologous (e.g., U.S. 5,641,670) or non-homologous (e.g., U.S. 6,602,686) recombination.

Successful transfection or transduction of target cells can be

demonstrated using genetic markers. The green fluorescent protein of Aequorea victoria, for example, has been shown to be an effective marker for identifying and tracking genetically modified hematopoietic ceils. Alternative selectable markers include the β-Gal gene, the truncated nerve growth factor receptor, and drug selectable markers (including but not limited to NEO, MTX, hygromycin).

Examples

The following examples are provided in order to demonstrate and further illustrate certain embodiments and aspec ts of the present invention and are not to be construed as limiting the scope thereof.

Example 1

The use of amniotic fluid stem cells in the repair and amelioration of pulmonary fibrosis is a novel treatment for pulmonary fibrosis. In utero, the developing lungs of the fetus are filled with amniotic fluid. In the late gestational period, surfactant produced by the fetal lungs contributes to the composition of amniotic fluid and can be measured to determine the de v elopment stage of the fetal lungs. A population of cells, approximately 1% of cells found in amniotic fluid, has been identified that exhibits both embryonic and mesenchymal characteristics and retains pluripotent characteristics in vitro, These cells can be easily obtained through amniocentesis without any harm to the fetus or mother, and have been termed amniotic fluid stem cells, AFSC. Herein, intravenous AFSC transplantation following acute bleomycin induced lung injury, which mimics idiopathic pulmonary fibrosis (IPF), is employed to modulate the inflammatory response and to stimulate proliferation of resident progenitor cells, while protecting against apoptosis of alveolar epitheha cells, thus protection/reconstituting alveolar epithelia. it is demonstrated that AFSC are retained in injured lung including within the fihrotic lesions. Further characterization of the composition on a subpopulation of AFSC elucidated the expression of type 1 lung epithelial cell markers prior to transplant which has not been previously described. These findings support that AF cells respond to injury via a type 1 cell dependent mechanism, not previously characterized, and that type I alveolar epithelial progenitor phenotype in AF has therapeutic properties as a treatment for lung diseases/disorders, including pulmonary fibrosis and other inflammatory and fibro ic lung diseases. isolation and Characterization of AFSC for Pluripotentiality

Samples of amniotic fluid from embryos, E 13.5, were isolated from timed pregnant murine females. The stem cell population was separated from the general amniotic cellular milieu using standard Magnetic Sorting (MACS) techniques (Miltenyi Biotech) against the cell surface marker c-kit as described in Perm et al, 2007 and WO 2010/047824 (each of which are incorporated herein by reference). Pluripotent characteristics of the clonal and subclonai groups were previously tested and described in Perin et al. 2007 and WO 2010/047824 (each of which are incorporated herein by reference). Expression of pluripotent marks such as Oet-4, stage specific embryonic antigen 4 (SSEA- 4), CD90 and CD 105 were confirmed using FACS in order to confirm their phenotype. Clones derived from a single sample of amniotic fluid were then cultured in petri dishes in medium containing a-MEM Medium (Gibco/BRL) supplemented with 20% Chang Medium B (Irvine Scientific) and 2% Chang Medium C (Irvine Scientific), 20% Fetal Bovine Serum (Gibco/BRL), 1% L- Glu!amine (Gibco/BRL), and 1% antibiotics (pen-strep: Gibco/BRL).

Before injection, a clonal AFSC population was trypsimzed in 0.05M trypsin/EDTA (Gibco/BRL) solution and centrifuged at 1500 rpm for 5 minutes, and then labeled with a cell surface marker CM-Dil (Molecular Probe) following manufacturer's directions (so as to track cells after injection). Briefly, the cells were incubated with a working solution of 1 mg/ml of CM-Dil for 5 minutes at 37°C followed by incubation for 15 minutes at 4°C and then washed three times with a phosphate-buffered saline (PBS; Gibco/BRL).

Characterizati n of Pre-Transplanted AFSC for Subpopulations with Lung Specific Markers

Characterization of AF SC along pulmonary lineages has not been previously described in the literature. AJiquots of clones derived from a single sample of amniotic fluid from five different AFSC isolations were tested for various lung markers characi eristic of type 1 alveolar epithelia, type II alveolar epithelia and Clara cell lineages. qPCR for nine markers indicate a type I cell lineage expression pattern for all five AFSC lines (Table 1 ).

Table 1. Characterization of Lung Lineage Markers via qPCR .

Example 2,

AFSC Treatment Inhibits Pulmonary Fibrosis

introduction

IFF is a chronic, progressive and fatal lung disease, surmised to result from a myriad of factors (Borchers et af. 2010). The improvement of diagnostic technology and criteria, coupled with an increase in aged populations worldwide, virtually ensures that morbidity and mortality attributed to IFF will increase (Raghu et al. 2.006; Faner et al. 2012). The histopathoJogy of IFF demonstrates a characteristic heterogeneity: areas of normal parenchyma interspersed with areas of paraseptal and subpleural fibrosis (King et al., 1961). Currently, the only effective and definitive treatment for IPF is lung transplantation; however, this option is limited by the quality and availability of donor lungs (Meltzer and Noble 2008).

At the cellular level 1PF is characterized by alveolar epithelial injury, the initiation of inflammatory cascades, aberrant activation of developmental pathways in type Π alveolar epithelium (AECIT), exaggerated pro-fibrotic cytokine expression, increased extracellular matrix deposition, and the development of fibrotic lesions termed 'foci" (Kind and Pardo 1961 ; Wynn 201 1 ; Sisson et al. 2009; Stricter and Mehrad 2009; Hardie et al, 2010; Todd et al. 2012; Jenkins et al., 201 I). In particular, expression of the pro-fibrotic cytokine CCL2 plays a significant role in IPF as it is significantly increased during inflammatory and fibrotic remodel events (Agostini and Gurrieri 2006; Rose et al., 2003). in experimental models of lung fibrosis, increased expression of CCL2 attracts fibroblasts and stimulates their proliferation (Ekert et al., 2001 ; Liu et al., 2007). Inhibition of CCL2 production, deletion of CCR2, or CCR2 antagonism inhibits the deposition of collagen and attenuates the development of fibrosis (Sun et al, 201 1 ; Moore et al, 2001 ; Moore et al., 2005; Gharaee- Kermani et al. 2003; Inoshima et ai, 2004). Thus emerges a role for

CCL2/CCR2 signaling in the pathologies of IPF.

Herein is described a bleomycin injury which models the parenchymal remodeling and elevated CCL2 production seen in human IPF, coupled with intravenous administration of AFSC to test whether AFSC can inhibit the progression of experimentally induced pulmonary fibrosis. It was determined that AFSC treatment administered during either acute or chronic fibrotic remodeling events inhibits changes in pulmonary function associated with the development of pulmonary fibrosis. It was also discovered that AFSC inhibits increased CCL2 levels following injury. It is believed that this CCL2 inhibition occurs through increased expression of MMP2 by AFSC, resulting in the cleavage of CCL2 to form a receptor antagonist (Denney et al, 2009; Dean et al, 2008; McQuibban et al, 2002). It is also shown herein that AFSC express CCR2, migrate toward CCL2 during bleomycin lung injury and home to foci. This novel cell based therapy and proposed mechanism can arrest the progression of pulmonary fibrosis at the stage at which the AFSC are administered, making AFSC a powerful therapeutic tool and a treatment strategy for human IFF.

Materials and Methods

Isolation, Culture and Labeling of Amniotic Fluid Stem Cells (AFSC): Samples of murine amniotic fluid from FJ 3.5 embryos were isolated from timed pregnant females. Samples of human amniotic fluid from 12- 18 weeks of gestation were isolated and characterized. Briefly, the stem cell population was isolated from the general amniotic cellular milieu using standard Magnetic Sorting (MACS) techniques (Miltenyi Biotech, Auburn, CA) against the cell surface marker, c-kit. Pluripotential characteristics of the clonal and subclonal groups were tested. Clones derived from a single sample of amniotic fluid were cultured in petri dishes in mediu containing -MEM Medium, 20% Fetal Bovine Serum, 1 % L-Glutamine and 1% antibiotics (pen-strep) (Gibco/ BRL, Rockville, MD) supplemented with 20% Chang Medium B and 2% Chang Medium C (Irvine Scientific, Santa Ana, CA). Prior to injection, a clonal AFSC population was labeled with a cell surface marker, chloromethyfbeiizamine-Ι , - diaetaolecyl-3,3,3 ',3 '-tetramethylindocarboc anine perchlorate (CM-Dil) (Invitrogen, Carlsbad, CA), in order to track the cells after injection. Briefly, the cells were incubated with a working solution of 1 rng/^'ml of CM-Dil for 5 minutes at 37°C followed by an incubation of 15 minutes at 4°C and then washed three times with phosphate-buffered saline (PBS), before filtration through a 40μιη filter.

Bleomycin induced Lung Injury and AFSC Treatment: Ail animal studies were approved and performed according to the protocols and guidelines of the Institutional Animal Care and Use Committe at Children's Hospital Los Angeles. Female C57/B1/6J mice 8- 12 weeks of age (Jackson Laboratories, Bar Harbor, Maine) were randomly selected for bieomycin-injury or saline controls; a minimum of 6 mice were used for each experimental condition and time point. AFSC treated mice received 1x10⁶ cells intravenously (IV) at either 2 hours (Bleo+AFSC day 0) or 14 days (Bleo+AFSC day 14) post-bleomycin-injury. Mice recieving AFSC on day 0 were sacrificed at either 3 days (acute time point) or 28 days (chronic time point) post-bleomycin. Mice receiving AFSC on day 14 were sacrificed at 28 days post-bleomycin.

For mice receiving bleomycin-injury, 1.5U/kg bleomycin (Sigma, St.

Louis, MO) was dissolved in 50μ1 of saline and injected into the trachea. Mice receiving AFSC were injected via tail vein with I xl O⁶ CM-D l (Invitrogen, Grand Island, NY) labeled murine AFSC in a 50μ1 volume of sterile PBS.

Histological Analysis and Immunofluorescence: Lung tissues were fixed in 4% paraformaldehyde at 20-25 cm H₂0 inflation pressure, embedded in paraffin and cut into 5-7|im thick sections. Mouse lung sections were stained with Sirius Red/Fast Green FCF (Sigma, St. Louis, MO) for collagen visualization. Morphological changes in 225 randomly chosen microscopic fields, spanning all experimental conditions at the chronic time point, photographed with 20-fold magnification, were quantified according to the numerical scale proposed by Ashcroit et al. (Ashcroit ei al., 1988). Visualization and quantification of CM-Dil labeled cells was achieved through counterstaining with 4^,,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, CA). Overnight incubation with primary antibodies used for

immunofluorescence included CCR2 [I fig/ml] (abeam, Cambridge, MA.) and a- smooth muscle actin ( -SMA) (4_iug/ml) (Sigma, St. Louis, MO).

Measurements of Lung Mechanics and Collagen Quantification: Mice were anesthetized with 70-90 mg/kg pentobarbital sodium solution, tracheotomized, placed in a plethysmograph and connected to the Scireq small animal ventilator (Scireq, Montreal, Canada). Mice were mechanically ventilated at a rate of 150 breaths/min, tidal volume of 10 mi/kg, and positive end- expiratory pressure of 2-3 em¾0. All maneuvers were computer controlled via Flexivent v5.2 software (Scireq, Montreal, Canada). Pressure-volume loops were generated by a sequential delivery of seven increments of air into the lungs from resting pressure to total lung capacity followed by seven expiratory steps during which air was incrementally released. Pressures at each of the incremental volumes delivered were recorded and graphed to give pressure-volume loops. The Salazar-Knowles equation was applied to measurements resulting from the pressure volume manipulations to calculate quasi-static compliance and hysteresis (the area enclosed by the pressure volume loop), which provides an estimate of the amount of airspace closure that existed before the P-V loop maneuver (Lee et a!., 2.005), Negative pressure forced expirations were preformed via rapidly switching the airway opening to negative pressure, resulting in the ability to measure Forced Vital Capacity (FVC). Ail

measurements and maneuvers were preformed in triplicate. Total collagen content of whole lung samples was assessed by hydroxyproime assay kit (Bio Vision, Milpitas, CA) according to the manufacturers instructions. Briefly, whole lungs were washed in PBS, weighed and homogenized in d¾Q. Tissue samples were then hydro lyzed at 120°C for 3 hours before transfer to a 96 well plate for oxidation of free hydroxyproline. Hydroxyproime content was then assessed by spectrophotometry at 570 mn.

Collection of Brpnchpalyeolar Lavage (BAL) and Lung Tissue: BAL and lung tissue were collected according to previously published protocols (Lee et al., 2005). Cohorts were sacrificed using lOOmg/kg intraperitoneal injection of peniobarbital sodium solution. The chest cavity was then opened for tissue retrieval creating a pneumothorax. Subjects were exsanguinated via injection of 0.9% saline into the right ventricle. BALwas collected through three separate washes consisting of the addition of 0.5cc phosphate buffered saline into the trachea via a 3cc syringe attached to a 2.0G angiocatheter followed by gentile aspiration. BAL was spun at 1500xg for 5 minutes at 25°C to separate the cellular components. Protein concentrations in BAL supernatants were determined by the Bradford method using an assay kit (Bio-Rad Laboratories, Hercules, CA). BAL supernatants were frozen at -20°C, and cellular fractions were cytospun and stained with the Diff-Quick Stain Kit (IMEB Inc., San Marcos, CA) for differential analysis. Following BAL collection, the lungs were removed from the chest cavity, washed briefly in PBS and homogenized in PBS with protease inhibitors before the addition of Triton X-100 to 1%. Homogenates were vortexed, and kept at -8Q°C until use. Prior to use, samples were centrifuged at lO.OOGxg for 5 minutes, and supernatants were quantified using the Bradford assay kit previously described.

Proteomic Cytokine Analysis: Cytokine levels in both bleomycin injured and saline treated control animals were assessed via the use of multiplex cytokine assay membranes according to the suggested protocol (R&D Systems, Minneapolis, MN). Samples of previously described BAL and homogenized whole lung extracts were used for each assay. Samples were briefly incubated with an antibody detection cocktail before being added to array membranes for an overnight incubation at 4°C, The following day membranes were washed, developed with Super Signal West Pico Chemiluminescent Substrate (Thermo Fisher Scientific Inc., Rockford, IL) scanned and analyzed using Image J Software.

CCL2 ELISA: CCL2 levels in BAL were determined using the mouse MCP- 1 ELISA KIT (Invitrogen, Camarilio, CA) according to the manufacturer's suggested protocol. Samples were incubated in pre-eoated wells containing anti- MCP- 1 /CCL2 antibodies for two hours and then conjugated with biotinylated anti-MCP- 1/CCL2. Samples were then washed, incubated with streptavidia-HRP and developed with chromogen solution and read in a spectrophotometer at 450nm.

In vitro Collagen Assay: To study the ability of the damaged cytokine milieu secreted into BAL, specifically CCL2, to induce collagen synthesis in fibroblasts, a new in vitro assay system was developed to measure newly synthesized soluble collagen. Murine 3T3 fibroblasts (ATCC, Manassas, VA) were plated at 4x 10 cells per well in 24 well plates and cultured in DMEM + 10% FBS + 1% penicillin-streptomycin. Once confluent, duplicates of lOOul of BAL (n=6 per time point), conditioned media (n=10) or recombinant murine CCL2 at 0, 50, 100 or 200 pg/ml (R&D Systems, Minneapolis, MN), was added to each culture for an additional 48 hours. At the end of the 48-hour growth period, conditioned media supernatants were removed, adherent cells were washed in PBS, and incubated with 0.5M acetic acid for 2 hours. Acetic acid fractions containing newly synthesized solubilized collagen was then collected and assayed according to the manufacturer's instructions via the Sircol Assay system (Biocolor Life Sciences, County Antrim, UK). Solubilized samples were incubated with an equivalent volume of Sircol dye reagent for 30 minutes at room temperature, spun at 12,000 rpm for 10 minutes to pellet collagen.

Collagen pellets were then washed with an acid-salt solution, centrifuged at 12,000 rpm for an additional 10 minutes, decanted and resuspended in alkali reagent and read in a spectrophotometer at 570nm. Western blotting and Zymography: BAL samples were concentrated using Amicon Ultra-4 Centrifugal Filter Units (3kDa) (Miiipore, Bilerica, MA). 20_,ug total protein fro BAL or cell lysate was loaded onto 4-12% Bis-Tris Gels with MOPS buffer Novex, Grand Island, NY). Antibodies against CCL2 (1 :200) (R&D Systems, Minneapolis, MN) and β-actin (1 : 1000) (Cell signaling, Danvers, MA) were incubated with membranes overnight. BAL zymography was performed using either 10 or 20 μg protein (indicated in figure legend) on 10% gelatin gels (Novex, Grand Island, NY) with MMP-9 control (Amersham Life Science, Pittsburg, PA) and MMP-2. control collected from conditioned media from CCL-201 human lung fibroblasts (ATCC, Manassas, VA), Western blots and zymograms were each repeated a minimum of 3 times per sample.

Migration Assay: Murine AFSC were assayed for migration toward recombinant mouse CCL2 (R&D Systems, Minneapolis, MN) at concentrations of 0, 25, 50, 75, 100, 150, 2.00 pg/^'mJ. Human AFSC were assayed for migration toward recombinant CCL2 at concentrations of 0, 12.5, 25, 50 and 100 ng/ml. Murine AFSC migration toward duplicates of ΙΟΟμΙ BAL samples (n=6 per time point) from mice with acute and chronic bleomycin injury were also assayed. Furthermore, to determine the extent of acutely produced CCL2 on murine AFSC migration, a mouse CCL2 neutralization antibody (R&D Systems, Minneapolis, MN) was used on acute BAL samples in additional wells. CCL2 concentrations in BAL were previously determined by ELISA. Migration assays were preformed according to the Boyden chamber method. AFSC were trypsinized and washed in PBS to remove all traces of serum, counted and suspended in DMEM containing 0.1% BSA. Using the BD Falcon cell culture insert/companion plate system (BD Falcon, Franklin Lakes, NJ), cells were plated at a density of 2 cells/pore on insert membranes containing pores of 8μτη diameter and 10^" pores/cm^7'. Media containing recombinant CCL2 or BAL was added to the well underneath the insert. As positive and negative controls DMEM and 0.1% BSA (random migration) or DMEM with 2.5% FBS

(stimulated migration) were used in additional wells. AFSC were allowed to migrate for 2.4 hours at which time cells adherent to the upper surface of the membrane (non-migratory) were gently removed with a Q-tip, Membranes were then stained with crystal violet, rinsed in distilled water, eluted from the membrane using 0.1M FiCl and read at 600nm in a spectrophotometer. In Vitro AFSC Rescue: To determine the extent of the direct interaction between AFSC and AECII during acute inflammation a ne assay system was devised which employed in vivo bleomycin lung injury, followed by in vitro AFSC rescue. AECIi was isolated from bleomycin-injured mice, three days post- intratracheal instillation of 1.5U kg bleomycin according to the previously published protocol (Lee et a!., 2005). Briefly, AECII from lavaged lungs were isolated by dispase digestion followed by differential adherence on lgG plates. Isolated AECII were plated in 6 well tissue culture plates (BD Falcon, Franklin Lakes, NJ) coated with fibronectin (Sigma -Aldrich, Si. Louis, MO) at a density of 5x10^s cells/well. Cells were allowed to attach overnight. Once attached, 5x10* AFSC were added to experimental wells and allowed to remain in culture with AECII for an additional 24 hours. At the end of the 24 hour period conditioned media was collected and spun at 1500xg for 5 minutes at 25°C to separate the cellular components. CCL2 levels in conditioned media was determined via ELISA (Invitrogen, Camarillo, CA) then assayed for its ability to induce collagen synthesis according to the previously described in vitro soiuble collagen assay. Adherent cells were trypsinized, washed with PBS, pelleted and saved at - 80°C f

Valencia, CA) according to the manufacturer's instructions. Quantitative PGR for, 1 8S ( F: AAATCAGTTATGGTTCCTTTGGTC (SEQ ID NO:l ); R:

GCTCTAGAATTACCACAGTTATCCAA (SEQ ID NO:2)), MMP2 (F:

ATAACCTGGATGCCGTCGT (SEQ ID NO:3); R:

TCACGCTCTTGAGACTTTGG (SEQ ID NO:4)), CCL2 (F:

GCCTGCTGTTCACAGTTGC (SEQ ID NO:5); R:

CAGGTGAGTGGGGCGTTA. (SEQ ID NO:6) ), CCR2 (F:

GGAGAAAAGCCAACTCCTTCA (SEQ ID NO:7); R:

CACAGATCTCTGCCTTTTTGC (SEQ ID NO: 8)), TIMP- 1 (F:

GC A A AG A G CTTTCTC A A A G A.CC (SEQ ID NO:9); R:

AGGGATAGATAAACAGGGAAACACT (SEQ ID NO: 10)), TIMP-2 (F: CGTTTTGCAATGCAGACGTA (SEQ ID NO: 11); R

GGAATCCACCTCCTTCTCG (SEQ ID NO: 12)), TIMP-3 (F:

CACGGAAGCCTCTGAAAGTC (SEQ ID NO: 13); R:

TCCCACCTCTCCACAAAGTT (SEQ ID NO: 14)), TIMP-4 (F: CTGAGGCTGCTGGCTTTG (SEQ ID NO: 15); R:

GGATATTTTGGCCCGTATCA (SEQ ID NO: 16)) was performed using a Roche Light Cycler 480. Real-time PGR conditions were as follows: 90°C for 10 minutes, 60°C for 10 seconds, 72°C for 1 second with the analysis of the fluorescent emission at 72°C. Thirty-five cycles were performed for each experiment and each qPCR analysis was performed in triplicate.

In Vitro MMP2 inhibition: AECTI non- injured lavaged lungs were isolated by dispase digestion followed by differential adherence on IgG plates. Isolated AECII were plated in 6 well tissue culture plates (BD Falcon, Franklin Lakes, NJ) coated with fibronectin (Sigma-Aldrieli, St. Louis, MO) at a density of 5x10^"' cells/well. Cells were allowed to attach overnight, before being injured with l()0-mU/ml bleomycin. Two hours post-bleomycin injury 5xl0⁴ AFSC with and without an MMP-2 inhibitor (MMPi), cis-9-Octadecenoyl-N- hydroxyl amide, Oleoyl-N-hydroxylamide, (l OmM) in ethanol (EMB

Biosciences, San Diego, CA) were added to experimental wells and allowed to remain in culture with AECII for an additional 24 hours. At the end of the 24 hour period conditioned media was collected and spun at 1500xg for 5 minutes at 25°C to separate the cellular components. Adherent cells were trypsinized, washed with PBS, pelleted and saved at -80°C for protein or RNA extraction.

Data Presentation and Statistical Analysis : Data are represented as mean ± SEM unless otherwise stated. Comparisons between two groups were determined using a two-tailed Student's t-test. For multiple comparisons, one- factor analysis of variance was used, followed by the appropriate ad-hoc test as dictated by the normality and distribution of the data. All statistical analyses were performed using SigmaPlot 12 (Systate Software Inc., San Jose, CA). P values less than or equal to 0.05 were considered significant and expressed as *p<0.Q5; **p<0.001.

Results

IV AFSC Treatement Inhibits Fibrotic Parenchymal Destruction 28 Days P ost- B 3 e o my cin Inj ur : Histological Specimens receiving AFSC treatment during the acute (day 0) or chronic (day 14) phases of pharenchymal destructions associated with bleomycin injury were stained with Si ius Red/FCF Green. Analyses showed no fibrotic lesions or alveolar destruction in control animals, while animals injured with bleomycin exhibited a large amount of alveolar destruction and collagen deposition (red fibers) (Figure 6, A -B). Animals treated with AFSC at day 0 showed minimal fibrotic changes, limited to minor alveolar septal thickening and marginal alveolar destmction. Mice treated with AFSC at day 14 showed some collagen deposition, alveolar destruction and cellular infiltrate, which occurred mostly in distal subpleural regions of the lung. The Ashcroft score for histological sections from bleomycin-injured lung measured a median of 4 (Ashcroft et al., 1988). In contrast, development of fibrosis in mice that received AFSC either at day 0 or day 14 was significantly diminished, generating median Ashcroft scores of 1 and 2 respectively (<0.05) (Figure 6, C). Furthermore, bleomycin-injured mice demonstrated a significant increase in measurable hydroxyproline content when compared to controls (pO.QOl), but mice treated with AFSC showed a significant reduction in hydroxyproline content when compared to bleomycin-injured cohorts, whether AFSC were administered at day 9 (p<0.05) or at day 14 (p<0.()5) (Figure 6, D). Sham injured control animals injected with AFSC at either day 0 or lay 14 did not develop fibrotic lesions or display changes in hydroxyproline content (data not shown).

IV AFSC Treatment Inhibits Loss of Pulmonary Function Associated with the Developmen of Pulmonary' Fibrosis 28 Days Post-Bleomycin Injury: Pressure-volume (PV) loops describe the mechanical behavior of the lungs and chest wall during inflation and deflation. A shift of the PV-loop downwards along the volume axis occurs due to the de velopment of fibrotic disease, indicating that more pressure is required to inflate the lungs to a given volume (Harris 2005). Following bleomycin injury, a downshift of the PV-loop along the volume axis was observed compared to control animals. Animals given AFSC at day 0 post- bleomycin injury displayed a PV loop at lay 28 nearly identical to control animals. Mice treated with AFSC at day 14 post-bleomycin injury showed an upward shift of the PV-loop along the volume axis as compared to control and bleomycin-injured animals. This upward shift indicates that less pressure was require to inflate the lungs to a given volume and could be attributable to the enlarged air-space size observed in day 14 treated mice in Figure 6, B. (Figure 7, A). The Salazar-Knowles equation was applied to the PV-loop data to quantify hysteresis (the area contained within the pressure- volume loop) (Figure 7, B (Ashcroft et ah, 1988). When compared to control animals, bleomycin-injured mice showed decrease in hysteresis (p<0.05).

Animals that received AFSC treatment at either day 0 or day 14 showed an increase in hysteresis (p<0.Q5) when compared to bleomycin-injured mice. Following bleomycin injury, forced vital capacit routinely decreased (p<0.05) and day 14 (p<0.001 ) (Figure 7, C). Quasi-static compliance, which measures the elastic recoil pressure of the lungs at a g ven volume, decreased following bleomycin injury (p<0.05), but improved in both day 0 and day 14 (p<0.05) AFSC treated cohorts (Figure 7, D).

AFSC Mpdul ates Acute Infiamm atory Cytokine Expression i B A and

Lung Tissue: Proteomic arrays were used to examine BAL and lung tissue cytokine profiles 3 days post-bleomycin injury. Control, bleomycin-injured and bleomycin-injured mice that received AFSC treatment at day 0 were compared. BAL cytokine profiles demonstrated significant changes in C5a (p<0.05), CCL2 (p<().001) and ΤΓΜΡ- 1 (p<0.()5) levels following bleomycin injury and AFSC treatment (Figure 8, A). Analysis of whole lung tissue homogenates (Figure 8, B) showed increases in CCL1, CXCL1 and CCL5 (p<0.05) and a decrease in CXCL9 (p<0.05) following both bleomycin injury and bleomycin injury with day 0 AFSC treatment. Other cytokine modulations in BAL and lung tissue were detected, but were found not to be statistically significantly (Figure 13).

CCL2 concentrations in BAL from animals 3 days post-bleomycin injury- were further quantified via ELISA. BAL collected from control mice exhibited CCL2 levels of 42.67±4.01 pg/ml, while CCL2 levels in BAL from bleomycin- injured animals increased 2-fold to 84.97±13.87 pg/ml (p<0.G5). Animals that received AFSC at day 0 demonstrated a decrease in CCL2 levels to 42.78±5.10 pg/ml (p<0.05) (Figure 8, C). BAL collected from bleomycin-injured animals 28 days post-injury demonstrated an increase in CCL2 when compared to control animals (8G.89±13.07 pg/ml versus 53.15±4.45 pg/ml), in contrast with animals that received AFSC at either day 0 or day 14, which showed significantly decreased levels of CCL2 at the 28 day post-injur time point (20.18±6.23 (pO.001 ) and 32.48+5.49 pg/ml (p<0.05), respectively) (Figure 8, D).

To determine the impact of increased CCL2 concentrations found in BAL post-bleomycin injury could have on collagen synthesis by fibroblasts, 3T3 fibroblasts were exposed to increasing concentrations of recombinant CCL2 in culture. This resulted in a 2.5 fold increase in collagen synthesis when cells were exposed to 100 pg/ml CCL2, similar to the CCL2 levels detected in bleomyc in- injured murine BAL (Figure 8, E). BAL samples analyzed via ELISA in Figure 8, C-D were then used in this same assay. BAL from mice 3 days post- bleomycin injury elicited a moderate but noticeable increase in collagen synthesis by 3T3 cells exposed to BAL from AFSC teat mice (Figure 8, F). BAL from animals 28 days post-bleomycin injury induced a significant increase in collagen synthesis when compared to control animals (p<0.()5). Treatment of bleomycin-injured mice with AFSC at day s 0 or 14 post-injury resulted in production of BAL that induced significantly less collagen synthesis when compared to BAL from bleomycin-injured mice, with 3.34-fold (p<0.001 ) and 1.77-fold (p<0.05) reductions in 3T3 collagen synthesis respectively (Figure 8, G).

AFSC Modulate (^"CI . through M.MP2 Mediated Proteolytic Cleavage: To determine which cells contributed to increased CCL2 levels in BAL following bleomycin injury, CCL2 production by AECii and the cellular component of BAL fluid, which was comprised mainly of macrophages, lymphocytes, and neutrophils, was analyzed (Figure 14), As it was previously demonstrated that AFSC treatment most significantly attenuates CCL2 secreted into the BAL. following bleomycin injury (Figure 3, A-D), Western blots of cell fractions were not used to measure changes in levels of CCL2 secretion, but instead as an indicator of the present and type of intracellular and membrane bound CCL2 within BAL cells and in AECii cellular fractions. Western blots determined that CCL2 was absent from BAL cells in control samples as well as those 3 days post-bleomycin injury, but present 28 days post-injury (Figure 9, A). Western blots of AECII showed constitutive expression of CCL2 in controls, which remained present at 3 days and at 28 days post bleomycin injury (Figure 9, B). More detailed Western blot analysis of CCL2 in AECII cellular fractions 3 days post-bleomycin injury (immunomodulatory time point of interest), using a gradient gel with greater resolving capacity, showed that in controls, as well as following bleomycin injury, mouse specific CCL2 showed a band of the expected molecule weight, 25 kDa (Figure 9, C). However, following AFSC treatment, a subtle shift downward in the CCL2 band was visualized, indicating the cleaveage of a 0,4 kDa peptide, thereby rendering the cleave form of CCL2 a CCR2 receptor antagonist (Denney et al., 2009; Dean et al., 2008; McQuibban et al, 2002). In parallel studies, gelatin zymograp y of BAL harvested 3 days post-bleomycin injury plus AFSC day 0 treatment showed a significant increase in MMP2 (Figure 9, D). This effect was transient, as elevated levels of MMP2 did not persist to 28 days and this was true whether AFSC were given at 0 or day 14 days post-bleomyci injury (Figure 9, E). These data are significant, as CCL2 is a known target of MMP2 proteolytic cleavage, with the CCL2 cleavage product forming the aforementioned receptor antagonist for CCR2 (Denney et al, 2009).

AFSC Chemotacticali Respond to increased CCL2 Gradients : Control mice injected with CM-Dil labeled AFSC did not exhibit fibrotic changes in lung tissue when analyzed using Si ius Red/Fast Green FCF and did not demonstrate retention of AFSC (data not shown). Mice injured with bleomycin and treated with AFSC at either day 0 or day 14 exhibited preferential AFSC retention within fibrotic regions of the lung when examined at day 28 (Figure 10, A). To rule out any contribution by AFSC to the development of fibrotic lesions, a- SMA expression in AFSC in situ in bleomycin-injured and treated lung was analyzed, Colocalization of a- SMA expression with AFSC was not observed (data not shown).

^'TO determine if the presence of AFSC in fibrotic lesions was the result of chemotaxis toward areas of increased CCL2 expression, AFSC was analyzed prior to injection for CCR2 receptor expression. Immuofluorescent staining for CCR2 demonstrated that both murine (pictured) and human AFSC express this receptor prior to injection (Figure 10, B).

Both human and mouse AFSC were assayed for chemotaxis towards increasing concentrations of recombinant mouse CCL2, which is a

chemoattractant for both human and mouse cells that express CCR2 (Deshmane et al., 2009). Murine AFSC migrated in a dose dependent manner toward increasing concentration of CCL2 in culture (Figure 5, C). The greatest AFSC migration observed, toward a concentration of 100 pg/ml (similar to what is found in murine BAL following bleomycin injury), demonstrated a 2.24-fold increase when compared to AFSC not exposed to CCL2, Migration of human AFSC demonstrated a moderate peak at 50 ng/mi, a CCL2 concentration similar to that reported in BAL for IFF patients (Figure 10, D) (Car et al., 1994). BAL samples previously analyzed via ELISA (Figure 8, C-D) were also tested for the ability to chemoattract AFSC, AFSC were significantly more attracted to bleomycin-injured BAL than to BAL from control and day 0 AFSC-treated mice (p<0.05) (Figure 10, E) demonstrating the specificity of CCL2 as a potent chemoattractant for AFSC. Furthermore, upon CCL2 neutralization in BAL samples 3 days post- bleomycin injury using a CCL2 neutralizing antibody (Nab), migration toward control, bieomycin-injured, and bleomycin-injured plus AFSC day 0 treated samples all decreased significantly (pO.001) (Figure 10, E). Finally, AFSC migration toward BAL samples harvested at day 28 post- bleomycin injury demonstrated a significant increase (p<0.05) in chemotaxis when compared to controls. Chemotaxis decreased in both day 0 and day 14 AFSC treated mouse BAL (Figure 10, F).

AFSC Co-Cultured with Bleomycin Injured AECII Inhibits increased CCL2 Expression in Vitro: To further examine the direct interaction between bleomycin-injured AECII and AFSC during the acute inflammatory period, mice were injured with bleomycin or saline, harvested AECII 3 days post- injection, and then co-cultured AECII with AFSC. AECII harvested from saline injected animals grew in circular colonies on fibroiiectm-coated plates, while AECII from bleomycin injected animals grew sporadically and did not appear to attach well (Figure 1 1 , A). Addition of AFSC to bleomycin-injured AECII in culture resulted in the AFSC surrounding bleomycin-injured AECII, which then formed colonies (arrows). Further visualization with CM-Dil labeled AFSC and unlabeled AECII demonstrated a similar phenomenon, in which AFSC surround bleomycin injured AECII colonies (Figure 1 1 , B).

In experiments on cultured AECII that paralleled the previous observation using BAL, elevated levels of secreted CCL2 in conditioned media as measured by ELISA were observed in bleomycin-injured AECII wells at 70.47±6.83 pg/ml compared to 35.85±1.68 pg/^'mJ measured in control AECII wells (p<0.05). Conditioned media from wells containing AECII co-cultured with AFSC demonstrated a decrease in secreted CCL2. levels to 44.91±7.98 pg/ml (p<0.05) (Figure 1 1, C). Conditioned media form cultured ceils isolated form bleomycin-injured lung induced a significant increase in collagen synthesis in 3T3 fibroblasts (p<0.()5) as compared to control AECII conditioned media. This ability to stimulate collagen synthesis was reduced when injured AECII were co-cultured with AFSC (Figure 1 1, D).

CCL2 and CCR2 mRNA levels as determined by qPCR were increased in cultured bleomycin-injured AECII when compared to control AECII, but expression decreased following AFSC co-culture (Figure 1 1, E). MMP2 mRNA expression, normalized against control AECIT, demonstrated a minimal change following bleomycin injury, but increased 21.10±5.96 fold upon AECII co- culture with AFSC (p<0.()5) (Figure 1 1, F). Analysis of tissue inhibitors of metalloproteinases (TIMPs) expression in AECII showed a decrease in the MMP2-specifie inhibitory TIMPs 2 and 3 (p<0.001) following bleomycin injury, which further decreased following AFSC co-culture. Bleomycin treatment caused an increase in TIMP-1 expression, while TIMP-4 expression was not detected (Figure 8). These data confirm that regulation of CCL2/CCR2 and MMP2 are occurring on a transcriptional level as well.

Inhibition of MMP2 In Vitro Attenuates the Ability of AFSC to Reduce CCL2 Expression: To determine if inhibition of MMP2 using an MMP2. specific inhibitor (Oleoyl- -hydroxy] amide) would restore increased mRNA and secreted CCL2 levels observed in cultured AECII following bleomycin injury, an assay in which AECII were injured with bleomycin in vitro and co-cultured with AFSC two hours post-injury was employed. Control levels of CCL2 in AFSC and non-injured AECII conditioned media were measured at 27.1 8±1.78 pg/ml and 38.18 1.75 pg/ml, respectively (Figure 12, A). After each AECII bleomycin injury in vitro, CCL2 levels in the media doubled to 72.13±2.68 pg/ml (p<0.05). Following AFSC co-culture, CCL2 levels significantly decreased to 47.86*1.15 pg/ml. Finally, addition of MMP2 inhibitor to bleomycin- injured AECII co-cultured with AFSC resulted in a significant increase in CCL2 to 62.22±1.42 pg/ml (p<Q.05). Furthermore, this increase in CCL2 was not significantly different from levels in wells that had experienced bleomycin injury alone.

To confirm transcriptional regulation, analysis of cellular mRNA wa s performed via qPCR, normalized against control AECII (Figure 12, B) and demonstrated an increase of CCL2 mRNA accompanied by a significant increase of CCR2 mRNA (p<0.05) following bleomycin injury in vitro and significant increases in both CCL2 and CCR2 mRNA following the additiona of the MMP2 inhibitor (P<0.05). niRNA levels of MMP2, normalized against control AECII, were significantly higher in AFSC prior to co-culture as well as following co- culture (p<0.G5) and showed a noticeable decrease, when compared to AFSC co- cultured wells, following the addition of the MMP2 inhibitor (Figure 12, C). Analysis of TIMPs 1-4 demonstrated a significant increase in TlMP-l (p<0.001 ) following MMP2 inhibition, as well as a decreases in MMP2 inhibitory TIMPs 2 and 3 following AFSC co-culture. ΤΓΜΡ-2 was significantly increased following MMP2 inhibition (p<0.05) while TIMP-4 was not detected (see Figitre 16).

Discussion

IFF is a disease that lacks both a cause and definitive treatment (Meltzer and Noble 2008). Particularly insidious in the progression of IPF is that it is typically not diagnosed until a patient experiences, and presents with, diminished lung function (King et al, 1961 ). Presented herein is a novel treatment strategy for pulmonary fibrosis at this stage. If is demonstrated herein that AFSC treatment preserves lung function when administered during both acute and chronic fibrotic remodeling events associated with bleomycin-induced pulmonai fibrosis in an animal model. While the acute intervention is relevant in that it allowed for the determination of a novel mechanism of action of AFSC, the chronic intervention provides data that are clinically relevant and promises a treatment strategy. Although lung function cannot fully be stored to normal levels due to alveolar destruction caused by the development of fibrosis, it is demonstrated herein that following AFSC treatment, lung function and destruction of alveolar architecture did not progress to the extent seen in untreated cohorts. The inhibition of development of fibrosis was demonstrated by a decrease in measure hydroxyproline content and measure Ashcroff score and improvements in lung mechanics and pulmonary function.

Based upon clinical and experimental characterizations of cellular and molecular response in human IPF, specifically exaggerated CCL2. expression (Car et al., 1994; Shinoda et al, 2009; Antoniades et al., 1992; Prasse et al. 2009), a novel mechanism by which AFSC attenuates this known increase in CCL2 in BAL in experimental fibrosis is described. It is demonstrated that transient and local MMP2 up regulation by AFSC resulted in the proteolytic cleavage of CCL2, thus creating a localized CCL2/CCR2 antagonist within the injured alveolar milieu ihai down regulates pro-fibrotic CCL2/CCR2 signaling. The data indicate that CCL2 regulation by MMP2-mediated proteolytic cleavage occurs acutely following AFSC treatment, but continues chronically in vivo to downreguiaie the CCL2-CCR2 axis. It is believed ihai this transient MMP2 expression is sufficient to cleave excess CCL2 produced during the active disease state, yet transitory enough to avoid parenchymal degradation typically associate with chronic up regulation of MMPs (Dancer et al., 201 1). The mechanism is further supported through analyses of two independent in vitro AECTI injury models in which significant, secreted CCL2 expression was attenuated followmg AFSC co-culture. Finally, it is noted that in all experiments that utilized AFSC, the CCL2 axis was not completely abrogated, which may be needed for the protection of the homeostatic arm of the CCL2/CCR2 signaling pathway (Deshmane et al., 2.009).

The usefulness of these findings lies in the ability of AFSC to not only target their salutary therapeutic properties during clinically relevant intervention periods, but to home to the diseased region of the lung, foregoing non-diseased regions, as seen in the in vitro migration assays and in vivo histology that shows AFSC retention within fibrotic regions. AFSC therapy, unlike previously published MSG based therapy, does not show deleterious secondary effects, such as tumorogenesis or expression of fibrotic phenotypes (McNulty and James 2012). The findings provide insight into the targeting of CCL2/CCR2 pathway in fibrotic lung diseases via a novel cell-based therapy, and pro vides a treatment strategy.

Example 3

Isolation and Culture of human Amniotic Fluid Stem Cells ihAFSC). Five samples of human amniotic fluid from 12- 18 weeks of gestation were isolated and characterized as previously described above. Briefly, the stem cell population was isolated from the general amniotic cellular milieu using standard Magnetic Sorting (MACS) techniques (Miltenyi Biotech, Auburn, C A) against the cell surface marker, c-kit. Pluripotential characteristics of the clonal and subclonal groups were tested according. Clones derived from a single sample of amniotic fluid were cultured in petri dishes in medium containing ct-MEM Medium, 20% Fetal Bovine Serum, 1% L-Glutamine and 1 % antibiotics (pen- strep) (Gibco/ BRL, Rockvilie, MD) supplemented with 20% Chang Medium B and 2% Chang Medium C (Irvine Scientific, Santa Ana, CA),

TafeSe 1 : {gentiftcs&on of the 5 taAFSC isrwss tested;

qPCR, Western Blot analysis and Immunofluorescent staining of lung lineage markers within the 5 ItAFSC cell lines.

Tabte 2: Gene, fexpresston, im¾a e arsd pnmer sequences for tmsa fe markers tested.

The expression profiles from the qPCR analysis are described described in Figure 17, Figure 18 provides Western blot analysis and Figure 19 provides immunofluorescent staining of lung lineage markers.

Bibliography

Perm et al. Methods in Cell Biology, Academic Press, 2008, Volume 86, pages 86-99,

Perm et al. Ceil Proliferation, 2007, Volume 40, pages 936-948.

PCT/US2009/005779 (WO 2010/047824)

Borchers AT, et al, Clin Rev Allergy Immunol 2010: 117-134.

Raghu G, et al., Am J Respir Crit Care Med 2006; 174:810-826. Faner R, et al, Am JRespir Crit Care Med 2012:306-313.

King TE, et al. The Lancet 201 1 ;378: 1949-1961.

Meltzer EB and Noble PW. Or phanet Journal of Rare Diseases 2008;3. Wyren TA. The Journal of Experimental Medicine 201 1 ;208: 1339- 1350. Sisson ΊΉ, Am J Respir Crit Care Med 2009; 1 81 :254-263,

Stricter RM and Mehrad B. Chest 2009:136: 1364- 1370.

Hardie WD, et al., Cell Cycle 2010;9:2769-2776.

Todd NW, et al. BioMed Central Fibrogenesis and Tissue Repair 2012;5 Jenkins G, et al., Thorax 201 1 : 179- 182.^"

Agostini C, and Gurrieri C. Proceedings of the American Thoracic Society 2006;3:357-363.

Rose CE, et al Microcirculation 2003;10:273-288.

Ekert JE, et al., BioMed Central Fibrogenesis and Tissue Repair 2011;4.

Liu X, et al, Am J Respir Cell Mo! Biol 2007;37: 121 -128.

Sun L, et al. American Journal of Phy iology-Lung Cellular and Molecular Physiology 201 l ;300:341 -353.

Moore BB, ill et al, The Journal of Immunology 20 1 ; 167:4368-4377.

Moore BB, et al., The American Journal of Pathology 2005; 166:675-684

Gharaee-Kermani M, et al., Cytokine 2003;24:266-276.

Inoshima 1, et al. American Journal of Physiology-Lung Cellular and Molecular Physiology 2004;286: 1038- 1044.

Xia M et al. Expert Opinion on Therapeutic Patents 2009; 19:295-303.

G reia O, et al . Br Med Bull 2012 ; 101 : 147- 161.

Weiss DJ, et al., Proceedings of the American Thoracic Society

201 1 ;8:223-272.

Warburton D, et al., Proceedings of the American Thoracic

Society 2008;5:703-706.

Neuringer IP.and Randell SH. Respiratory Research 2004;5.

Buckle S, et al. Am J Respir Cell Mol Biol 2011;45: 1212-1221.

Perm L, et al. PLoS ONE 2010;5:e9357.

Sedrakyan S, J Am Soc Nephrol 2012;23:661-673.

Carraro G, Stem Cells 2008;26:2902-2911

Moore BB, and Hogaboam CM. American Journal of

Physiology-Lung Cellular and Molecular Physiology 2007 ;294: 152- 160.

Manali ED, et al. BioMed Central Pulmonary Medicine 201 1 ;! 1.

Zhang K, et al., The Journal of immunology 1994; 1 3:4733-4741.

Smith RE, et al. Am JRespir Cell Mol Biol 1996;15:693-702.

Denney H, et al. Biochem Biophys Res Comrnun 2009;382:3 1-347.

Dean R, et al. Blood 2008;! 12:3455-3464.

McQuibban GA, et al. Blood 2002; 100: 1 160-1 167.

Garcia O, et al. Am J Respir Crit Care Med 2012; 185.

Perin L, et al.Ce// Pro ?/2007;40:936-948.

Lee J, et al. American Journal of Physiology-Lung Cellular and

Molecular Physiology 2005;290:684-693.

Ashcroft T, et al., J Clin Pathol 1988;41 :467-470.

Harris RS. Respir Care 2005;50:78-98.

Deshmane S, et al Journal of Interferon Cytokine Research 20Q9;29:313-

326.

Car B, et al, Am J Respir Crit Care Med 1994; 149:655-659.

Shinoda H, et al. Respiration 2009;78:285-292, Antoniades H, et al, Proceedings of the National Academy of Sciences 1992;89:5371 -5375.

Prasse A and Muller-Quernheim J. Respirology 2009; 14:788-795.

Dancer R, et al, Eur Respir J IM 1 ;38: 1461 - 1467.

McNulty K, and James SM. Proceedings of the American Thoracic

Society 2012;9: 164- 171.

Perin L, et al. Cell Prolif 2007;40:936-948.

Carraro G, et al. Stem Cells 2008;26:2902-291 1.

SedraJkyan S, et al. J Am Soc Nephrol 2012;23 :661 -673.

Buckle S, et al. Am J Respir Cell Mol Biol 201 1 ;45: 1212- 1221.

Perin L, et al. PLoS ONE 2010;5:e9357

Sacco SD, et al. The Journal of Urology 2010; 183 : 1 193- 1200.

All publications, patents and patent applications are incorporated herein by reference. While in (he foregoing specification this invention has been described in relation to certain preferred embodiments thereof, and many details have been set forth for purposes of illustration, it will be apparent to those skilled in the art that the invention is susceptible to additional embodiments and that certain of the details described herein may be varied considerably without departing from the basic principles of the invention.

Claims

WHAT IS CLAIMED IS:

A method to treat a CCL2 and/or a CCR2 mediated disease comprising administering to a subject in need thereof an effective amount of amniotic fluid stem cells (AFSCs) effective to treat the CCL2. and/or CCR2 mediated disease, wherein the AFSCs are positive for c-kit.

The method of claim 1 , wherein the CCL2 and/or CCR2 mediated disease is rheumatoid arthritis (RA), multiple sclerosis (MS), chronic obstructive pulmonary disorder (CORD), atherosclerosis, delayed type hypersensitivity, autoimmune encephalomyelitis, inflammatory arthritis, lupus nephritis, chronic inflammatory diseases, metabolic disease, neuropathic pain, insulin resistance, autoimmune disease, inflammatory disease (such as vascular restenosis), HIV, transplant rejection, and/or cardiovascular disease.

A method to treat lung disease or injury comprising administering to a subject in need thereof an effective amount of amniotic fluid stem cells (AFSCs) effective to treat the lung disease or injury, wherein the AFSCs are positive for c-kit.

The method of claim 3, wherein the disease comprises acute respiratory distress syndrome (ARDS), infant respiratory distress syndrome (IRDS), asbestosis, asthma, bronchiectasis, bronchiolitis, bronchopulmonary dysplasia, chronic bronchitis, coccidiodomycosis (Cocci), emphysema, acute and/or chronic bronchitis, cystic fibrosis, diffuse interstitial fibrosis, hantavirus pulmonary syndrome, histoplasmosis, human rnetapneumovirus, hypersensitivity pneumonitis , influenza, lung cancer, lymphangiomatosis, nontuberculosis mycobacterium, pertussis, pneumoconiosis, pneumonia, primary ciliary dyskinesia, primary pulmonary hypertension, pulmonary arterial hypertension, cavitary pneumonia, pulmonary fibrosis, pulmonary vascular disease, respiratory syncytial virus, sarcoidosis, severe acute respiratory syndrome, silicosis, sleep apnea, sudden infant death syndrome, tuberculosis, and/or chronic obstructive pulmonary disease (COPD).

The method of any one of claims 1-4, wherein the subject is a mammal.

The method of claim 5, wherein the mammal is a human.

The method of any one of claims 1-4, wherein the cells are administered by local or systemic injection.

The method of claim 4, wherein the disease is pulmonary fibrosis.

The method of claim 4, wherein the injury is a result of physical trauma, accident, surgery, smoking, inhaling of harmful chemicals or contaminants, or injury caused by a pathogen.

The method of claim 9 wherein the pathogen is bacterial or viral .

An isolated and purified population of amniotic iluid stem cells positive for c-kit for use in treating lung disease or a CCL2 and/or a CCR2 mediated disease.

The use of an isolated and purified population of amniotic fluid stems cells positive for c-kit to prepare a medicament for treating lung disease or CCL2 and/or a CCR2 mediated disease.

The use of claim 12, wherein the medicament includes a physiologica lly acceptable carrier and/or cell culture medium.

An isolated and purified population of amniotic fluid stem cells positive for c-kit and one or more of FoxPl, A.BCA3 or AQP5.

An isolated and pui'ified population of amniotic iluid stem cells positive for c-kit and one or more of Tlct/PDPN, TTF- 1/ KX2-1 or AQP5.

16. The population ceils of claim 15, wherein the cells are negative for SP-A, SP-B, SP-C, SP-D, CC10 or a combination thereof,

17. The population of cells according to claim 14 or 15 wherein the

population is a clonal population.

18. A composition comprising ihe popuiaiion of cells of any one of claims 14- 17 and a pharmaceutically acceptable carrier and/or culture medium.