WO2013068901A1 - Isolation of novel thermophilic bacteria and thermostable enzymes responsible for the bioreduction of platinum (iv) to elemental platinum - Google Patents

Abstract

The present invention relates to newly discovered, novel strains of thermophilic Geobacillus bacteria isolated from the Northam Platinum Mine (NPM) in South Africa. The present invention further relates to the isolation and characterization of novel thermostable enzymes responsible for the bioreduction of Pt (IV) to elemental Pt. The present invention also extends to the use of the isolated enzymes in the bioreduction of Pt (IV) to elemental Pt and in the microbial transformation of Pt (IV) to platinum nanoparticles. The invention further extends to a process for the bioremediation, or at least partial remediation, of a site contaminated with a source of Pt (IV).

Description

ISOLATION OF NOVEL THERMOPHILIC BACTERIA AND THERMOSTABLE ENZYMES RESPONSIBLE FOR THE BIOREDUCTION OF PLATINUM (IV) TO ELEMENTAL PLATINUM

Field of the Invention

The present invention relates to newly discovered, novel strains of thermophilic GeobaciHus bacteria isolated from the Northam Platinum Mine (NPM) in South Africa. The present invention further relates to the isolation and characterization of novel thermostable enzymes responsible for the bioreduction of Pt (IV) to elemental Pt. The present invention also extends to the use of the isolated enzymes in the bioreduction of Pt (IV) to elemental Pt and in the microbial transformation of Pt (IV) to platinum nanoparticles. The invention further extends to a process for the bioremediation, or at least partial remediation, of a site contaminated with a source of Pt (IV).

Background to the Invention

Microorganisms are the most important and the main source of production of enzymes. Thermophilic microorganisms are defined as groups of microorganisms which grow at a temperature above 50°C, some of them still actively grow at 80°C (Madigan, ef a/., 1997). These organisms can be found in compost, hot springs, deep vents and other geothermal active regions. Thermophilic microorganisms can be used as sources of thermostable enzymes and usually show optimal activity between 60 and 80^°C. Active at high temperatures, thermophilic enzymes typically do not function well below 40^°C (Stetter, K.O., 1996). Thermostable enzymes have a high potential for application as biocatalysts (Akhmaloka, ef a/., 2006). Extensive research on the genetics of thermophiles has resulted in the modification of the known phylogenetic tree. Currently, it is divided into three major groups, which are bacteria, archea and eukarya. Recently, researches on thermophilic bacteria have extensively been carried out since these organisms offer many advantages either for the development of basic sciences or for industrial applications. Thus the isolation of thermophilic bacteria and the purification of thermostable enzymes are of significant importance in industry and scientific researches. The deep mines of South Africa provide relatively easy access to the deep subsurface and unique geochemical characteristics have been explored for novel phylogenetic lineages of microbes. However, very few complete phylogenetic studies of the deep biome have been initiated (Moser ef a/., 2003). Current research has shown novel microbes associated with these mines and thus these mines provide unique opportunities to investigate environments for microorganisms that are able to survive at high temperatures, high pressures, saline groundwater systems and mine drainage systems from high acidity to high alkalinity (Gihring et al., 2006; Takai ef a/., 2001 ). Accordingly, the deep subsurface has been known to conceal a wide biodiversity that is capable of enduring the harshest of conditions (Gold, 1992; Pedersen, 2007).

The Northam Platinum Mine (NPM) is situated in the Republic of South Africa near the South African Bushveld Igneous Complex (BIC). The geological setting of the NPM can be located at the tip of the western limb of the BIC. The BIC is one of the world's largest layered igneous complexes and is host to giant ore deposits of chromate, vanadium and platinum group metals. The complex is also acknowledged for the world's largest concentration of platinum and palladium (Cawthorn, 1999). The approximate age of the BIC at the time of magmatism was determined to be 2054 million years (Scoates and Friedman, 2008).

Microorganisms are involved in metal speciation in a biogeochemically limited environment. The effect of metal speciation by the microorganisms is dependent on the environment and the biogeochemical cycling of the elements that can result in the bio-absorption, immobilization or mobilization of metal particles (Brandl & Faramarzi, 2006). Biomineralization processes can play a vital role in the maintenance of the microorganism's cellular structure. These can be divided into two important processes such as biologically induced mineralization (BIM) for extracellular mineral precipitation and biologically controlled mineralization (BCM) with the advancement of cellular structures for specific processes.

In 2008, Rashamuse and co-workers had proposed a mechanism for the reduction of platinum group metals (PGMs) by resting cells of a consortium of sulfate reducing bacteria that in the presence of hydrogen as the electron donor, cytochrome C₃ and a cofactor and under anaerobic conditions involved a hydrogenase for a two step reduction of platinum. This was further supported by Govender and co-workers (2010), that the resting cells of the fungus, Fusarium oxysporum, was also involved in the bioreduction of PGMs by a dimeric hydrogenase (44.5 kDa and 39.4 kDa subunits) in the presence of hydrogen as the electron donor. Since the reaction occurs in the presence of hydrogen as the electron donor, a hydrogenase is likely to be involved in the bioreduction of PGMs. However, in the case of the absence of a classical hydrogenase of resting cells and with hydrogen as an electron donor under anaerobic conditions the test for whole cell reduction of PGMs has not been done.

The platinum and palladium group nanoparticles have been extensively studied because of their novel catalytic properties. These catalytic characteristics are dependent on a particular array of atoms across the particles with high monodispersity and an even distribution that is required for optimal catalytic functions. There are many chemical methods for the synthesis of platinum nanoparticles that can result in the optimal shapes and sizes preferable for catalytic applications (Herricks et al., 2004; Teranishi ef al., 2000). One method includes the reduction of soluble platinum Pt (IV) and Pt (II) to elemental platinum with the use of stabilizing polymers such as PAA (sodium polyacrylate) or PVP (poly N-vinyl-2-pyrrolidone) in the presence of the reducing agents methanol, ferrous iron, hydrogen gas or sodium borohydride under different conditions of temperature and pH. The morphology of platinum nanoparticles has been manipulated by methods such as the use of sodium nitrate for colloidal distribution of nanoparticles, the freeze thawing method and the exploitation of thermal characteristics (Herricks et al., 2004; Teranishi et al., 2000; Wen et al., 2009). However, these methods are time consuming, tedious and expensive because only high grade reagents are used for optimal platinum nanoparticle shape, atomic and molecular distribution and monodisperity (Daniel & Astruc, 2004; Luo et al., 2006).

Biological inorganic nanoparticles that can be synthesized by cost effective high efficiency applications using microorganisms are part of the promising future for highly specialized nanoparticles. The formation of biological platinum nanoparticles has been described for sulfur reducing bacteria, fungi and algae. As mentioned herein above, the cellular mechanism involved in the biological reduction of platinum by sulfur reducing bacteria and fungi has been proposed to be coupled to an activated hydrogenase, explaining the formation of nanoparticles in the presence of hydrogen (Govender ef al., 2009; Konishi et al., 2007; Rashamuse ef al., 2008). So far, there are no reports on the biological reduction of platinum and the formation of nanoparticles by thermophilic microorganisms from the deep subsurface. The understanding of the mechanisms of metal reductases are playing an important role in the advancement of methods that are being applied to develop optimally sized nanoparticles as well as optimized bioremediation processes for green technology (Mandal ef a/., 2006).

Accordingly, it is clear that there is a need in the art to explore the microbial biodiversity present in platinum mines. Furthermore, since very little is known about the mechanisms involved in Pt (IV) reduction and platinum nanoparticle formation and the enzymes involved in these mechanisms, conclusive evidence as to which enzymes are responsible for these said processes is highly desirable in the art.

For purposes of the present specification, the terms "enzyme(s)" and "protein(s)" will be understood herein to be used interchangeably.

Summary of the Invention

According to a first aspect of the instant invention, the Applicant has isolated nine novel thermophilic Geobacillus strains of bacteria.

For purposes of the present specification, the nine Geobacillus strains are designated as Geobacillus sp. A3, Geobacillus sp. A4, Geobacillus sp. A5, Geobacillus sp. A7, Geobacillus sp. A8, Geobacillus sp. A10, Geobacillus sp. A11 , Geobacillus sp. A12, and Geobacillus sp. A13.

The nine novel Geobacillus strains of bacteria are designated as follows:

Accession Assigned name Closest relative

and sequence size

AB362290.1 Geobacillus sp. A3 (1453 bp) Brevibacillus thermoruber

EU214615.1 Geobacillus sp. A4 (1465 bp) Geobacillus sp. P1

EU680816.1 Geobacillus sp. A5 (1428 bp) Geobacillus thermoparaffinivorans

EU214615.1 Geobacillus sp. A7 (1509 bp) Geobacillus thermoparaffinivorans

EU214615.1 Geobacillus sp. A8 ( 1451 bp) Geobacillus thermoparaffinivorans

^*DGQ55417.1 Geobacillus sp. A10 (1407 bp) Thermus sp. Tibetan G7

FJ529816.1 Geobacillus sp. A1 1 (1425 bp) Geobacillus sp. A83

EU214615.1 Geobacillus sp. A12 (1515 bp) Geobacillus thermoparaffinivorans

EU214615.1 Geobacillus sp. A13 (1495bp) Geobacillus thermoparaffinivorans

As can be observed from the above table, each of the nine novel thermophilic Geobacillus strains of bacteria that have been isolated correlate to a microorganism which has been designated as its closest relative. Thus, the closest relative to Geobacillus sp. A3 is Brevibacillus thermoruber. The closest relative to Geobacillus sp. A4 is Geobacillus sp. P1 ; the closest relative to Geobacillus sp. A5, to Geobacillus sp. A7, to Geobacillus sp. A8, to Geobacillus sp. A12 and to Geobacillus sp, A13 is Geobacillus thermoparaffinivorans; the closest relative to Geobacillus sp, A10 is Thermus sp. Tibetan G7 and the closest relative to Geobacillus sp. A11 is Geobacillus sp. A83.

In an embodiment of the invention, the nine novel thermophilic Geobacillus strains of bacteria may be classified as either Gram negative bacteria or Gram positive bacteria. In a preferred embodiment of the invention, said Geobacillus strains of bacteria are Gram positive bacteria.

The instant invention provides for a combination of two or more of the novel thermophilic Geobacillus strains of bacteria. In an embodiment, the present invention contemplates a microbial consortium including two or more of the foregoing thermophilic Geobacillus strains of bacteria.

In one embodiment of the instant invention, the aforesaid novel thermophilic Geobacillus strains of bacteria (also referred to herein as thermophilic microorganisms) are derived from the Northam Platinum Mine (NPM) in South Africa. Alternatively, said microorganisms are derived from NPM site material. For purposes of the present invention, site material includes environmental media in the form of water, soil or both.

As is described below, the Applicant has shown that the thermophilic Geobacillus strains of bacteria that have been isolated as indentified herein provide a source of thermostable, multifunctional enzymes which are responsible for the reduction of platinum (IV), in a source of platinum (IV), to elemental platinum. Accordingly, said thermostable enzymes play a role as biocatalysts in the bioreduction of platinum (IV), in a source of platinum (IV), to elemental platinum.

In an embodiment of the present invention, the source of Pt (IV) is selected from the group consisting of hydrogen chloroplatinic acid (H₂PtCI₆), potassium tetrachloroplatinate(ll) (K₂PtCI₄), platinum sulfide (PtS), platinum telluride (PtBiTe), platinum antimonide (PtSb), platinum arsenide (sperrylite, PtAs₂). platinum sulfide mineral cooperite ((PtNi)S), and ammonium hexachloroplatinate (ammonium chloroplatinate, (NH₄)₂(PtCI₆)). It will be appreciated that the source of platinum (IV) of the present invention is not limited to the foregoing and accordingly may be any suitable source of platinum (IV).

In accordance with a second aspect of the present invention, there is provided a novel thermostable enzyme derived from Geobacillus sp. A8, as identified herein, that is responsible for the reduction of platinum (IV), in a source of platinum (IV), to platinum (0) wherein the enzyme comprises the amino acid sequence of SEQ ID No: 1.

The isolated enzyme comprising the amino acid sequence of SEQ ID No: 1 is characterized in that it has a molecular mass of 37.7 kDa, as identified by SDS-PAGE gel analysis.

In terms of the present invention, this 37.7 kDa enzyme is determined to be a NADPH dependent oxidoreductase, commonly known as the old yellow enzyme (OYE) or as the OYE oxidoreductase, as revealed by BLAST analysis.

According to a third aspect thereof, the present invention provides for a further novel thermostable enzyme derived from Geobacillus sp. A8, as identified herein, that is responsible for the reduction of platinum (IV), in a source of platinum (IV), to platinum (0) wherein the enzyme comprises the amino acid sequence of SEQ ID No: 2.

The isolated enzyme comprising the amino acid sequence of SEQ ID No: 2 is characterized in that it has a molecular mass of 18.19 kDa, as identified by SDS-PAGE gel analysis.

In terms of the present invention, this 18.19 kDa enzyme is determined to be a hypothetical UPF0234 protein GK7042, also known as the YajQ protein, as revealed by BLAST analysis.

In accordance with the present invention, the enzymes indentified herein are isolated from a culture of Geobacillus sp. A8, recovered and purified.

In terms of the present invention, the temperature range for optimal growth rate of the Geobacillus sp. A8 culture is from 55 to 75°C, the optimal growth temperature being 60°C. The pH range for optimal growth rate of the Geobacillus sp. A8 culture is from 5.5 to 1 1 , the optimal pH being 7. According to a fourth aspect thereof, the present invention provides isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID No: 1 comprising a nucleotide sequence of SEQ ID No: 3.

According to a fifth aspect thereof, the present invention provides isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID No: 2 comprising a nucleotide sequence of SEQ ID No: 4.

For ease of reference, the amino acid sequence and nucleotide sequence pertaining to OYE oxidoreductase and YajQ protein, as referred to in this description and contained in the sequence listing filed herewith, are also set out below.

SEQ ID No: 1 and SEQ ID No: 3 represent the amino acid sequence and nucleotide sequence, respectively, used to identify OYE oxidoreductase.

SEQ ID No: 2 and SEQ ID No: 4 represent the amino acid sequence and nucleotide sequence, respectively, used to identify YajQ protein.

SEQ ID No: 1 -

Met Asn Thr Met Leu Phe Ser Pro Tyr Thr H e Arg Gly Leu Thr Leu

1 5 10 15

Lys Asn Arg He Val Met Ser Pro Met Cys Met Tyr Ser Cys Asp Thr

20 25 30

Lys Asp Gly Ala Val Arg Thr Trp Hi s Lys H e Hi s Tyr Pro Ala Arg

35 40 45

Ala Va l Gly Gin Val Gly Leu H e He Val Glu Ala Thr Gly Val Thr 50 55 60

Pro Gin Gly Arg He Ser Glu Arg Asp Leu Gly H e Trp Ser Asp Asp 65 70 75 80

Hi s He Ala Gly Leu Arg Glu Leu Val Gly Leu Val Lys Glu His Gly

85 90 95

Ala Ala He Gly H e Gin Leu Ala Hi s Ala Gly Arg Lys Ser Gin Val

100 105 110

Pro Gly Glu He He Ala Pro Ser Ala Val Pro Phe Asp Asp Ser Ser

115 120 125

Pro Thr Pro Lys Glu Met Thr Lys Ala Asp H e Glu Glu Thr Val Gin 130 135 140

Ala Phe Gin Asn Gly Ala Arg Arg Ala Lys Glu Ala Gly Phe Asp Val 145 150 155 160

He Glu He Hi s Ala Ala Hi s Giy Tyr Leu He Asn Glu Phe Leu Ser

165 170 175

Pro Leu Ser Asn Arg Arg Gin Asp Glu Tyr Gly Gly Ser Pro Glu Asn

180 185 190

Arg Tyr Arg Phe Leu Gly Glu Val He Asp Ala Val Arg Glu Val Trp

195 200 205

Asp Gly Pro Leu Phe Val Arg H e Ser Ala Ser Asp Tyr His Pro Asp 210 215 220

Gly Leu Thr Ala Lys Asp Tyr Val Pro Tyr Thr Lys Arg Met Lys Glu 225 230 235 240

Gin Gly Val Asp Leu Val Asp Val Ser Ser Gly Ala He Val Pro Ala

245 250 255

Arg Met Asn Val Tyr Pro Gly Tyr Gin Val Pro Phe Ala Glu Leu He

260 265 270 Arg Arg Glu Ala Asp lie Pro Thr Gly Ala Val Gly Leu He Thr Ser 275 280 285

Gly Trp Gin Ala Glu Glu He Leu Gin Asn Gly Arg Ala Asp Leu, al 290 295 300

Phe Leu Gly Arg Glu Leu Leu Arg Asn Pro Tyr Trp Pro Tyr Ala Ala 305 310 315 320

Ala Arg Glu Leu Gly Ala Lys He Ser Ala Pro Val Gin Tyr Glu Arg

325 330 335

Gly Trp Arg Phe

340

SEQ ID No: 2-

Met Ser Lys Glu Ser Ser Phe Asp He Val Ser Lys Val Asp Leu Ser 1 5 10 15

Glu Val Ala Asn Ala He Asn He Ala Met Lys Glu He Lys Thr Arg

20 25 30

Tyr Asp Phe Lys Gly Ser Lys Ser Asp He Ser Leu Glu Lys Asp Glu

35 40 45

Leu Val Leu lie Ser Asp Asp Glu Phe Lys Leu Glu Gin Leu Lys Asp

50 55 60

Val Leu lie Gly Lys Leu He Lys Arg Gly Val Ala Thr Lys Asn He 65 70 75 80

Gin Tyr Gly Lys He Glu Pro Ala Ala Gly Gly Thr Val Arg Gin Arg

85 90 95

Ala Lys Leu Val Gin Gly He Asp Lys Glu Asn Ala Lys Lys He Thr

100 105 110

Thr lie He Lys Asn Thr Gly Leu Lys Val Lys Ser Gin Val Gin Asp

115 120 125

Asp Gin He Arg Val Ser Gly Lys Ser Lys Asp Asp Leu Gin Lys Val

130 135 140

He Ala Ala He Arg Glu Ala Asp Leu Pro He Glu Val Gin Phe Val 145 150 155 160

Asn Tyr Arg SEQ ID No: 3- atgaacacga tgctgttttc gccgtataca atccgcgggc tgacgctgaa aaaccgaatt 60 gtcatgtcgc cgatgtgcat gtattcgtgc gacacgaaag acggcgccgt acgcacgtgg 120 cataaaatcc actacccggc tcgcgctgtc ggccaagtcg gcttgattat cgttgaagcg 180 accggcgtga cgccgcaagg tcgcatttct gaacgcgact taggcatttg gagcgatgac 240 catatcgccg ggcttcgcga actcgttggg cttgtgaaag agcatggggc ggccatcggc 300 atccagcttg cccatgcggg gagaaaatcg caagtgccgg gagagatcat cgctccgtca 360 gccgtcccgt ttgatgattc gtcgccgacg ccaaaagaaa tgacgaaagc cgacattgaa 420 gaaacggtgc aagcgttcca aaacggcgca cggcgcgcga aggaagccgg ctttgacgtc 480 attgaaatcc atgccgccca cggctacctc attaacgaat ttttatcgcc gctctccaac 540 cggcgccaag acgagtacgg cggctctccg gaaaaccgtt accgtttctt gggcgaggtg 600 atcgacgctg tccgcgaggt gtgggacgga ccgctttttg tccgcatctc ggcgtccgac 660 taccatccgg acgggctgac ggccaaagac tatgtcccat acaccaagcg gatgaaagaa 720 caaggagtcg acctcgtcga tgtcagctcc ggcgctattg ttccggcgcg catgaacgtc 780 tatcccggct accaagtgcc atttgccgaa ctgatccgcc gtgaagcaga catcccgacc 840 ggcgctgtcg gcctcattac gtccggctgg caagcggaag aaattttgca aaacggccgc 900 gccgatctcg tctttttggg gcgcgagctg ctgcgcaacc cgtattggcc atacgccgcg 960 gcgagagagc tgggcgcaaa aatctcggcg cccgtccaat atgagcgcgg ctggcggttt 1020 taa 1023

SEQ ID No: 4- atgtcgaaag aaagttcgtt tgatatcgta tccaaagtcg atttgtcgga agtggcgaac 60 gccattaaca tcgccatgaa agaaatcaaa acgcgctacg acttcaaagg aagcaaaagc 120 gacatttcgc tcgagaaaga cgagctcgtt ctcatctccg acgacgagtt taagcttgag 180 cagctgaaag atgtgctcat cggcaagctc attaaacgcg gggtggcgac gaaaaacatc 240 caatacggca aaatcgagcc ggccgcaggc ggcacagtgc gccagcgcgc caagcttgtc 300 caagggatcg acaaagaaaa cgcgaaaaaa atcaccacga tcatcaagaa caccggcttg 360 aaagtgaaaa gccaagtgca agatgaccaa attcgcgtca gcggcaaaag caaagacgac 420 ttgcaaaagg tgatcgccgc cattcgcgaa gcggatttgc cgattgaggt gcagtttgtg 480 aattatcgat aa 492 The isolated enzyme comprising the amino acid sequence of SEQ ID No: 1 , indentified as the OYE oxidoreductase herein, and the isolated enzyme comprising the amino acid sequence of SEQ ID No: 2, identified as the YajQ protein herein, are thermostable enzymes and have been found by the Applicant to be novel biocatalysts in the bioreduction of platinum (IV) to elemental platinum.

Without wishing to be bound by theory, the Applicant believes that the isolated enzymes identified herein are capable of performing more than one function. Such enzymes are commonly referred to in the art as "moonlighting proteins" or as "multi-tasking enzymes".

For purposes of the present invention, platinum (IV) reduction is determined by observing a colour change with elemental platinum observed as a black precipitate in solution. Furthermore, platinum (IV) reduction is confirmed spectrophotometrically by observing the gradual shifting of the peaks for each oxidation state over time.

According to a sixth aspect of the invention, there is provided the use of OYE oxidoreductase, as described and characterized herein, in the bioreduction of Pt (IV), in a source of Pt (IV), to Pt (0).

According to a seventh aspect of the invention, there is provided the use of YajQ protein, as described and characterized herein, in the bioreduction of Pt (IV), in a source of Pt (IV), to Pt (0).

In an embodiment of the invention, the OYE oxidoreductase of SEQ ID No: 1 is produced recombinantly by expressing the nucleotide sequence of SEQ ID No: 3 encoding the enzyme in a host cell. With the aid of an expression vector, the nucleic acid molecules containing the nucleotide sequences of SEQ ID No: 3 may be transfected and expressed in a host cell.

In a further embodiment of the invention, the YajQ protein of SEQ ID No: 2 is produced recombinantly by expressing the nucleotide sequence of SEQ ID No: 4 encoding the enzyme in a host cell. With the aid of an expression vector, the nucleic acid molecules containing the nucleotide sequences of SEQ ID No: 4 may be transfected and expressed in a host cell.

Thus the present invention also relates to vectors that include the nucleotide sequence of SEQ ID No: 3 and/or SEQ ID No: 4, as the case may be, host cells that are genetically engineered with one or more recombinant expression vectors, and the production of OYE oxidoreductase of SEQ ID No: 1 and/or of YajQ protein of SEQ ID No: 2, as the case may be, by recombinant techniques as is well known in the art.

The present invention further provides a method for producing OYE oxidoreductase, as identified herein, which is responsible for the bioreduction of Pt (IV,) in a source of Pt (IV), to Pt (0), the method including the steps of:

a) transfecting the nucleic acid molecules of SEQ ID No: 3 into a host cell;

b) culturing the host cell so as to express the OYE oxidoreductase of SEQ ID No: 1 in the host cell; and c) optionally, isolating and purifying the OYE oxidoreductase of SEQ ID No: 1.

The present invention further provides a method for producing YajQ protein, as identified herein, which is responsible for the bioreduction of Pt (IV), in a source of Pt (IV), to Pt (0), the method including the steps of:

a) transfecting the nucleic acid molecules of SEQ ID No: 4 into a host cell;

b) culturing the host cell so as to express the YajQ protein of SEQ ID No: 2 in the host cell; and

c) optionally, isolating and purifying the YajQ protein of SEQ ID No: 2.

According to an eighth aspect thereof, the present invention provides a process for the bioremediation, or at least partial bioremediation, of a site contaminated with a source Pt (IV), the process comprising the steps of introducing an electron donor to the contaminated site in order to stimulate the proliferation of one or more of the thermophilic microorganisms selected from the group consisting of GeobaciHus sp. A3, Geobacillus sp. A4, Geobacillus sp. A5, Geobacillus sp. A7, Geobacillus sp. A8, Geobacillus sp. A10, Geobacillus sp. A1 1 , Geobacillus sp. A12, and Geobacillus sp. A13 to reduce the Pt (IV), in the source of Pt (IV) present therein, to Pt (0). According to one embodiment of the eighth aspect of the invention, the microorganism is Geobacillus sp. A8 as identified herein.

According to a ninth aspect of the invention, there is provided a process for the bioremediation, or at least partial bioremediation, of environmental media contaminated with a source of Pt (IV), the process comprising the steps of removing environmental media from a Pt (IV) contaminated site and introducing an electron donor to such environmental media for a sufficient period of time so as to allow the one or more thermophilic microorganisms selected from the group consting of Geobacillus sp. A3, Geobacillus sp. A4, Geobacillus sp. A5, Geobacillus sp. A7, Geobacillus sp. A8, Geobacillus sp. A10, Geobacillus sp. A1 1 , Geobacillus sp. A12, and Geobacillus sp. A13 to reduce the Pt (IV), in the source of Pt (IV) present therein, to Pt (0).

According to one embodiment of the ninth aspect of the invention, the microorganism is Geobacillus sp. A8 as identified herein.

In an embodiment of the invention, the Pt (IV) contaminated site and the site material discussed in terms of the eighth and ninth aspects of the invention is the NPM site and NPM site material, respectively.

For purposes of the present specification, the term novel thermophilic Geobacillus strains of bacteria (said term also being referred to herein as thermophilic microorganisms) may be used, interchangeably, with the term novel Pt (IV) reducing bacteria.

The present invention thus contemplates employing the novel Pt (IV) reducing bacteria, as identied herein, for the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) that can be practiced in situ, ex situ, or both.

The reduction of Pt (IV) to Pt (0) is initiated by an electron donor. It will be appreciated that the electron donor may be any suitable electron donor of the type known and described in the art. In one embodiment of the invention, the electron donor is selected from the group consisting of H₂, lactate, glucose, and pyruvate. In a preferred embodiment of the invention, the electron donor is H₂.

The invention provides for certain substrates including, but not limited to, L-Arabinose, D-Ribose, D-Trehalose, D- xylose, a-ketovaleric acid, L-malic acid, pyruvic acid, acetic acid, methyl ester, succinic acid, D-cellobiose, D- Galactose, a-D-Lactose, maltose, sucrose and/or glycerol.

In one embodiment of the present invention, Pt (IV) reduction takes place under aerobic and/or anaerobic conditions. Preferably, reduction takes place under anaerobic conditions so as to prevent the reduced Pt (0) from being oxidized to Pt (IV).

The chemical reaction involved in the reduction of platinum (IV), where the source of platinum (IV) is hydrogen chloroplatinic acid, to elemental platinum by the novel platinum (IV) reducing enzymes of the present invention can be represented as follows:

H_;.PtCI₆ + 2H_? H> Pt (0) + 6HCI

Thus, in terms of the present invention, H₂ as an electron donor is introduced to the NPM site or to NPM site material in order to stimulate the proliferation of the novel platinum (IV) reducing bacteria, as identified herein, thereby facilitating said bacteria to reduce the platinum (IV), in the source of platinum (IV) present in the NPM site or the NPM site material, to elemental platinum.

Further, the present invention provides for the use of novel platinum (IV) reducing bacteria, as identified herein, in the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) or of environmental media contaminated with a source of Pt (IV).

The invention yet further provides for the use of novel Pt (IV) reducing bacteria, as identified herein, in the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) or of environmental media contaminated with a source of Pt (IV), wherein said Pt (IV) reducing bacteria are indigenous to the site or to the environmental media, contaminated with a source of Pt (IV), that is to be remediated, or at least partially remediated.

The invention thus provides novel Pt (IV) reducing bacteria, indigenous to the NPM contaminated site or to the NPM contaminated site material to be remediated, or at least partially remediated.

In view of the foregoing, the Applicant has found that, in the absence of a classical hydrogenase, Pt (IV) reduction by either or both of the novel isolated thermostable enzymes, namely OYE oxidoreductase and YajQ protein as identified herein, to elemental platinum is achieved.

Thus, without wishing to be bound by theory, the Applicant believes that an alternative metobolic pathway or mechanism to that described in the art is involved in the bioreduction of Pt (IV) to elemental Pt.

In this regard, the Applicant believes that the classical hydrogenase is not involved in the reduction of Pt (IV) to Pt (0) by the novel Pt (IV) reducing bacteria of the instant invention, this thus being indicative that the novel Pt (IV) reducing bacteria, in particular Geobacillus sp. A8, possesses a different metabolic interaction with platinum than what is taught in the art with respect to known bacterial strains and metal reduction.

In addition thereto, the Applicant has further surprisingly found that both OYE oxidoreductase and YajQ protein, as identified herein, are responsible for the microbial transformation of Pt (IV) to platinum nanoparticles.

Thus, according to a yet further aspect of the invention, there is provided the use of OYE oxidoreductase, as described and characterized herein, in the microbial transformation of Pt (IV) to platinum nanoparticles.

According to a still yet further aspect of the invention, there is provided the use of YajQ protein, as described and characterized herein, in the microbial transformation of Pt (IV) to platinum nanoparticles. In this regard, the Applicant believes that Pt (IV) bioreduction and platinum (0) deposition may occur by the bio- absorption of the PtCL₆ ^2" ions from solution into the periplasmic space of the bacterial cell of the novel Pt (IV) reducing bacteria of the instant invention and enzyme reduction of the PtCL₆ ^2"ions with hydrogen as the electron donor.

Thus, the invention further provides for the formation, deposition and bioaccumulation of platinum nanoparticles, by Geobacillus sp. A8, to be localized in the periplasmic space of the cell, as revealed by TEM analysis.

The above therefore suggests that the enzymes responsible for nanoparticles formation, namely OYE oxidoreductase and YajQ protein, are located in the periplasm.

In an embodiment of the invention, the nanoparticles are characterized as being spherical and possessing a particle diameter ranging from 20 nm to 480 nm as analyzed by electron dispersive spectrometry, X-ray diffraction analysis and particle size and distribution analysis.

According to a further aspect of the invention, there is provided a method for producing platinum nanoparticles, the method including the step of contacting Geobacillus sp. A8 with a source of Pt (IV) in the presence of an electron donor for a sufficient amount of time in order to allow for Pt (IV) bioreduction, microbial transformation of Pt (IV) and for platinum (0) deposition.

These and other objects, features and advantages of the invention will become apparent to those skilled in the art following the detailed description of the invention as set out in the Examples.

Brief Description of the Drawings

Photographs depicting the cells as stained with DAPI when viewed under a fluorescent light microscope at 100 x magnification. (A) Represents NO212FW050508 biomass and (B) represents NO24FW030908 biomass. Scale bar = 20Mm;

Figure 2: A 1 % [w/v] agarose gel to show DNA extraction of the fissure water sample using the metagenomics DNA isolation kit (Epicentre, U.S. A). The gel was stained with Goldview and visualized under UV radiation using the Gel Doc system (Bio-Rad laboratories). Lane 1 : Molecular weight marker, Lane 2: Genomic DNA isolated from fissure water NO212FW050508, and Lane 3: Genomic DNA isolated from fissure water NO24FW030908;

Figure 3: A DGGE fingerprint analysis of partial rRNA genes (A) 16S rRNA genes (B) 18S rRNA genes, derived from fissure water DNA. The gel gradient consisted of a 40% - 60% urea formamide gradient;

Figure 4: A graph depicting the rarefaction curves of unique OTUs calculated with DOTUR for the 16S rRNA clone library at a 1 % (interspecies level), 3% (species level) and 20% (phylum level) distance for sample NO24FW030908. ■ = 1 % distance, —♦— = 3% distance, = 20% distance. Error bars represent the 95% confidence interval;

Figure 5: A phylogenetic tree generated by the ARB program using the neighbour-joining algorithm based on 16S rRNA gene sequences derived from sample NO24FW030908 and reference strains from GenBank. Bootstrap values of 40% and above are shown. The scale indicated a 10% difference in every 100 nucleotide base per sequence; Figure 6: A pie chart depicting the axonomic assignment microbial community composition of the four major phylogenetic groups present in sample NO24FW030908 detected by 16S rRNA gene sequence analysis. ^a = γ-Proteobacteria, ^Q= β-Proteoobacteria, ^a= a-Proteobacteria, ta = Firmicutes;

Figure 7: A graph depicting the rarefaction curves of unique OTUs calculated with DOTUR (Schloss and

Handelsman, 2005) obtained for the 18S library of 40 clones at a 1 % (interspecies level), 3% (species level) and 20% (phyla level) distance for sample NO24FW030908.— a— = 1 % distance, ^~ τ¾— = 3% distance,—— = 20% distance. Error bars represent the 95% confidence interval;

Figure 8: A phylogenetic tree generated by the ARB using the Neighbour joining distance method based on 18S rRNA gene sequences and reference strains from GenBank to show eukaryote diversity of sample NO24FW030908. Bootsrap values of 40% and above are shown. The scale indicated a 10% difference in every 100 nucleotide base per sequence;

Figure 9: Photographs depicting the gram stain of (A) Thermus sp. A10, a Gram negative microorganism and (B) Geobacillus sp. A8, a Gram positive microorganism. Scale bar = 20pm;

Figure 10: A phylogenetic tree generated by the RDP tree builder online software using the Neighbour joining distance method based on 16S rRNA gene sequences of isolates cultured from the fissure water from level 12 at the NPM and reference strains from GenBank to show the relationship and novelty of isolates. Bootsrap values of 40% and above are shown. The scale indicated a 2% difference in every 100 nucleotide base per sequence; Figure 11 : Micrographs illustrating cell morphology of novel Geobacillus sp A8 and Geobacillus sp. A12 at 1000 X magnification. (A-C) represents cell morphology of Geobacillus sp. A8 and (D-F) represents cell morphology of Geobacillus sp. A12. (A) and (D) are unstained cells, (B) and (E) are Gram stain analyses, (C) and (F) are DAPI stain analyses. Bars represent 5pm;

Figure 12: Graphs depicting the growth rates to illustrate the effect of temperature, pH and salinity. (A-C)

Growth curves for Geobacillus sp. A8— and Geobacillus sp. A12—— at (A) different temperatures, (B) different pH and (C) different salt concentrations;

Figure 13: A graph representing the comparison of fatty acid profiles for Geobacillus sp. A8, Geobacillus sp. A12 and their relatives. (1 ) Geobacillus sp. A8, (2) Geobacillus sp. A12, (3) Geobacillus kaustophilus TERI NSM (Sood & Lai, 2008), (4) Geobacillus thermoleovorans GE-7 (DeFlaun et al., 2007), (5) Geobacillus jurassicus DS1 , (6) Geobacillus jurassicus DS2 (Nazina ef a/., 2005);

Figure 14: A graph representing a standard curve for H₂PtCI₆ detection at 261 nm. The standard deviation is shown in error bars;

Figure 15: A graph representing a standard curve for the BCA protein assay with BSA as the protein standard. Standard deviation is shown as error bars;

Figure 16: A photograph depicting a control reaction of 2 mM aqueous chloroplatinic ions for the platinum reduction assay in the absence of cells after two weeks at 55°C. Reduction was observed as a black precipitate at the meniscus; Figure 17: Photographs depicting platinum reduction for isolates cultured from the NPM, where (A) is the positive reaction with a black brown precipitate observed, (B) is the negative control in the presence of cells and absence of Pt (IV) and (C) is the negative control in the presence of Pt (IV) and the absence of cells;

Figure 18: Wavelength scans for whole cell reduction by Geobacillus sp. A8 taken over time to detect the surface plasmon resonance for platinum over time. (A) peak at approximately 261 nm at time 0 indicates the presence of Pt (IV), (B) After 2-3 hours a peak is observed at 235 nm to indicate the reduction of Pt (IV) to Pt (II), (C) After a further 2 hours the only peak observed at approximately 235 nm indicates the presence of Pt (II) and the disappearance of Pt (IV);

Figure 19: (A) and (B) are TEM images of cells of Geobacillus sp. A4 after exposure to 2 mM aqueous

H₂PtCI₆ solution. Arrows indicate possible extracellular platinum. Scale bar = 1000 nm;

Figure 20: TEM micrographs showing the cell morphology and platinum particle distribution after exposure to 2 mM aqueous H₂PtCI₆ solution. (A) are cells of Geobacillus sp. A8 and (B) are cells of Thermus scotoductus SA-01. The black arrows indicate extracellular spherical particles. Scale Bar for (A) = 500 nm and (B) = 2 μηη;

Figure 21 : (A) and (B) are TEM micrographs of a thin section of Geobacillus sp.A8 cell after exposure to 2 mM aqueous H₂PtCI₆ solution to visualize the localization of biogenic platinum nanoparticles. Black arrows indicate particles localized in the periplasmic space. Scale (A) = 1000 nm and (B) = 500 nm; Figure 22: Shows the EDS analysis to confirm the presence of elemental platinum from Geobacillus sp.

A8. (A) is a micrograph of platinum nanoparticles after exposure to 2 mM H₂PtCI₆ solution and (B) is a EDS elemental composition profile. The white arrows indicate the platinum nanoparticles and the black arrows indicate the platinum in the element composition. Scale bar = 200 nm;

Figure 23: Shows the EDS analysis to confirm the presence of elemental platinum from Thermus scotoductus SA-01. (A) is a micrograph of coupled EDS to TEM after exposure to 2 mM H₂PtCI₆ solution and (B) is a EDS elemental composition profile. The white arrows indicate the platinum nanoparticles and the black arrows indicate the platinum in the element composition. Scale bar = 100 nm;

Figure 24: Photographs depicting the results of a scanning electron microscope coupled to an Auger PHI

700 nanoprobe to determine the element composition, size and shape of platinum particles. (A- D) Geobacillus sp. A8 after exposure to 2 mM H₂PtCI₆ solution and (E-F) Thermus scotoductus SA-01 after exposure to 2 mM H₂PtCI₆ solution. The white arrows indicate spherical nanoparticles and microbe-metal interactions. (A) Scale bar = 2 pm; (B), (D), (F) = 0.200 pm; (C), (E) = 0500 pm;

Figure 25: Graphs depicting the results of a Scanning electron microscope coupled to an Auger PHI 700 nanoprobe to determine the element composition of platinum particles. (A) and (B) are the kinetic energy spectra for the element composition of the aqueous solution for Geobacillus sp. A8 and Thermus scotoductus SA-01 respectively. The black arrows indicate the composition profile for platinum; Figure 26: X-Ray diffraction emission profiles with the intensity of X-Ray spectra versus the Bragg angles to determine the crystallite size and distortion of platinum. (A) Geobacillus sp. A8 after exposure to 2 rnM H₂PtCI₆ solution and (B) Thermus scotoductus SA-01 after exposure to 2 mM H₂PtCI₆ solution.

Figure 27: Graphs representing the size and particle distribution using the NanoTrac system for (A)

Geobacillus sp. A8 and (B) Thermus scotoductus SA-01. (— ) indicates the cumulative sum of nanoparticles;

Figure 28: Graphs depicting the PSD profile comparisons for the Geobacillus sp. A8 and Thermus scotoductus SA-01. (A-B) Volume weighted PSD and (C-D) Number weighted PSD. (A) and (C) Geobacillus sp. A8, (B) and (D) Thermus scotoductus SA-01. The Geobacillus sp. A5 showed similar distribution to A8;

Figure 29: A schematic diagram to illustrate the spherical agglomeration of nanoparticles (Taken from

Kausch and Michler (2007));

Figure 30: A proposed mechanism by the activation of a hydrogenase by a cofactor and cytochrome c₃ in the bio-reduction of platinum by sulfate reducing bacteria and a fungus Fusarium oxysporum (Taken from Rashamuse ef a/., 2008 and Govender et a/., 2009);

Figure 31 : Photographs depicting the test for hydrogen oxidation bacteria in minimal chemolithotrophic media. (A) Aerobic growth of Geobacillus sp. A8 and Thermus scotoductus SA-01., Anaerobic growth with H₂ as electron donor and Fe(lll) as the electron acceptor (B) Thermus scotoductus SA-01 , (C) Geobacillus sp. A8; Photograph showing a hydrogenase assay by the reduction of TTC to triphenylformazine in (A) Geobaallus sp, A8 and (B) Thermus scotoductus SA01 colonies, confirming the absence of a classical hydrogenase in Geobaallus sp. A8;

A 1% [w/v] agarose gel to show genomic DNA extraction Geobaallus sp. A8. The gel was stained with Goldview and visualized under UV radiation using the Gel Doc system (BIORAD). Lane 1 : Molecular weight marker, Lane 2: Genomic DNA;

A pie chart depicting the gene distribution of each role category for Geobacillus sp. A8;

Photographs depicting the platinum reduction assays of subcelluar fractions. (A) periplasmic fraction, (B) cytoplasmic fraction, (C) spheroplasts and membrane fractions. A black precipitate is evident of the reduction of platinum (IV) to platinum (0);

SDS-PAGE analysis showing the subcelluar fractions of Geobaallus sp. A8 separated by a 10% [w/v] SDS-PAGE. Lane 1 : cytoplasm, lanes 2 and 3: spheroplasts, lanes 4 and 5: periplasm and lane 6: protein standards;

SDS-PAGE analysis showing the periplasmic fraction of Geobacillus sp. A8 separated by a 10% [w/v] SDS-PAGE;

The elution profile for the anion exchange chromatography for protein purification of the periplasmic fraction;

SDS-PAGE analysis - (A) a 10% [w/v] SDS-PAGE, Lane 1 ; MWM, lane 2: unbound fraction, lane 3: 25 min fraction, lane 4: 30 min fraction, lane 5: 32 min fraction, lane 6: 35 min fraction, lane 7: 37 min fraction, lane 8: 40 min, lane 9: 43 min fraction, lane 10: 50 min fraction and (B) a 15% [w/v] SDS-PAGE with lanes loaded with the same samples as described in (A); Figure 40: SDS-PAGE analysis showing the separation of the proteins from the periplasmic fraction from Geobacillus sp. A8 using the Amicon® concentrator. (A) a 10% [w/v] SDS-PAGE to show the proteins separated by the 30 kDa membrane and (B) a 10% [w/v] SDS-PAGE to show fractions separated by the 30 kDa and 10 kDa membranes where the orange squares represent the bands excised for mass spectrometry. M = molecular weight marker;

Amino acid sequence showing the multiple protein alignment of the OYE trypsin peptide fragment (highlighted text), Geobacillus sp. A8 OYE and the OYE from the closest blast hits to the OYE trypsin peptide fragment;

Figure 42: Amino acid sequence showing the multiple protein alignment of the hypothetical YajQ trypsin peptide fragment (highlighted text), Geobacillus sp. A8 YajQ and the YajQ from the closest blast hits to the YajQ trypsin peptide fragment.

Figure 43: Flowchart to illustrate experimental workflow for the expression and purification of the OYE and

YajQ protein;

Figure 44: Map of pSMART low copy vector indicating the transcription terminators, multiple cloning sites, the origin of replication and kanamycin resistant gene;

Figure 45: Map of pET 22b (+) expression vector indicating the multiple cloning site, restriction sites, the lac I gene and the ampicillin resistant gene. The pelB leader sequence is shown at the N- terminal for unfused protein and the C-terminal His Tag sequence for optional fusion protein;

Figure 46: Map of pET 28b (+) expression vector indicating the multiple cloning site, restriction sites, the lac I gene and the kanamycin resistant gene. The N-terminal His Tag sequence and the thrombin cleavage site fusion are shown; Figure 47: Genomic DNA isolated from Geobacillus sp. A8. Lane 1 : Molecular weight marker (MWM) and lane 2: genomic DNA;

Figure 48: Gradient PCR for the optimization of the amplification conditions of the OYE and YajQ genes.

(A) amplification of the OYE gene with different primer annealing temperatures, Lane 1 : MWM, lane 2: 51 °C, lane 3: 52°C, lane 4:53°C, lane 5: 54°C, lane 6: 55°C, lane 7: 56°C, lane 8: 57°C, lane 9: 58°C and (B) amplification of the YajQ gene with different primer annealing temperatures, Lane 1 : MWM, lane 2: 45°C, lane 3: 46°C, lane 4: 47°C, lane 5: 48°C, lane 6: 49°C, lane 7: 50°C, lane 8: 51 °C, lane 9: 52°C, lane 10: 53°C. The lanes with the white arrow indicates the selected optimal primer annealing temperatures;

Figure 49: Double digest of the pSMART vector containing the OYE gene with restriction enzymes Ndel and Xhol. Lane 1 : MWM, lanes 2-1 1 : clones 1 to 10 screened for a positive insert. The black arrow indicates the clones that could contain the correct insert and the double arrow indicates the selected clone for excision of insert;

Figure 50: Double digest of the pSMART vector containing the YajQ gene with restriction enzymes Ndel and EcoRI. Lane 1 : MWM, lanes 2-7: clones 1 to 5 screened for a positive insert. The black arrow indicates the selected clone for excision of insert;

Figure 51 : Double digestion of pET 22b (+) and pET 28b (+) expression vectors containing the gene of interest (A) expression vectors digested with Ndel and Xhol containing the OYE gene, lane 1 : MWM, lanes 2-5: clones screened for inserts in pET 22b (+) vector, lanes 6-9: clones screened for inserts in pET 28b (+) and (B) expression vectors digested with Ndel and EcoRI containing the YajQ gene, lane 1 : MWM, lanes 2-6: clones screened for inserts in pET 22b (+) vector, lanes 7-1 1 : clones screened for inserts in pET 28b (+) vector. Black arrows indicate the clones selected for sequencing and further expression studies; Figure 52: Sequence alignment of the reference (sequence) OYE from Geobacillus sp. A8 and the OYE from the Geobacillus sp. A8 genome database;

Figure 53: Sequence alignment of the reference (sequence) YajQ gene from Geobacillus sp. A8 and the

YajQ gene from the Geobacillus sp. A8 genome database;

Figure 54: SDS-PAGE analysis to show the expression of the recombinant OYE and YajQ proteins using the pET22 b(+) and pET 28b(+) expression systems with the negative controls (A) OYE expression in pET 22b(+), (B) OYE expression in pET 28b(+), (C) YajQ expression in pET22b(+) and (D) YajQ expression in pET 28b(+). S=spheroplasts, C=cytoplasm, M=membranes. Black arrows indicate the expression of the protein of interest;

Figure 55: Graphs depicting the purification of the OYE expressed in the pET vector systems (A) pET expression 22b elution profile from size exclusion chromatography and (B) pET 28b expression elution profile from the I MAC;

Figure 56: SDS-PAGE analysis to show fractions collected during size exclusion chromatography and

I MAC of the OYE (A) size exclusion chromatography, (B) I MAC. The black arrow indicates the most homogenous protein collected;

Figure 57: Graphs depicting the purification of the YajQ expressed in the pET vector systems (A) pET expression 22b elution profile from size exclusion chromatography and (B) pET 28b expression elution profile from the I MAC; Figure 58: SDS-PAGE analysis to show fractions (F1 -F6) collected for size exclusion chromatography for YajQ protein. The black arrow indicates the most homogenous protein collected; and

Figure 59; Photographs showing the platinum reduction assay by the purified OYE and YajQ protein (A)

OYE, (B) YajQ protein, (C) negative control -OYE, (D) negative control -H₂, (E) negative control +0₂, (F) negative control denatured OYE, (G) negative control -H₂PtCI₆ ,(H) negative control E.coli proteins from uncut pET 22b (+) vector, (I) negative control E.coli proteins from uncut pET 28b(+) vector.

The presently disclosed subject matter will now be described more fully hereinafter with reference to the accompanying Examples, in which representative embodiments are shown. The presently disclosed subject matter can, however, be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the embodiments to those skilled in the art.

Examples

The invention was performed in accordance with the following steps. Example 1 : Assessment of microbial biodiversity in the NPM 1.1 Site description and sample collection

The NPM, now renamed Zondereinde division, is a platinum group metal mine situated in the upper end of the western limb of the Bushveld Igneous Complex. Two fissure water samples were collected in May 2008 (sample 1 : NO212FW050508) and September 2008 (sample 2: NO24FW030908) from existing valved boreholes at longitude and latitude coordinates (27° East 20" 18.24'; 24° 49' 45.12" South). The first sample was collected at shaft 2, level 12 and the second sample was collected at shaft 2, level 4. The borehole was plugged with the sterile sampling manifold (Moser et a/., 2003; Moser ef a/., 2005). The borehole water flowed through the plug for several minutes to remove any contamination introduced during the insertion of the plug before the tubing to the 12 L Cornelius canister was connected (sterile) and it was filled. A volume of 5L of sample 1 (N0212) was collected at 1.9 km below the land surface (kmbls). A volume of 1 1.5L of NO24FW030908 was collected at approximately 1.4 kmbls. Water was collected for NO212FW050508 at position 12-14 crosscut. Sample NO24FW030908 was collected at position 17 crosscut. Samples for geochemical analysis were taken and stored appropriately. Ambient conditions were measured on site such as water temperature, conductivity (conductivity meter Orion 122, Orion research, U.S.A), pH and redox potential (pH meter Crison 506 pH/Eh). The CHEMet self filling ampoules for colorimetric analysis (CHEMetrics Inc., U.S.A) were used for assessment of total Fe, H₂S and oxygen concentrations based on the principles of the phenanthroline, methylene blue and indigo carmine methods, respectively. 1.2 Geochemical analysis of site and sample collection

Analysis of the anion and cation concentrations was performed using the ICS 1600 ion chromatography system (Dionex, California, U.S.A) with columns AS14 and AG14. Carbon content and geochemical composition were determined at the Institute for Groundwater Studies, University of the Free State, R.S.A. Water samples were stored at 4°C before analysis.

1.3 Filtration

The fissure water sample was processed with a tangential flow filtration system (Amersham Biosciences, U.S.A) at a pressure of 100 kPa. The tangential flow filtration columns consisted of a 0.22 pm sterile hollow fibre membrane, peristaltic pump, pressure gauges, retentate and filtrate tube (MasterFlex, U.S.A). The retentate containing the cell biomass was concentrated 46 fold and stored at 4 'C for further molecular analysis.

1.4 Cell enumeration

Cell enumeration was performed using a DAPI stain (Morikawa & Yanagida, 1981 ) and cells viewed under a fluorescence microscope (Zeiss, Axioskop, Germany) provided with a 100 x magnification objective (Zweifel & Hagstrom, 1995). The average number of cells was estimated by two sets of counts of 10 random fields on the microscope slide. The calculation took into account the size of field of the microscope and the area of the filter. The final equation used was derived from equation 1 and 2 (Hamada & Fujita, 1983; Zweifel & Hagstrom, 1995).

100 x objective = 10⁶ μιη² (Equation 1 )

Area of filter = π x 8² (radius of filter = 8) = 2.01 x 10⁸ pm² (Equation 2) Therefore, cells/field = 10⁶m² and X number of cells = 2.01 x 10⁸ μηι². Cross multiplication was done to obtain final number of cells/ml.

1.5 Genomic DNA isolation

Approximately 100 ml of the concentrated fissure water containing 2.8 x 10³ cells/ml for NO212FW050508 and 1.19 x 10³ cells/ml for NO24FW030908 was filtered onto a sterile 0.2 pm nylon filter (Millipore, MA, U.S.A) and cut into smaller pieces. The DNA isolation method for sample NO212FW050508 was according to Labuschagne and Albertyn (2007), with slight modifications. The filtered paper pieces were transferred to a sterile 15 ml Faclcon tube. A volume of 1 ml DNA isolation buffer [100 mM Tris-CI, pH 8; 50 mM EDTA; 1 % SDS] was added to the tube followed by the addition of 0.4 ml glass beads to the suspension. The sample was vortexed for 4 min followed by immediate cooling on ice. A final concentration of 4 M ammonium acetate (pH 7.0) was added to the suspension followed by a 10 sec vortex and 5 min incubation at 65°C followed by cooling on ice for a further 5 min. A final volume of 0.5 ml chloroform (99% purity) was added to the suspension and the cell debris containing the chloroform was separated by centrifugation (20 000 x g; 5 min; 4°C). The supernatant was transferred to a clean 1.5 ml eppendorf tube and the DNA was precipitated with isopropanol for 30 min at room temperature. The isopropanol (supernatant) was removed from the DNA (pellet) by centrifugation (20 000 x g; 10 min; 4°C). The pellet was washed with 70% [v/v] ethanol and separated by centrifugation (20 000 x g; 10 min; 4°C), dried in a rotary concentrator (5301 Eppendorf, U.S.A) at 30°C for 15 min, dissolved in sterile distilled water containing RNaseA and incubated for a further 30 min at 37 C in a water bath. The DNA was stored at 4°C.

DNA was extracted from the filter membranes containing NO24FW030908 using the metagenomic DNA isolation kit for water (Epicentre, U.S.A) according to the manufacturer's instructions. Extracted DNA was quantified using the NanoDrop ND-1000 spectrophotometer (NanoDrop, Germany). The DNA was visualized on a 1 % [w/v] agarose gel in TAE buffer [0.04 M Tris-HCL; 1 mM EDTA pH 8.0; 0.02 mM glacial acetic acid] and 0.5 pg/ml ethidium bromide DNA staining reagent using a Gel Doc XR (Bio-Rad Laboratories, Hempstead, U.K) after electrophoresis at 90 volts for 60 min. All DNA fragment sizes were estimated based on electrophoretic mobility relative to the molecular weight markers for gene size determination. These were MassRuler DNA ladder mix (Fermentas, U.S.A) or GeneRuler™ DNA ladder mix (Fermentas, U.S.A).

1.6 Polymerase chain reaction (PGR) amplification

The environmental DNA was screened for the presence of DNA from archaea, bacteria and eukaryotes with sequence specific primers to amplify the full length 16S rRNA and 18S rR A genes. All PCR amplification reactions (unless otherwise stated) were performed in a final reaction volume of 50 μΙ and consisted of template DNA (± 25 ng), 5 μΙ of 10 x Super-Therm reaction buffer, 2 mM MgCI₂, 0.01 mg bovine serum albumin, 0.2 μΜ universal oligonucleotide primers, 0.2 mM deoxynucleotide triphosphates (DNTPs) and 0.02 U of Super-Therm polymerase (New England Biolabs, U.S.A). Universal primers were used for archael 16S rRNA (Baker ef a/., 2003), bacterial 16S rRNA (Lane, 1991 ) and eukaryal 18S rRNA (Diez ef a/., 2001 ) genes amplification (Table 1 ). The positive controls used for the amplification of 16S rRNA genes were E.coli TOP10 genomic DNA, 18S rRNA genes were yeast genomic DNA from Saccharomyces cerevisiae and for archaea the 16S rRNA genes were genomic DNA from Halobacterium salinarum.

Thermal cycling was carried out using a thermocycler (pXe 0.2, Thermo Electron, U.S.A) as follows: the reaction mixture was incubated at 94"C for 2 min. This was followed by 30 cycles of denaturation at 95°C for 30 sec, an optimized annealing temperature at 59°C for 30 sec and extension of the primers at 72°C for 90 sec. Final extension was at 72°C for 10 min (Barns ef a/., 1994; Rincon, ef a/., 2006). PCR products were viewed as described in Item 1.5 above. The PCR products were excised from the agarose gel and purified using the DNA BioFlux gel extraction kit and were followed according to the manufacturer's instructions (Separations Scientific, R.S.A). Table 1 : Primers used for PGR studies to amplify 16S rRNA and 18S rRNA genes

Specificity Forward primer Sequence Reverse primer Sequence

5'- YTC CSG TTG 5'- GGC GAT

Archaea (Baker et

20bF ATC CYG CSR 1090R GCA CCW CCT al„ 2003)

GA -3' CTC -3'

5'- GGT TAG CTT

Bacteria (Lane, 5'- AGA GTT TGA

27F 1492R GTT ACT ACT T - 1991 ) TCM TGG C -3'

3'

5'-GC-clamp 5'-GC-clamp

Bacteria (DGGE)

341 FJ3C7341 F CCT ACG GGA 517R CCT ACG GGA (Dar ef a/., 2005)

GGC AGC A -3' GGC AGC A -3' 5'-CGCGCG CCG

Universal GC CGC CCC GCG

clamp (Diez et al., GC_clamp^* CCC GTC CCG

2001 ) CCG CCC CCG

CCCG-3'

5'- AAC CTG GTT 5'- TGA TCC TTC

Eukaryotes (Diez

EukA GAT CCT GCC EukB TGC AGG TTC er a/., 2001 )

AGT -3' ACC TAG -3'

5'-GC-clamp-CAG

Eukaryotes 5'-ACG GGC GGT

GTC TGT GAT

(DGGE) (Diez et 1209F GC71209F U1392R GTG TRC-3'

GCC C-3'

al., 2001 )

^* Please refer to Item 1.7

1.7 Denaturation gradient gel electrophoresis (DGGE)

DGGE analysis was performed to determine the microbial diversity in this environmental sample. The 16S rRNA and 18S rRNA genes were amplified to produce a DGGE PC R product for analysis. The PGR reaction and thermal cycling procedure was performed as described in Item 1.6. The PGR products were purified as described in Item 1.6 and were amplified using the fully amplified 16S rRNA and 18S rRNA genes from Item 1.6. The primers used to produce a 200-bp fragment were 341 F-GC and 517R for 16S rRNA gene (Dar et al., 2005). The 18S rRNA DGGE analysis was also performed using universal eukaryote DGGE primers 1209F and U1392R and a fragment of 300 bp was obtained (Diez et al., 2001 ).

DGGE was performed using a DGGE Dcode system (Bio-Rad Laboratories, Hampstead, UK) as described by Diez and co-workers (2001 ). The gradient ranged from 40% - 60% urea formamide. Electrophoresis was performed with a 8% [w/v] polyacrylamide gel (ratio of acrylamide to bisacrylamide, 37.5: 1 ) in Tris-Acetate- EDTA (TAE) buffer (40 mM Tris, 40 mM acetic acid, 1 mM EDTA; pH 7.4) at 60°C. Approximately 800 ng of DGGE_PCR product was used and resolved at 200 V for 3 h. The polyacrylamide gel was stained with ethidium bromide (Merck, R.S.A) for 30 min in TAE buffer and visualized with UV radiation using the Gel Doc XR viewing system (Bio-Rad Laboratories, Hampstead, U.K). Individual DGGE bands were excised from the gel and re- suspended in 50 pi of sterile water overnight at 55°C to elute the DNA. The resulting DNA solution was used as the template for re-amplification from each band using the forward primer without the GC clamp and the reverse primer. The PGR products were cloned, sequenced and subsequently analyzed.

1.8 Clone library construction

The 16S rRNA and 18S rRNA gene amplicons from Items 1.6 and 1.7 were ligated into the pGEM-T Easy vector system (Promega, U.S.A) and transformed into Escherichia coli Top 10 competent cells (Invitrogen, U.S. A) (Table 2). Competent cells were prepared by using the method described by Hanahan (1983) with slight modifications. The enrichment media and buffer solutions were prepared containing per litre of distilled water. Psi broth [5g yeast extract; 20g tryptone; 5g MgS0₄ pH 7.6) was inoculated with 1 ml of E.coli Top 10 cells and grown at 37°C to an absorbance of 0.6 AU at 600 nm. Cells were cooled on ice for 15 min, pelleted by centrifugation (5000 x g; 5 min; 4°C), resuspended in 40 ml Tfbl buffer [30 mM potassium acetate; 100 mM rubidium chloride; 10 mM calcium chloride; 15% (v/v) glycerol, pH 5.8] and incubated on ice for 15 min. Cells were pelleted again by centrifugation [3000 x g; 10 min; 4°C] and resuspended in Tfbll buffer [10 mM MOPS; 75 mM calcium chloride; 10 mM rubidium chloride; 15% (v/v) glycerol, pH 6.5]. The resuspended cells were cooled on ice while being aliquoted and snap frozen with liquid nitrogen and stored at -80°C. Ligation was carried out at 16°C for 12 hours followed by an overnight incubation at 4°C. Transformation into competent E.coli Top 10 cells was followed according to manufacturer's instructions and the transformed cells were spread onto 40 pg/ml X-gal, 0.2 mM IPTG, 100 pg ampicillin agar selection plates. Table 2: Ligation mixture for cloning into pGEM-T Easy vector system

Reagents Final concentration

2 x ligase buffer (Promega) 1 x

PGEM T vector (Promega) 50ng/pl

T4 ligase (Promega) 1 U

PGR Product ±30 ng

1.9 Sequencing and phylogenetic analysis

Sequencing was performed using the ABI Prism^® Big Dye ^* Terminator cycle Sequencing Ready Reaction Kit V.3.1 (Applied Biosystems, U.S. A) according to manufacturer's instructions, using the primers described in Table 1. Sequencing was carried out using the DYE terminating sequencer (Applied biosystems 3130 XL genetic analyzer) at the University of the Free State, R.S.A.

The sequence data was assembled to form contigs using the Vector NTI contig express software (Lu and Moriyama. 2004). Vector sequences were removed using the VecScreen tool on the National Centre for Biotechnology Information NCBI website (Johnson ef al., 2008)

(http://www.ncbi.nlm.nih.gov/VecScreen/VecScreen.html). All sequences were checked for chimeric artifacts using the Bellerophon server (Huber ef al., 2004) (http://foo.maths.uq.edu.au/~huber/bellerophon.pl) and Mallard software (Ashelford ef al., 2006). The possible anomalies identified on Mallard were then assessed on Pintail (Ashelford ef a/., 2005). The sequences were submitted to the NCBI basic local alignment search tool (BLAST) for sequence identity. Multiple sequence alignment was carried out on ARB. The refinement of multiple sequence alignments was carried out manually using the ARB editor tool incorporated in the ARB software version 4.1 (Ludwig et al, 2004). After alignment of sequences and the construction of a preliminary tree using the neighbor-joining algorithm, a distance matrix was generated on ARB and subsequently operational taxonomic units (OTU) were calculated at the 1 %, 3% and 20% genetic distances using the software DOTUR to estimate bacterial richness (Schloss and Handelsman, 2005; Simon ef al., 2009). Nonparametric species richness estimates were calculated using DOTUR, the abundance-based coverage estimator (ACE) and the Chaol estimator to determine the distribution of the singletons and doubletons at the above distances. The Shannon weaver index was calculated to determine the level of diversity. Only one representative sequence was selected for each OTU and used for phylogenetic construction. Novel sequences were aligned against their closest phylogenetic relationships identified from Genbank NCBI (http://www.ncbi.nlm.nih.gov/). BLAST hits to newer sequences deposited on NCBI Genbank were imported into the ARB database at the same time updating the ARB database followed by alignment. Phylogenetic trees were generated using the neighbour- joining algorithm implemented in ARB. The robustness of the tree topologies was evaluated by 1000 inferences on the original alignment. The 16S rRNA gene sequences were deposited on Genbank at NCBI and the accession numbers were given JN030499 to JN030578.

1.10 Bacterial enrichments and isolation

The concentrated biomass from the fissure water was inoculated both aerobically and anerobically in various enrichment mineral media that contained per litre of distilled water; yeast peptone dextrose (YPD) (5 g yeast extract; 10 g peptone; 10 g dextrose), Thermus broth (8 g tryptone; 4 g yeast extract; 3g NaCI), Luria-Bertani broth (as described by Sambrook et al., 1989), sulfur reducing broth (SRB) (7.48 ml sodium lactate; 2 g MgS0₄.7H₂0; 1 g NH₄CI; 1 g Na_?SO,; 0.5 g K₂HP0₄; 0.1 g CaCI₂.2H₂0; 3.28 g sodium acetate: 1 g yeast extract), iron reducing broth (IRB) (2.5 g aHCO ,; 0.1 g KCI; 1.5 g NH₄CI; 0.6 g NaH₂P0₄.2H₂0; 0.82 g NaCH₃COO; 1.87 ml sodium lactate; 1.1 g sodium pyruvate; 12.3 g ferric citrate) and dilute heterotrophic broth (HB) (0.1 g glucose; 0.1 g yeast extract; 0.05 g peptone; 0.05 g tryptone; 0.6 g MgS0₄.7H₂0; 0.07 g CaCI₂.2H₂0; 0.1 g MOPS). Thermus broth, SRB, IRB and HB mediums were adjusted to an approximate pH range of 7.0 - 9.0. A few drops of vitamin solution containing per litre of distilled water (0.02 g biotin; 0.02 g folic acid; 0.10 g B6 pyridoxine HCL; 0.05 g B, thiamine HCL; 0.05 g B₂ riboflavin; 0.05 g nicotinic acid 0.05 g pantothenic acid; 0.05 g B₁₂ cyanobalamine crystalline; 0.001 g p-aminobenzoic acid; 0.05 g lipoic acid) were added to IRB, HB and SRB media.

Anaerobic media was prepared in 10 ml gas tight anaerobic tubes sealed with a rubber and a clamped metal cap (Wheaton science products, U.S. A). An indicator for the presence of 0₂ resazurin was added to the tubes at a final concentration of 0.002% [w/v]. Tubes were then connected to the nitrogen cylinder. Nitrogen gas was then flushed through the media for 30 cycles for 60 minutes and the tubes were autoclaved inverted at 121 'C for 20 minutes. The cultures were incubated for a few days until growth was observed at 55°C and 65°C. These are the minimum and maximum temperatures that were selected according to sampling site parameters.

1.11 Pure culture analysis

A pure culture was obtained by subsequent sub-culturing and passaging single colonies onto enrichment media containing 2% [w/v] bacteriological agar on Petri-dishes at the same isolation temperatures. Gram staining analysis was followed as described by Bartholomew & Mittwer, 1952.

Bacterial 16S rRNA complete gene amplification was done as described in Item 1.6. The sequencing and analysis was done as described in Item 1.9. Identification of novel isolates was determined based on sequence identity to the NCBI public database and was established at a threshold identity below 97% or below the 3% genetic distance (Simon ef a/., 2009). The isolates and their reference sequences were aligned on RDP tree builder (http://rdp.cme.msu. edu/treebuilder/treeing.spr;jsessionid=92FD0D52577F9679D347F42FBFB3E8BD) using the neighbour-joining algorithm to generate a phylogenetic tree for comparative studies.

1.12 Characterization of isolates

Two novel aerobic isolates identified based on the novelty of their 16S rRNA genes (Item 1.11 ) were selected for strain characterization according to systematic and taxonomic classification. These isolates were named Geobacillus sp. A8 and Geobacillus sp. A12. The isolates were grown on LB media and assessed for physiological characterization using the Biolog MicroLog14.20 system (Department of Microbial, Biochemical and Food Biotechnology, University of the Free State, R.S.A). This was followed by taxonomic characterization at the DSMZ Identification Service, Braunschweig, Germany by Dr. Brian Tindall. The following methods were carried out: quinone system analysis (Nazina er a/., 2001 ), cellular fatty acid composition (DeFlaun ef a/., 2007), DNA composition (Cashion ef a/., 1977; Mesbah ef a/., 1989; Tamaoka and Komagata, 1984) and cell wall sugar analysis (Nazina ef a/., 2001 ). Whole cell sugars were hydrolyzed in 1 N H₂S0₄. H₂S0₄ was removed by 20% N, N-dioctylmethylamine chloroform according to Whiton ef a/. (1985) and the sugars in the hydrolysate were analyzed by TLC on cellulose plates according to Staneck & Roberts ( 1974). Further growth studies and cell morphology analysis was carried out by Dr Daniel Vega (Department of Biochemistry, University of the Free State, R.S.A). Aerobic bacterial growth was monitored over time. The optical density was monitored at 600 nm using a spectrophotometer (UV-visible spectrophotometer, Cary 300 Bio). The effect of salinity, pH and temperature was carried out in Thermus broth (Item 1.10) as described in DeFlaun ef a/., 2007.

Results and discussion

Site description and sample collections

A geochemical analysis of the NPM was done as described in Items 1.1 and 1.2 to obtain information on the chemical components of the fissure water. Both samples revealed similar geochemical analyses and corresponds to other shaft 2 data in literature (Gihring ef a/., 2006) (Table 3).

Both fissure water samples indicated alkalinity, high temperatures and the presence of oxygen. Conductivity of the samples was measured to estimate the dissolved salts in the fissure water. When the valve was opened fissure water was collected for NO212FW050508 at an adjusted flow rate of 163.6L/hour, at this lowered flow rate gas was present at 10.6 L/hour.

Table 3: Measurements taken at the site of sample collection, the Northam Platinum Mine

Parameters NO212FW050508 NO24FW030908

pH 9.3 8.54

Conductivity 4.3 mS 1.59 mS

Temperature 53.7°C 46.7°C

Ave. Flow Rate 163.6L/hour 1705.2L/hour

Ave. Gas Rate 10.6L/hour (6.5%) 5.29L/hour (0.31 %)

Chemistry: H₂S 0.2 ppm 0.3 ppm

o₂ > 1 ppm > 1 ppm

Soluble Fe 0.2 ppm BD

Total Fe 0.2 ppm BD

BD = Below detection

The fissure water sampled at NPM had high mineral content including calcium and magnesium cations suggesting the presence of calcium carbonate or calcium sulfates and dolomite, commonly known as sedimentary rock (Table 4). NO212FW050508 displayed significantly higher chloride (1312 ppm) and sodium (580 ppm). NO24FW030908 also displayed high concentrations of chloride (437 ppm), sulfate (38 ppm) and sodium (207 ppm).

The nitrogen species were detected at extremely low concentrations; ammonium (0.7 mM) was present for NO212FW050508, nitrate (0.001 mM) for both samples, and nitrous oxide (0.001 mM) was present for NO24FW030908. The dissolved carbon species showed that dissolved inorganic carbon (DIG) was substantially higher than dissolved organic carbon (DOC) in the samples. The DIC concentrations measured NO212FW050508 was 1.83 mM and (NO24FW030908) 0.24 mM suggesting a high content of bicarbonate and C0₂ levels in the borehole fissure water and a low concentration of DOC measured at 0.007 mM indicating a low concentration of organic matter. The trace element concentrations were very low with zinc being the most abundant. Groundwater geochemistry of fissure water collected from the 2" borehole from the surface

Composition NO212FW050508 NO24FW030908

DOC (mM) ND 0.007

TOC (mM) 8x10^"5 0.002

DIC (mM) 1.83 0.24

pH 9.97 8.54

NH₄ (mM) ND 0.7

Major Cations (mM)

Ca 6.79 1.67

Mg 0.01 0.06

Na 25 9.00

K 0.19 0.05

Al 1.1 X 10^"4 0.003

Fe 2.1 x10^"" 0.001

Mn 5.5 x 10^"* 0.001

B ND 0.03

Major Anions (mM)

F 0.004 0,04

CI^" 37 12.33

N0₂ ^" (N) 0.006 BD

Br^" ND 0.01 1

N0₃ ^'(N) 0.001 0.001

0.001

P0₄ ^2" 0.001

S0₄ ^2" 0.06 0.4

Trace Minerals (^~iM)

Ag ND < 0.093

As <0.133 < 0.080

Cr <0.1 15 < 0.1 15

Cd NA < 0.009

Co ND < 0.085

Cu <0.094 < 0.047

<0.072

Pb < 0.048

<0.15

Zn < 0,184

NA

V < 0.118

NA

Ni < 0.170

NA

Mo < 0.031

NA

Se < 0.076

NA

Sb < 0.082

BD= Below Detection ND= Not Done Microbial biomass concentration and cell enumeration

The fissure water samples collected at the NPM were filtered for bacteria as described in Item 1 .3. The cells were stained with DAPI as described in Item 1.4. A DAPI stain revealed a higher number of cells for NO24FW030908 (Figure 1 ). This was due to the large amount of debris present in the concentrated biomass that was excluded during the cell count analysis as described in Item 1.4. These could be observed as large fluorescent blots across the microscope slide. An overall low cell count was observed for both of the water samples using the DAPI stain technique for cell enumeration (Zweifel & Hagstrom, 1995), after the 46 fold concentration. The cell count for sample 1 revealed an estimate total of 2.8 x 10³ cells/ml. The cell count for sample 2 revealed an estimate total of 1.19 x 10³ cells/ml. The total number of cells obtained for NO212FW050508 was 3.02 x 10⁵ cells and for NO24FW030908 was 5.72 x 10⁵ cells.

Genomic DNA isolation

Many methods and techniques are available for the isolation of genomic DNA from microorganisms. Genomic DNA isolation for NO212FW050508 was carried out as described in Item 1 .5. This method was firstly described in the DNA isolation from yeast cells with a high DNA yield. DNA extraction was however unsuccessful (Figure 2) due to the low number of cells present in the sample, and the method was not optimized for DNA extraction from a fissure water sample. NO24FW030908 DNA isolation was done using the metagenomics DNA isolation kit for water as described in Item 1.5. The metagenomics DNA isolation kit for water is suitable for isolating randomly sheared high molecular weight metagenomic DNA directly from microorganisms present in environmental water. The DNA is finally prepared by end repair reactions and can be used directly for cloning into fosmid libraries. High quality (A260/A230 = 1 -89) genomic DNA was isolated from NO24FW030908 as shown in Figure 2. The final yield of DNA from NO24FW030908 was 100 ng dissolved in a final volume of 10 μΙ distilled water. Community analysis of sample NO24FW030908 by DGGE

DGGE analysis was performed as described in Item 1.7 to provide a comparative microbial community analysis for the related comprehensive phylogenetic analysis. A 200 bp product was obtained for partial 16S rRNA genes and a 300 bp product was amplified for the partial 18S rRNA gene analysis and applied to DGGE (Figure 3). There were six distinct resolved bands observed for the 16S rRNA gene analysis and seven distinct resolved bands observed for the 18S rRNA gene analysis. As observed in Figure 3, more than one band represented a single species and this could be due to microheterogeneity in the DNA sequence therefore yielding more than one band that may result in the same species. Sometimes DGGE also yields more than one species representative in one band, which could be due to a steep gradient gel that results in the bands not separating out properly. In order to verify this, the bands should be excised and cloned and more than one clone per band should be sequenced (Kisand ef a/., 2002). Bands were excised, reamplified and the fragments cloned and sequenced. These partial sequences were subsequently compared against the NCBI database for sequence identity (Table 5). All E values were 0.0. The DGGE community analysis revealed low diversity for the 16S rRNA library, however or, γ and β-Proteobacteria classes were observed, with some indication of dominance by or and γ-Proteobacteria. This was also apparent for the 18S rRNA gene library where at the phylum level both the Fungi and Protozoa were dominant and at the species level, both Heteromita globosa and Rhodotorula mucilaginosa were observed.

Table 5: Sequence similarity of sequenced 16S rRNA and 18S rRNA genes obtained from DGGE bands for microbial community studies of fissure water collected at the NPM, R. S.A

DGGE Band Accession Closest relative Identity Class

Bacteria

B1 FJ645062 Rheinheimera sp. Chandigarh 97% y-Proteobacteria

B2 FJ719351 Pseudomonas sp. T123 96% y-Proteobacteria

B3 FJ204424 Groundwater biofiim bacterium M1 97% a-Proteobacteria

B4 FJ795659 Brevundimonas sp. 3-4 97% a-Proteobacteria

B5 FJ204424 Groundwater biofiim bacterium M1 99% a-Proteobacteria

B6 AY167838 Janthinobacterium agaricidamnosum 99% $-Proteobacteria

Eukaryote

E1 U42447 Heteromita globosa 100% Protozoa

E2 U42447.1 Heteromita globosa 99% Protozoa

E3 GQ433375 Rhodotorula mucilaginosa 98% Fungi

E4 GQ433375 Rhodotorula mucilaginosa 98% Fungi

E5 U42447 Heteromita globosa 99% Protozoa

E6 U42447 Heteromita globosa 99% Protozoa

E7 U42447 Heteromita globosa 100% Protozoa Clone library construction and phylogenetic analyses

Archaeal 16S rRNA, bacterial 16S rRNA and eukaryote 18S rRNA genes from NO24FW030908 were amplified as described in Item 1.6. No archaeal 16S rRNA genes could be amplified indicating the possible absence of archaea and in the biome fissure water as found by Gihring and co-workers (2006), and Borgonie and coworkers (201 1 ). This was confirmed by the amplification of the positive control. The product for the bacterial 16S rRNA gene was used to construct a rRNA gene library for assessment of the microbial diversity. This was similarly done for the 18S rRNA genes as described in Item 1.8.

The 16S and 18S rRNA gene libraries were constructed, sequenced and subsequently analyzed using ARB alignment software (Ludwig ef a/., 2004) and NCBIJ3LAST as described in Item 1.9. A total of 80 non chimeric clones were analyzed for the 16S rRNA gene library and 40 clones for the 18S rRNA gene library. The sequences were aligned using the ARB program and then manually aligned for further adjustments. A scoring matrix was constructed on ARB and then analyzed in the clustering analysis software DOTUR designed by Sch!oss and Handelsman, (2005) to generate the operational taxonomic unit (OTU) values and to determine species richness. A neighbour-joining phylogenetic tree for each of the clones was generated.

Bacterial community composition

DOTUR clustering analysis was performed as described in Item 1.9. DOTUR analysis revealed the rarefaction curves, the number of unique OTUs, parametric and non-parametric estimators, ACE (abundance coverage estimator) and Chad , respectively. The OTU values were plotted against the number of clones analyzed to generate a rarefaction curve (Figure 4). Species richness was determined at a 1 % genetic distance (interspecies), 3% genetic distance (species level), 10% genetic distance (genus level) and at a 20% genetic distance (phylum level) (Zeng ef a/., 2007; Simon ef a/., 2009) (Table 6). Both the estimators show the confidence of the sequencing effort covered by the diversity based on different algorithms. The richness and diversity estimates of the 16S rRNA gene library derived from samp!e NO24FW030908 and assessed by DOTUR (Schloss and Handelsman, 2005) rRNA gene Genetic

Richness ACE^† Chaol* Shannon* library distance

Bacteria 0.01 12 15 15 1.90

0.03 7 7 7 1.40

0.1 5 5 5 1.18

0.2 4 4 4 0.62 richness is the number of observed unique operational taxonomic units (OTUs).

^†abundance-based coverage estimator (ACE), nonparametric richness estimator based on distribution of abundant (>10) and rare (≤ 10) OTUs.

'nonparametric richness estimator is based on the distribution of singletons and doubletons.

¥Shannon-Weaver Index of diversity. A higher number indicates higher diversity.

The 16S rRNA gene phylotypes exhibited seven different OTUs at the species level after 80 clones were analyzed. Rarefaction curves approached saturation at the 1% (interspecies level) and saturation at the 3% (species level) and 20% (phylum) genetic distances as observed in Figure 4 and Table 6. The ACE and Chaol estimators (Table 6) indicated the expected diversity and therefore maximum diversity had been reached at the 3% genetic distance. The 20% genetic distance had shown four different phyla present corresponding to the phylogenetic analysis shown in Figure 5, also confirmed again by the ACE and Chaol estimators. The Shannon-weaver index indicates a low diversity at the 3% genetic distance of 1.40 as observed.

Low microbial diversity was observed for the bacterial community as compared to the surface, that have revealed high diversity. Diversity studies on NO24FW030908 had revealed an abundance of OTUs that belonged to the class σ and γ-Proteobacteria, however exhibiting low microbial diversity (Figure 5). There were seven unique OUT's at the 3% genetic distance (species level) (Simon ef a/., 2009) for the 16S rRNA library clones (Figure 5). These were grouped into four major taxa, σ(51 %), β(6%) and y(38%)-Proteobacteria and a smaller group of Firmicutes (5%) (Figure 6). This data compares well with Gihring and co-workers (2006), and Borgonie and co-workers (201 1 ), where they had sequences from their diversity study that had belonged to the same classes of Proteobacteria. It is important to note that Gihiring and co-workers (2006), and Borgonie and co-workers (201 1 ), did not share the same OTUs. The diversity study for NO24FW030908 OTUs was also different to the OTUs described in both publications. This suggests the possibility of an overall high diversity at the NPM because of the unique microbial communities that were observed at three different sites. We also report here the presence of a small group of Firmicutes not observed by the two other studies.

As compared to the DGGE microbial community analysis (described in Item 1.7) four of the five genera shown in the phylogenetic tree (Figure 5) were already revealed. The corresponding band on DGGE 16S rRNA was probably too faint to visualise. However, the complete microbial diversity could not be revealed by DGGE at the species and interspecies level. This is because the size of the partial 16S rRNA gene amplicon described in Item 1.7 was too small (300 bp) to identify the DGGE sequences at the species level.

As observed in Table 6, the Shannon index indicated interspecies diversity at a value of 1.90 which was higher when compared to the 3% and 2% genetic distances. This data correlates with the phylogenetic tree (Figure 5) that also indicates interspecies diversity. The more interspecies diversity provides an indication of the evolutionary processes that have taken place in the biome. From Figure 5, the phylogenetic relationships of the sequences were established, where interspecies diversity and novel sequences at the species level were verified at the OTU level. Sequences that exhibited interspecies diversity with a 1 % genetic distance were observed for clones N02416S17 (JNO30515) and N02416S27 (JNO30525). The closest relative of Clone N02416S17 at 97% sequence identity was Agrobacterium sp. Ag-1 (ATCC 31749) and clone N02416S27 was 99% identical to the closest relative Brevundimonas sp. LMG (AJ244648). Sequences that exhibited novelty at the 3% genetic distance were N02416S31 (JNO30530); N02416S48 (JN030546) and NO2416S70 (JN030568). N02416S31 had shown novelty at the species level (91 % sequence identity) as compared to the 16S rRNA gene of the close relative Clostridium thermobutyricum (X72868). Clone N02416S48 had shown novelty at the species level (95% sequence identity) as compared to the 16S rRNA gene of the closest relative Rheinheimera sp. JA3-B52 (DQ874340). Clone NO2416S70 had shown novelty at the species level (96% sequence identity) as compared to the 16S rRNA gene of the closest relative Janthinobacterium lividium (EU275366). There were no sequences that exhibited novelty at the 10% genetic distance or at the 20% genetic distance. As shown in Table 4, the majority of carbon present in the NPM was inorganic carbon, however low levels of dissolved organic carbon were detected. The level of organic carbon detected was similar to other reported values of DOC in mines at various South African sites (Takai ef al., 2001 ; Gihring et al. , 2006; Borgonie ef al., 201 1 ). Microbes favour the utilization of the most readily available components of the complex naturally dissolved organic matter and therefore these nutrients are exhausted faster than more unattainable substrates. DOC and dissolved organic matter levels influence the presence of taxa in a microbial population (Krumholz, 2000; Eiler et al., 2003; Langenheder ef al,, 2004). The concentrations of dissolved metals such as sodium, magnesium and potassium had influenced the alkalinity of the groundwater of sample NO24FW030908 (Table 3). The nitrogen levels were present at 0.7 mM of NH₄; therefore suggesting this is not a nitrogen-limited system. However the ecosystem was able to support the presence of heterotrophic and facultative anaerobic bacteria involved in nitrogen fixation under oxygen limiting conditions, which has been revealed within the diversity results. This supports the presence of Proteobacteria that are involved in nitrogen fixing. Sahl and coworkers (2008) had reported an elevated presence of C0₂ present in the deep subsurface and that C0₂ had provided the carbon source for autotrophic iron reducing bacteria that can thrive in oxic borehole water. A high molar concentration of sulfate most likely provides an energy source for the proliferation of sulfate reducing bacteria however these microorganisms were not seen in this diversity study.

The metabolism of the microbial community present in the fissure water at 1.4 km below the surface at the NPM was based on sequence identity and compared to the public GenBank database, NCBI as described in Item 1 .9. Clone 37 had shown a 99% identity to Clostridium bowmanii, a known anaerobic microorganism (Spring et al., 2003). The presence of this microorganism in NO24FW030908 suggests an oxygen limiting environment. This is similar to Clostridium thermobutyricum mentioned previously, a heterotrophic, moderate thermophile found to be involved in the formation of butyrate and a shift in metabolism forms acetate via fermentation. Fermentation metabolism occurs under oxygen limiting conditions where organic carbon is used as the electron acceptor (Wiegel ef al., 1989; Canganella & Wiegel, 2000).

Chemolithotrophs are found in the deep subsurface, because they are able to utilize the inorganic carbon for energy where inorganic carbon is the electron donor and oxygen or nitrate could be the electron acceptor. Chemolithotrophy has been observed by autotrophic as well as in heterotrophic organisms. Clone 16S70 had shown >96% sequence identity to a Jantinobacterium lividium found in soil and water in temperate conditions. This microorganism has shown the potential to thrive in small microbial communities and has been previously shown to be involved in the oxidation of iron and the reduction of hexavalent chromate (Burkhardt ef a/., 2010; Gu et al., 2003; Saeger ef a/., 1993). This indicates that microorganisms living in these extreme environments are likely to be adapted to gradual growth over a long period of time (Krumholz, 2000). Similar data has been shown by Kieft ef al. (1999) in the isolation of novel Thermus scotoductus SA-01 from a deep South African mine.

Eukaryotic community composition

DOTUR analysis of the 18S rRNA gene library was performed similarly to the 16S rRNA gene library as described herein above and in Item 1.9. Similarly, to the 16S rRNA gene library, a rarefaction curve was generated for the 18S rRNA gene library (Figure 7). Species richness was also determined at the 1 %, 3%, 10% and 20% genetic distances (Table 7).

The 18S rRNA gene phylotypes exhibited a much higher diversity with 13 different OTUs at the 3% distance after 40 clones were analyzed (Figure 7). The Ace and Chaol (Table 7) estimated even a higher expected diversity at the 1 % and 3% distances as compared to the 16S rRNA gene library. At the 20% genetic distance, ACE and Chao 1 estimators had indicated saturation for two phyla present in the 18S rRNA gene library. The 18S rRNA gene library did not reach saturation at the 1 % and 3% genetic distances. According to the ACE and Chaol estimators, 22 to 34 OTUs are needed to reach saturation at the 3% distance. The Shannon weaver index indicated a higher interspecies diversity at 2.74 and also a higher diversity at the 3% distance at 2.23 as compared to the 16S rRNA gene library (Table 6). The high interspecies and species diversity of the eukaryotes demonstrated by the DOTUR analysis had revealed the relation with the NPM environment and the novelty associated with the biome. Table 7: The richness and diversity estimates of the 18S rRNA gene library derived from sample

NO24FW030908 assessed by DOTUR (Schloss and Handelsman, 2005)

rRNA Genetic

Richness^* ACE^† Chad * Shannon" gene library distance

Eukarya 0.01 21 58.1 51.3 2.74

0.03 13 22.2 34 2.23

0.1 4 7.9 4 0.55

0.2 2 2 2 0.32 richness is the number of observed unique operational taxonomic units (OTUs).

^†abundance-based coverage estimator (ACE), nonparametric richness estimator based on distribution of abundant (>10) and rare (< 10) OTUs.

*nonparametric richness estimator is based on the distribution of singletons and doubletons.

¥Shannon-Weaver Index of diversity. A higher number indicates higher diversity.

The 18S rRNA gene library clones that exhibited high interspecies diversity shown by the DOTUR analysis was confirmed in the eukaryote phylogenetic analysis of NO24FW030908 (Figure 8). These phylotypes had as closest relatives a soil flagellate (Protozoan) Heteromita globosa and a fungus Rhodosporidium mucilaginosa.

Low diversity was observed (Figure 8) for the eukaryote community in sample NO24FW030908. There were two classes Fungi and Protozoa and two species Rhodotorula mucilaginosa and Heteromita globosa identified with high interspecies however low species diversity. Novelty at the 3% genetic distance was observed for clone NO2418S09. Clone NO2418S09 had shown species diversity (95% sequence identity) as compared to the 18S rRNA gene of the closest relative Heteromita globosa (U42447). Novelty at the genus and phylum level was not observed as with the 16S rRNA gene library. These OTUs are different from the study described by Borgonie and co-workers (2011 ), as no nematodes were observed in NO24FW030908. Again, this emphasizes the low diversity observed at different sites at the NPM, however a possibility of a high overall diversity.

As compared to the DGGE study (Table 5) more than one band represented a single species. This is now possible because of the high interspecies diversity observed in Figure 8. DGGE does not take into account interspecies diversity because of the size of the partial 18S rRNA gene (200 bp). A larger product (>1400 bp) is required for a reliable identity at species level (Zeng et al., 2007). All of these sequences identified, like the DGGE profiles suggested environmental isolates from ground and water which correlates to the fissure water environmental sample. The high interspecies diversity was confirmed by the 1 % distance (Table 7, Figure 8) where the ACE and Shannon weaver index was relatively high. There is clearly higher interspecies diversity among the eukaryotes as compared to the prokaryotes. This can be related to the evolution of the complex where organisms have adapted to their extreme environments. There is an increasing discovery of a novel kingdom of anoxic or oxygen limited conditions where eukaryote diversity has been reported by Dawson and Pace, 2002 in the deep subsurface.

So far, a single eukaryote study in the deep subsurface has revealed the presence of nematodes (Borgonie et al., 201 1 ). The phylogenetic analysis of the 18S rRNA gene library clones from N024 revealed that 90% of the phylotype's closest relative was a soil flagellate Heteromita globosa. The protozoan Heteromita globosa has capabilities such as the biograzing of Pseudomonas species for nutrients and has been shown to be involved in nitrogen fixing and therefore they are able to survive in anoxic or oxygen limiting environments (Brad et al, 2008). Fungi such as Rhodosporidium mucilanginosa (GQ433375) are able to survive as well in anoxic environments during fermentative metabolism. (Libkind et al., 2004)

Bacterial isolation from sample NO212FW050508

Isolation of bacteria from the NPM water samples was carried out as described in Item 1.10. Growth was observed in all enrichment media from inoculation of NO212FW050508 fissure water. Purification of each isolate was followed as described in Item 1.1 1 by sub-culturing single colonies from agar petri dishes to liquid media. Gram staining analysis was done to determine a preliminary identity and to confirm homogeneity of the isolates (Figure 9). A Gram negative microorganism does not have a peptidoglycan layer and therefore does not retain the crystal violet dye as does Gram positive microorganisms. Gram negative microorganisms are equipped with a lipopolysaccharide layer and a thin cell wall. Two genera have been successfully cultured from the deep terrestrial subsurface and have been encountered on several occurrences; these are Geobacillus and Thermus (DeFlaun et al., 2007; Popova et al., 2002; Kieft ef al., 1999). The diversity study based on NO24FW030908 did not reveal sequences related to these genera and this is possibly because the sample collected for NO212FW050508 was deeper in the subsurface (Item 1.1 ),

Pure culture identification based on 16S rRNA gene sequence identity

Pure culture identification and analysis was performed as described in Item 1.1 1. Moderately thermophilic isolates have been successfully isolated in various enrichment media from fissure water sample NO212FW050508 (Table 8). Although a bias was introduced by the selected media, the main aim of this study was achieved to isolate new thermophilic isolates from the NPM. Isolates were cultured at an optimal temperature ranging from 55°C to 65°C at a neutral pH. Isolates were identified at the 16S rRNA gene level and these sequences were searched against the nt database by BLAST at NCBI. Two dominant genera were observed, Geobacillus and Thermus as previously mentioned. A total of 10 isolates were cultured and of these, 5 isolates had a≤97% sequence identity to other Geobacillus sp. sequences. At the 3% distance, Geobacillus sp A7, Geobacillus sp A8, Geobacillus sp A12 and Geobacillus sp A13 had displayed novelty at the species level. Geobacillus sp. A14 had shown 85% sequence identity to Geobacillus thermoleovorans and a close phylogenetic association to Thermoalkalibacilus uzonensis, at the 10% distance and therefore exhibited novelty at the genus level (Figure 10). Thermus sp. A10 was closely related at a 98% identity to Thermus Tibetan G7 (DQ055417) but is considered novel because of the absence of a culture in a collection for this microorganism. Difficulty maintaining and culturing this strain was encountered. The Geobacillus isolates were highly competitive in the enrichment media especially in the IRB media since this genus is well known for their iron reducing metabolism (Nazina ef al., 2005). The geochemical data of the N0212 site suggests chemolithotrophy due to the higher DIC content of the biome and the presence of iron, that can relate to the expected microorganisms identified. Kieft and co-workers (1999) had shown that novel isolate Thermus scotoductus SA- 01 was involved in iron reduction, explaining the presence of this genus. The identification of novel isolates cultured from the sample (NO212FW050508). all E values were 0

Accession Assigned name and Closest relative % Identity Optimal sequence size media

AB362290.1 A3 (1453 bp) Brevibacillus thermoruber 97% IRB/YPD

EU214615.1 A4 (1465 bp) Geobacillus sp. P1 99% IRB/LB

EU680816.1 A5 (1428 bp) Geobacillus thermoparafflnivorans 98% IRB/TB-'

EU214615.1 A7 (1509 bp) Geobacillus thermoparafflnivorans 96% IRB/LB/TB^;

EU214615.1 A8 (1451 bp) Geobacillus thermoparafflnivorans 92% IRB/LB/TB^;

^*DQ055417.1 A10 (1407 bp) Thermus sp. Tibetan G7 98% HB/TB^;

FJ529816.1 A 1 (1425 bp) Geobacillus sp. A83 99% IRB/NB^"

EU214615.1 A12 (1515 bp) Geobacillus thermoparafflnivorans 94% IRB/LB/TB^;

EU214615.1 A13 (1495bp) Geobacillus thermoparafflnivorans 96% IRB/LB/TB^;

NB = Nutrient broth, TB= Thermus broth Characterization of novel isolates

The characterization of selected novel isolates was performed as described in Item 1.12. Taxonomic classification was based on the novelty of the 16S rRNA gene sequence, quinone and fatty acid composition, GC content and cell wall sugar analysis (DeFlaun et al., 2007). Novel isolates Geobacillus sp. A8 and Geobacillus sp. A12 were cultured in optimal media and characterized at the DSMZ institute (Table 8). Biolog database assessment was also performed on these isolates to identify a close phylogenetic relative in the database. The characterization of these novel isolates included cell morphology analysis, growth studies, DNA composition analysis, PLFA and respiratory quinine analysis. DeFlaun ef al., 2007 had described a new Geobacillus thermoleovorans strain GE-7 from the deep subsurface isolated from a gold mine in South Africa. Cell morphology

Both Geobacillus species are long rod-shaped microorganisms (Figure 1 1 ). Geobacillus sp. A8 is approximately 3-6 μιη long and 0.8 pm wide. Geobacillus sp. A 2 is approximately 4-6 pm long and 0.75 pm wide. Gram stain analysis revealed that both these microorganisms display similar cell wall structure and are Gram positive and therefore these results correspond to most microorganisms belonging to this genus (Nazina ef a/., 2001 ).

Growth studies of optimal pH, temperature and salinity

Growth studies for Geobacillus sp. A8 and Geobacillus sp. A12 were carried out as described in Item 1.12. The growth rate of both isolates was determined at temperatures 30, 37, 45, 55, 65 and 75°C where the optimal growth temperature was determined to be 60°C for both the isolates. Both isolates were also able to grow in liquid media at different pH and NaCI concentrations. The pH range was 5.5, 6.5, 7, 7.5, 8, 9, 10 and 11. The optimal pH for Geobacillus sp. A8 was 7 and Geobacillus sp. A12 was pH 5.5. The salt concentrations ranged from 0% to 4%, with 0% being the optimal for Geobacillus sp. A8 and 0.5% being the optimal for Geobacillus sp. A12 (Figure 12).

Physiological characterization

Physiological characterization was done as described in Item 1.12. Aerobic growth experiments tested on a variety of substrates are illustrated in Table 9. Geobacillus sp. A8 and Geobacillus sp. A12 both are able to grow on L-Arabinose. D-Ribose, D-Trehalose, D-xylose, cc-ketovaleric acid, L-malic acid, pyruvic acid, methyl ester and succinic acid mono-methyl ester. Geobacillus sp. A8 can also grow on pyruvate similar to Geobacillus thermoleovorans GE7. Geobacillus sp. A12 can grow on acetic acid, which is different from the other isolates listed. Geobacillus thermoleovorans GE-7 utilizes many substrates different from the two isolates from the NPM such as D-cellobiose, D-Galactose, a-D-Lactose, maltose, sucrose and glycerol. Geobacillus sp. A8 and Geobacillus sp. A12 have similar physiological characteristics. Physiological characterization of Geobacillus sp. A8 and Geobacillus sp. A12 and a comparison to strain Geobacillus thermoleovorans GE-7 (DeFlaun et al., 2007)

Substrate G.A8 G.A12 GE-7

Water

β-Cyclodextrin

Dextrin - Glycogen

Inulin - -

Mannan -

Tween 40 -

Tween 80 -

N-Acetyl-D-Glucosamine

N-Acetyl-(3-D-Mannosamine -

Amygdalin -

L-Arabinose + + +

D-Arabitol

Arbutin -

D-Cellobiose - - +

D-Fructose

L-Fucose

D-Galactose - - +

D-Galacturonic Acid

Gentibiose

D-Gluconic Acid

a-D-Glucose

M-inositol

a-D-Lactose - - ⁺

Lactulose

Maltose - - +

Maltotriose

D-Mannitol

D-Mannose

D-Me!ezitose

D-Melibiose

β-Methyl-D-Galactoside

3-Methyl Glucose

a-Methyl-D-Glucoside

β-Methyl-D-Glucoside

a-Methyl-D-Mannoside

Palatinose

D-Psicose

D-Raffinose

L-Rhamnose

D-Ribose + +

Salicin

Sedoheptulosan

D-Sorbitol

Stachyose

Sucrose - - ⁺

D-Tagatose D-Trehalose

Turanose

Xylitol

D-Xylose

Acetic Acid

a-Hydroxybutyric Acid β-Hydroxybutyric Acid γ-Hydroxybutyric Acid

P-Hydroxy-Phenylacetic Acid a-Ketoglutaric Acid

a-Ketovaleric Acid

Lactamide

D-Lactic Acid Methyl Ester L-Lactic Acid

D-Malic Acid

L-Malic Acid

Pyruvic Acid Methyl Ester

Succinic Acid Mono-methyl Ester

Propionic Acid

Pyruvic Acid

Succinamic Acid

Succinic Acid

N-Acetyl-L-Glutamic Acid

L-Alaninamide

D-Alanine

L-Alanine

L-Alanyl-Glycine

L-Asparagine

L-Glutamic Acid

Glycil-L-Glutamic Acid

L-Pyroglutamic Acid

L-Serine

Putrescine

2.3-Butanediol

Glycerol

Adenosine

2'-Deoxy Adenosine

Inosine

Thymidine

Uridine

Adenosine-5'-Monophosphate

Tymidine-5'-Monophosphate

Uridine-5'-Monophosphate

D-Fructose-6-Phosphate a-D-Glucose-1 -Phosphate

D-Glucose-6-Phosphate

D-L-a-Glycerol Phosphate 16S rRNA gene amplification

The 16S rRNA genes were amplified and analyzed as described in Items 1.6 and 1.9. The 16S rRNA genes for Geobacillus sp. A8 had shown a 92% sequence identity to Geobacillus thermoparaffinivorans strain it-12 (EU214615), an isolate cultured from a hot spring close to the Xiamen Sea in China (Chen & Yang, 2009), which is not included in any culture collection. The 16S rRNA genes for Geobacillus sp. A12 had revealed a 94% identity to Geobacillus thermoparaffinivorans as described in Table 8. These isolates from the NPM had exhibited novelty at the species level and therefore do not have a described type strain for comparative analyses. The taxonomic position of these novel species which belong to the genus Geobacillus, have not been classified in the Bergey's manual (Garrity et a/., 2004). However, other closely related species of the genus Geobacillus can be used for comparative analyses.

DNA composition

DNA composition analysis was done as described in Item 1.12. The G+C content of the DNA of genomes Geobacillus sp. A8 and Geobacillus sp. A12 was 50.7 and 49.0 mol%, respectively. The respective values between isolates Geobacillus sp. A8 and Geobacillus sp. A12 and other reference isolates of the genus Geobacillus (G. kaustophilus, G. vulcani, G. lituanicus and G. thermoleovorans) displayed similar DNA base composition ranging from 35-55 mol% GC (Nazina ef a/. , 2005). The re-association values were not determined.

Respiratory quinones

The analysis for respiratory quinones was done as described in Item 1.12. As described by Li et a/., (2010), the major structural respiratory quinone groups in microorganisms are ubiquinone (1-methy!-2-isoprenyl-3,4- dimethoxyparabenzoquinone) and menaquinone (1-isoprenyl-2-methylnaphthoquinone, MK-n). The side chains and lengths of quinones are variable among different microorganisms. Most studies have indicated that Gram positive microorganisms have the quinones MK-n. The quinone system for Geobacillus sp. A8 was dominated by MK7 (94%). This strain also had quinones MK6 (1 %) and MK8 (5%). The quinones for Geobacillus sp. A12 was also dominated by MK7 (96%). Other quinones identified were MK6 (2%) and MK8 (2%). These isolates use the same major quinone system and are similar to Geobacillus subterraneous and Geobacillus uzonensis (Nazina ef a/., 2001 ).

Polar lipids and fatty acid analysis

The phospholipids and polar fatty acids for Geobacillus sp. A8 and Geobacillus sp. A12 were done as described in Item 1.12. Phospholipids exist as random distribution of fatty acids with a β or γ side chain. As described by Hildebrand and Law in 1964, the β side chain usually contains unsaturated fatty acids and the γ side chain contains the saturated fatty acids. However it has been described that phosphatidylehanolamine (PE) commonly contains unsaturated fatty acids. The phospholipids of strains Geobacillus sp. A8 and Geobacillus sp. A12 were diphosphatidylglycerol (DPG), phosphatidylglycerol (PG), PE, aminophospholipid (PN) and phospholipids (PL)1-(PL)2. With the utilization of thin layer chromatography (TLC) done at the DSMZ a higher concentration of DPG, PG and PE were present in Geobacillus sp. A8. PN and PL1 -PL2 is presented in similar but smaller compositions in both Geobacillus isolates. DPG has a dimeric structure and four acyl groups with two negative charges. DPG and PG (anionic) are located mostly in bacterial membranes and are able to produce an electrochemical potential for the synthesis of ATP and the transportation of substrates. PE is incorporated into bacterial membranes and is an essential phospholipid in bacteria. PG and PE have also been found in a thermophilic microorganism Hydrogenbacter thermophilus TK-6 in relatively same concentrations (Yoshino ef a/., 2001 ).

The cell wall fatty acid profiles of Geobacillus isolates from the NPM had revealed that Geobacillus sp. A8 was dominated by the branched saturated fatty acids iso-C15:0 and iso-C17:0 similar to both Geobacillus kaustophilus TERI NSM and Geobacillus thermoleovorans GE-7 while Geobacillus sp. A12 largely contained of iso-C15:0, iso-C16:0 and iso-C17:0 similarly to Geobacillus jurassicus strain DS1 and DS2 described by Nazina er a/., 2005 (Table 10) (Figure 13). Geobacillus sp. A8 exhibited a higher relative percentage of iso-C15:0, C15:0 anteiso, iso-C16:1w7c, iso-C17: 1w5c, C-17:0 anteiso and Geobacillus sp. A12 exhibited a higher relative percentage of fatty acids (C15:0, C16:0, iso-C16:0, iso-C17:0) to each other. Geobacillus sp. A12 had a higher composition of iso-C17:0 anteiso to Geobacillus sp. A8 but a lower composition than both Geobacillus kaustophilus TERI NSM and Geobacillus thermoleovorans GE-7. Both isolates exhibited similar yet distinct differences in the fatty acid analysis to each other. As compared to other Geobacillus isolates, there were distinct similarities to the genus yet again distinct differences to other closely related Geobacillus thermoleovorans GE-7 and Geobacillus kaustophilus TERI NSM. Geobacillus sp. A12 iso-C16:0 fatty acid compositions were observed to be double of Geobacillus sp. A8, yet to have a similar profile to Geobacillus thermoleovorans GE-7. Geobacillus sp. A8 and Geobacillus A12 seemed to have a similar but lower C16:0 fatty acid compositions as compared to the phylogenetic relatives. Geobacillus thermoleovorans strain GE-7 had shown double the composition of C17:0 anteiso as compared to closely related isolates Geobacillus thermoleovorans and Geobacillus thermodenitrificans as described in DeFlaun ef a/., 2007. As compared to the NPM isolates, a similar profile to C17:0 anteiso was observed. Overall a significant difference in cell wall fatty acids were observed between the Geobacillus isolates from the NPM. Geobacillus sp. A8 fatty acid profile was very similar to previously characterized Geobacillus thermoleovorans GE-7 and Geobacillus sp. A12 exhibited a fatty acid profile similar to both Geobacillus kaustophilus TERI NSM, Geobacillus thermoleovorans GE-7, Geobacillus jurassicus DS1 and Geobacillus jurasicus DS2.

Table 10: Relative percentage comparison of major fatty acid profiles of Geobacillus sp. A8, Geobacillus sp. A12 Geobacillus isolates (DeFlaun et al., 2007; Sood & Lai, 2008)

G.A8 G.A12 G. TERI NSM GE-7

Fatty Acid Relative Relative Relative Relative

percentage percentage percentage percentage

14:0 iso 1.23 1.64 n/a NP

14:0 0.84 0.34 0.3 NP

15:0 iso 39.80 30.38 47.8 35

15:0 anteisio 5.10 3.50 NP NP

15:0 0.64 0.76 NP NP

16 0 iso 1 1.61 25.51 6.9 12

16:0 1.66 2.51 0 9

Iso 16:1 w7c 2.10 0.33 0 NP

Iso 17: 1 w5c 2.69 0.38 2.3 NP

17 1 anteiso A 1.09 0 0 NP

17 0 iso 17:37 19.70 23.9 22

17 0 anteiso 14.46 13.78 0 15

17 0 0.31 0.46 0 NP

18 0 iso 0.22 0.35 0 NP

18 0 0.32 0.21 0 NP

12 0 aide unknown 0.56 NP NP NP

14 0 iso 30H NP 0.15 NP NP

Bold font = cell wall fatty acid largest composition.

NP = Not Provided

Cell wall sugars

The whole cell wall sugars of Geobacillus sp. A8 revealed high amounts of ribose and smaller amounts of xylose and traces of mannose and arabinose. The whole cell wall sugars of Geobacillus sp. A12 revealed high amounts of ribose and traces of galactose. Therefore these two strains are structurally different from each other. The cell wall sugar composition of Geobacillus microorganisms has been described to be similar and the major sugar component in both isolates is common in Gram positive bacteria (Nazina et al., 2001 ).

Conclusions

To the Applicant's knowledge, the first comprehensive microbial phylogenetic study of the fissure water from the subsurface of the NPM has been performed by cultivation-independent analysis. An overall low diversity has been observed at the species level with the 16S and 18S rRNA gene libraries with a high interspecies diversity. The 16S rRNA gene library had reached saturation at the 1% (interspecies level), 3% (species level) and 20% (phylum level) therefore the whole extent of the 16S rRNA gene library microbial diversity has been revealed.

As compared to other deep mine diversity studies with borehole fissure water, the Applicant has reported herein on one of the deepest platinum mines in South Africa with a relatively overall low prokaryotic diversity consisting of mainly a and y-Proteobacteria, which correlates with the studies by Gihring and co-workers (2006), and Borgonie and co-workers (201 1 ), at two different sites. However all three sites had displayed OTUs unique to each site, with low diversity at each site but suggesting an overall high diversity at the NPM. DGGE analysis provided a suitable comparative analysis of the microbial biodiversity of the biome. The geochemical data emphasizes the presence of lithotrophs and heterotrophy as substantiated by the phylogenetic analysis. There are very few limited eukaryote diversity reports shown from deep subsurface mines in South Africa. Here, the Applicant reports a high interspecies diversity among the eukaryotes from the NPM and this has been supported by phylogenetic data of Gihring and co-workers (2006). DGGE analysis had emphasized the novelty of the biome and had confirmed the eukaryal genera present, however interspecies diversity was only observed in the phylogenetic analysis. The 18S rRNA gene sequences exhibited 13 different OTUs at a 3% distance, where 90% of their closest relatives had shown an affiliation with the protozoan Heteromita globosa, a soil flagellate known to survive in oxygen limiting environments and be involved in the bio-grazing of Pseudomonas species that has been established by the phylogenetic study. These microbial communities' endurance are probably based on the geochemical energy obtained from the igneous rock and the reduced minerals that will facilitate a growing era of life in the deep subsurface. Novel isolates from the second collection site (NO24FW030908) were found to be associated with the biome of the NPM from a warm fissure water sample at shaft 2. level 12. A total of 10 isolates were cultured and of these, 5 isolates had a <97% sequence identity to other Geobacillus sp. sequences in the NCBI public database. At the 3% distance, Geobacillus sp. A7, Geobacillus sp. A8, Geobacillus sp. A12 and Geobacillus sp. A13 had displayed novelty at the species level. Geobacillus sp. A14 had shown an 85% sequence identity to Geobacillus thermoleovorans and a close phylogenetic association to Thermoalkalibacilus uzonensis. Geobacillus sp. A8 and Geobacillus sp. A12 were characterized for taxonomic position using strain characterization techniques by DS Z. These two isolates exhibited similarities in the biochemical, morphological, quinone and polar lipids characteristics. They had also shown their differences in the DNA composition analysis, fatty acid compositions and cell wall sugar compositions. Overall the identification of these isolates revealed characteristics identical to the genus Geobacillus and displayed similar characteristics yet are also very different to reported strain characterizations such as Geobacillus thermoleovorans GE-7 an isolate also cultured from the deep subsurface, therefore novelty has been emphasized at the species level, and hence Geobacillus sp. A8 and Geobacillus sp A12 will be added to the DSMZ culture collection. There have been many novel phylogenetic lineages with low diversity that has been described from fissure water studies: however the advancement and development of new sampling techniques increases the possibility of discovering even more novel lineages in the deep subsurface.

Example 2: Platinum reduction and nanoparticle formation by bacteria isolated from the NP

2.1 Bacterial cultures

Isolates from the Northam platinum mine (NPM) were grown in optimal enrichment media at 55°C as described herein above. Thermus scotoductus SA-01 (ATCC 700910) was isolated by Kieft and co-workers (1999), and was cultured at 65°C in a complex organic tryptone, yeast, glucose (TYG) media (5 g tryptone; 3 g yeast extract and 1 g glucose per litre of water).

2.2 Whole cell preparation

Cultures were grown overnight in 250 ml flasks containing 100 ml of each individual respective medium in shaking incubators (200 rpm) as described in Item 1.9 and collected between mid exponential and stationary phase. The biomass was separated from the medium by centrifugation (8000 x g; 15 min; 4°C). Removal of excess media was done by washing the biomass three times with 200 ml of 50 mM Tris HCI, pH 7.5 buffer followed by centrifugation (8000 x g; 15 min; 4°C). The resting cells were suspended in 50 mM buffer at pH7.5 and made up to a 15% (g wet weight/vol) stock solution (van Marwjik, 2010). Each step of the assay was done in the anaerobic glove box that was flushed three times with N₂ (99.99%) [v/v] and flushed twice with a combination of N₂, C0₂ and H₂ (80: 10:10) [v/v] (200 kPa) before use.

2.3 Platinum reduction assay

The optimization of the platinum assay was adapted from Konishi and co-workers (2007), with the following modifications: the selection of a suitable electron donor, buffer and optimal parameters under anaerobic conditions. 2.4 Selection of electron donor and whole cell reduction

Various electron donors that could be involved in platinum reduction under anaerobic conditions were tested. Electron donors that were used at a final concentration of 2 mM were NAD⁺, NADH and NADPH, at a final concentration of 30 mM were glucose, pyruvate and lactate, and hydrogen gas which was flushed into the tube. Lactate was also supplemented with 2mM NAD\ Anaerobic gas tight tubes (10 ml) were sealed with rubber stoppers and clamped with metal caps (Wheaton science products, U.S. A). The tubes were flushed with 99.99% [v/v] N₂ gas containing 50 mM Tris-CI buffer, pH 7.5. When H₂ was used as the electron donor, anaerobic tubes containing 50 mM Tris-CI buffer, pH 7.5 were flushed with 99.99% [v/v] H₂ gas instead of N₂ gas. After the tubes were flushed with the appropriate gas, they were autoclaved before the addition of cells. A 10 mM stock solution of hydrogen chloroplatinic acid (H₂PtCI₆) (Pt IV) (Sigma-Aldrich, U.S. A) in distilled water was filtered through a 0.2 pm filter, flushed with 99.99% [v/v] N₂ gas before use and added to the tubes to a final concentration of 2 mM. This was followed by the addition of the resting cells as described in Item 2.2. During all whole cell reduction experiments a final concentration of 3% [w/v] resting cells were used in any reaction tube. There were three control reactions for this experiment. The first control reaction was the same except that it was under aerobic conditions. The second control reaction was completed in the absence of resting cells and the third control reaction was completed in the absence of H₂PtCI₆. All reactions were incubated at respective culture growth temperatures for 16 to 48 hours.

2.5 Screening novel isolates for platinum reduction

Platinum reduction was evaluated visually by a colour change indicating a positive. A yellow colour indicated Pt (IV) and the reaction was observed for the loss of a yellow colour yielding a colourless reaction indicating the reduction to Pt (II). A black brown precipitate indicated Pt (0). 2.6 Alternative platinum reduction assay

A wavelength scan from 200 nm to 400 nm using the Cary 300 Bio UV-visible spectrophotometer was used to detect platinum at each oxidation state more quantitatively and to determine the surface plasmon resonance band for platinum nanoparticles. Pt (IV) was detected at a wavelength of 261 nm; Pt (II) was detected at 225 nm and Pt (0) at a wavelength of 334 nm (Henglein ef a/., 1995; Liu ef a/., 2004). The reactions were also monitored over time for the first reduction step of Pt (IV) for a dilution series from 0.01 mM to 0.12 mM. The analysis was done in triplicate (Figure 14).

2.7 Electron microscopy

Platinum metal particles were isolated by selective sedimentation (20 000 x g; 30 min) and suspending the precipitate with water. The metal would settle to the bottom and the cells that were suspended in the liquid were removed by aspiration using a pipette. The process was repeated at least three times. The platinum particles were then prepared for electron microscopy.

Positive reduction by isolates was further analyzed by transmission electron microscopy (TEM) (University of Ghent, Electron Microscopy Unit, Belgium and at the University of the Free State Electron Microscopy Unit, R.S.A).. scanning electron microscopy (SEM) (University of the Free State, Department of Physics), electron dispersive X-ray spectrometry (EDS) coupled to TEM (Nelson Mandela Metropolitan University, Microscope Unit, Port Elizabeth, R.S.A) and X-ray diffraction (Intertek MSG, U.K).

TEM analysis of the samples was carried out by adding a drop of the prepared cell-free extracts onto a carbon formvar grid. The excess liquid was removed using filter paper and the grid left to dry at room temperature overnight. Selected samples were also used for thin layer sections. The cells used for platinum reduction were washed twice in 50 mM Tris-CI, pH 7.5 buffer and separation of biomass was done by centrifugation (8000 x g; 15 min). Cells were fixed overnight with 3% glutaraldehyde prepared in Tris-CI buffer and a series dilution of acetone in water was used to dehydrate the cells. The cells were then immersed in agar and embedded in two changes of spurr epoxy resin followed by polymerization of the epoxy blocks at 70°C for 8 hours. The embedded material was then ready for sectioning by the ultra microtome. Each section was cut with a glass knife at a thickness of 60 nm - 90 nm. A single section was then placed on an Athene 200-mesh copper grid and analysed using the TEM. All electron micrographs were recorded using a Philips CM 200 kV CM 20 TEM (van Wyk & Wingfield, 1991 ). EDS was also performed on these samples. The instrument used was a 200 kV Philips CM20 transmission electron microscope with EDAX DX4 (EDS) system.

For SEM analysis, a drop of the selected cell free extract samples was- added onto silicone tape and left to air dry overnight before analysis using the scanning Auger nanoprobe PHI 700 (Physical Electronics, U.S.A) coupled to a SEM. A primary electron beam bombards the sample and with the release of Auger electrons kinetic energy is released which yields a specific signal for a specific element.

2.8 X-ray diffraction

Platinum particles recovered from whole cell reduction experiments were thoroughly washed three times in distilled water. The samples were air dried and then sent for elemental analysis to Intertek MSG, U.K. The samples were then ground with a small volume of propan-2-ol and mounted as thin layer specimens on single crystal silicon disc holders. The Siemens D5000 diffractometer D6 and the Bruker AXS Diffrac-Plus basic measurement centre XRD Commander Software, version 2.4 were used for data capture. The Si/Li energy dispersive detector was used. The scan start angle measured 1.5° and the finish angle measured 1 5° with a step size of 0.02° at 5 sec. intervals. Particle size and distribution analysis

The size and distribution of platinum particles were analysed using the NanoTrac particle size analyzer (MicroTrac, Inc, U.S. A) at Swiss Labs, R.S.A and the Gaussian and Multi-modal NiComp 380 2LS particle sizing system (Agilent Technologies, U.S. A) at Particle Sizing Systems, U.S.A. Samples were prepared as described in Item 2.6. The samples were visibly aggregated and concentrated. These samples required probe ultrasonication for 5 min at 100 W to break apart the aggregates and were diluted for particle size analysis.

2.10 Hydrogen oxidation capacity

The assay for hydrogen oxidation capacity by heterotrophic bacteria Geobacillus sp. A8 and Thermus scotoductus SA-01 were carried out by initially growing the culture aerobically in complex LB medium (as described by Sambrook et a/., 1989) and TYG respectively. Geobacillus sp. A8 was incubated at 55°C and Thermus scotoductus SA-01 was incubated overnight at 65°C in a shaking (200 rpm) incubator. The growth medium selected for the hydrogen oxidation assay was minimal chemolithotrophic broth (Table 1 1 ) (Kliiber, 1995). The ferric ammonium solution (0.125 g per 50 ml) was added to the chemolithotrophic medium before flushing the tubes with H₂ gas. A volume of 100 μΙ of each culture in their respective liquid medium was transferred to an anaerobic tube containing 99.99% [v/v] H₂ gas as the electron donor and surplus Fe (III) as the electron acceptor in 2 ml of minimal chemolithotrophic medium. Potassium nitrate (10 mM) was also used instead of Fe (III) to determine respiration in the presence of hydrogen.

Table 11 : Minimal chemolithotrophic medium for the hydrogen oxidation capacity assay

Minimal chemolithotrophic medium Trace minerals solution

Reagents Per litre Reagents Per litre

Na₂HP0₄.2H₂0 2.9 g MnCI₂.4H₂0 0.5 g

KH₂P0₄ 2.3 g H₃B0₃ 0.3 g

NH4CI 1 .0 g CoCI₂.6H₂0 0.2 g

MgS0₄.7H₂0 0.5 g ZnS0 .7H₂0 0.1 g

NaHC0₃ 0.5 g Na₂Mo0₄.2H₂0 0.03 g

CaCI₂.2H₂0 0.01 g NiCI₂.6H₂0 0.02 g

Ferric ammonium citrate 50 ml CuCI₂.H₂0 0.01 g

solution

Trace elements 5 ml 2.11 Hydrogenase inhibition tests

Hydrogenase activity can be inhibited with carbon monoxide, cyanide and rotenone (Bongers, 1967). The resting cells were prepared for whole cell experiments as described in Item 2.2. The cells were then transferred to an anaerobic gas tight tube and then flushed with 100% [v/v] carbon monoxide and the cells were left to stand for an hour. This was followed by whole cell reduction. Similarly, sodium cyanide or rotenone was also used as the inhibitor in the reaction at 0.5mM, 1 mM and 2mM final concentrations.

2.12 Hydrogenase activity stain

The 2, 3, 5-triphenyl tetrazoliumchloride (TTC) test was a modified version described by Kluber, 1995. Colonies of Geobacillus sp. A8 and Thermus scotoductus SA-01 were grown overnight as described in Item 2.1. Single colonies were picked and transferred onto a sterile filter paper strip (3 mm by 5mm, Preiser Scientific, U.S.A) in approximately 2-3 ml of a 0.1 % [w/v] TTC solution freshly prepared in a Petri dish. The filter strip was placed in a sterile 100 ml Schott bottle with a rubber stopper inserted into a hole in the cap and incubated for 15 min under air at room temperature in the dark after which it was flushed with 99.99% [v/v] H₂ gas for ten seconds to create a H₂:0₂ atmosphere. This was followed by a second incubation for 15 min at room temperature in the dark. After each incubation step the colonies were monitored for the appearance of a red colour change. If the colonies appeared red it is indicative of the presence of an active hydrogenase.

2.13 DNA isolation and genome analysis

Genomic DNA isolation of the Geobacillus sp. A8 was extracted using the Fast® soil DNA extraction kit which was followed according to the manufacturer's instructions. Extracted DNA was quantified using the NanoDrop ND-1000 spectrophotometer (NanoDrop, Germany). Genomic DNA was visualized on a 1% [w/v] agarose gel containing Goldview using a Gel Doc XR (Bio-Rad Laboratories, Hempstead, U.K) after electrophoresis at 90 V for 60 minutes. The molecular weight marker used was GeneRuler™ DNA ladder mix (Fermentas, U.S.A). Strain identity was verified by the amplification of the 16S rRNA gene and the transformation into the pGEM T easy vector system (Promega, U.S. A) as described previously in Item 1.8. Five clones were randomly selected and sequenced. DNA was sent to Inqaba Biotec, South Africa for genome analysis using the GS FLX Titanium DNA sequencer.

The reads were assembled using the Roche Newbler assembly software by de novo assembly and mapping using known Geobacillus genome sequences as templates. The Roche ace assembly file was converted to a Staden gap file using the roche454ace2caf and caf2gap conversion pipeline (http://genome.imb- jena.de/software/roche454ace2caf/). The gap4 module of the Staden package (Judge ef al., 2001 ; Staden ef al., 2000) was used to manually check the assembly and to join contigs which may have been missed by Newbler.

After editing, the contigs were joined with the sequence NNNNN C ACAC ACTTAATTAATTAAGTGTGTG NNNN to generate a pseudo-chromosome. The sequence inserts stop codons in six reading frames. Genome annotation was done using the prokaryotic annotation pipeline at the Institute for Genome Sciences at the University of Maryland (http://ae.igs.umaryland.edu/cqi/index.cgi).

The ORF annotation was viewed using Manatee (http://manatee.sourceforge.net) and the manual editing and analysis of the annotated ORFs was done using Artemis software (Rutherford ef al,, 2000). The annotation data was used to construct a pathway genome database (PGDB) of Geobacillus sp. A8 using the PathwayTools software (Karp et al., 2002). The software allows the user to generate a model organism database. All the genes, proteins and the derived metabolic network are incorporated into the PGDB. 2.14 Protein characterization

Subcellular fractionation

Geobacillus sp. A8 was grown in LB medium (Table 12). The cells were harvested by centrifugation (10 000 x g; 15 min; 4°C) at mid exponential phase and washed three times with 50 mM Tris-CI, pH 7.5. Cells (1g wet weight) were resuspended in 20 ml of 50 mM Tris-CI, pH 7.5 containing 25% [w/v] sucrose. Subcellular fractions were prepared as described by Opperman & van Heerden, 2007 with modifications. Cell wall lysis was carried out by adding 0.1 % [w/v] lysozyme and shaking (200 rpm) at 37 C for 30 min. This was followed by the addition Na₂ EDTA, pH 8.0 to a final concentration of 5mM, shaking for 20 min, addition of MgCI₂ to a final concentration of 13 mM and shaking for 20 min. The separation of the periplasmic fraction (supernatant) and spheroplasts (pellet) was done by centrifugation (20000 x g; 30 min). The spheroplasts were resuspended in 20 mM Tris-CI, pH 7.5 followed by cell disruption using the French press at 30 psi. followed by removal of the cell debris by centrifugation (4000 x g; 10 min; 4°C). The supernatant containing the crude extract was separated into the cytoplasmic fraction (supernatant) and membrane (pellet) by ultracentrifugation (110000 x g; 1.5hrs; 4°C). The membrane was resuspended in 20 mM Tris-CI, pH 7.5.

The periplasmic fraction contained 25% [w/v] sucrose. Removal of the sucrose was done by dialysis. The suspension was added to a 3.7 ml/cm dialysis membrane (Snakeskin, Thermo Scientific, U.S.A). The dialysis membrane was then immersed into 1 L of 20 mM Tris-CI, pH 7.5 and stirred overnight at 4°C. The buffer was changed twice during that time.

Protein assay

Protein concentration was determined using the Pierce kit (Thermo Scientific, U.S.A) based on the bicinchoninic assay (BCA) described by Smith ef a/., 1985. A standard curve for protein concentration was constructed at the wavelength of 562 nm. The protein standard used was bovine serum albumin (BSA) provided with the kit and was prepared at various concentrations in distilled water. A volume of 1 ml working reagent and 50 μΙ of each standard or unknown sample were added to 1.5 ml eppendorf tubes and vortexed. This was followed by incubation at 60°C and reading the absorbance at 562 nm (Figure 15).

The purification of proteins from the periplasmic fraction

Anion exchange chromatography was used to purify proteins from the periplasmic subcellular fraction. All purification steps were carried out aerobically and the enzyme fractions collected were stored at 4°C. The sample was applied to a diethylaminoethyl (DEAE) - Toyopearl 650 M column (6 cm x 2.5 cm; Tosoh Corporation, Japan). The purification was followed using the Akta Prime Plus Purification System (Amersham Biosciences, U.S.A.). Pre-equilibration was done with 20 mM Tris-HCI, pH7 (buffer A). Unbound proteins were eluted from the column with pre-equilibrium buffer and elution was performed using a 0-1 M NaCI gradient in 20 mM Tris-CI, pH 7. Fractions of 5 ml were collected in 15 ml Falcon tubes. Strongly bound protein fractions that were eluted with a high salt concentration were dialyzed against 50 mM Tris-CI, pH 7.5.

SDS-PAGE analysis

Protein separation was performed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions as described by Laemmli, 1970. A 10% resolving gel was used for proteins greater than 25 kDa and a 15% resolving gel was used for proteins equal to or less than 25 kDa with a 4% stacking gel. The mighty small SE245 dual gel caster (Hoefer Scientific Instruments, U.S. A) was used to cast the SDS-PAGE gel and the proteins were separated using the Hoefer miniVE vertical electrophoresis system at 100 V, 20 mA for 3 hours. Protein Standards (Bio-Rad Laboratories, Hampstead, U.K) were used as molecular weight markers. Protein bands were visualized by staining the gels with coomassie brilliant blue R-250 (Fairbanks et a/., 1971 ) or silver (Rabilloud et al., 1988). Protein separation of the periplasmic fraction by ultrafiltration

The periplasmic fractions were applied using the Amicon® concentrator at 100 kPa. The two ultrafiltration membranes (Millipore) used consisted of regenerated cellulose with nominal molecular weight cut off at 30 kDa and 10 kDa. The retentate and filtrate fractions were collected for the 30 kDa and 10 kDa membranes. The 30 kDa membrane retentate fraction after ultrafiltration contained proteins greater than 30 kDa and the filtrate fraction contained proteins less than or equal to 30 kDa. The 10 kDa membrane retentate fraction after ultrafiltration contained proteins greater than 10 kDa and the filtrate fraction contained proteins less than or equal to 10 kDa.

Trypsin digest for mass spectrometry

The protein bands of interest after SDS PAGE were excised from the polyacrylamide gel and samples were prepared for trypsin digestion as required for mass spectrometry and protein identification. The excised bands were transferred to a sterile 1.5 ml eppendorf tube and washed twice in 0.1 ml distilled water for ten minutes. The gel pieces were then alternatively washed three times with ultra pure water and 50% [v/v] acetonitrile for 15 min each and repeated two times. Dehydration of the gel pieces was done with a few drops of 100% acetonitrile to cover each gel piece. After 15 min the gel pieces had shrunk and the acetonitrile was removed by aspiration using a pipette. Reduction was performed with 10 mM dithiotreitol/0.1 M NH₄HC0₃ and incubated for 45 min at 56° C. The tubes were then cooled to room temperature. All excess liquid was removed by aspiration and alkylation followed by the addition of the same volume of iodacetamide solution (55 mM lodoacetamide; 0.1 M NH4HCO3) and incubation in the dark for 30 min. The iodoacetamide solution was removed by aspiration and the gel pieces were washed alternating again with ultra pure water and 50% [v/v] acetonitrile for 15 min each and again dehydrated with 100% acetonitrile. All excess acetonitrile was aspirated and the gel pieces dried in a rotary concentrator (5301 Eppendorf, U.S.A) at 30°C for 15 min. This was followed by digestion of the peptides with trypsin (Promega, U.S.A). Digestion of the peptides was performed on ice by the addition of a trypsin digest solution [50 mM NH₄HC0₃; 5ng/pl trypsin]. All gel pieces were covered with the digestion solution and incubated at 4 C for 45 min. The supernatant was then aspirated and the digest was then resuspended in 20 μΙ of 50 mM NH₄HCO3 without trypsin and incubated at 37 C overnight.

The supernatant of the digest solution containing the peptides of interest was transferred to a sterile eppendorf tube. A volume of 20 μΙ formic acid at a final concentration of 5% [v/v] was added to the supernatant, vortexed (Vortex-Genie, Scientific Industries, U.S.A) for 10 seconds and incubated for 15 min at room temperature. This was followed by the addition of approximately 20 μΙ of 100% acetonitrile, vortexing for 10 sec and incubation at room temperature for 15 min. The supernantant containing the peptides were separated by centrifugation (5000 x g; 10 min) and transferred to a clean 1.5 ml eppendorf tube. The gel pieces were again treated with 5% formic acid and 100% acetonitrile and the same peptide extraction steps were repeated. Both the supernatants containing the peptides were combined and completely dried in the rotary evaporator for 20 min at 30°C and the peptides were re-dissolved in 5% formic acid. The digests were then analysed by mass spectrometry at the University of the Free State, R.S.A.

The analysis was done on an AB SCIEX API4000QTRAP hybrid triple quadrupole linear ion trap LC/MS/MS instrument equipped with a nanospray ionization source. Peptide separation was performed using an Agilent 1200 series nanoflow HPLC stack by injecting 5μΙ of the peptide digest onto an in-line Zorbax SB300 C18 5pm (5mm x 0.3mm) column to concentrate and desalt the sample. After a 3 minutes loading period a switching valve redirected the LC flow and the peptides were eluted off the trapping column onto an Agilent Zorbax 300SB C18 3.5pm (150mm x 75um) nanoflow column for peptide separation at 350 nl/min. The peptides were separated with a LC program as follows: 0 to 10 min at 0%B; 15 min 10%B; 95 min at 25%B; 100 min at 50%B; 101 min at 90%; 120 min at 90% B followed by adequate column equilibration. Eluent A consisted of H₂0 with 0.1 % formic acid and eluent B of 100% acetonitrile with 0.1 % formic acid. Eluting peptides were analysed on the mass spectrometer in positive ionization mode with the following parameters: Curtain gas of 15 psi; collision gas at high; ion spray voltage at 3000 V and nebulization gas at 20 psi. The instrument was operated in information dependant acquisition (IDA) mode where, as a survey scan, an enhanced MS (EMS) scan was performed between 400 and 1400 Da at a scan rate of 1000 Da/sec. From this survey scan the 3 most intense peaks above 200,000 counts per second (cps) were picked by the software and an enhanced resolution scan (ER) were performed to determine the peptide charge state. These three peptides were subsequently submitted to the collision cell for fragmentation and the fragmentation pattern (MS/MS) from the enhanced product ion (EPI) spectra obtained was used by MASCOT (Matrix science) for protein identification. The MS/MS data from the entire chromatographic run was submitted to a local MASCOT server where the Swissprot database was queried. The parameters used were the default values for an ion trap with a peptide mass tolerance of 1.2 Da and the fragment mass tolerance of 0.6 Da and allowing up to 4 miss cleavages by trypsin.

The peptide sequences were subjected to BLASTP (Altschul et al., 1999) against the Swissprot database using the software MASCOT (http://cbio.ufs.ac.za/mascot/) and the Geobacillus sp. A8 ORF database on an internal net-blast server (Gilmore er a/., 1999).

Results and discussion

Electron donor selection and whole cell reduction

Hydrogen chloroplatinic acid was used as the platinum salt (Pt IV) in the reduction. It can be reduced by hydrogen (H₂) by the reaction: H₂PtCI₆ + 2H₂-»Pt (0) + 6HCI (Teranishi et al., 2000). The reactions were done as described in Item 2.4. The chemical reaction showed minimal reduction when observed after two to three weeks of incubation with a small yield of elemental platinum at the meniscus of the tube (Figure 16), thus not contributing to any reduction observed in the other reactions described in Item 2.4. In the biological reduction of Pt (IV) to Pt (0) four electrons are required to complete the two step cycle as shown in Rashamuse and coworkers (2008), therefore sufficient electron donor is required to provide four electrons.

All electron donors described in Item 2.4 except H₂ yielded a positive reduction of Pt (IV) (Table 13). Together with the other electron donor reaction results, this observation excluded the classical oxidation reduction pathway for metal reduction. Therefore, the platinum reduction pathway does not follow the regular pathway of the generation of reducing equivalents via glycolysis or the Krebs cycle does not yield platinum reduction unlike other metals such as the chromate and iron reductase pathways (Bester ef al., 2010; Opperman & van Heerden, 2007). H₂ gas without whole cells was not involved in the reduction of PtCI₆ ^2" ions, an indication that the cells play a role as the catalyst in the reaction as described by Rashamuse and co-workers (2008), and that it possibly followed the same reduction pathway via a hydrogenase. Therefore hydrogen was selected as the electron donor in the platinum reduction assay. The only variation in the platinum reduction was observed when NADH was used as an electron donor, although at a very low concentration, there was a colour change in the cell suspension but no real platinum reduction was visible.

Table 13: Whole cell reduction with various electron donors

Screening novel isolates for platinum reduction

The whole cell reduction assay was done as described in Item 2.4. Thermus scotoductus SA-01 was chosen as the comparative isolate for platinum reduction because this microorganism has shown to be involved in dissimilatory reduction of metals (Kieft et al., 1999). All Northam platinum mine (NPM) isolates were incubated at 55°C overnight. The observed results for the reduction of platinum are shown in Table 14. The reduction of platinum to elemental platinum can be seen clearly in Figure 17A where a black precipitate formed under anaerobic conditions. All 9 isolates from NPM and Thermus scotoductus SA-01 showed the ability to reduce platinum. All controls showed a negative chemical reduction (Figure 17 B-C). These experiments were repeated in triplicate and the metal particles were further analyzed by electron microscopy for size, shape and particle size distribution.

Table 14: Platinum reduction with newly cultured isolates from the NPM

Isolates tested Platinum reduction

Brevibacillus thermoruber Aggregation of black precipitate in solution after overnight incubation.

Geobacillus sp. A4 Black precipitate in solution after overnight incubation.

Geobacillus sp. A5 Black precipitate with larger particles in solution after overnight incubation.

Geobacillus sp. A7 Black precipitate in solution after 20 hours of incubation.

Geobacillus sp. A8 Black precipitate with small aggregates in solution after overnight incubation.

Thermus sp. A10 Black precipitate in solution after overnight incubation.

Geobacillus sp. A11 Black precipitate in solution after overnight incubation.

Geobacillus sp. A12 Black precipitate in solution after overnight incubation. Geobacillus sp. A13 Black precipitate in solution after 20 hours of incubation

Thermus scotoductus SA-01 Black precipitate with smaller aggregates observed than with Geobacillus sp.

A8 after overnight incubation.

Alternative platinum reduction assay

In order to determine the reduction of platinum and the oxidation states of the Pt in the reactions, a UV-Vis spectroscopy investigation was conducted as described herein above. A wavelength scan was drawn from 200 nm to 400 nm. The absorbance for H₂PtCI₆ is at 260 nm. At time 0, a peak at approximately 260 nm was observed (Figure 18A), however over time the peak disappeared (Figure 18B). This could also be due to bio- absorption of the PtCI₆ ^2" ions by the resting cells. If one should follow the platinum reduction steps in order to confirm reduction, the shift in peak from 260 nm to 235 nm can be observed. For Geobacillus sp. A8 whole cell reduction, a peak was found at 230nm (Pt II) as shown in Figure 18C. If one analyzes reduction of Pt (IV) to Pt (0), the reduction to Pt (0) should preferably be verified visually. Only a very small peak appeared at 334nm (Pt 0) indicating the reduction of Pt (IV). This was due to the high concentration of metal particles that were not all in the nanoscale range and did not give the typical surface plasmon resonance peak. These absorbance values correlate to values obtained from literature, Pt (II) at 225nm (Henglein ei a/, 1995) and Pt (IV) at 261 nm (Liu et al, 2004). In Figure 19, wavelength scans show evidence of the reduction of Pt over time. Elemental platinum could not be quantified because the metal particles' absorbance wavelength characterized for platinum nanoparticles were not constant due to the density of the black precipitate. This had occurred because of the agglomeration of the particles. Observation of the metal particles had to be done by electron microscopy.

Platinum reduction and nanoparticle observation

Transmission electron microscopy

Whole cell reductions were observed for platinum and analyzed using TEM (Figures 19, 20 and 21 ) as described above. After exposure to the H₂PtCI₆ solution, nanoparticles were observed to be distributed across the cell wall as seen by Konishi and co-workers (2008), when Shewanella algae cells were exposed to H₂PtCI₆ solution. TEM images had indicated polydisperse spherical metal particles at the nanoscale range of 5-10 nm. Since heavy metals in solution are toxic to the cell, a cell defence mechanism is to convert the valence of the metal to a non-toxic form (Husseiney ef a/., 2007). This has lead to the formation and agglomeration of nanoparticles by the cell by enzymatic reduction. The toxicity of the heavy metal and the reduction to elemental metal had influenced the morphology of the cells and they became elongated and narrow, deviating from the normal dimensions of 3-6 μΜ long and 0.8 iiM wide. Apart from the formation of platinum particles observed on the cell walls (Figure 20A), platinum reduction was observed in the matrix between the cells where particle aggregation had occurred (Figure 19B). To confirm the bioreduction of platinum, EDS and XRD analysis was done. Thin sections of the cells of Geobacillus sp. A8 revealed platinum metal particles were localized in the periplasmic space which is situated outside the inner membrane of the cell (Figure 21 ). The agglomeration of the particles on the cell wall and the matrix suggest the possibility of the biomineralization processes BIM or BCM used by the microorganism. Since the nanoparticles were synthesized in the periplasm and not in the aqueous solution, it is likely that an enzyme or protein system responsible for the reduction of the PtCI₆ ^2" ions is localized there. As hypothesized by Konishi and co-workers (2008), platinum bioreduction and deposition by the resting cells may occur by the bio-absorption of the PtCI₆ ^2~ ions from solution into the periplasmic space and enzyme reduction of the PtCI₆ ^2" ions with hydrogen as the electron donor. In the case of Konishi and co-workers (2008), the electron donor was lactate. Both NPM isolates and Thermus scotoductus SA-0 cells demonstrated the deposition and bioaccumulation of platinum nanoparticles in the periplasmic space.

Electron dispersion spectrometry

Electron dispersive spectrometry coupled to TEM analysis was used to determine the elemental composition of the nanoparticles from Geobacillus sp. A8 and Thermus scotoductus SA-01 and was performed as described herein above. From Figures 22 and 23, the Cu and low emission Cr peaks observed occurred from background signals of the supporting grid. There were no observed emission signals from chlorine, indicating the absence of contaminating H₂PtCI₆ and the presence of elemental platinum nanoparticles. EDS emission signals of C and O had arose from cellular components.

SEM Auger nanoprobe analysis

The scanning electron microscopy (SEM) using the Auger PHI 700 nanoprobe was used to determine the size, shape, element composition and particle size distribution of biogenic platinum nanoparticles produced by Geobacillus sp. A8 and Thermus scotoductus SA-01 as described herein above. The Auger (Riviere, 1973) nanoprobe mechanism bombards the sample with a 25 kV primary electron beam. With every excitation an Auger electron with a specific kinetic energy is released, producing a signal which is specific for each element. Organic material is not as electron conductive as metal and therefore the Auger electrons do not scatter too far away from the sample. This causes a charging of organic material and is indicative of a bright glow in Figures 24A to 24F. The kinetic energy spectra indicated the element composition of the sample. C, N₂ and 0₂ were detected at different energy levels which were expected because of the presence of the cells. Platinum was also detected confirming the presence of platinum in the sample. The absence of chlorine in the element compositions indicated the absence of chloroplatinic salts and therefore the presence of elemental platinum. In Figures 24B and 24F, target analysis was also done to confirm the distribution of metal throughout the sample. Spherical platinum nanoparticles approximately 60-69 nm were observed for Geobacillus sp. A8 and spherical platinum nanoparticles with a size range of 36 nm to 96 nm were observed for Thermus scotoductus SA-01. Although both isolates had produced the same shape nanoparticles, the size and distribution were different with Thermus scotoductus SA-01 with smaller and larger nanoparticles observed as compared to Geobacillus sp. A8. Agglomeration of nanoparticles was observed due to smaller particle sizes and a larger specific surface area (Xue et al., 2005). As observed in Figures 24(B-E) the cells involved in the platinum reduction were disrupted during the reaction, where an overflow of platinum nanoparticles was observed. This postulates the possibility of these platinum nanoparticles being synthesized by enzyme reduction localized in the periplasmic region of the cell. The cell morphology was also affected by the toxicity of the PtCI₆ ^2" ions and with the reduction of the platinum. The cells' morphology had been affected as observed in Figures 24C and 25E as nanoparticles were deposited across the cell. Overall, the observation of spherical platinum nanoparticles were confirmed and both isolates had obtained similar profiles. The size of the nanoparticles differed but the optimization for a specific size range was not done.

X-ray diffraction analysis

X-ray diffraction (XRD) analysis was performed as described herein above to confirm the oxidation state of the platinum after platinum reduction in solution. X-ray diffraction analysis was determined using Braggs law of diffraction which is when the phases of the reflected beams coincides when the angle of incidence equals the angle of reflection (Jauncey, 1924) as illustrated by the 2Θ scale in Figures 26A and 26B. The crystallite size was determined by the Scherrer method (Langford & Wilson, 1978) by taking into account the Bragg angles (2Θ) that is inversely proportional to crystallite size (Meir, 2004). Periodic lattice structure distortion is due to the change in lattice parameters such as the Debye-Waller parameter that describes the displacement of the atoms from their original and most preferred positions (Lu & Zhao, 1999; Tsutsumi, 1982). The platinum crystallite size for Geobacillus sp. A8 was determined to be 3.6 nm with a lattice distortion of 6.4 nm and for Thermus scotoductus SA-01 it was determined to be 3.5 nm with a lattice distortion of 6 nm. The results do have some limitations because of the presence of broad peaks and the complexity of the profile fitting process due to the bacterial cells present in the samples. X-ray diffraction emissions had confirmed the presence of biogenic elemental oxidation state of the platinum nanoparticles present in both solutions (Figure 26A, 26B).

Particle size and distribution

Particle size and distribution are important in nanoparticle synthesis. Monodisperse nanoparticle size and distribution is desirable in the field of nanotechnology because the nanoparticles will form a much stronger nanomaterial as a result of the equal interfacial distance between the similar sized nanoparticles. The nanomaterials would then not be temperature sensitive in thermal applications and the nanomaterial is able to undergo localized de-bonding to release the stress when the matrix is under pressure in an application (Kausch & Michler, 2007; Xue ef a/., 2005).

The NanoTrac system

The NanoTrac system is based on the principle of size exclusion chromatography however in this case with the smallest particles eluted first. The NanoTrac particle size analysis was to confirm the size distribution of the platinum nanoparticles in both Geobacillus sp. A8 and Thermus scotoductus SA-01 after the exposure of 2 mM H₂PtCI₆ for 16 hours. The particle size distribution comparisons are shown in Figure 27. The distribution range can be observed as the green curve. A multimodal size and distribution was observed for Geobacillus sp. A8 and a distinctly bimodal distribution for Thermus scotoductus SA01. A mixture of small to large particles was observed for Geobacillus sp. A8 ranging from 290 nm to 1.984 pm. Two populations with apparent Gaussian size distribution were observed in Thermus scotoductus SA-01 which ranged from 85 nm to 3 pm. Compared to the SEM analysis, the particle size for the NanoTrac system indicates much larger particles, however this could be due to agglomeration of particles. In addition, an exhaustive measure of the size distribution over a large area of the electron micrographs was not done. The smallest fraction containing particle size and distribution was 10%. This means that 10% of the nanoparticles for Geobacillus sp. A8 was in the range of <290 nm and for Thermus scotoductus SA-01 in the range of <84.6 nm. These results were compared to the NiComp ZLS particle size distribution analyzer.

The NiComp 380 ZLS particle size analysis

The NiComp 380 ZLS particle size and distribution (PSD) analyzer is based on the principle of dynamic light scattering also known as photon correlation spectroscopy and is commonly used for sizing submicron particles. In solution, particles undergo Brownian motion and scatter light with time-dependent fluctuations in scattering intensity (Clark ef a/., 1970). By looking at the changes in the amplitude of scattered light and determining the coefficient of diffusion, the particle radius can be calculated using the Stokes-Einstein equation (Edward, 1970). As particle size decreases, the fluctuations in time will become more rapid. NiComp 380 ZLS instruments have the unique ability to calculate particle size using both a Gaussian and a deconvolution algorithm which allows for unimodal, skewed unimodal, and bimodal size distribution analysis with high resolution (Goldburg, 1999).

Platinum nanoparticles from Geobacillus sp. A5, Geobacillus sp. A8 and Thermus scotoductus SA-01 were analyzed for particle size using the NiComp 380 ZLS (PSD) analyzer at Particle Sizing Systems, U.S.A. Most of the samples demonstrated some poly-dispersity with scattering from larger particles, especially in the volume weighted particle size distributions (PSDs) (Figure 28). Larger particles scatter light more intensely than smaller particles and a few large particles can dominate these distributions. When the number weighted distribution is considered, the peaks representing the larger particles are greatly diminished or not present at all. This is usually an indication of agglomeration. Both Geobacillus sp, A5 and Geobacillus sp. A8 samples showed a multimodal volume weighted PSD with particle diameters at -20 nm, -125 nm, and -480 nm (represented in Figure 28A). These samples contain mostly 20 nm particles with some agglomerates present. The number weighted distribution shows only one peak at -20 nm (Figure 28C). Sample Geobacillus sp. A8, like the sample Geobacillus sp. A5 displayed volume weighted peaks at -20 nm, -133 nm, and -480 nm. The sample from Thermus scotoductus SA-Q1 also displayed a multimodal distribution with volume weighted mean diameters of ~6 nm, -66 nm, and -650 nm (Figures 28B), This sample is dominated by the 6 nm particles with some larger particles present as shown in the number weighted distribution of the nanoparticles again providing evidence for agglomeration (Figure 28D).

As compared to the NanoTrac system, the preparation for the analysis of the NiComp ZLS PSD was performed differently before application to the machine. The samples were diluted and sonicated to decrease the clumping of the nanoparticles. The NiComp ZLS therefore provided more accurate and reliable data because agglomeration was taken into account after the volume weighted PSD was completed. The number of weighted platinum nanoparticles obtained indicated smaller nanoparticles in a close size range which differed from the observation indicated previously herein above therefore suggesting an even distribution of nanoparticles. The low level of poly-dispersity observed in Figures 28C and 28D indicates that the nanoparticles are close to monodisperse (Xue ef a/., 2005). With further optimization of the parameters in the platinum assay, production of monodisperse platinum nanoparticles could be possible. The nanotechnology industry is always in search of nanoparticles with high monodisperity, durability and chemical stability that can be utilized in the commercial production of nanomatenals. the properties of which are determined by the particle size and distribution (Mandal er a/., 2006; Siegel er a/., 1999).

As observed herein before, the platinum nanoparticles are spherical in shape. In relation to the PSD. it was determined that the platinum nanoparticles are smaller than the observed size from the TEM analysis in Figure 20 and SEM analysis in Figure 24. Since the nanoparticles size is shown to be much smaller in Figures 28C and 28D, data can be correlated to the hypothesis by ausch and Michler (2007), that the nanoparticles form spherical agglomerates (Figure 29). Hydroqenase tests

Based on hydrogen being the electron donor in the platinum reduction assay, the putative protein/s involved in the reduction of platinum were probably related to a hydrogenase,. Rashamuse ef a/., (2008) proposed a two cycle reduction of H₂PtCI₆ solution by a sulfate reducing bacterial consortium. The proposed hypothesis suggests the presence of a ferricytochrome c₃ that will activate the oxidation of H₂ by a hydrogenase.

A NAD-dependent hydrogenase has been confirmed in the Thermus scotoductus SA-01 genome database; however a cytochrome c₃ was not found (Gounder, 2009). The hydrogenase hypothesis was further supported by Govender et a/., (2010) with the hypothesis of a dimeric hydrogenase from a fungus, Fusarium oxysporum that was involved in the production of platinum nanoparticles with a two cycle reduction of PtCI₆ ^2" ions (Figure 30). In order to confirm the presence or absence of a classical hydrogenase as described by the hypothesis of a two cycle reduction of platinum, hydrogen oxidation, hydrogenase inhibition and active hydrogenase tests were performed followed by whole genome sequencing for novel isolate Geohacillus sp. A8.

Hydrogen oxidizing bacteria can be characterized based on the ability to utilize hydrogen as a main source of energy (Krumholz, 2000). In this study growth of the cells, as the indication of hydrogen respiration by the cells, was performed as described herein before. Both Geobacillus sp. A8 and Thermus scotoductus SA-01 were able to grow aerobically in the chemolithotrophic media (Figure 31 A). Thermus scotoductus SA-01 was able to respire anaerobically in the presence of hydrogen as the electron donor and with either Fe (III) (Figure 31 B) or nitrate as the electron acceptor indicating the presence of a hydrogenase. Geobacillus sp. A8 could not respire in the presence of hydrogen even after a week of incubation (Figure 31 C). Negative controls had confirmed the results.

In order to determine if a classical hydrogenase was involved in the reduction of platinum, hydrogenase inhibition tests were performed as described herein before. Three inhibitors were selected to block the hydrogenase pathway, carbon monoxide, cyanide and rotenone. Control reactions contained no cells. Carbon monoxide and cyanide bind irreversibly to the catalytic site of a classical hydrogenase (Tibelius & Knowles, 1984; Korbas ef a/., 2006). Rotenone inhibits the complex I pathway during respiration in prokaryotes (Fang et ai, 2001 ). Carbon monoxide and rotenone did not inhibit the platinum reduction assay (Table 14), as confirmed visually by a black precipitate. Cyanide was expected to inhibit the platinum reduction because cyanide complexes with heavy metals such as platinum to form hexacyanoplatinate (IV) (Brandl & Faramarzi, 2006). According to literature (Bongers, 1967) 0.3 mM cyanide and 0.5 mM rotenone should be enough to inhibit hydrogenase activity. These results confirm the absence of a classical hydrogenase, perhaps opening a discussion for an alternative protein involved in the reduction of platinum.

Table 14: Inhibition of the hydrogenase pathway to confirm the absence of a classical hydrogenase in the Geobacillus sp, A8 genome

Inhibitor Final Concentration Reaction with cells Control reaction

Carbon Monoxide Cells flushed with 100 % [v/v] Positive black negative

CO and left to stand for an hour precipitate

Rotenone 0.5mM , 1 mM, 2mM Positive black negative

precipitate

Cyanide 0.5mM , 1 mM, 2mM No platinum reduction negative

because of ability to

complex with heavy

metals

The TTC test was performed as described herein before to test for the presence of an active hydrogenase in Thermus scotoductus SA-01 and Geobacillus sp. A8. Bacterial organisms containing a hydrogenase can be identified by the irreversible reduction of a colourless TTC water soluble salt to a water insoluble triphenylformazine that is clearly identified by a red coloured dye in the presence of a hydrogenase, as observed in Figure 32 (Kluber, 1995; Schlegel & Meyer, 1985). Geobacillus sp. A8 colonies indicated the absence of a classical hydrogenase (Figure 32A). A hydrogenase was demonstrated in Thermus scotoductus SA-01 (Gounder, 2009) and by this assay (Figure 32B). This possibly indicates platinum reduction is not via a classical hydrogenase pathway in Geobacillus sp. A8. DNA isolation and genome analysis

Pyrosequencing is a technique used in place of Sanger sequencing to perform whole genome sequencing. This can produce high throughput short reads from 100 to 500 bp reads (Cardenas & Tiedie, 2008). The GS FLX titanium series is an upgrade of the GS FLX with an average read length of 400 to 500 bp reads (Lister ef a/., 2009).

GeobaciHus sp. A8 was selected for pyrosequencing based on the novelty associated with the genome at the 3% distance (species level) and the putative novel hydrogenase activity. The 16S rRNA gene had shown a 94% identity to GeobaciHus thermoparaffinivorans. The whole genome data has provided not only basic data about the metabolism of the microorganism but that the genome data consists of novel genes that can be applied in biotechnology applications.

In order to sequence the whole genome of GeobaciHus sp. A8, genomic DNA was extracted from the microorganism. DNA extraction was performed as described herein before. High quality (A260/A230 = 1 .84) intact genomic DNA was isolated as shown in Figure 33. The verification of the strain identity was performed by sequencing random clones of the 16S rRNA gene. A total of 18 g of genomic DNA was used for GS FLX 454 pyrosequencing.

A total of 229 887 reads were assembled using Newbler to produce 140 and a draft genome size of 3.3 Mb which correlates to the genome size of GeobaciHus kaustophilus of 3.5 Mb (Takami et al., 2004). Assembly using mapping against known GeobaciHus genome sequences was unsuccessful with only a part of the reads being used (Table 15). The best mapping assembly was with GeobaciHus kaustophilus but the de novo assembly still proved superior. This is an indication of either a lack of synteny between the genomes or that the genomes differ significantly with respect to their gene content. The closest reference genome had a fully mapped read of 60.8% to genome Geobacillus kaustophilus. A closely related reference genome is always desired because the new genome can easily be compared to and can assist in the closure of gaps and the completion of a draft genome.

Table 15: Summary of the results for the runMapping assembly using various reference genomes

Consensus G11 MC16 HTA426 WCH70 Y4.1 C1 Y412MC52 Y412MC61 Geobacillus Geobacillus Contigs kaustophilus thermodenitrificans

Num 108509 184769 41906 39475 179195 178794 195063 107709

Mapped 46.91% 79.87% 18.12% 17.06% 77.46% 77.29% 84.32% 46.56%

Reads*

Num 17871564 54192546 7136350 4978759 51202003 51229539 66187554 17849277

Mapped 21.98% 66.64% 8.78% 6.12% 62.96% 63% 81.39% 21.95%

Bases

Inferred 1375055 1541071 267732 303953 1998873 1997699 1966227 1359109

Read Error 10.05% 2.99% 7.76% 9.75% 4.04% 4.04% 3.13% 10.15%

Num Of 924 76036 2043 248 63876 64000 140654 582 fully 0.40% 32.87% 0.88% 0.11 % 27.61 % 27.67% 60.80% 0.25%

Mapped*

Num of 97413 101237 3031 1 34893 110424 109720 44929 96318

Partially 42.1 1 % 43.76% 13.10% 15.08% 47.74% 47.43% 19.42% 41.64%

Mapped

Num 121147 44887 187750 190181 50461 50862 34593 121947

Unmapped 53.37% 19.4% 81.16% 82.21 % 21.81 % 21.99% 14.95% 52.72%

Num of 239 2072 48 13 2021 2010 398 228

Contigs

Num of 179478 2224085 46677 13174 2137808 2133041 29279913 165756

Bases

'The number of mapped reads and fully mapped reads are highlighted to indicate the percentage alignment of each genome assessed

After the contigs were edited and joined using the GAP 4 software, the contigs were combined into a pseudo genome. The automatic annotation was done at the University of Maryland as described herein before followed by the construction of the PGDB to target metabolic capabilities of the genome using PathwayTools (Karp ef a/., 2002). The data obtained from the University of Maryland annotation engine was viewed on the program Manatee. The total number of open reading frames (ORFs) obtained was 3380 and these were distributed into each role category (Table 16) (Figure 34). From the annotation data, 25.24% of hypothetical and 0.36% of unknown proteins were observed. These novel proteins could lead to the possible discovery of novel pathways; however, the search for a hydrogenase within the genome data yielded a negative result. Table 16: The summary of the ORFs from annotation data obtained from UM using the GS FLX 454 pyrosequencing data

ORFs Number of ORF distribution Percentage of ORF distribution

Total ORF's 3380 100%

Assigned function 1265 37.4 %

Conserved hypothetical 807 24 %

Unknown function 12 0.4%

Unclassified 443 13.2 %

Hypothetical 853 25.2%

A draft metabolic pathway and a pathway genome database was constructed for the draft genome Geobacillus sp. A8 utilizing the annotation data. No protein annotated as a classical hydrogenase or a possible hydrogenase was found in the pathway genome database. This indicated that the genome of Geobacillus sp. A8 probably does not have a hydrogenase present and therefore another protein or novel hydrogenase had to be responsible for the reduction of platinum. Compared to other Geobacillus genomes submitted to GenBank, only one genome Geobacillus sp. Y4.1 MCI (accession number CP002293) isolated from a hot spring in Yellow wood park, U.S. A has so far been demonstrated to have a nickel dependent hydrogenase present in the genome (Lucas et ai, 2010). The other possibility could be that there could be a novel hydrogenase present in the other Geobacillus genomes but that they have not yet been annotated. This was further clarified by querying the Geobacillus sp. Y4.1 MCI hydrogenase against the Geobacillus sp. A8 large contigs (blastp) and raw read data (tblastn). No homologues were found. Therefore the protein responsible for platinum reduction could not be a classical hydrogenase and probably does not follow the mechanism proposed by Rashamuse ef a/., 2008. The possibility of a moonlighting or multitasking protein was considered (Jeffery, 2004). Chromate (VI) a toxic heavy metal that is highly soluble was reduced to chromate (IV) a non toxic form by a novel chromate reductase that is also involved in oxidative stress response and is homologous to a FAD dependent old yellow enzyme (Opperman & van Heerden. 2007). Uranium and gold was found to be reduced by the ABC transporter protein (Cason, 2010; van Marwijk, 2010). This protein has a main function that is the translocation of substrates across the membrane of the cell. In order to determine the enzyme responsible for platinum reduction the subcellular fractionation of proteins and platinum reduction assay of the fractions was performed.

Protein work

Subcellular fractionation

The spheroplasts, periplasm, cytoplasm and membrane fractions were separated and analyzed for possible biogenic platinum reduction after exposure to 2 mM H₂PtCI₆ solution using the developed platinum reduction assay as described herein before, except the 3% [w/v] cells were replaced with subcellular protein fractions. No reduction was observed by the spheroplasts and membrane fractions. Most of the biogenic platinum reduction was observed with the periplasmic fraction, however some platinum reduction was observed in the cytoplasmic fraction (Figure 35). This is, unfortunately not clear due to the poor quality of the picture. The subcellular fractions were resolved by SDS-PAGE analysis as described herein before (Figure 36). Comparing the results of the thin section analysis using TEM, both data analysis confirm the localization of platinum nanoparticles in the periplasmic space. There was minimum reduction in the cytoplasm that could be due to fraction processes or protein processes in both fractions. The purification of proteins from the periplasmic fraction

The periplasmic fraction observed on SDS-PAGE (Figure 37) had displayed the bioreduction of platinum and was supported by the SEM and TEM.

Anion exchange chromatography for the separation of the proteins of the periplasmic fraction was performed using a DEAE Toyopearl column as described herein before (Figure 38). Two fractions eluted between 25 min and 45 min corresponding to a wide peak that was assayed for the ability to reduce platinum (IV). The fractions with most activity for platinum reduction were close to the peak between 30 min and 40 min. Activity was not observed in the unbound fraction. The proteins for each fraction were separated by a 10% [w/v] and a 5% [w/v] SDS-PAGE and analyzed for homogeneity (Figure 39). A small protein was observed at approximately 15-20 KDa. As observed on the SDS-PAGE (Figure 39), the fractions containing the 15-20 kDa protein had indicated platinum reduction observed by a black precipitate. The yield of this protein was too low for protein identification.

Protein identification

The proteins in the periplasmic fraction were size separated using the Amicon® concentrator and then further analyzed for platinum reduction. The fractions that had shown activity in the bioreduction of platinum after SDS- PAGE were excised from the gel, treated with trypsin and identified using protein mass spectrometry as described herein before.

Size fractionation of the periplasmic fraction was performed as described herein before using two membranes, a 30 kDa NMWCO membrane and a 10 kDa NMWCO membrane. The 30 kDa retentate fraction between 10 and 30 kDa and less than 10 kDa was analysed on SDS-PAGE (Figure 40). The 0-30 kDa fraction displayed positive platinum reduction. This fraction was separated on a 10% [w/v] SDS-PAGE where four distinct bands of 37 kDa, 20-25 kDa and 15 kDa were observed. The presence of the weak 37 kDa protein band illustrates that the 30 kDa membrane, which is made up of a netted structure of cellulose, does not have a distinct curoff and larger proteins can be forced through the membrane at the 100 kPa working pressure during filtration. The larger three bands were prepared for protein identification by protein mass spectrometry, by digestion with trypsin. The higher yield of the <15 kDa band was probably the lysozyme used in the subcellular fractionation process.

Protein mass spectrometry is commonly used in the identification of proteins by peptide mass fingerprinting after tryptic digestion. The peptides were analyzed using the mass spectrometer and the peptide sequence was aligned against the Swiss Prot public database for homology. The results obtained from the mass spectrometry analysis (Table 17) were viewed on the program Mascot. Two proteins were selected for further exploration and assay for platinum reduction. The proteins were identified as a 37 kDa NADPH dehydrogenase (xenobiotic reductase) and an 18 kDa hypothetical UPF0234 protein GK7042 also known as the YajQ protein identified in Bacillus and Geobacillus species, respectively. The presence of the proteins in the genome Geobacillus sp. A8 and the sizes of the proteins were confirmed by aligning the peptides against the ORF database using the internal BLAST server and the ORF editing tool Artemis. The BLAST server identified ORF NT02GS0869 oxidoreductase, FAD/FMN-binding protein as 37.7 kDa with 340 amino acids and ORF NT02GS3768 which was annotated as a conserved hypothetical protein of 18.19 kDa and a composition of 163 amino acids (Figures 41 and 42). The xenobiotic reductase is homologous to the old yellow enzyme (OYE), a flavin dependent protein involved in oxidation reduction reactions. The YajQ protein has not been investigated as extensively as the OYE. Compared to the size of the protein observed from the anion exchange chromatography (Figure 38), a good correlation to the protein that had revealed that a protein of approximately 15-20 kDa was responsible for the bio-reduction of platinum, the small hypothetical protein was also selected for expression and purification for the platinum reduction assay. Table 17: Summary of the results from the protein mass spectrometry analysis and identification of proteins using the SwissProt public database

Band # Trypsin peptide Identity (SwissProt)

NADPH dehydrogenase

Band 1 : 37 kDa R.TDAYGGSLENR.Y (Xenobiotic reductase) - Bacillus halodurans

30S ribosomal protein

Band 2: 25 kDa R.WLGGMLTNFK.T

Pseudomonas syringae

10 kDa chaperonin (Protein

Band 3: 18 kDa K.VVFGPYSGSNTVK.V Cpn10) (groES protein)

Pseudomonas putida

30S ribosomal protein

.ALDAIAPLVEVK.S

Pseudomonas syringae

Peptidoglycan-associated

R.VVLEGNTDER.G lipoprotein precursor

Pseudomonas putida

Conclusions

The optimization of the platinum reduction assay with hydrogen as the electron donor was successful in the reduction of platinum (IV) to elemental platinum. The formation of biogenic nanoparticles by isolates cultured from the Northam platinum mine and the deep gold mine near Carletonville in South Africa (Thermus scotoductus SA-01 ) could also be demonstrated. Platinum reduction was observed by a colour change with elemental platinum observed as a black precipitate in solution. Wavelength scans confirmed the reduction of platinum which was visualized with the gradual shifting of the peaks for each oxidation state over time. The platinum reduction of the chloroplatinic ions was analyzed using electron microscopy. TEM images revealed the bio-reduction and deposition of platinum nanoparticles across the cell wall of the isolates. Thin sections of Geobacillus sp. A8 had shown whole cell reduction and the formation of platinum nanoparticles localized in the periplasmic space of the cell, which supported the hypothesis by Konishi and co-workers (2008), that the enzyme responsible for biogenic nanoparticles formation was located in the periplasm. This was further confirmed by the SEM Auger nanoprobe that had revealed the disruption of the cell wall that could be due to the overflow of nanoparticles from the periplasmic space. The characterization of the nanoparticles was performed using the SEM Auger nanoprobe, electron dispersive spectrometry, X-ray diffraction analysis and particle size and distribution analysis. All analyses confirmed platinum reduction and the formation of platinum particles.

Geobacillus sp. A8 had already shown a difference in the reduction of platinum indicative of a different metabolic interaction with platinum. The crystallite sizes determined by XRD for the nanoparticles produced by both Geobacillus sp. A8 and Thermus scotoductus SA-01 was determined and confirmed to be in the nanometre range. Platinum nanoparticles play a significant role in the production of electrochemical sensors and biosensors due to their special optical and catalytic properties. These biological platinum nanoparticles will provide new applications in nanotechnology that are cost effective and reproducible (Luo et a/., 2006).

In the field of nanotechnology, nanoparticles have a wide range of applications due to their unique chemical, physical, optical, electronic and catalytic properties. The chemical synthesis of metal nanoparticles that are in this range and are monodisperse is a long and tedious effort as described herein before. Metal reduction by microorganisms is a much more environmentally friendly process and involves low energy consumption, high nanoparticle yield, monodispersity and high economic benefits as compared to chemical synthesis (Krumov ef a/., 2009; Mandal ef a/., 2006).

Geobacillus sp. A8 was selected for investigation of the enzymes responsible for the reduction of platinum - this isolate was novel at the species level. A metabolic pathway was constructed for this genome from high throughput 454 pyrosequencing data. The metabolic pathway provided useful data on the metabolism of the microorganism and also information for thermostable novel genes and proteins that can be useful in molecular biology and biotechnology applications. The hydrogenase metabolism in Thermus scotoductus SA-01 and Geobacillus sp. A8 was compared using a hydrogen oxidation test that revealed differences to the classical hydrogen metabolism. This was confirmed by the hydrogenase inhibition and hydrogenase activity tests. Therefore, genome analysis was done on Geobacillus sp. A8 and the metabolic pathways coded by the genome Geobacillus sp. A8 were elucidated. The mechanism as proposed by Rashamuse and co-workers (2008), is also not applicable for the Thermus scotoductus SA-01 with the absence of the cytochrome c₃ (Gounder, 2009). The automatic annotation data for Geobacillus sp. A8 provided the percentage gene distribution of the ORFs and had revealed 3380 total ORFs with a high percentage of unknown and hypothetical proteins present in the genome.

Subcellular fractionation of the Geobacillus sp. A8 cells had revealed that the periplasmic fraction contained most of the activity, confirming the localization of the platinum nanoparticles as observed by SEM. The periplasmic protein fractions was purified using anion exchange chromatography and a small protein of 15-20 kDa, identified by SDS-PAGE had shown platinum reduction activity. Further separation of the proteins based on molecular weight using the Amicon® concentrator and identification by protein mass spectrometry had revealed that two potential proteins, a 37 kDa oxidoreductase and an 18 kDa hypothetical protein could be involved in the reduction of platinum. These proteins were selected for protein expression and purification for platinum reduction and the formation of platinum nanoparticles in the next Example. These results indicate that the Geobacillus sp. A8 did not reduce the Pt (IV) by the mechanism proposed by Rashamuse and co-workers (2008), and that a novel mechanism was probably involved. The two likely candidates for platinum reduction were an oxidoreductase, which had previously been shown to display chromate reductases activity and a hypothetical protein. This again illustrates the importance of correlating physiological and biochemical data to specific proteins if their real function is to be elucidated.

Example 3: Expression of proteins involved in the reduction of platinum

3.1 Bacterial isolates, vectors and experimental flowchart

Table 18: Bacterial strains used in molecular characterization

Bacterial strain Properties

Escherichia coli Top 10 (Invitrogen, U.S.A) Competent E.coli strain used for expression

experiments with the pET 22b (+) and pET 28b (+)

(Novagen, Germany) and pSMART vector

(Lucigen, U.S.A).

Escherichia coli BL21 (DE3) (Lucigen, U.S.A) Competent E.coli strain containing the pRARE 2

vector (Novagen, Germany) used for expression experiments with the pET 22b (+) and pET 28b (+).

Geobacillus sp. A8 Isolated from Northam platinum mine. A draft

genome was done on this isolate as described in

Example 2. This isolate was used for genomic DNA

isolation and isolation of the OYE and YajQ genes.

Table 19: Plasmids used in molecular characterization with some of their functions and properties

Plasmid Properties pSMART vector (Low copy) Linear vector used tor blunt end cloning of the OYE and YajQ genes

and contains a kanamycin resistance marker

The vector requires phosphorylation of the 5'-ends before ligation.

The vector was designed for cloning sequences that are unstable or

difficult to clone with high efficiency and high yield of recombinants

(10⁵) from approximately 50 ng of DNA.

The vector also contains transcription terminators to prevent translation of the vector (Godiska et al. , 2010).

pRARE2 vector Vector contains 7 tRNA sequences for rare codons in E.coli and contains a

chloramphenicol resistance marker (Novy er al., 2001 ).

pET 22b (+) expression vector Ampicillin (100 pg/L) resistant expression vector used for the expression of

the OYE and YajQ proteins and transformed into the E.coli BL21 (DE3) cells containing the pRARE2 vector.

A C-terminal His Tag sequence can be used for the fusion of target proteins and a N-terminal pelB signal sequence that facilitates the export of the unfused protein of interest to the periplasmic space.

Cloning into the Ndel site will allow for the expression of unfused protein

(Novagen, 2002-2003).

pET 28b (+) expression vector Kanamycin (30 pg/L) resistant expression vector used for the expression of the

OYE and YajQ proteins and transformed into the E.coli BL21 (DE3) cells containing the pRARE2 vector.

Cleavable N terminal His Tag sequence that allows for the fusion of the target protein and can be done by cloning into the Ndel site (Novagen, 2002-2003). E.coli cells (Table 18) containing the vectors were grown in Luria-Bertoni broth (Sambrook et a/., 1989) at 37 C in a shaking incubator at 200 rpm. The selective markers used were based on antibiotic resistance specific to the vector. Kanamycin [30 ug/L], ampicillin [100 pg/L] and chloramphenicol [34 pg/L] were used for selection (Table 19).

The products for each experimental procedure were renamed as per flowchart in Figure 43.

3.2 Genomic DNA isolation

GeobaciHus sp. A8 was grown as previously described herein before at 55°C overnight. Genomic DNA was extracted from GeobaciHus sp. A8 using the method described by Labuschagne and Albertyn, (2007).

3.3 Primer design and PGR optimization

A temperature gradient polymerase chain reaction (PCR) was done to obtain optimal annealing temperature. The gene of interest was purified using the Bioflux gel extraction kit as per the manufacturer's instructions. The optimization of the PCR protocol was done by performing a gradient PCR using the Mastercycler Gradient thermocycler (Eppendorf, Germany). The selected annealing temperatures ranged from 51 "C to 58' C. The screening for the complete ORF of the NADH/NADPH dependent oxidoreductase (OYE) was carried out using the degenerate primers previously designed by Dr. D.J. Opperman and Miss. S. Litthauer, (2009). They had designed the primers for GeobaciHus kaustophilus, namely, GKau _F del and GKau _R Xhol that included a Nde I and a Xhol site for cloning into the pET vectors (Table 20). The PCR reaction was performed in a final volume of 50 μΙ. The PCR reaction mixture contained template DNA (± 25 ng), 5 μΙ of 10 x Super-Therm reaction buffer. 2 mM MgCI₂, 0.01 mg bovine serum albumin, 0.2 μΜ of both the forward (GKau_F_Ndel) and reverse (GKau _R_Xhol) primers, 0.2 mM deoxynucleoside triphosphates (DNTPs) and 0.02 U Super-Therm polymerase (New England Biolabs, U.S. A). The PCR gradient amplification reaction protocol was performed by initial denaturation of the reaction mixture at 94°C for 2 min. This was followed by 35 cycles of denaturation at 94°C for 30 sec, primer annealing at 51 C to 58°C for 30 sec and extension of the primers at 72°C for 2 min, 30 sec. A final extension cycle was at 72^'C for 10 min. All PGR reactions were visualized using agarose gel electrophoresis. The gel consisted of 1 % [w/v] agarose in TAE buffer [0.04 M Tris-HCL, 1 mM EDTA pH 8.0 and 0.02 mM glacial acetic acid] and 0.5 pg/ml Goldview DNA staining reagent. The gel was visualized using a Gel Doc XR (BIO-RAD) after electrophoresis at 90 volts for 60 min. The product yielded was named OYE_amplicon from Figure 43.

Table 20: Oligonucleotide primers designed for the amplification of the genes of interest

Primer name Sequence Tm (°C)

GKau F Ndel 5'CCATATGAACACGATGCTGTTTTCGC3^' 58.7

GKau R Xhol 5'CTCGAGTTAAAACCGCCAGCCGC3' 62.8

Hyp_F_Ndel 5'CCATATGTCGAAAGAAAGTTCGTTTG'3 54.7

Hyp R EcoRI 5'GAATTCTTATCGATAATTCACAAACTGC'3 53.2

Bold font indicate the restriction sites

Primers were designed for the complete ORF YajQ hypothetical gene using the draft genome data of Geobacillus sp. A8. The database of the ORFs was viewed using the Artemis software (Rutherford et a/., 2000). These primers also included the restriction sites Ndel and EcoRI for cloning into the pET vector systems. The optimization of the PCR protocol was also performed by gradient PGR. The selected annealing temperatures ranged from 45' C to 53 C. The PCR protocol and PCR reactions were followed similarly to the amplification of the OYE gene with modifications made to the PCR reaction with the forward (Hyp_F_Ndel) and reverse ( Hyp_F_EcoRI) primers and the different primer annealing temperatures. The product yielded was named the YajQ_amplicon (Figure 43).

3.4 PCR of genes of interest

Two complete ORF's were amplified for expression studies. The reaction mixture contained the same reagents and final concentrations as described above except for the substitution of 2.5U Phusion hot start II DNA polymerase (Finnzymes, Thermo Scientific, U.S.A) and 10 μΙ of the 5 x Phusion reaction buffer containing 2.75 mM MgCI₂ instead of the Super-Therm polymerase and reaction buffer. The PGR amplification reaction protocol was performed by initial denaturation of the reaction mixture that was incubated at 98 'C for 30 sec. This was followed by 35 cycles of denaturation at 98'C for 10 sec, primer annealing at 56°C for 30 sec and extension of the primers at 72 C for 30 sec. A final extension cycle was at 72 C for 10 min. Agarose gel electrophoresis was performed as described herein above. The band observed with the correct molecular weight corresponding to the gene of interest was excised from the gel and purified using the BioFlux DNA/RNA gel extraction kit and followed as per manufacturer's instructions (Separations Scientific, R.S.A) processed as earlier described. The products yielded were named OYE_amplicon_P/u/s/on and YajQ_amplicon_Prtus/on (Figure 43).

3.5 Phosphorylation

The OYE_amplicon_Pftus/on and YajQ_amplicon_P/7i/s/on were phosphorylated at the 5'-ends for blunt end cloning into the low copy kanamycin resistant pSMART vector (Figure 44). These were renamed to OYE_amplicon_ pSMART and YajQ_amplicon pSMART. The purified DNA was concentrated in a Speedy Vac (Eppendorf, Germany) at 60°C for 5 min. This was followed by the re-suspension of the purified DNA into 15 μΙ of sterile 2 x distilled water. The phosphorylation reaction mixture consisted of 2 μΙ of 10 x T₄ reaction buffer A (Fermentas, U.S. A), 1 mM ATP and 10 U polynucleotide kinase (PNK) (Fermentas, U.S. A). The reaction was performed in a final volume of 20 μΙ with the addition of the purified DNA.

3.6 Cloning into pSMART vector and transformation

As described in Table 19, the pSMART vector was used for transformation of the OYE jamplicon Phusion and YajQ_amplicon_Pftus/on. The 5'-phosphorylated DNA was ligated and transformed into the kanamycin resistant (30 pg/L) pSMART vector. Ligation was performed in a final reaction volume of 10 μΙ (50 ng pSMART vector), 5% [v/v] polyethylene glycol (PEG), 1 μΙ ligase reaction buffer, 5 Weiss units T4 ligase and 50 ng purified DNA. The ligation reaction was incubated at room temperature for 1 hour followed by an overnight incubation at 4°C. Transformation was followed as described herein before into competent E.coli Top 10 cells (Table 18), plated onto LB plates containing the antibiotic kanamycin and incubated overnight at 37°C. The products yielded were named OYE amplicon pSMART and YajQ_amplicon_pS ART (Figure 43). Five to ten clones were randomly selected for plasmid DNA extraction using the BioFlux plasmid DNA kit following the manufacturer's instructions. The test to confirm a positive insert was carried out by performing a restriction digest. The plasmid DNA was double digested by the selected restriction enzymes Ndel and Xhol for the OYE gene and Ndel and EcoRI for the YajQ gene as shown in Table 20. The restriction digest reaction for the OYE contained 0.5U Ndel, 1 U Xhol, 1 μΙ of 10 x buffer O, 50 ng plasmid DNA and sterile distilled water to make up to a final volume of 20 pi and incubated at 37°C for 3 hours. The restriction digest reaction for the OYE gene contained 0.5U Ndel, 1 U Xhol, 1 μΙ of 10 x buffer O, 50 ng plasmid DNA and sterile distilled water to make up to a final volume of 20 pi and incubated at 37°C for 3 hours. The product yielded was named OYE_amplicon_pSMARTJVcte/_X/?o7 from Figure 43. The restriction digest reaction for the YajQ gene contained 1 U Ndel, 1 U Xhol, 1 μΙ of 10 x buffer O, 50 ng plasmid DNA and sterile distilled water to make up to a final volume of 20 μΙ and also incubated at 37°C for 3 hours. The reactions were observed on a 1 % [w/v] agarose gel after electrophoresis as described herein above. The clones with a positive insert were then fully digested at 37°C overnight in a final volume of 50 μΙ. This was again visualized after agarose gel electrophoresis and the positive insert was excised from the gel and purified. The product yielded was named YajQ_amplicon j S ART JVcte/ Ecof?/ from Figure 43.

3.7 Cloning and transformation into expression vectors

Cloning and propagation of the genes of interest were performed using the expression vectors pET 22b (+) (Figure 45) and pET 28b (+) (Table 19; Figures 45 and 46). A complete double digestion of 22.2 ng pET 22b (+) and 24.3 ng pET 28b (+) was carried out in a final volume of 50 μΙ for cloning of the inserts. The expression vectors were visualized and purified after agarose gel electrophoresis. The purified inserts were ligated into the cut expression vectors and transformed into £ coli Top 10 cells whereby transformation was plated on LB plates containing ampicillin or kanamycin as the selective markers for expression vectors pET 22b(+) and pET 28b(+), respectively. Five random clones were selected and digested with appropriate enzymes as described herein above to confirm a positive insert which was then prepared for sequencing. The constructs yielded were named as described in Figure 43. 3.8 Sequencing

The OYE_amplicon_pET22b, OYE _amplicon _pET28b, YajQ_amplicon _pET22b and YajQ _amplicon _pET28b clones containing a positive insert were sequenced to confirm the identity of the genes before protein expression. Sequencing was performed as described herein before except that the premix for the sequencing preparation reaction contained the primers listed in Table 20. The confirmation of the full ORF was carried out by the alignment of the OYE and YajQ genes using the DNAssist editing and analysis tool for molecular biology sequences (Patterton & Graves, 2000).

3.9 Protein expression

The OYE amplicon _pET22b, OYE amplicon pET28b. YajQ_amplicon_pET22b and YajQ_amplicon_pET28b constructs were transformed into competent E.coli BL21 (DE3) cells containing the pRARE2 vector for expression studies. The pRARE2 vector transformed into competent E.coli BL21 (DE3) cells that were supplied by the Molecular lab, Department of Biochemistry, University of the Free State. Competent E.coli BL21 (DE3) cells containing pRARE2 vector were prepared. The final volume of the ligation reaction was 10 μΙ and the reaction mixture consisted of the reagents and final concentrations as described in Item 3.6 except for the ratio of vector to insert determined by the equation [(50 ng final concentration x size of product)] / [(5.3 Kb) vector size]. The ligation reactions were transformed into competent E.coli BL21 (DE3) cells as described in Item 3.7 except plated on LB plates containing ampiciliin and chloramphenicol or kanamycin and chloramphenicol as the selective markers for expression vectors pET 22b(+) and pET 28b(+), respectively (Table 19; Figure 43). The negative controls consisted of uncut expression vectors that were also transformed into competent E.coli BL21 (DE3) cells. 3.10 vPurification of the recombinant OYE and YajQ protein

Ail the OYE_amplicon_pET22b_BL21 , OYE_^amplicon_pET28b_^BL21 , YajQ_amplicon_ pET22b_BL21 and YajQ_amplicon_pET28b_BL21 transformation colonies were washed from the plates and inoculated into 50 ml of LB media containing antibiotics and grown in a shaking incubator (200 rpm) at 37°C to obtain an OD of 0.8 to 1 at a wavelength of 600 nm. This was followed by a 1 % inoculation into autoinduction media and grown at 37°C overnight. Autoinduction media (Blommel ef a/., 2007) was used for the expression of the proteins of interest and prepared in a litre of distilled water. Autoinduction media consisted of ZY media [10 g tryptone; 5g yeast], 50 ml of NPS media [0.5 M (NH₄)₂S0₄; 1 M KH₂P0₄;1 M Na₂HP0₄], 20 ml of 5052 media [250 g glycerol; 25 g glucose; 100 g a-lactose] and 0.002 M MgS0₄. Cells were harvested by centrifugation [5000 x g; 10 min; 4°C] and washed with 50 mM Tris-CI, pH 7.5 buffer.

The recombinant OYE and YajQ proteins were purified through immobilized metal affinity chromatography (IMAC). The harvested cells containing the pET 28b (+) vector was resuspended in binding buffer [20 mM Tris- CI buffer, pH 7.4; 20 mM imidazole; 0.5 M NaCI]. Cells were broken using the Constant cell disruption system (Constant Systems, U.K) at 30000 psi. Cell debris was removed by centrifugation [5000 x g; 10 min; 4 C], The soluble fraction (cytoplasm) was separated from the insoluble fraction (membranes) by ultracentrifugation [100000 x g; 90 min; 4°C]. The soluble fraction was loaded onto a 5 ml His Trap FF column (Amersham Biosciences, U.S.A). The unbound proteins were eluted at 5ml/min with the binding buffer. Bound proteins were eluted with a linear gradient of imidazole with the elution buffer [20 mM Tris-CI pH7.4; 0.5 M NaCI; 0.5 M imidazole]. The fractions that indicated activity were collected and pooled, dialyzed and visualized after SDS- PAGE electrophoresis.

A second purification step used was size exclusion chromatography. The harvested cells containing the pET 22b (+) vector was resuspended in 20 mM Tris-CI, pH 7.4 buffer. Cells were broken using the Constant cell disruption system at 30000 psi. Cell debris was removed by centrifugation [5000 x g; 10 min; 4°C], The soluble fraction (cytoplasm) was separated from the insoluble fraction (membranes) by ultracentrifugation [100000 x g; 90 min; 4°C]. Purification of the OYE and YajQ. proteins were performed by heating the soluble fraction to denature the non-thermostable proteins from E.coli. The soluble fraction was heated at 70' C for 90 min and the separation of the denatured non-thermostable proteins (pellet) from the thermostable protein (supernatant) was removed by centrifugation [12000 x g; 30 min; 4"C]. The supernatant containing the protein of interest was concentrated to 3 ml by ultra filtration using the Amicon^® concentrator with the 30 kDa membrane (Milipore) for the OYE and the 10 kDa membrane (Milipore) for the YajQ protein. The 3 ml concentrated protein samples were loaded onto a Sephacryl S200HR column (2.5 x 6.3 cm, Sigma, Germany) that was equilibrated with 50 mM Tris-CI, pH 7.4 containing 50 mM NaCI. The proteins were eluted with the same buffer at a flow rate of 1 ml/ min.

SDS-PAGE analysis

SDS PAGE was carried out as described herein before. Protein concentration

Protein concentrations were determined as described herein before. Results and discussions Genomic DNA isolation

Genomic DNA isolation from Geobacillus sp. A8 was performed as described in Item 3.2. A high concentration of genomic DNA (4174 ng/μΙ) was isolated as described in Item 3.2. High quality (A₂₆o/A₂₃o = 1 -87) intact genomic DNA (Figure 47) was obtained. PGR of genes of interest

Primers were designed for the amplification of the OYE and YajQ genes with incorporated restriction sites and were optimized as described in Item 3.3. The amplification of the OYE and YajQ genes was carried out as described in Item 3.4. PGR conditions for the optimal primers (Table 20) OYE_amplicon and YajQ_amplicon genes were optimized at the annealing temperature of 56°C and 51 °C, respectively. Amplification of the OYE and YajQ genes were confirmed by a band obtained at approximately 1000 bp for the OYE gene (Figure 48A) and a band obtained at approximately 500 bp for the YajQ gene (Figure 48B).

Cloning and transformation into pSMART vector

The amplified genes were purified as described in Item 3.4 and prepared for ligation into the pSMART vector and transformation into E.coli Top 10 cells as described in Items 3.5 and 3.6. Several clones transformation, (10 clones) were selected for the OYE_amplicon_pSMART and for the YajQ_amplicon_pSMART transformation (6 clones) for plasmid extraction to screen for a positive insert as described in Item 3.6. A double digest of the plasmid DNA was performed as described in Item 3.6 to confirm a positive insert into the pSMART vector.

Four of the random clones OYE_amplicon _pSMART_Wde/_X/?o/ contained the correct OYE gene (Figure 49). The OYE gene was amplified using degenerate primers therefore non specific binding was expected. The restriction enzyme Xhol cuts the backbone of the pSMART vector and yields two fragments (200 bp and 1780 bp). The clone in lane 3 of the agarose gel contained a correct insert size for the OYE gene. This band was excised from the gel for cloning into the pET 22b (+) and pET 28b (+) expression vectors as described in Item 3.6.

Six of the random clones YajQ_amplicon_pSMART plasmid DNA was double digested with Ndel and EcoRI restriction enzymes (Figure 50). All five clones YajQ_ amplicon_pSMART_/Vc/e/_£coR/ contained the correct size insert of approximately 500 bp for the YajQ gene. The insert of the clone in lane 3 of the agarose gel was selected for cloning into the pET 22b (+) and pET 28b (+) expression vectors.

Cloning and transformation into expression vectors

Purified inserts (OYE_amplicon_pSMART_Mfe/_Xfto/ and YajQ__amplicon_pSMARTJVcfe/_ EcoR) were ligated into pET 22b (+) and pET 28b (+) expression vectors prepared as described in Item 3.7, followed by transformation into E.coli Top 10 cells and grown on LB plates containing the selective antibiotic ampicillin for pET 22b(+) or kanamycin for pET 28b(+) as described in Item 3.7 and Table 19. Four random clones

(OYE amplicon pET22b. OYE_amplicon__pET28b) were selected and five random clones

(YajQ_amplicon_pET22b, YajQ__amplicon_pET28b) were selected for plasmid extraction as described in Item 3.7. The selected clones containing the possible OYE gene were digested with Ndel and Xhol restriction enzymes (OYE_amplicon _pET22b_Wde/_Xto/, OYE_amplicon_ pET28b_Wcte/_X/7o/) (Figure 51 A) and the selected clones containing the YajQ gene were digested with Ndel and EcoRI restriction enzymes (YajG_amplicon_pET22bJVde/_£coR/, YajQ_amplicon_pET28b_A cte/_ EcoRI) (Figure 51 B) to confirm a positive insert.

Sequencing

One clone containing a positive insert with the correct size was sequenced as described in Item 3.8 before expression studies. The sequenced genes were then aligned to the known OYE and YajQ genes from Geobacillus sp. A8 obtained from the genome database, this confirmed a complete gene with the correct ORF (Figures 52 and 53). The reference gene was the gene sequenced that was removed from the backbone of the pET vectors and the Geobacillus sp. A8 referred to the gene obtained from the genome database. Protein expression

The OYE and YajQ proteins were expressed to determine the ability of each individual protein to reduce platinum (IV). Clones with correct inserts were retrieved (OYE_amplicon_pET22b, OYE_amplicon_pET28b), (YajQ_amplicon_pET22b, YajQ_amplicon _pET28b) and re-transformed into E.coli BL21 (DE3) as described in Item 3.9. The selected clones from plasmid DNA containing the pET 22b(+) or pET 28b(+) vector with the correct gene confirmed by sequencing as described in Item 3.8 was transformed into E.coli BL21 (DE3) cells as described in Item 3.9. The OYE and YajQ proteins were then expressed without a N-terminal HisTag (pET 22b (+)) (shown in Figures 54A and 54B) and with a N-terminal HisTag (pET 28b (+)) (shown in Figures 54C and 54D). Proteins without HisTags (pET 22b (+)) were used as controls to assess the possible influence of the Tag on reduction activity or platinum nanoparticle formation. The negative controls had confirmed the expression of the proteins of interest.

Purification of the recombinant OYE and YajQ protein

Two purification protocols were followed, shown in Figures 55A, 55B, 56A, 56B for the OYE and Figures 57A, 57B and 58 for the YajO indicating purification for both untagged and tagged proteins. The recombinant proteins expressed in the pET 22b (+) vector were loaded onto the Sephacryl S200HR resin for purification after a heat shock step to remove the non thermostable proteins as described in Item 3.10 and as observed in Figures 55 and 57 elution profiles. Contamination with some of the non thermostable E.coli proteins was observed as indicated by more than one peak after size exclusion chromatography. Therefore, to determine the correct protein; fractions for each peak were collected and were observed after SDS electrophoresis (Figure 56A and 58A). The platinum reduction assay was performed using the most homogenous protein fractions as described herein before. The heat shock step of the expressed OYE had shown remarkable results in the removal of most of the E.coli proteins and after the size exclusion chromatography more contaminating proteins were removed as indicated in Figure 55A. The first peak fraction was collected and observed on the SDS- PAGE. The concentration yield of the OYE was determined to be 7.8 pg/ml. Fraction 2 from Figure 57B was observed to be the correct size of the YajQ protein and the most homogenous from the other fractions collected during size exclusion chromatography. The concentration yield of the fraction collected for the YajQ protein was 4.3 pg/ ml. Both of these fractions containing the correct proteins were used to test for the reduction of platinum (IV). The negative controls containing only the pET 22b(+) vector without the OYE and YajQ genes were also heat shocked, the contaminated proteins were removed and then tested for the reduction of platinum as described in Item 3.10. The negative controls were not subjected to the purification steps because there was no expression of the proteins of interest.

The recombinant proteins expressed in the pET 28b (+) vector were loaded onto the metal (nickel) affinity resin for purification. The N terminal HisTag has an affinity towards the nickel therefore imidazole with a greater affinity to nickel contains the same side chain (functional group) as histidine and is used as a strong competitor to displace the protein with the HisTag from the nickel ions and elute the protein of interest. The elution profiles in Figure 55 indicate the purification of the OYE protein (Figure 57A) and the YajQ protein (Figure 57B). After purification of the OYE the fraction obtained from a single peak indicated a good degree of homogeneity as observed on the SDS-PAGE in Figure 56. However, the YajQ protein could not be purified from the pET 28b (+) expression vector system. As observed from Figure 54D no expression was obtained for the YajQ protein. The experiment for the YajQ protein expression was done in triplicate with different clones containing the correct gene and no expression was observed with the N terminal HisTag. There could be many reasons for the non- expression of the YajQ protein in the pET 28b (+) expression vector system such as the prevention of translation by the interference of the HisTag or the folding of the protein post translation due to the size of the protein that causes the breakdown of the protein. The OYE purified protein concentration yield was determined to be 7 pg/rnl and was tested for platinum (IV) reduction.

Assessment of platinum reduction activity

Two single prurified proteins described in the preceeding paragraph were assayed to determine the possibility to reduce platinum (IV) to elemental platinum. Platinum reduction was observed by both proteins indicative by a black brown precipitate after incubation at 55' C overnight as described in Item 3.2. Platinum (IV) reduction by the OYE was observed at a final concentration of 0.3 pg. Platinum (IV) reduction by the YajQ was observed at a final concentration of 0.9 pg three times more than the OYE. A much higher concentration of platinum reduction was observed under the same conditions by the OYE as compared to the YajQ protein (Figure 59A and 59 B). The OYE was able to produce particles that form agglomerates as observed in Figure 59A. The YajQ protein has shown the ability to reduce platinum and not form particle agglomerates which is a good indication for the formation of monodisperse nanoparticles. The pET 28b (+) vector containing the fusion protein (HisTag and OYE) did not affect the reduction of platinum (IV) to platinum (0). The negative controls indicated negative reduction as expected ( Figures 59C to 59H). The negative controls for the OYE in Figures 59D, 59E, 59G indicate a yellow colour instead of a colourless solution and this is due to the yellow colour of the OYE flavin mononucleotide cofactor (Williams & Bruce, 2002). Similar negative results were observed for the YajQ protein negative controls. Platinum reduction was not observed after the proteins were denatured, in the absence of H₂PtCI_6> in the presence of air, in the absence of the electron donor H₂ and in the presence of the E. coli proteins from the uncut pET 22b (+) and pET 28b (+) vector systems. It can thus be deduced from these results that the mechanism pertaining to the microorganism Geobacillus sp. A8 isolated from a deep platinum mine for the reduction of platinum (IV) to platinum (0) does not involve a classical hydrogenase as described by Rashamuse et al., 2008. Although hydrogen was the electron donor in the reaction, shuffling of electrons was definitely facilitated by both the proteins.

Conclusions

Two proteins were identified by protein mass spectrometry as described herein before. These proteins were the NADPH dependent oxidoreductase commonly known as the old yellow enzyme and the putative YajQ protein. These proteins were expressed in the pET 22b (+) and pET 28b (+) expression systems. The OYE was successfully expressed and purified from both expression systems and the YajQ protein was successfully expressed in the unmodified pET 22b (+) expression vector without the N terminal HisTag. Both the purified OYE oxidoreductase and YajQ protein were able to reduce the platinum (IV) to platinum (0). It was determined that the OYE was able to reduce platinum (IV) with three times less the concentration than the YajQ protein. It can be deduced from the results obtained that a classical hydrogenase is not involved in the reduction of platinum (IV) to platinum (0) in the genome Geobacillus sp. A8.

The metabolic processes of the biological system involved in the biosynthesis mechanism of metal nanoparticles can occur by the bio-absorption and uptake of the metal ions into a cellular compartments such as the periplasmic space, followed by enzymatic metal reduction by redox reactions or by the chelating of metal ions by secreted polysaccharides or peptides that change the valency of the metal (Govender ef a/., 2010; Konishi ef a/., 2007; Ramezani ef a/., 2010). The metal efflux system of the cell would actively transport the toxic metals out of the cell. This is usually observed by the extracellular metal precipitation, not always in the elemental state but usually in a non toxic state (Senapati ef a/., 2005).

The OYE can be proposed as a novel biocatalyst in the reduction of platinum (IV) to elemental platinum (0). The YajQ hypothetical protein has now been assigned a putative function to reduce the soluble platinum to insoluble platinum and the possible formation of platinum nanoparticles. Future optimization of the OYE and YajQ protein conditions for the reduction of platinum will yield monodisperse platinum nanoparticles for applications in nanotechnology and green technology.

References

• Abed, R.M.M, B.Zein, A. Ai-Thukair, D. de Beer. 2007 Phylogenetic diversity and activity of aerobic heterotrophic bacteria from a hyper saline oil-polluted microbial mat. Systematic and applied microbiology 30: 319-330.

• Akhmaloka, A., S. Suharto, I.N. Nurbaiti and F.M.

Warganegara. 2006. Ribotyping Identification of Thermophilic Bacterium from Papandayan Crater. PROC.ITB Eng. Science, 38: 1 -10.

• Altschul, S.F., W. Gish, W. Miller, E.W. Myers, D.J. Lipman. 1990. Basic local alignment search tool. J.

Mol. Biol. 215:403-410.

• Ashelford, K.E., N.A Chuzhanova, J.C Fry, A.J. Jones, and A.J. Weightman. 2005. At least 1 in 20 16S rRNA sequence records currently held in public repositories is estimated to contain substantial anomalies. Applied and Environmental Microbiology 71(12): 7724-7736.

• Ashelford, K.E., N.A. Chuzhanova, J.C. Fry, A.J. Jones, and A.J. Weightman. 2006. New screening software shows that most recent large 16S rRNA gene clone libraries contain chimeras. Applied and Environmental Microbiology72: 5734-5741.

• Baker, B.J., D.P. Moser, B.J. MacGregor, S. Fishbain, M. Wagner, N.K. Fry, B. Jackson, N. Speolstra, S. Loos, K. Takai, B.S. Lollar, J. Fredrickson, D. Balkwill, T.C. Onstott, C.F. Wimpee, and D.A. Stahl.

2003. Related assemblages of sulphate-reducing bacteria associated with ultra deep gold mines of South Africa and deep basalt aquifers of Washington State. Environmental Microbiology 5(4): 267 277. Barns, S.M., R.E. Fundyga, M.W. Jeffries, N.R. Pace. 1994. Remarkable archaeal diversity detected in a Yellowstone National Park hot spring environment. PNAS 91 : 1609-1613.

Bartholomew, W., and T. Mittwer. 1952. The Gram stain. Microbiology and Molecular Biology Reviews 16 (1 ): 1-29.

Bester, A.P., D. Litthauer, LA. Piater, E. van Heerden. 2010. A thioredoxin reductase-!ike protein from the thermophile, Thermus scotoductus SA-01 , displaying iron reductase activity. FEMS Microbiology Letters 302:182-188.

Blommel, P.G., K.J. Becker, P. Duvnjak, B.G. Fox. 2007. Enhanced bacterial protein expression during auto-induction obtained by alteration of lac repressor dosage and medium composition. Biotechnology progress 23:585-598.

Bo, Y., O. Jianping, and C. Xinhua. A culture-dependent survey of thermophilic bacteria from hot springs in Xiamen area in China. 2009. Acta Oceanologica Sinica 28(1 ): 62-71.

Bongers, L. 1967. Phosphorylation in hydrogen bacteria. Journal of Bacteriology 93(5): 1615-1623.

Brandl, H., and . A. Faramarzi. 2006. Microbe-metal-interactions for the biotechnological treatment of metal-containing solid waste. CHINA Particuology 4:93-97.

Burkhardt, E., D. . Akob, S. Bischoff, J . Sitte, J.E. Kostka, D. Banerjee, A.C. Scheinost, and K. Kiisel. 2010. Impact of biostimulated redox processes on metal dynamics in an iron-rich creek soil of a former uranium mining area. Environ. Sci. Technol 44: 177-183.

Cardenas, E., and J.M. Tiedje. 2008. New tools for discovering and characterizing microbial diversity. Current Opinion in Biotechnology 19: 544-549. Cason, E. 2010. Msc dissertation: The importance of bifunctional enzymes for U (VI) reduction in Thermus scotoductus SA-01 . Department of Biochemistry, Microbiology and Food Biotechnology. University of the Free State, Bloemfontein.

Cashion, P., .A. Holder-Franklin, J. McCully, and M. Franklin. 1977. A rapid method for the base ratio determination of bacterial DNA. Analytical Biochemistry 81 : 461 -466.

Cawthorn, R.G. 1999. The platinum and palladium resources of the Bushveld Complex. South African Journal of Science 93: 481 -489.

Cavicchioli, R. 2002. Extremophiles and the search for extraterrestrial life. Astrobiology 2(3): 281-292.

Cawthorn, R.G. 1999. The platinum and palladium resources of the Bushveld Complex. South African Journal of Science 93: 481 -489.

Chen, W., A. ulchandani, and M.A. Deshusses. 2005. Environmental biotechnology: challenges and opportunities for chemical engineers. AIChE Journal 51 (3): 690-695.

Chung, A.P., F. A. Rainey, M. Valente, M.F. Nobre and M.S. da Costa. 2000. Thermus igniterrae sp. nov. and Thermus antranikianii sp. nov., two new species from Iceland. International Journal of Systematic and Evolutionary Microbiology 50: 209-217.

Clark, N., J.H. Lunacek, G.B. Benedek. 1970. A study of Brownian motion using light scattering. Am. J. Phys. 38: 575-585.

Cunliffe, M., and J.C. Murrell. 2010. Eukarya 18S rRNA gene diversity in the sea surface microlayer: implications for the structure of the neustonic microbial loop. The ISME Journal 4: 455-458. Daniel, .C., and D. Astruc. 2004. Gold nanoparticles: assembly, supramolecular chemistry, quantum- size-related properties, and applications toward biology, catalysis, and nanotechnology. Chem. Rev. 104: 293-346.

DeFlaun, M.F., J.K Fredrickson, H. Dong, S.M. Pfiffner, T.C. Onstott, D.L. Balkwill, S.H. Streger, E. Stackebrandt, S. Knoessen and E. van Heerden. 2007. Isolation and characterization of a Geobacillus thermoleovorans strain from an ultra-deep South African gold mine. Systematic and Applied Microbiology 30: 152-164.

Diez, B., C. Pedros-Alio , and R. Massana . 2001. Study of genetic diversity of eukaryotic picoplankton in different oceanic regions by small-subunit rRNA gene cloning and sequencing. Applied and Environmental Microbiology 67(7): 2932-2941.

Douglas, F., R. Yanez, J. Ros, S. Marin, A. la Escosura-Muniz, S. Alegret and A. erkoci. 2008. Silver, gold and the corresponding core shell nanoparticles: synthesis and characterization. J. nanopart Res 10: 97-106.

Eiler, A, S. Langenheder, S. Bertilsson, and L.J. Tranvik. 2003. Heterotrophic bacterial growth efficiency and community structure at different natural organic carbon concentrations Applied Environmental Microbiology 69: 3701 -3709.

Edward, J.T. 1970. Molecular volumes and the Stokes-Einstein equation. Journal of Chemical Education 47(4): 261 -270.

Fairbanks, G., T.L. Steck, D.F.H. Wallach. 1971. Electrophoretic analysis of the major polypeptides of the human erythrocyte membrane. Biochemistry 10: 2606-2617. Fang, J., Y. Wong, D.S. Beattie. 2001. Isolation and characterization of complex I, rotenone-sensitive NADH;ubiquinone oxidoreductase, from the procyclic forms of Trypanosoma brucei. European Journal of Biochemistry 268: 3075-3082.

Fritz, I., C. Strompl, D.I. Nikitin, A.M. Lysenko, W.R. Abraham. 2005. Brevundimonas mediterranea sp. nov., a non-stalked species from the Mediterranean Sea. Int J Syst Evol Microbiol 55 (1 ): 479-486.

Gadd, G.M. 2010. Metals, minerals and microbes: geomicrobiology and bioremediation. Microbiology 156:609-643.

Garrity, G.M., J.A. Bell, T.G. Lilburn. 2004. Taxonomic outline of the prokaryotes Bergey's manual of systematic bacteriology, second edition. Springer, New York, U.S.A.

Gerday, C, and N. Glansdorff. 2007. Physiology and biochemistry of extremophiles. ASM Press Washington, D.C.

Gihring, T.M., L.-H. Lin, M. Davidson, T.C. Onstott, L. oegan, M. Milleson, T.L. Kieft, E. Trimarco, D.L. Balkwill, and M.E. Dollhopf. 2006. The distribution of microbial taxa in the subsurface water of the Kalahari shield, South Africa. Geomicrobiology Journal 23:415-430.

Gilmore, C, D. Kormann, A.D. Rubin. 1999. Secure remote access to an internal web server. Proceedings of the ISOC Symposium on Network and Distributed System Security. IEEE Network 13(6): 31 -37.

Gilmour, C, and G. Riedel. 2009. Biogeochemistry of trace metals and metalloids. Encyclopedia of Inland Waters. Elsevier, Amsterdam: Netherlands. Godiska, R., D. Mead, V. Dhodda, C. Wu, R. Hochstein, A. Karsi, K. Usdin, A. Entezam , N. Ravin.

2010. Linear plasmid vector for cloning of repetitive or unstable sequences in Escherichia coli. Nucleic Acid Research 38(6): 1 -9.

Gold, T. 1992 .The deep, hot biosphere. PNAS 89: 6045-6049.

Gotelli, N.J., and R.K. Colwell. 2001. Quantifying biodiversity: procedures and pitfalls in the measurement and comparison of species richness. Ecology Letters 4: 379-391.

Gounder, K. 2009. PhD thesis: Genome sequencing of the extremophile Thermus scotoductus SA-01 and expression of selected genes. Department of Biochemistry, Microbiology and Food Biotechnology. University of the Free State, Bloemfontein.

Govender, Y., T. Riddin M. Gericke C.G. Whiteley. 2009. Bio-reduction of platinum salts into nanoparticles: a mechanistic perspective. Biotechnology Letters 31 : 95-100.

Govender, Y., T. Riddin M. Gericke C.G. Whiteley. 2010. On the enzymatic formation of platinum nanoparticles. 12:261 -267.

Govender, Y., T. Riddin M. Gericke C.G. Whiteley. 2009. Bio-reduction of platinum salts into nanoparticles: a mechanistic perspective. Biotechnology Letters 31 : 95-100.

Govender, Y., T. Riddin M. Gericke C.G. Whiteley. 2010. On the enzymatic formation of platinum nanoparticles. 12:261 -267.

Govindaraju, K., S.K. Basha, V.G. Kumar, and G. Singaravelu. 2008. Silver, gold and bimetallic nanoparticles production using single-cell protein (Spirulina platensis) Geitler J Mater Sci 43:51 15-5122. • Griebler, C, and T. Lueders. 2009. Microbial biodiversity in groundwater systems. Freshwater Biology 54: 649-677.

• Gu, J., C.K. Wan, and H. Sun. 2003. Surface properties of galvanized metals and attachment by the bacterium Janinobacterium lividum. Corrosion 1 : 3567-3579.

• Hamada, S., and S. Fujita. 1983. DAPl staining improved for quantitative cytofluorometry. Histochemistry 79:219 226.

• Handelsman, J. 2004. Metagenomics: Application of genomics to uncultured microorganisms.

Microbiology and Molecular Biology Reviews 68:669-685.

• Henderson, B., and A. Martin. 2011. Bacterial virulence in the moonlight: multitasking bacterial moonlighting proteins are virulence determinants in infectious disease. Infectious Immunology 10: 1 128- 1 139.

• Henglein, A., B.G. Ershov, M. Malow. 2005. Absorption spectrum and some chemical reactions of colloidal platinum in aqueous solution. The Journal of Physical Chemistry 99(38): 14129-14136.

• Hennebel, T., B.D. Gusseme, W. Verstraete. 2009. Biogenic metals in advanced water treatment.

Trends Biotechnol 27: 90-98.

• Hennebel, T., B.D. Gusseme, W. Verstraete. 2009. Biogenic metals in advanced water treatment.

Trends Biotechnol 27: 90-98.

• Herricks, T., J. Chen, Y. Xia. 2004. Polyol synthesis of platinum nanoparticles: control of morphology with sodium nitrate. Nano Letters 4(12): 2367-2371.

http:/7www.nanocon.cz data/nanocon2010/sbornik/lists/papers/545.pdf. Retrieved 04-04-201 1. Herricks, T., J. Chen, Y. Xia. 2004. Polyol synthesis of platinum nanoparticles: control of morphology with sodium nitrate. Nano Letters 4(12): 2367-2371.

Hilderbrand, J.G., and J.H. Law. 1964. Fatty acid distribution in bacterial phospholipids - the specificity of the cyclopropane synthetase reaction. Biochemistry 3(9): 1304-1308.

Huber, T., G. Faulkner, and P. Hugenhoitz. 2004. Bellerophon: a program to detect chimeric sequences in multiple sequence alignments. Bioinformatics 20(14):2317-2319.

Husseiny, M.I., M.A El-Aziz, Y. Badr, M.A. Mahmoud. 2007. Biosynthesis of gold nanoparticles using Pseudomonas aeruginosa. Spectrochimica Acta Part A 67: 003-1006.

Jauncey, G.E.M. 1924. The scattering of X-Rays and Bragg's law. PNAS 10(2): 57-60.

Jeffrey, C.J. 2004. Moonlighting proteins: complications and implications for proteomics research. Drug Discovery Today: Targets 3(2): 71-78.

Johnson, M., I. Zaretskaya, Y. Raytselis, Y. Merezhuk, S. McGinnis, and T.M. Madden. 2008. NCBI BLAST: a better web interface. Nucleic Acids Research 36: 5-9.

Judge, D.P., J.K. Bonfield, R. Staden. 2001. Sequencing project management using the Staden package. Online manual, http://www.mrc-lmb.cam.ac.uk/pubseq. Retrieved 30-01 -2009.

Ju-Nam, Y., J R. Lead. 2008. Manufactured nanoparticles: An overview of their chemistry, interactions and potential environmental implications. Science of the Total Environment 400:396-414, Kapur, M., and R.K. Jain. 2004. Microbial diversity: exploring the unexplored. Institute of microbial technology, Chandigarh, India, http://www.wfcc.nig.ac.jp/ NEWSLETTER news39/ a2 .pdf. Retrieved 25- 03-2009.

Karger, S., and A.G. Basel. 2005. Beneficial bacteria and bioremediation. J. Mol Microbiol Biotechnol 9:63-64.

Karger, S., and A.G. Basel. 2005. Beneficial bacteria and bioremediation. J. Mol Microbiol Biotechnol 9:63-64.

Karnezis, T., H.C. Fisher, G.M. Neumann, B.A. Stone, V.A. Stanisich. 2002. Cloning and characterization of the phosphatidylserine synthase gene of Agrobacterium sp. strain atcc 31749 and effect of its inactivation on production of high-molecular-mass (1— K3)-&-d-glucan (curdlan). Journal of Bacteriology 184 (15): 41 14-4123.

Karp, P.D., S. Paley, P. Romero. 2002. The pathway tools software. Bioinformatics 18:225-232.

Kausch, H.H., and G.H. Michler. Effect of nanoparticle size and size-distribution on mechanical behavior of filled amorphous thermoplastic polymers. Journal of applied polymer science 10: 2577-2587.

Kieft , T.L., Fredrickson, J.K, Onstott, T.C., Gorby, Y.A., Kostandarithes, H.M., Bailey, T.J., Kennedy, D.W., Li, S.W., Plymale, A.E., Spadoni, CM. and M.S. Gray. 1999. Dissimilatory reduction of Fe (III) and other electron acceptors by a Thermus isolate. Applied and Environmental Microbiology 65 (3): 1214-1221 .

Kisand, V., and J. Wikner. 2003. Limited resolution of 16S rDNA DGGE caused by melting properties and closely related DNA sequences. Journal of Microbiological Methods 54: 183-191. Kliiber, H.D., S. Lechner, R, Conrad. 1995. Characterization of populations of aerobic hydrogen-oxidizing soil bacteria. FEMS Microbiology Ecology 16: 167-176.

Konishi Y., K. Ohnoa, N. Saitoh, T. Nomura, S. Nagaminea, T.H. Hishida, T. Uruga. 2007. Bioreductive deposition of platinum nanoparticles on the bacterium Shewanella algae. Journal of Biotechnology 128: 648-653.

Konishi Y., K. Ohnoa, N. Saitoh, T. Nomura, S. Nagaminea, T.H. Hishida, T. Uruga. 2007. Bioreductive deposition of platinum nanoparticles on the bacterium Shewanella algae. Journal of Biotechnology 128: 648-653.

Korbas, ., S. Vogt, W. Meyer-Klaucke, E. Bill, E.J. Lyon, R.K. Thauer, S. Shima. 2006. The iron-sulfur cluster-free hydrogenase (HMD) is a metalloenzyme with a novel iron binding motif. Journal of Biological Chemistry 281 (41 ): 30804-30813.

Krumholz, L.R. 2000. Microbial communities in the deep subsurface. Hydrogeology Journal 8:4-10.

Krumholz, L.R. 2000. Microbial communities in the deep subsurface. Hydrogeology Journal 8:4-10.

Krumov, N., I. Perner-Nochta, S. Oder, V. Gotcheva, A. Angelov, C.Posten. 2009. Production of inorganic nanoparticles by microorganisms. Chem. Eng. Technol. 32(7): 1026-1035.

Krumov, N., I. Perner-Nochta, S. Oder, V. Gotcheva, A. Angelov, C.Posten. 2009. Production of inorganic nanoparticles by microorganisms. Chem. Eng. Technol. 32(7): 1026-1035.

Labuschagne, M., and J. Albertyn. 2007. Cloning of an epoxide hydrolase-encoding gene from Rhodotorula mucilaginosa and functional expression in Yarrowia lipolytica. Annual Review of Ecology and Systematics 27:569-595. Laemmli, U.K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227:680-685.

Lane, D.J. 1991. 16S/23S rRNA sequencing. Nucleic Acid Techniques in Bacterial Systematics. Wiley, Chichester.

Langford, J. I., and A.J.C. Wilson. 1978. Scherrer after sixty years: A survey and some new results in the determination of crystallite size. J. Appl. Cryst. 11 : 102-1 13.

Langenheder, S., V. Kisand, E.S. Lindstrom, J. Wikner, and L.J. Tranvik. 2004. Growth dynamics within bacterial communities in riverine and estuarine batch cultures. Aquatic Microbial Ecology 37(20): 137-148.

Li, Y. 2010. Microbial respiratory quinones as indicator of ecophysiological redox conditions. Front. Earth Sci. China 4(2): 195-204.

Libkind, D., S. Brizzio, M. van Brook. 2004. Rhodotorula mucilaginosa, a carotenoid producing yeast strain from a Patagonian high-altitude lake. Folia Microbiology 49 (1 ): 19-25.

Life Technologies Corporation. 201 1. Ion Torrent. The chip is the machine. http://w'<vw.iontorrent.com/lib/imaqes/PDFs/ on%20torrent%20product%20information^o/o20.pdf. Retrieved 10-05-2011.

Lin L.H., G. F Slater, B.S. Lo!lar, G. Lacrampe-Couloume, T.C. Onstott. 2005. The yield and isotopic composition of radiolytic H₂, a potential energy source for the deep subsurface biosphere. Geochimica et Cosmochimica Acta 69(4): 893-903. Lister, R., B.D. Gregory, J.R. Ecker. 2009. Next is now: new technologies for sequencing of genomes, transcriptomes, and beyond. Current Opinion in Plant Biology 12: 107-118.

Liu, Z., X.Y. Ling, X. Su, J.Y. Lee. 2004. Carbon-supported pt and pt/ru nanoparticles as catalysts for a direct methanol fuel cell. The Journal of Physical Chemistry 108(24): 8234-8240.

Lloyd, J.R., P. Yong, L. Macaskie. 1998. Enzymatic recovery of elemental palladium by using sulfate- reducing bacteria. Applied and Environmental Microbiology 64(1 1 ): 4607-4609.

Lu, K., and Y.H. Zhao. 1999. Experimental evidences of lattice distortion in nanocrystalline materials. NanoStructured Materials 12: 559-562.

Lu, G., and E.N. Moriyama. 2004. Vector NTI, a balanced all-in-one sequence analysis suite. Briefings in Bioinformatics 5(4): 378-388.

Lucas, S., A. Copeland, A. Lapidus, J.F. Cheng, D. Bruce, L. Goodwin, S. Pitluck, O. Chertkov, X. Zhang, J.C. Detter, C. Han, R. Tapia, M. Land, L. Hauser, C. Jeffries, N, Kyrpides, N. Ivanova, G. Ovchinnikova, P. Brumm, D. Mead, T. Woyke. 2010. GeobaciHus sp, Y4.1 MC1 , complete genome. US DOE Joint Genome Institute, California.

Lucigen. 2010. Ultra high fidelity PGR cloning. eLucidations 4: 1 -4. http://lucigen.com/store/docs/literature/eLucidations/Ultra_High_Fidelity.pdf. Retrieved 10-10-2010.

Ludwig, W., O. Strunk, R. Westram, L. Richter, H. Meier, Yadhukumar, A. Buchner, T. Lai, S. Steppi, G. Jobb, W. Forster, I. Brettske, S. Gerber, A.W. Ginhart, O. Gross, S.Grumann, S. Hermann, R. Jost, A. Konig, T. Liss, R. Luflmann, M. May, B. Nonhoff, B. Reichel, R. Strehlow, A.Stamatakis, N. Stuckmann, A. Vilbig, M. Lenke, T. Ludwig, A.Bode, and K.H Schleifer. 2004. ARB: a software environment for sequence data. Nucleic Acids Research 32(4): 1363-1371.

Luo, X., A. Morrin, A. J. Killard, M.R. Smyth. 2006. Application of nanoparticles in electrochemical sensors and biosensors. Electroanalysis 18(4), 319 - 326.

Madigan, M.T. and B.L. Marrs. 1997. Extremophiles. J. Sci. American, 276: 66-71.

Mandal, D., M.E. Bolander, D. Mukhopadhyay, G. Sarkar, and P. Mukherjee. 2006. The use of microorganisms for the formation of metal nanoparticles and their application Appl. Microbiol. Biotechnol. 69: 485-492.

Mandal, D., M.E. Bolander, D. Mukhopadhyay, G. Sarkar, and P. Mukherjee. 2006. The use of microorganisms for the formation of metal nanoparticles and their application Appl. Microbiol. Biotechnol. 69: 485-492.

Meier, M. 2004. Crystallite size measurement using X-Ray Diffraction. Department of Chemical Engineering and Materials Science, University of California. http://chms. engineering. ucdavis.edu/students/underqraduates/labs/files/XRD-CSize1 .pdf. Retrieved 10-05- 201 1.

Merck KgaA, Germany. BL21 and Beyond. http://www.emdchemicals.com/life-science- research/competent-cells-spotlight-bl21/c_5fKb.s10l6YAAAEhYAMsglSF. Retrieved 29-04-201 1.

Mesbah, M., U. Premachandran, and W. Whitman. 1989. Precise measurement of the G+C content of deoxyribonucleic acid by high performance liquid chromatography. International Journal of Systematic Bacteriology 39: 159-167. Moghaddam, . . 2010. An introduction to microbial metal nanoparticle preparation method. The Journal of Young Investigators 19( 19): 1 -6. orikawa, K., and . Yanagida. 1981. Visualization of individual DNA molecules in solution by light microscopy: DAPI staining method. Journal of Biochemistry 89: 693-696.

Moser, D.P., T.C. Onstott, J.K. Fredrickson, F.J. Brockman, D.L Balkwill, G.R. Drake, S.M. Pfiffner, and D.C. White. 2003. Temporal shifts in the geochemistry and microbial community structure of an ultra deep mine borehole following isolation. Geomicrobiology Journal 20:517-548.

Moser, D.P., T.M. Gihring, F.J. Brockman, J.K. Fredrickson, D.L. Balkwill, M.E. Dollhopf, B.S. Lollar, L.M. Pratt, E. Boice, G. Southam, G. Wanger, B.J. Baker, S.M. Pfiffner, L.H. Lin, T. C. Onstott. 2005. Desulfotomaculum and Methanobacterium spp. dominate a 4- to 5-kilometer-deep fault. Applied and Environmental Microbiology 71 (12): 8773-8783.

Narayanan, K.B., and N. Sakthivel. 2010. Biological synthesis of metal nanoparticles by microbes. Advances in Colloid and Interface Science 156: 1 -13.

Nazina, T.N., T.P. Tourova, A.B. Poltaraus, E.V. Novikova, A.A. Grigoryan, A.E. Ivanova, A.M. Lysenko, V.V. Petrunyaka, G.A. Osipov, S.S. Belyaev , and M.V. Ivanov. 2001. Taxonomic study of aerobic thermophilic bacilli: descriptions of Geobacillus subterraneus gen.nov. sp. nov. and Geobacillus uzenensis sp. nov.from petroleum reservoirs and transfer of Bacillus stearothermophilus, Bacillus thermocatenulatus, Bacillus thermoleovorans, Bacillus kaustophilus, Bacillus thermoglucosidasius and Bacillus thermodenitrificans to Geobacillus as the new combinations G. stearothermophilus, G. thermocatenulatus, G. thermoleovorans, G. kaustophilus, G. thermoglucosidasius and G. thermodenitrificans. International Journal of Systematic and Evolutionary Microbiology 51 :433-446. Nazina, T.N., D.S. Sokolova, A. A. Grigoryan, N. . Shestakovaa, E.M. Mikhailovaa, A.B. Poltaraus, T.P. Tourova, A.M. Lysenko, G.A. Osipov, S.S Belyaev. 2005. Geobacillus jurassicus sp. nov., a new thermophilic bacterium isolated from a high-temperature petroleum reservoir, and the validation of the Geobacillus species. Systematic and Applied Microbiology 28: 43-53.

Nazina, T.N., E.V. Lebedeva, A.B Poltaraus, T.P. Tourova, A.A. Grigoryan, D S. Sokolova, A.M. Lysenko, and G.A. Osipov. 2004. Geobacillus gargensis sp. nov., a novel thermophile from a hot spring, and the reclassification of Bacillus vulcani as Geobacillus vulcani comb. nov. International Journal of Systematic and Evolutionary Microbiology 54: 2019-2024.

Noderer, W. 2005. DNA pyrosequencing using microfluidic chips. NNIN REU Research Accomplishments 1 : 96-97.

Novagen, 2002-2003. Protein expression. In: Novagen 2002-2003 Catalog. P 84-91. www.novagen.com/Sharedlmages/Novaqen/05 PROEXP.pdf. Retrieved 29-10-2010.

Novy, R., D. Drott, K. Yaeger, R. Mierendorf. 2001. Overcoming the codon bias of E.coli for enhanced protein expression. InNovations 12: 1-3.

Opperman, D. and E. van Heerden. 2007. A membrane-associated protein with Cr (Vl)-reducing activity from Thermus scotoductus SA-01. FEMS Microbiological Letters 280:210-218.

Opperman, D. and E. van Heerden. 2007. A membrane-associated protein with Cr (Vl)-reducing activity from Thermus scotoductus SA-01. FEMS Microbiological Letters 280:210-218.

Onstott, T.C., L.-H. Lin, M. Davidson, B. Mislowack, M. Borcsik , J. Hall, G. Slater, J. Ward, B. Sherwood Lollar.J. Lippmann-Pipke, E. Boice.L. M. Pratt.S. Pfiffner.D. Moser ,T. Gihring, T. L. Kieft, T.J. Phelps, E. van Heerden ,D. Litthauer, M. Deflaun, R. Rothmel, G. The origin and age of biogeochemical trends in deep fracture water of the Witwatersrand Basin, South Africa. Geomicrobiology Journal 23:369-414.

Patterton, H.G., and S. Graves. 2000. DNAssist: the integrated editing and analysis of molecular biology sequences in Windows. Bioinformatics Applications Note 16(7): 652-663.

Pedersen, K. 2007. Microbial life in deep granitic rock. FEMS Microbiology Reviews 20: 399-414.

Pfiffner, S. ., J.M. Cantu, A. Smithgall, A.D. Peacock, D.C. White, D.P. Moser.T.C. Onstott, and E.van Heerden.2006. Deep subsurface microbial biomass and community structure in Witwatersrand Basin mines. Geomicrobiology Journal 23: 431-442.

Pikuta, E.V., R. B, Hoover, and J. Tang. 2007. Microbial extremophiles at the limits of life. Critical reviews in microbiology 33: 183-209.

Popova, N.A., Y.A. Nikolaev, T. P. Tourova, A. M. Lysenko, G. A. Osipov, N. V. Verkhovtseva, and N. S. Panikov. 2002. Geobacillus uralicus, a new species of thermophilic bacteria. Microbiology 71(3): 335-341.

Qiao, X., Y. Sun, J. Qiao, L. Mindich. 2008. The role of host protein YajQ in the temporal control of transcription in bacteriophage ^"6. PNAS 105(41 ): 15956-15960.

Quince, C, T.P. Curtis, and W.T. Sloan. 2008. The rational exploration for microbial diversity. The ISME Journal 2:997-1006.

Rabilloud, T., G. Carpentier, P. Tarroux. 1988. Improvement and simplification of low-background silver staining proteins by using sodium dithionite. Electrophoresis 9: 288-291. Rainey, F.A., and A. Oren. 2006. Extremophiles. Methods in Microbiology. Academic Press, Amsterdam: Netherlands.

Raji, A.I., C. Moller, D. Litthauer, E. van heerden and L.A. Piater. 2008. Bacterial diversity of biofilm samples from deep mines in South Africa. Biokemistri 20(2):53-62.

Ramezani, F., M. Ramezani, S. Talebi. 2010. Mechanistic aspects of biosynthesis of nanoparticles by several microbes. Shahid Beheshti University, Iran. NanoCon. http://www.nanocon.cz/data/nanocon2010/sbornik/lists/papers/545.pdf. Retrieved 04-04-201 1.

Ramezani, F., M. Ramezani, S. Talebi. 2010. Mechanistic aspects of biosynthesis of nanoparticles by several microbes. Shahid Beheshti University, Iran. NanoCon.

Rashamuse, K.J., C.C.Z. Mutambanengwe, C.G. Whiteley 2008. Enzymatic recovery of platinum (IV) from industrial wastewater using a biosulphidogenic hydrogenase. African, Journal of Biotechnology 7 (8): 1087-1095.

Rashamuse, K.J., C. C. Z. Mutambanengwe, C. G. Whiteley. 2008. Enzymatic recovery of platinum (IV) from industrial wastewater using a biosulphidogenic hydrogenase. African Journal of Biotechnology 7 (8): 1087-1095.

Rincon, B., F. Raposo, R. Borja, J.M. Gonzalez, M.C. Portillo and C. Saiz-Jimenez. 2006. Performance and microbial communities of a continuous stirred tank anaerobic reactor treating two-phase olive mill solid wastes at low organic loading rates. Journal of Biotechnology 121 : 534-543.

Riviere, J.C. 1973. Auger electron spectroscopy. Contemporary physics 14 (6): 513-539. Ronagh!, M. 2001. Pyrosequencing sheds light on DNA sequencing. Genome Research 11 : 3-1 1.

Rutherford, K., J. Parkhill, J. Crook, T. Horsnell, P. Rice, M.A. Rajandream, B. Barrell. 2000. Artemis: sequence visualization and annotation. Bioinformatics 16(10): 944-945.

Rutherford, K., J. Parkhill, J. Crook, T. Horsnell, P. Rice, M.A. Rajandream, B. Barrell. 2000. Artemis: sequence visualization and annotation. Bioinformatics 16(10): 944-945.

Saeger, J., and A.B. Hale. 1993. Genetic variation within a lotic population of Janthinobacterium lividum. Applied and Environmental Microbiology 59(7): 2214-2219.

Sahl, J.W., R. Schmidt, E.D. Swanner, K.W. Mandernack, A.S. Templeton, T.L. Kieft, R.L. Smith.W.E. Sanford, R.L. Callaghan, J.B. itton ,and J.R. Spear. 2008. Subsurface microbial diversity in deep- granitic-fracture water in Colorado. Applied and Environmental Microbiology 74(1 ): 143-152.

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Lab. Cold Spring Harbor: U.S.A.

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Lab, Cold Spring Harbor: U.S.A.

Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Lab, Cold Spring Harbor: U.S.A.

Saveanu, C, S. Miron, T. Borza, C.T. Craescu, G. Labesse, C. Gagyi, A. Popescu, F. Schaeffer, A. Namane, C. Laurent-Winter, O. Bazu, A.M. Gilles. 2002. Structural and nucleotide-binding properties of YajQ and YnaF, two Escherichia coli proteins of unknown function. Protein Science 11 :2551 -2560. Schlegel, H.G., and M. Meyer. 1985. Isolation of hydrogenase regulatory mutants of hydrogen-oxidizing bacteria by a colony-screening method. Arch. Microbiology 141 : 377-383.

Schloss, P.D., and J. Handelsman. 2005. Introducing DOTUR, a computer program for defining operational taxonomic units and estimating species richness. Applied and Environmental Microbiology 71 (3): 1501-1506.

Scoates, J.S., and R.M. Friedman. 2008. Precise age of the platiniferous Merensky reef, bushveld complex, South Africa by the U-Pb zircon chemical abrasion ID-TIMS technique. Economic Geology 103: 465-471.

Senapati, S., A. Ahmad, M.I. Khan, M. Sastry, R. Kumar. 2005. Extracellular biosynthesis of bimetallic Au-Ag Alloy nanoparticles. Small 1 (5):517-520.

Senapati, S., A. Ahmad, M.I. Khan, M. Sastry, R. Kumar. 2005. Extracellular biosynthesis of bimetallic Au-Ag Alloy nanoparticles. Small 1(5):517-520.

Stetter, K.O. 1996. Hyperthermophiles in the history of life. Ciba Foundation Symposium, 202: 1 -10.

Siegel, R.W., E.Hu. M.C. Roco. 1999. Nanostructure science and technology- a worldwide study. National Science and Technology Council, http://www.wtec.org/pdf/nano.pdf. Retrieved 03-02-201 1.

Simon, C, Wiezer, A., Strittmatter, A.W., and R. Daniel. 2009. Phylogenetic diversity and metabolic potential revealed in a glacier ice metagenome. Applied and Environmental Microbiology 75(23): 7519- 7526. Sood, N., and B.Lai. 2008. Isolation and characterization of a potential paraffin-wax degrading thermophilic bacterial strain Geobacillus kaustophilus TERI NSM for application in oil wells with paraffin deposition problems. Chemosphere 70: 1445-1451.

Smith, M.G., T.A Gianoulis, S. Pukatzk. 2007. New insights into Acinetobacter baumannii pathogenesis revealed by high-density pyrosequencing and transposon mutagenesis. Genes and Development 21 :601 - 614.

Staden, R., K.F. Beal, J.K. Bonfield. 2000. The Staden package, 1998. Methods in Molecular Biology 132: 1 15-130.

Takai, K., D.P. Moser, . DeFlaun, T.C. Onstott, and J.K. Fredrickson. 2001. Archael diversity in waters from deep South African gold mines.

Takai, K., D.P. Moser, ML DeFlaun, T.C. Onstott, and J.K. Fredrickson. 2001. Archael diversity in waters from deep South African gold mines.

Tamaoka, J., and K. Komagata. 1984. Determination of DNA base composition by reversed phase high performance liquid chromatography. FEMS Microbiology Letters 25: 125-128.

Takami, H., Y. Takaki, G.J. Chee, S. Nishi, S. Shimamura, H. Suzuki, S. Matsui ,l. Uchiyama.

Thermoadaptation trait revealed by the genome sequence of thermophilic Geobacillus kaustophilus. Nucleic Acids Research 32(21 ): 6292-6303.

Teplyakov, A., G. Obmolova, N. Bir, P. Reddy, A. J. Howard, G.L. Gilliland. 2003. Crystal structure of the YajQ protein from Haemophilus influenzae reveals a tandem of RNP-like domains. Journal of Structural and Functional Genomics 4: 1-9. Teranishi, T., R. Kurita, M. Miyake. 2000. Shape control of pt nanoparticles. Journal of Inorganic and Organometallic Polymers 10(3): 145-156.

Tibelius, K.H., and R. Knowles. 1984. Hydrogenase activity in Azospirillum brasilense is inhibited by nitrite, nitric oxide, carbon monoxide, and acetylene. Journal of Bacteriology 160 (1 ): 103-106.

Tsutsumi, K. 1982. X-ray-diffraction study of the periodic lattice distortion associated with a charge-density wave in 1T-VSe₂. Phys. Rev. 26: 5756-5759.

Valenzuela, L, A. Chi, S. Bearda, A. Orella, N. Guiliania, J. Shabanowitz, D.F. Hunt, and C.A. Jerez.

2006. Genomics, metagenomics and proteomics in biomining microorganisms. Biotechnology Advances 24:197-21 1.

Van Marwijk, J. 2010. PhD thesis: Biological synthesis of gold nanoparticles by Thermus scotoductus SA- 01. Department of Biochemistry, Microbiology and Food Biotechnology. University of the Free State, Bloemfontein.

Van Wyk, P.W.J. , and M.J. Wingfieid. 1991. Ascospore ultrastucture and development in Ophiostoma cucullantum. Mycologia 83: 698-707.

Wanger, G., T.C. Onstott, and G. Southam. 2008. Stars of the terrestrial deep subsurface: a novel star - shaped bacterial morphotype from a South African platinum mine. Geobiology 6: 325-330.

Wen, Y., H. Fanga, Z. Zhu, S. Sun. 2009. Molecular dynamics investigation of shape effects on thermal characteristics of platinum nanoparticles. Physics Letters A 373: 272-276, • Whiton, R.S., P. Lau, S. Morgan, J. Gilbert, and A Fox. 1985. Modifications in the alditol acetate method for analysis of muramic acid and other neutral and amino acid sugars by capillary gas chromatography mass spectrometry with selected ion monitoring. Journal of Chromatography 347: 109-120.

• Williams, R.E., and N.C. Bruce. 2002. New uses for an old enzyme - the old yellow enzyme family of flavoenzymes. Microbiology 148:1607-1614.

• Williams, R.E., D.A. Rathbone, N.S. Scrutton, N.C. Bruce. 2004. Biotransformation of explosives by the old yellow enzyme family of flavoproteins. Applied and Environmental Microbiology 70(6): 3566-3574.

• Williams, D.M., and T.M. Embley. 1996. Microbial diversity: domains and kingdoms.

Yeast 24:69-78.

• Xue, Y., H.Y. Yang, Y.T. Yang. 2005. Determination of size distribution of nano-particles by capillary zone electrophoresis. Chinese Chemical Letters 16 (1 ): 67-70.

• Yang, B., O. Jianping, X. Chen. 2009. A culture-dependent survey of thermophilic bacteria from hot springs in Xiamen area in China. Ocean Science 1 : 62-71 .

• Yoshino, J., Y. Sugiyama, S. Sakuda, T. Kodama, H. Nagasawa, M. Ishii, and Y. Igarashi. 2001.

Chemical structure of a novel aminophospholipid from Hydrogenobacter thermophilus strain TK-6. Journal of Bacteriology 183(2): 6302-6304.

• Zeigler, D.R. 2001. Bacillus genetic stock center catalog of strains, seventh edition, volume, 3: the genus Geobacillus. Department of Biochemistry, the Ohio State University, U.S.A. Online catalog www.bgsc.org/Catpart3.pdf. • Zeng, Y.H., X.H. Chen, N.Z. Jiao. 2007. Genetic diversity assessment of anoxygenic photosynthetic bacteria by distance-based grouping analysis of pufM sequences. Letters in Applied Microbiology 45:639- 645.

• Zweifel, U.I., and A. Hagstrom. 1995. Total counts of marine bacteria include a large fraction of non- nucleoid-containing bacteria (ghosts). Applied and Environmental Microbiology 61(6): 2180-2185.

Claims

Claims

1. A novel thermostable enzyme derived from Geobacillus sp. A8 that is responsible for the reduction of platinum (IV), in a source of platinum (IV), to platinum (0) wherein the enzyme comprises the amino acid sequence of SEQ ID No: 1.

2. The enzyme according to claim 1 , wherein the enzyme is characterized in that it has a molecular mass of 37.7 kDa, as identified by SDS-PAGE gel analysis.

3. The enzyme according to claim 1 or claim 2, wherein the enzyme is a NADPH dependent oxidoreductase. commonly known as the old yellow enzyme (OYE) or as the OYE oxidoreductase, as revealed by BLAST analysis.

4. The enzyme according to any one of claims 1 to 3, wherein the enzyme is a biocatalyst for the bioreduction of platinum (IV), in a source of platinum (IV), to platinum (0).

5. A novel thermostable enzyme derived from Geobacillus sp. A8 that is responsible for the reduction of platinum (IV), in a source of platinum (IV), to platinum (0) wherein the enzyme comprises the amino acid sequence of SEQ ID No: 2.

6. The enzyme according to claim 5. wherein the enzyme is characterized in that it has a molecular mass of 18.19 kDa, as identified by SDS-PAGE gel analysis.

7. The enzyme according to claim 5 or claim 6, wherein the enzyme is a hypothetical UPF0234 protein GK7042, also known as the YajQ protein, as revealed by BLAST analysis.

8. The enzyme according to any one of claims 5 to 7, wherein the enzyme is a biocatalyst for the bioreduction of platinum (IV), in a source of platinum (IV), to platinum (0).

9. The enzyme according to any one of the preceding claims, wherein Geobacillus sp. A8 is a thermophilic Geobacillus strain of bacteria derived from the Northam Platinum Mine (NPM) in South Africa and/or from NPM site material.

10. The enzyme according to any one of the preceding claims, wherein Geobacillus sp. A8 is a 1451 bp Gram positive thermophilic strain of bacteria having Geobacillus thermoparaffinivorans as its closest relative.

1 1. The enzyme according to any one of the preceding claims, wherein the source of Pt (IV) is selected from the group consisting of hydrogen chloroplatinic acid (H₂PtCI₆), potassium tetrachloroplatinate(ll) (K₂PtCI₄), platinum sulfide (PtS), platinum telluride (PtBiTe). platinum antimonide (PtSb), platinum arsenide (sperrylite, PtAs₂), platinum sulfide mineral cooperite ((PtNi)S), and ammonium hexachloroplatinate (ammonium chloroplatinate, (NH₄)₂(PtCI₆)).

12. Isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID No: 1 comprising a nucleotide sequence of SEQ ID No: 3.

13. A vector including the nucleic acid molecules according to claim 12.

14. A host cell including the vector according to claim 13.

15. A method for producing at least one OYE oxidoreductase of SEQ ID No: 1 , according to any one of claims 1 to 4, which is responsible for the bioreduction of Pt (IV,) in a source of Pt (IV), to Pt (0), the method including the steps of:

a) transfecting the nucleic acid molecules of SEQ ID No: 3 into a host cell;

b) cuituring the host cell so as to express the OYE oxidoreductase of SEQ ID No: 1 in the host cell; and

c) optionally, isolating and purifying the OYE oxidoreductase of SEQ ID No: 1.

16. A microorganism transformed with a Pt (IV) resistant gene obtained from the host cell according to claim 14.

17. Isolated nucleic acid molecules coding for the amino acid sequence of SEQ ID No: 2 comprising a nucleotide sequence of SEQ ID No: 4.

18. A vector including the nucleic acid molecules according to claim 17.

19. A host cell including the vector according to claim 18.

20. A method for producing at least YajQ protein of SEQ ID No: 2, according to any one of claims 5 to 8, which is responsible for the bioreduction of Pt (IV), in a source of Pt (IV), to Pt (0), the method including the steps of:

a) transfecting the nucleic acid molecules of SEQ ID No: 4 into a host cell;

b) culturing the host cell so as to express the YajQ protein of SEQ ID No: 2 in the host cell; and c) optionally, isolating and purifying the YajQ protein of SEQ ID No: 2.

21. A microorganism transformed with a Pt (IV) resistant gene obtained from the host cell according to claim 19.

22. Use of an enzyme of SEQ ID No: 1 , according to any one of claims 1 to 4, in the bioreduction of Pt (IV), in a source of Pt (IV), to Pt (0).

23. Use of an enzyme of SEQ ID No: 2, according to any one of claims 5 to 8, in the bioreduction of Pt (IV), in a source of Pt (IV), to Pt (0).

24. A microbial consortium of two or more of thermophilic Geobacillus strains of bacteria selected from the group consisting of Geobacillus sp. A3, Geobacillus sp. A4, Geobacillus sp, A5, Geobacillus sp. A7, Geobacillus sp. A8, Geobacillus sp. A10, Geobacillus sp. A1 1 , Geobacillus sp. A12, and Geobacillus sp. A13 as identified herein.

25. A process for the bioremediation, or at least partial bioremediation, of a site contaminated with a source Pt (IV), the process comprising the steps of introducing an electron donor to the contaminated site in order to stimulate the proliferation of one or more of thermophilic microorganisms selected from the group consisting of Geobacillus sp. A3, Geobacillus sp. A4, Geobacillus sp. A5, Geobacillus sp. A7, Geobacillus sp. A8, Geobacillus sp. A10, Geobacillus sp. A1 1 , Geobacillus sp. A12, and Geobacillus sp. A13 to reduce the Pt (IV), in the source of Pt (IV) present therein, to Pt (0).

26. The process according to claim 25, wherein the microorganism is Geobacillus sp. A8.

27. The process according to claim 25 or claim 26, wherein Geobacillus sp. A8 is derived from the Northam Platinum Mine (NPM) in South Africa and/or from NPM site material.

28. The process according to claim 25, wherein the Pt (IV) contaminated site is the NPM site.

29. A process for the bioremediation, or at least partial bioremediation, of environmental media contaminated with a source of Pt (IV), the process comprising the steps of removing environmental media from a Pt (IV) contaminated site and introducing an electron donor to such environmental media for a sufficient period of time so as to allow the one or more thermophilic microorganisms selected from the group consting of Geobacillus sp. A3, Geobacillus sp. A4, Geobacillus sp. A5, Geobacillus sp. A7. Geobacillus sp. A8, Geobacillus sp. A10, Geobacillus sp. A1 1 , Geobacillus sp. A1 2, and Geobacillus sp. A13 to reduce the Pt (IV), in the source of Pt (IV) present therein, to Pt (0).

30. The process according to claim 29, wherein the microorganism is Geobacillus sp. A8.

31. The process according to claim 29 or claim 30, wherein Geobacillus sp, A8 is derived from the Northam Platinum Mine (NPM) in South Africa and/or from NPM site material.

32. The process according to claim 29. wherein the Pt (IV) contaminated site material is NPM site material.

33. The process according to any one of claims 25 to 32, wherein the source of Pt (IV) is selected from the group consisting of hydrogen chloroplatinic acid (H₂PtCI₆), potassium tetrachloroplatinate(ll) (K₂PtCI₄), platinum sulfide (PtS), platinum telluride (PtBiTe), platinum antimonide (PtSb), platinum arsenide (sperrylite, PtAs₂), platinum sulfide mineral cooperite ((PtNi)S), and ammonium hexachloroplatinate (ammonium chloroplatinate, (NH₄)₂(PtCI₆)).

34. The process according to any one of claims 25 to 32, wherein the electron donor is selected from the group consisting of H₂, lactate, glucose, and pyruvate.

35. The process according to any one of claims 25 to 34, wherein the process is employed for the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) that can be practiced in situ, ex situ, or both.

36. Use of a microbial consortium according to claim 24, in the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) or of environmental media contaminated with a source of Pt (IV).

37. Use of a microbial consortium according to claim 24 or claim 36, in the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) or of environmental media contaminated with a source of Pt (IV), wherein said microbial consortium is indigenous to the site or to the environmental media, contaminated with a source of Pt (IV), that is to be remediated, or at least partially remediated.

38. Use of Geobacillus sp. A8 according to any one of the preceding claims, in the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) or of environmental media contaminated with a source of Pt (IV),

39. Use of Geobacillus sp. A8 according to any one of the preceding claims, in the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) or of environmental media contaminated with a source of Pt (IV), wherein Geobacillus sp. AS is indigenous to the site or to the environmental media, contaminated with a source of Pt (IV), that is to be remediated, or at least partially remediated.

40. Use of a microorganism according to claim 16 or claim 21 , in the bioremediation, or at least partial bioremediation, of a site contaminated with a source of Pt (IV) or of environmental media contaminated with a source of Pt (IV).

41. Use of an enzyme of SEQ ID No: 1 , according to any one of claims 1 to 4, in the microbial transformation of Pt (IV) to platinum nanoparticles.

42. Use of an enzyme of SEQ ID No: 2, according to any one of claims 5 to 8, in the microbial transformation of Pt (IV) to platinum nanoparticles.

43. A method for producing platinum nanoparticles, the method including the step of contacting Geobacillus sp. A8, accoding to any one of the preceding claims, with a source of Pt (IV) in the presence of an electron donor for a sufficient amount of time in order to allow for Pt (IV) bioreduction, microbial transformation of Pt (IV) and for platinum (0) deposition to be achieved, wherein the enzyme of SEQ ID No: 1 , according to any one of claims 1 to 4, and/or the enzyme of SEQ ID No: 2, according to any one of claims 5 to 8, is/are responsible for nanoparticles formation.

44. Platinum nanoparticles prepared by the method according to claim 43. The nanopariicles of claim 44, wherein the nanoparticles are characterized as being spherical and possessing a particle diameter ranging from 20 nm to 480 nm as analyzed by electron dispersive spectrometry, X-ray diffraction analysis and particle size and distribution analysis.