WO2013063305A2 - Directed cardiomyocyte differentiation of stem cells - Google Patents

Abstract

Disclosed is a fully chemically defined, small molecule-mediated, directed differentiation system that promotes differentiation of stem cells, including embryonic stem cells, induced pluripotent stem cells, and adult stem cells, such as human forms of these stem cell types, to ventricular cardiomyocytes in a highly efficient, reproducible and scalable fashion. Molecular characterization revealed the cardiomyocytes' progression through the sequential stages of cardiac fate specification. Phenotypic and electrophysiological analysis illustrated the generation of a highly pure population of cardiomyocytes (greater than 90%) exhibiting the expected physiological characteristics and response to cardioactive compounds. These data indicate that the directed differentiation system, through small molecule-mediated manipulation of developmental signaling pathways, generates a nearly pure population of functional ventricular cardiomyocytes from pluripotent stem cells. The disclosed differentiation system provides a platform to perform large-scale pharmacological screenings and to provide a valuable source of each of cardiac progenitor cells and cardiomyocytes for cell replacement therapies in cardiac repair.

Description

DIRECTED CARDIOMYOCYTE DIFFERENTIATION OF STEM CELLS

FIELD OF THE INVENTION

[0001] The disclosure relates to the field of controlled or directed differentiation of eukaryotic stem cells, such as human stem cells.

BACKGROUND

[0002] The adult heart has a limited intrinsic capacity to regenerate lost or damaged myocardium, with ventricular cardiac myocyte deficiency underlying most causes of heart failure. Cardiomyocytes derived from human embryonic stem cells (hESCs) are a potential source for cell replacement therapy, as well as an invaluable tool in the investigation of cardiac development, function, disease modeling and drug testing. Despite considerable progress, however, increasing the efficiency of hESCs to become ventricular cardiomyocytes has been challenging.

[0003] The myocardium, i.e., the striated muscle of the heart, is composed of multiple highly specialized myocardial lineages including those of the ventricular and atrial myocardium and the specialized conduction system.¹ An evolutionarily conserved gene regulatory network of transcription factors orchestrates the specification and maturation of each of these lineages during heart development, which is mediated by a plethora of extracellular instructive, spatiotemporally regulated, signaling molecules. Among these molecules are fibroblast growth factors (FGFs), Wnt proteins and members of the

transforming growth factor- β (TGF-β) superfamily, including bone morphogenic proteins (BMPs), Activin and Nodal. Similarly, exposing hESCs to a combination of signaling molecules that mimic developmental cues can induce cardiogenesis in vitro.

[0004] Current cardiomyocyte differentiation methods generate a low yield and/or a heterogeneous cell population consisting of atrial, pacemaker and ventricular

cardiomyocytes.^4"9 The generation of pure populations requires genetic manipulation with viral vectors that enable either drug selection or sorting^10"12, which do not satisfy the criteria for therapeutic applications. In other methods, the stem cells are exposed to a variety of growth factors, and either a P38 inhibitor (see U.S. Pat. Pub. No. 20080187494) or both blebbistatin and Rho-associated kinase (ROCK) (see U.S. Pat. Pub. No. 20110097799). Still other methods are cumbersome and relatively inefficient, such as the four-step method disclosed in U.S. Pat. No. 7,955,849. The existing methods produce insufficient yields, thus precluding their use in therapeutic applications. Additionally, batch-to-batch inconsistency of serum and other animal-based products as well as the high cost of multiple growth factors used in differentiation protocols are prohibitive to large-scale production.

[0005] For all of the foregoing reasons, needs continue to exist in the art for methods of generating differentiated cells, such as cardiomyocytes, from embryonic stem cells in quantities and at purity levels compatible with safe and cost-effective clinical use.

SUMMARY

[0006] The disclosure satisfies at least one of the aforementioned needs in the art by providing a fully chemically defined, two-step differentiation protocol using a combination of recombinant growth factors and small molecules that efficiently promotes the differentiation of embryonic stem cells, including human embryonic stem cells (hESCs), induced pluripotent stem cells (iPS) and adult stem cells, toward ventricular-like cardiomyocytes at the expense of other mesoderm-derived lineages, such as endothelial and smooth muscle. The successful incorporation of small molecules into the protocol provides a reproducible, cost-effective and scalable assay, generating a homogeneous population of ventricular-like cardiomyocytes.

[0007] The uses and methods according to the disclosure generate ample quantities of highly purified autologous, or heterologous, cardiomyocytes from stem cells, such as embryonic stem cells, iPS, and adult stem cells. The generation methods only involve two stages and can produce up to and exceeding 90% cardiomyocytes in culture without requiring genetic manipulation or cell sorting. These clinical-grade cardiomyocytes are useful in cell- replacement therapies or transplantations, and are thus useful in treating a variety of cardiovascular conditions, disorders and diseases. The cardiomyocytes generated according to the disclosure are also useful in screening compounds for toxicity, as any compound inhibiting differentiation of stem cells, e.g., embryonic stem cells, to cardiomyocytes in the methods of the disclosure, or any compound inhibiting viability of such cardiomyocytes, would be identified as a compound exhibiting toxic effects. Further, the disclosure provides methods of screening for cardiovascular therapeutics in that candidates that promote differentiation of stem cells, e.g., embryonic stem cells, to cardiomyocytes, or promote the viability of such cardiomyocytes, would be identified as cardiovascular therapeutics.

[0008] One aspect of the disclosure is a method of generating a cardiovascular progenitor cell comprising culturing a stem cell, such as an embryonic stem cell, an induced pluripotent stem cell or an adult stem cell, in feeder cell-free, serum-free growth medium comprising blebbistatin to form an embryoid body comprising a cardiovascular progenitor cell, wherein the growth medium lacks Rho-associated kinase and a P38 inhibitor. In some embodiments, the stem cell is an embryonic stem cell. The aspect extends to a method of generating a cardiovascular progenitor cell consisting essentially of culturing a stem cell, e.g., an embryonic stem cell, induced pluripotent stem cell, or adult stem cell, in feeder cell-free, serum-free growth medium comprising blebbistatin to form an embryoid body comprising a cardiovascular progenitor cell, wherein the growth medium lacks Rho-associated kinase and a P38 inhibitor. In some embodiments, the stem cell is Brach⁺, FLK1^". Also in some embodiments, the cardiovascular progenitor cell exhibits an increased expression of MESP1 compared to a stem cell such as an embryonic stem cell, induced pluripotent stem cell or adult stem cell. The disclosure expressly contemplates comparisons of cardiomyocyte expression levels and/or patterns to the type of stem cell from which the cardiomyocyte was generated. Additionally, the cardiovascular progenitor cell may further comprise upregulated expression of a protein selected from the group consisting of NKX2.5, GATA4, HAND1, TBX5, ISL1 and FLK-1 compared to the expression level in an embryonic stem cell. The cardiovascular progenitor cell may further comprise upregulated expression of NKX2.5, GATA4, HAND1, TBX5, ISL1 and FLK-1 compared to the expression levels in a stem cell, such as an embryonic stem cell, induced pluripotent stem cell or adult stem cell.

[0009] In still other embodiments, the method of generating a cardiovascular progenitor cell is performed wherein the culturing step is performed for about 4.5 days. In some embodiments, the yield of cardiovascular progenitor cells is selected from the group consisting of greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80% and greater than 90%. In one embodiment, the yield of cardiovascular progenitor cells is greater than 90%. In some embodiments, the stem cell, e.g., embryonic stem cell, induced pluripotent stem cell, or adult stem cell, is a human stem cell. In some embodiments, the growth medium is human embryonic stem cell-qualified Matrigel in TeSRl medium.

[0010] Another aspect of the disclosure is a method of generating a cardiomyocyte comprising: (a) culturing a stem cell such as an embryonic stem cell, an induced pluripotent stem cell or an adult stem cell, in feeder cell-free, serum-free growth medium comprising blebbistatin to form an embryoid body; and (b) differentiating a stem cell by incubating the stem cell in differentiation medium comprising a Wnt- 1 pathway inhibitor (any Wnt- 1 pathway inhibitor known in the art, including but not limited to, a member of the sFRP (secreted Frizzled-related protein) family, such as WIF (Wnt inhibitory factor- 1) and

Cerberus, which comprise a first class of Wnt-2 inhibitor; and a second class comprising certain members of the Dickkopf (Dkk) family, which bind to one subunit of the Wnt receptor complex), BMP-4, and Activin A, wherein at least one of the growth medium and the differentiation medium lacks Rho-associated kinase and a P38 inhibitor. For this and all other aspects of the disclosure, a Wnt- 1 pathway inhibitor is any Wnt-1 pathway inhibitor known in the art, including but not limited to, a member of the sFRP (secreted Frizzled- related protein) family, such as WIF (Wnt inhibitory factor- 1) and Cerberus, which comprise a first class of Wnt-2 inhibitor; and a second class comprising certain members of the Dickkopf (Dkk) family, which bind to one subunit of the Wnt receptor complex.

[0011] For this aspect, and for all other aspects of this disclosure, fragments, variants and fusions of the medium components are contemplated, on the condition that they provide the activity of a Wnt- 1 pathway inhibitor, BMP-4, and/or Activin A, as will be apparent from the context. This aspect extends to a method of generating a cardiomyocyte consisting essentially of (a) culturing a stem cell, such as an embryonic stem cell, an induced pluripotent stem cell or an adult stem cell, in feeder cell-free, serum-free growth medium comprising blebbistatin to form an embryoid body; and (b) differentiating a stem cell by incubating the stem cell in differentiation medium comprising a Wnt- 1 pathway inhibitor, BMP-4, and Activin A, wherein at least one of the growth medium and the differentiation medium lacks Rho-associated kinase and a P38 inhibitor. In some embodiments, the stem cell is an embryonic stem cell. In some embodiments, the Wnt pathway inhibitor is r R-1. In some embodiments, the differentiation medium comprises about 10 ng/ml BMP4. Embodiments are also contemplated wherein the differentiation medium comprises less than 30 ng/ml Activin A. In some embodiments, the level of ISL1 is lower in the cardiomyocyte than in a stem cell such as an embryonic stem cell.

[0012] Some embodiments of the method of generating a cardiomyocyte contemplated that the expression level of a protein selected from the group consisting of cardiac troponin-T and ventricular myosin light chain 2 is higher in the cardiomyocyte than in a stem cell, e.g. , an embryonic stem cell. In some embodiments, the cardiomyocyte exhibits a MYH11⁺, CD31^", CD34^", ADRB 1⁺, ADRB2⁺ phenotype. In some embodiments, the cardiomyocyte exhibits a TNNT2⁺, ACTN2⁺, MLC2v⁺ phenotype. Embodiments are also contemplated wherein the cardiomyocyte is a ventricular cardiomyocyte. Further, this aspect of the disclosure includes embodiments wherein the stem cell is a human stem cell. In some embodiments, a clinical grade preparation of cardiomyocytes is generated in the absence of genetic manipulation and cell sorting. In some embodiments, the cardiomyocytes are generated from autologous stem cells, e.g. , embryonic stem cells, and the cardiomyocytes are greater than 90% pure. In some embodiments, the differentiation medium is StemPro34. [0013] Yet another aspect of the disclosure is a method of transplanting autologous cardiomyocytes comprising administering to a subject a therapeutically effective amount of cardiomyocytes generated according to a method of generating a cardiomyocyte described above. The aspect extends to a method of transplanting autologous cardiomyocytes consisting essentially of administering to a subject a therapeutically effective amount of cardiomyocytes generated according to a method of generating a cardiomyocyte described above. In some embodiments, the subject is a human.

[0014] Still another aspect of the disclosure is a method of screening for compound toxicity comprising: (a) incubating cardiomyocytes generated according to a method of generating a cardiomyocyte (described above) in the presence or absence of the compound; and (b) determining the toxicity of the compound by measuring the viability of the cardiomyocytes exposed to the compound compared to cardiomyocytes not exposed to the compound. Another screening method according to this aspect of the disclosure is a method of screening for compound toxicity consisting essentially of: (a) incubating cardiomyocytes generated according to a method of generating a cardiomyocyte (described above) in the presence or absence of the compound; and (b) determining the toxicity of the compound by measuring the viability of the cardiomyocytes exposed to the compound compared to cardiomyocytes not exposed to the compound.

[0015] Another aspect of the disclosure is a method of identifying a cardiovascular therapeutic comprising: (a) incubating a stem cell, e.g., an embryonic stem cell, an induced pluripotent stem cell or an adult stem cell, in the presence or absence of a compound in differentiation medium comprising a Wnt-1 pathway inhibitor, BMP-4, and Activin A, wherein the differentiation medium lacks Rho-associated kinase and a P38 inhibitor; and (b) identifying a compound as a cardiovascular therapeutic if the yield of functional

cardiomyocytes is greater in the presence compared to the absence of the compound. In some embodiments, the stem cell is an embryonic stem cell. Another method according to this aspect of the disclosure is a method of identifying a cardiovascular therapeutic consisting essentially of: (a) incubating a stem cell, e.g., an embryonic stem cell, an induced pluripotent stem cell or an adult stem cell, in the presence or absence of a compound in differentiation medium comprising a Wnt-1 pathway inhibitor, BMP-4, and Activin A, wherein the differentiation medium lacks Rho-associated kinase and a P38 inhibitor; and (b) identifying a compound as a cardiovascular therapeutic if the yield of functional cardiomyocytes is greater in the presence compared to the absence of the compound. In some embodiments, the stem cell is an embryonic stem cell. [0016] Particular aspects and embodiments of the disclosure are described in the following enumerated paragraphs.

[0017] 1. A method of generating a cardiovascular progenitor cell comprising culturing a stem cell in feeder cell-free, serum-free growth medium comprising blebbistatin to form an embryoid body comprising a cardiovascular progenitor cell, wherein the growth medium lacks Rho-associated kinase and a P38 inhibitor.

[0018] 2. The method according to paragraph 1 wherein the stem cell is selected from the group consisting of an embryonic stem cell, an induced pluripotent stem cell and an adult stem cell.

[0019] 3. The method according to paragraph 2 wherein the stem cell is an embryonic stem cell.

[0020] 4. The method according to paragraph 3 wherein the embryonic stem cell is Brach⁺, FLK1^".

[0021] 5. The method according to paragraph 3 wherein the cardiovascular progenitor cell exhibits an increased expression of MESP1 compared to an embryonic stem cell.

[0022] 6. The method according to paragraph 5 wherein the cardiovascular progenitor cell further comprises upregulated expression of a protein selected from the group consisting of NKX2.5, GATA4, HAND1, TBX5, ISL1 and FLK-1 compared to the expression level in an embryonic stem cell.

[0023] 7. The method according to paragraph 6 wherein the cardiovascular progenitor cell further comprises upregulated expression of NKX2.5, GATA4, HAND1, TBX5, ISL1 and FLK-1 compared to the expression levels in an embryonic stem cell.

[0024] 8. The method according to paragraph 3 wherein the culturing step is performed for about 4.5 days.

[0025] 9. The method according to paragraph 3 wherein the yield of cardiovascular progenitor cells is selected from the group consisting of greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80% and greater than 90%.

[0026] 10. The method according to paragraph 3 wherein the embryonic stem cell is a human embryonic stem cell. [0027] 11. The method according to paragraph 3 wherein the growth medium is human embryonic stem cell-qualified Matrigel in TeSRl medium.

[0028] 12. A method of generating a cardiomyocyte comprising:

(a) culturing a stem cell in feeder cell-free, serum-free growth medium comprising blebbistatin to form an embryoid body; and

(b) differentiating an embryonic stem cell by incubating the stem cell in differentiation medium comprising a Wnt-1 pathway inhibitor, BMP-4, and Activin A, wherein at least one of the growth medium and the differentiation medium lacks Rho-associated kinase and a P38 inhibitor.

[0029] 13. The method according to paragraph 12 wherein the stem cell is selected from the group consisting of an embryonic stem cell, a pluripotent stem cell and an adult stem cell.

[0030] 14. The method according to paragraph 13 wherein the stem cell is an embryonic stem cell.

[0031] 15. The method according to paragraph 14 wherein the Wnt pathway inhibitor is IWR-1.

[0032] 16. The method according to paragraph 14 wherein the differentiation medium comprises about 10 ng/ml BMP4.

[0033] 17. The method according to paragraph 14 wherein the differentiation medium comprises less than 30 ng/ml Activin A.

[0034] 18. The method according to paragraph 14 wherein the level of ISL1 is lower in the cardiomyocyte than in an embryonic stem cell.

[0035] 19. The method according to paragraph 14 wherein the expression level of a protein selected from the group consisting of cardiac troponin-T and ventricular myosin light chain 2 is higher in the cardiomyocyte than in an embryonic stem cell.

[0036] 20. The method according to paragraph 14 wherein the cardiomyocyte exhibits a MYH11⁺, CD31^", CD34^", ADRB1⁺, ADRB2⁺ phenotype.

[0037] 21. The method according to paragraph 14 wherein the cardiomyocyte exhibits a TNNT2⁺, ACTN2⁺, MLC2v⁺ phenotype.

[0038] 22. The method according to paragraph 14 wherein the cardiomyocyte is a ventricular cardiomyocyte. [0039] 23. The method according to paragraph 14 wherein the embryonic stem cell is a human embryonic stem cell.

[0040] 24. The method according to paragraph 14 wherein a clinical grade preparation of cardiomyocytes is generated in the absence of genetic manipulation and cell sorting.

[0041] 25. The method according to paragraph 14 wherein the cardiomyocytes are generated from autologous embryonic stem cells and wherein the cardiomyocytes are greater than 90% pure.

[0042] 26. The method according to paragraph 14 wherein the differentiation medium is StemPro34.

[0043] 27. A method of transplanting autologous cardiomyocytes comprising

administering to a subject a therapeutically effective amount of cardiomyocytes generated according to paragraph 14.

[0044] 28. The method according to paragraph 27 wherein the subject is a human.

[0045] 29. A method of screening for compound toxicity comprising:

[0046] (a) incubating cardiomyocytes generated according to paragraph 14 in the presence or absence of the compound; and

[0047] (b) determining the toxicity of the compound by measuring the viability of the cardiomyocytes exposed to the compound compared to cardiomyocytes not exposed to the compound.

[0048] 30. A method of identifying a cardiovascular therapeutic comprising:

(a) incubating a stem cell in the presence or absence of a compound in differentiation medium comprising a Wnt-1 pathway inhibitor, BMP-4, and Activin A, wherein the differentiation medium lacks Rho-associated kinase and a P38 inhibitor; and

(b) identifying a compound as a cardiovascular therapeutic if the yield of functional cardiomyocytes is greater in the presence compared to the absence of the compound.

[0049] 31. The method according to paragraph 30 wherein the stem cell is selected from the group consisting of an embryonic stem cell, an induced pluripotent stem cell and an adult stem cell. [0050] 32. The method according to paragraph 31 wherein the stem cell is an embryonic stem cell.

[0051] Other features and advantages of the disclosure will be better understood by reference to the following detailed description, including the drawing and the examples.

BRIEF DESCRIPTION OF THE DRAWING

[0052] Figure 1. Molecular analysis during the course of the differentiation protocol. Gene expression was analyzed on cardiogenic embryoid bodies at the indicated time points for genes associated with pluripotency (a), mesoderm (b), primitive streak-like (c), cardiac mesodermal (d), cardiac progenitors (e-j) and terminal differentiated cardiomyocytes (k-1) Red line; IWR-1 mediated, black line; DMSO control. Arrow indicates the initiation of Stage 2 of the differentiation protocol. Gene expression was normalized to B2M endogenous control. Values represent means + s.e.m. n=6 for each time point.

[0053] Figure 2. Flow cytometry analysis of cardiomyocyte- specific markers after 21 days of differentiation. Cells were dissociated at day 21 of differentiation for immuno staining. The cells were immunostained with antibodies against cardiac specific markers CTNN2 (b) ACTN2 (c) and MLC2v (e); the smooth muscle marker MYH11 (SMMHC) (g); the endothelial cell surface markers CD31 and CD34 (i) or the IgG isotype control for CTNN2, ACTN2 and (a); the IgG isotype control for MLC2v (d); the IgG isotype control for MYHl 1 (f) and IgG-FITC and IgG-APC isotype controls for CD31 and CD34, respectively (h).

Alexa Fluor 647 indicates the secondary antibody fluorescence.

[0054] Figure 3. Indirect immunofluorescence of TNNT2 and MLC2v. At the end of the differentiation protocol (day 21) ciVCMs were immunostained the cardiac- specific structural protein TNNT2 (b) and ventricular- specific MLC2v (d) protein were indirectly labeled with secondary Alexa fluor 594 antibodies (red channel) and nuclear DNA labeled with DAPI (a, d)(blue channel). Merged images are also shown (c, f). Expression of both TNNT2 and MLC2v were highly expressed and showed well-organized myofilament structures. Insets show an enlargement of the indicated region. Scale bar: 20μιη.

[0055] Figure 4. Characterization of electrophysiological and Ca²⁺ handling properties of ciVCMs. Representative AP tracings of spontaneous (a) and electrically stimulated (b) ciVCMs. Representative Ca²⁺ transient tracings of electrically- (c) and caffeine-induced (d) cells demonstrating caffeine- sensitive Ca²⁺ stores. Comparison of averaged amplitude (e), Vmax upstroke (f) and decay between electrically (g) (n=28) and caffeine (n=13) induced Ca²⁺ transients. After staining with voltage- sensitive dye di-4-ANNEPS, transmembrane action potential propagation of ciVCM monolayer was recorded (i) and illustrated as pseudocolor wavefront (h). Point stimulation as depicted by white circle is applied to excite monolayers continuously at 1.5Hz. An isochrones map of complete action potential propagation with 20-ms intervals is also shown (j). Color bar in represents the entire propagation duration of a single wavefront. Conduction velocity was calculated based on the time delay of selected two points (black and red) on the AP propagation path (n=5).

Histogram of action potential durations (APD90) calculated from 755 sites of 5 separate monolayers (k). Values represent means + s.e.m. * P < 0.05.

[0056] Figure 5. Chronotropic response of ciVCMs to cardioactive compounds.

Representative microelectrode array extracellular field potential recordings from ciVCM cardiac tissue recordings at baseline (a), after administration of sotalol (b) or isoproterenol (c). Negative chronotropic dose response of ciVCMs to sotalol (n=12) (d) and positive chronotropic response to isoproterenol (n=12) (e) compared baseline. Values represent means + s.e.m. * P < 0.001.

[0057] Figure 6. Schematic of directed differentiation in 2 stages. In stage one (days 1- 4.5) hESCs are directed toward a cardiac progenitor population; in stage 2 (days 4.5- 8), differentiation toward terminally differentiated ventricular cardiomyocytes.

[0058] Figure 7. Molecular analysis during the course of the differentiation. Gene expression was analyzed on EBs at the indicated timepoints for genes associated with pluripotency (a), mesoderm (b), primitive streak-like (c), cardiac mesoderm (d), cardiac progenitors (e-j) and terminally differentiated cardiomyocytes (k-m) Red line; r R-1 mediated, black line; DMSO control. Arrow indicates the initiation of Stage 2 of the differentiation. Gene expression was normalized to the housekeeping gene B2M. (n) Spontaneously contracting 'cardiogenic' EBs during the course of differentiation. At day 20, the percentage of beating EBs after treatment with rWR-1 (red line) was >90 , while the percentage of beating EBs in the control (black line) differentiation was <10 of the total population. Values represent means + s.e of a minimum of four independent experiments. ^# P<0.05 versus DO; *P<0.05 WR-1 versus DMSO.

[0059] Figure 8. Quantification of the cardiomyocyte differentiation efficiency, (a-c) Flow cytometry analysis of the differentiation efficiency of at 21 days post differentiation. Representative contour plots of cells immunolabeled with antibodies against the

cardiomyocyte marker genes TNNT2 (b), ACTN2 (c) or the IgG isotype control antibody (a). Values represent means + s.e of six independent differentiation experiments. Alexa Fluor- 647 indicates the secondary antibody fluorescence. SSC-H: side scatter, (d-e) Structural organization of cardiomyocytes. Representative immunofluorescence staining images of the cardiomyocyte-specific marker TNNT2 (Red); DNA was counterstained with DAPI (blue) (d). The high magnification of the indicated region shows that the cardiomyocytes have well organized myofilament structures (e). Scale bar = 20 μιη. (f-g) Comparison of the cardiomyocyte differentiation efficiency in the current protocol (IWR-1) and the protocol described by Yang et al.⁶ (DKK-1). Flow cytometric quantification of the percentage of TNNT2-expessing cells treated with IWR-1, DKK-1 or in the absence of either inhibitor (DMSO) (f). Quantitative RT-PCR expression analysis of the cardiomyocyte marker genes: NKX2.5, TNNT2, MLC2v and IRX-4 (g). Gene expression was normalized to B2M endogenous control. Values represent means + s.e of a minimum of four independent experiments. ***p< 0.001.

[0060] Figure 9. Electrophysiological Characterization, (a-b) The action potential (AP) properties of single cells were analyzed using the patch-clamp method. Representative AP waveforms of spontaneous (a) and electrically stimulated cells (b) indicating a ventricular- like phenotype. (c-d) Electrophysiological properties at the multicellular level. Single cell preparations were plated at high density to form a monolayer and stained with the voltage- sensitive dye di-4-ANNEPS for high-resolution optical mapping. Representative AP tracings (d), which were mapped from two sites distal to the unipolar pacing electrode (indicated by the arrow) that correlates with the two designated points (black and red) in the representative pseudocolor repolarization map recorded from a monolayer (c). The conduction velocity was calculated based on the distance in between the two points and the conduction time delay, yielding an overall speed of 2.15 + 0.35 cm/s (mean + s.e of five independent experiments). Representative isochrones map with 18 ms intervals shows a circular spreading pattern of the optically mapped transmembrane potentials (e). Histogram is showing the distribution of the AP duration at 90% repolarization (APD90) values that were calculated from 755 spatially distinct locations from five monolayers (f).

[0061] Figure 10. Electrophysiological properties of the cardiomyocytes generated with two different protocols. Directed cardiomyocyte differentiation experiments were performed with the current protocol (IWR-1) and the method described by Yang et al.⁶ (DKK-1). (a-b) Doughnut charts showing the proportion of cardiomyocytes that were classified as atrial-, ventricular- and nodal-like subtypes in the IWR-1 (n=26) (a) and the DKK-1 (n=31) (b) protocol. All cells in the IWR-1 protocol were classified as ventricular- like, while the DKK- 1 protocol generated a heterogeneous population consisted of atrial- (48%), ventricular- (49%) and nodal-like cardiomyocytes (3%). (c-f) Frequency distributions of the individual AP values obtained from single cells in the indicated protocols. Frequency distribution of the APD90 (c, d) and the APA (e-f) parameters. The distributions were significantly different in the IWPv-1 protocol when compared to the DKK-1 protocol (APD90: P=0.001 and APA: P=0.04; Kolmogorov-Smirnov test). APD90: action potential duration at 90% depolarization APA: action potential amplitude.

[0062] Figure 11. Functional characterization of the ciVCMs. (a-b) Intracellular calcium ([Ca²⁺]i) transient recordings in ciVCMs. Single cell preparations were loaded with a fluorescent Ca ²⁺ sensitive dye (fluo-4) and Ca 2+ transients were recorded in a spinning disk laser confocal microscope utilizing the line-scan mode. Representative [Ca²⁺]i transient line- scan tracing recorded from of an electrically-induced (0.2Hz) ciVCM (a) and during the response to a rapid administration of lOmM of caffeine (b). (c-e) Effect of caffeine application (10 mM) on [Ca²⁺]i transients parameters. Analyses of [Ca²⁺]i transient amplitude (c), upstroke velocity (d) and upstroke decay velocity (e). Values represent means + s.e of n=28 (baseline) and n=13 (caffeine). *P < 0.05 versus the baseline values. F/Fo: fluorescence (F) normalized to baseline fluorescence (Fo); s: seconds; V _max : maximum velocity, (f-j) Chronotropic responses of ciVCMs to cardioactive compounds.

Representative extracellular field potential recordings at baseline (f), after administration of 1 μΜ of sotalol (g) and 5 μΜ of isoproterenol (h). Dose-response histograms showing the percentage of change in spontaneously beating rate upon administration of escalating concentrations (0.01, 0.1 and 1 μΜ; n = 12) of sotalol (i) and of isoproterenol (0.05, 0.5 and 5 μΜ; n = 12) (j) relative to baseline conditions (100%). Values represent means + s.e. ^# P < 0.01 versus the baseline values.

[0063] Figure 12. Schematic representation of the directed differentiation protocol in two stages. In stage one (days 0-4.5) the hESCs grown in feeder-independent conditions were differentiated towards a multipotent cardiovascular progenitor population by the

combinatorial activation of the BMP and Nodal/Activin signaling pathways. In Stage 2 (days 4.5-8), the uncommitted progenitors were terminally differentiated towards ventricular-like cardiomyocytes by the inhibition of the WNT signaling pathway with the small molecule WR-1.

[0064] Figure 13. Flow cytometric analysis of non-cardiomyocyte markers after 21 days of differentiation. Representative FACS contour plots. The cells were immunostained with antibodies against the smooth muscle cell marker MYH11 ( b), the endothelial cell surface markers CD31 and CD34 (d), the IgG isotype control for MYH11 (a) and IgG-FITC and IgG- APC isotype controls for CD31 and CD34, respectively (c). Alexa Fluor 647 indicates the secondary antibody fluorescence. SSC-H: side scatter.

[0065] Figure 14. Differentiation efficiency of H7 and HI hESC lines. After 21 days post-differentiation the cells were analyzed for the expression of the cardiomyocyte marker genes ACTN2 and TNNT2 by flow cytometry. Representative FACS contour plots of a) H7 and b) HI differentiated cultures. Values represent means + s.e of three independent experiments. Alexa Fluor-647 indicates the secondary antibody fluorescence. SSC-H: side scatter.

[0066] Figure 15. Differentiation efficiency of the SKiPS31.3 iPSC line and structural organization of cardiomyocytes. a) After 21 days the differentiated cells were analyzed by FACS. Representative contour plots for the expression of the cardiomyocyte marker genes a- sarcomeric actinin (ACTN2) and cardiac troponin-T (TNNT2). Values represent means + s.e. of three independent experiments. Alexa Fluor-647 indicates the secondary antibody fluorescence. SSC-H: side scatter. ( b) Representative immunofluorescence images of iPS- derived cardiomyocytes stained for TNNT2 (Red); nuclear DNA was counterstained with DAPI (blue); merged image also shown. Scale bar = 20 μιη.

[0067] Figure 16. Gene expression of major cardiac ion channel genes in ciVCMs.

Quantitative RT-PCR of gene expression analysis of Kv 11.1 (also known as hERG) and CaVl.2 (also known as CACNA1C) and Navl.5 (also known as SCN5). Gene levels are expressed as relative to B2M. Values represent means + s.e of three independent

experiments.

[0068] Figure 17. Representative ventricular- like type action potential (AP) from a spontaneously firing H7-derived cardiomyocyte. APs were recorded using the whole-cell configuration of the patch-clamp technique. The current-clamp mode with 100-lOOOpA pulse of 5 ms delivered to the cells was employed with cell capacitance and series resistance (>70 ) on-line compensated. APs from n=20 cells were recorded and classified according to the summarized in Supplementary Table 2. All cells were classified as ventricular-like type.

[0069] Figure 18. Genetic labeling and action potential (AP) analyses of ciVCMs. Single cells were enzymatically isolated and plated at low density on matrigel- coated coverslips. Twenty-four hours later they were transduced with a recombinant lentiviral vector in which short fragment (250 base pairs) of the human myosin light chain (MLC)-2v promoter drove the expression of tdTomato (LV-MLC2v-tdTomato; MOI=5). Subsequent

electrophysiological assays were performed at 7-15 days post- transduction at physiological temperature, a) Representative epifluorescent image of tdTomato-expressing ciVCM cells and b) Representative AP waveform of a tdTomato-expressing ciVCM cell. MOI:

multiplicity of infection.

[0070] Figure 19. Representative action potential (AP) waveforms of HES2-derived cardiomyocytes generated using the protocol described by Yang et al. APs were recorded using the whole-cell configuration of the patch-clamp technique. The current-clamp mode with 100- lOOOpA pulse of 5ms delivered to the cells was employed with cell capacitance and series resistance (> 70%) on-line compensated. APs were classified according to the criteria summarized in Supplementary Table 2. Electrophysiological characterization of single cells showed the presence of a heterogeneous population consisting of atrial-, ventricular- and nodal-like phenotypes.

DETAILED DESCRIPTION

[0071] The generation of human ventricular cardiomyocytes from stem cells, such as embryonic stem cells (e.g. , human embryonic stem cells or hESCs), induced pluripotent stem cells or adult stem cells, in particular human forms of one of these stem cell types, will fulfill a long-standing demand for such cells in therapeutic applications. The inability to produce large, pure populations with existing protocols remains a major limitation, however. The disclosure provides combinations of small molecules and growth factors in a chemically defined, direct differentiation protocol that differentiates stem cells such as embryonic stem cells (e.g. , hESCs), induced pluripotent stem cells and adult stem cells toward ventricular cardiomyocytes in an efficient, reproducible and scalable fashion. Phenotypic and molecular analyses demonstrated the generation of a nearly pure population of ventricular

cardiomyocytes (>90%). The chemically induced ventricular cardiomyocytes (termed ciVCMs) exhibited the appropriate phenotypic, electrophysiological, and calcium handling characteristics; the ciVCMs also responded appropriately to chronotropic compounds.

Collectively, the data indicate that the disclosed methods recapitulate the human cardiac developmental program and generate a high yield of functional ventricular cardiomyocytes. These methods also provide an efficient experimental platform that is expected to facilitate large-scale pharmacological screening and provide a source of ventricular cardiomyocytes for cell replacement therapies.

[0072] The chemical biology approach used herein takes advantage of readily available and inexpensive synthetic bioactive molecules that regulate stem cell fate. Described herein is the development of a fully chemically defined, small molecule-mediated directed method that drives differentiation of stem cells, such as human embryonic stem cells, toward ventricular cardiomyocytes. This method is reproducible, cost efficient, scalable and generates a large number of nearly pure ventricular cardiomyocytes that reach clinical-grade purity without genetic manipulation or cell sorting. The generation of a renewable source of readily available ventricular cardiomyocytes provides a platform for regenerative cell-based therapies as well as drug discovery and toxicity screening.

[0073] A better understanding of the signaling pathways during development has led to the development of assays to control cardiomyocyte specification in vitro. Current protocols are relatively inefficient with low percentage of a heterogeneous population of cardiomyocytes, however, indicating a need for further refinement. Described herein is a fully chemically defined, two-step differentiation method using a combination of protein growth factors and small molecules that effectively promotes the differentiation of stem cells such as hESCs toward cardiomyocytes at the expense of other mesoderm-derived lineages, including endothelial and smooth muscle cell lineages (Fig. 6). The successful incorporation of well- characterized small molecules into the method provides a reproducible, cost efficient and scalable methodology, which generates a large number of nearly pure ventricular

cardiomyocytes.

[0074] As detailed in the following examples, cardiac differentiation was initiated by formation of embryoid bodies (EBs) in suspension culture from hESCs as exemplary stem cells, maintained in feeder- free, serum-free culture. The cardiogenic EBs were formed in the presence of the small molecule blebbistatin, a myosin inhibitor known to efficiently suppress the dissociation-induced apoptosis of hESCs.¹⁹' ²⁰ As a result of the blebbistatin treatment, apoptosis was inhibited and EB formation efficiency was significantly increased. In the first phase of the differentiation process (Stage 1; days 2-4.5), the cells were differentiated into primitive streak-mesendoderm and subsequently to cardiac mesoderm by the combinatorial activation of the BMP and Nodal signaling pathways. In the second phase (Stage 2; days 4.5- 8) the inhibition of the Wnt/p-catenin pathway by the small molecule IWR-1²⁹ enhanced the differentiation of the cardiac progenitors to the ventricular cardiomyocyte lineage.

[0075] The two-step method is highly efficient with about 90%, and typically greater than 90%, of the resulting population expressing the cardiomyocyte specific markers TNNT2, ACTN2 and MLC2v (Fig. 2). The enhanced differentiation efficiency of the protocol disclosed herein was confirmed in two additional hESC lines (H7 and HI), as shown in Fig. 14 and described in the following examples. Additional confirmation was obtained in an experiment demonstrating the effect of the protocol on a patient-specific induced pluripotent stem cell (iPSC) line (Fig. 15), as disclosed in the examples. The cardiomyocytes produced by this method display characteristics of ventricular cardiac lineage cells, including the appropriate electrophysiological phenotype (Figs. 3, 4, and 16, as well as Tables 1 and 6) and gene expression profile (Fig. 1), as well as organized sarcomeric structures (Fig. 3). In addition, ventricular cardiomyocytes displayed the expected electrophysiological and functional Ca²⁺ -handling characteristics (Figs. 4 and l la-e). The differentiated cells also exhibited physiological responses to cardioactive compounds (Figs. 5 and l lf-j).

[0076] The use of small molecules in the generation of specialized cell populations under defined conditions in vitro also provides a chemical genetics-based interrogation of signaling pathway functions during cardiogenesis that bypasses the limitations of genetic approaches. The timely inhibition of the Wnt/p-catenin pathway by the small molecule IWR- 1 reduced the heterogeneity of the hESC-derived cardiomyocytes, generating a homogeneous ventricular-like cardiomyocyte population. The delineation of the Wnt/p-catenin signaling pathway during cardiogenesis with small molecules, such as IWR-1, provides important insights into the molecular mechanisms that regulate cardiomyocyte subtype specification during development in the heart, such as in the human heart.

[0077] Apparent from the foregoing discussion is that the development of a fully chemically defined directed differentiation protocol also provides a powerful tool in understanding cardiac development. The generation and characterization of specific, pure cell populations during stages of the differentiation process and the subsequent exposure to small molecules has helped to elucidate vital aspects of the cellular pathways affected in cardiac development. 13 For example, the Wnt/p-catenin pathway is key in cardiac differentiation and development. 36-^"38 The differentiation system disclosed herein also provides an experimental platform for large-scale pharmacological screening, as well as providing a valuable source of cardiomyocytes for cell replacement therapies.

[0078] The differentiation system disclosed herein provides a reproducible and efficient experimental platform that advances our understanding and control of basic developmental processes, leading to uses and methods for preventing or treating a variety of cardiovascular diseases, disorders or conditions in humans and other animals, as well as facilitating large- scale pharmacological screening and providing a valuable and renewable source of ventricular cardiomyocytes for cell replacement therapies.

[0079] The following examples illustrate embodiments of the disclosure. Example 1 discloses materials and methods used in the studies disclosed herein, along with some data providing fundamental characterization of the differentiation protocol and system. Example 2 provides an exemplary implementation of the differentiation protocol to direct

differentiation of hESCs into ventricular cardiomyocytes. Example 3 describes the phenotypic characteristics of the differentiated ventricular cardiomyocytes. Example 4 provides the electrophysiological characterization of the differentiated ciVCMs, and Example 5 provides a functional characterization of the differentiated ciVCMs. Finally, Example 6 shows the chronotropic responses of the differentiated ciVCMs to pharmacological compounds.

Example 1

Materials And Methods

Human Embryonic Stem Cell (hESC) Culture

[0080] All experiments used cells, such as the human embryonic stem cell lines, HES-2 (ES02), H7 (WA07) and HI (WA01), that were derived from the HES2 hESC line (Wicell, Madison, WI) propagated in feeder-free culture as previously described. The iPSC line (SKiPS-33.1) was derived by the reprogramming of human dermal fibroblast obtained from a skin biopsy of a 45-year-old volunteer with informed consent (Staten Island Hospital) as described.⁴¹ Briefly, the hESCs were maintained in an undifferentiated state on hESC- qualified Matrigel (BD Biosciences, San Jose, CA) in mTeSR™l medium (Stem Cell Technologies, Vancouver, BC) at 37°C in 5% C0₂, 90% N₂ and expanded following enzymatic treatment with dispase (Stem Cell Technologies, Vancouver, BC).

Cardiac Differentiation

[0081] For directed cardiac cell differentiation, undifferentiated hESCs were dissociated with dispase solution (1 mg ml -1 ) for 8 minutes at 37°C. Small clusters (50-100 cells) were cultured in suspension on ultra-low-attachment cell culture dishes (Corning, Lowell, MA) with differentiation media (StemPro34, 50 μg ml -1 ascorbic acid and 2mM GlutaMAX-I; Invitrogen, Carlsbad, CA) supplemented with recombinant cytokines and small molecules for the indicated time period and at the following concentrations: day 1, BMP4 (lng ml^"1), Blebbistatin (5μΜ); days 2-4.5, human recombinant BMP4 (10 ng ml^"1) and human recombinant Activin-A (5 ng ml^"1); days 4.5-8, r R-1 (ΙμΜ). The protocol is summarized in Table 1.

Table 1. Directed Differentiation Protocol Summary

/mL)

1 0 50 5 1 - -

1 1 50 - 10 5 -

1 2 50 - 10 5 -

1 3 50 - 10 5 -

2 4 50 - - - 1

2 5 50 - - - 1

2 6 50 - - - 1

2 7 50 - - - 1

2 8 50 - - - -

[0082] More generally in terms of induced differentiation, cells were induced to differentiate by culturing in mTESRl medium supplemented with BMP4 (10 ng ml^"1) and Blebbistatin (5 μΜ) in suspension on ultra-low attachment dishes (Corning, Lowell, MA) for one day (day 0-1). The next day the medium was switched to differentiation medium (StemPro34, 50 μg ml^"1 ascorbic acid, 2mM GlutaMAX-I) supplemented with BMP4 (10 ng ml^"1) and Activin-A (25 ng ml^"1) and maintained for 48 hours (days 1-3). Then the medium was switched to differentiation medium without any supplements for another 36 hours (days 3-4.5). Finally, the cells were differentiated in differentiation medium supplemented with r R-1 (2.5 μΜ) for 96 hours (day 4.5-8.5). The differentiated cardiomyocytes were maintained in differentiation media without supplements for up to 4 weeks (protocol is summarized in Table 4). All differentiation cultures were maintained in 5% C0₂ air environment. The human recombinant cytokines BMP4 and Activin-A were purchased from R&D systems. The small molecules rWR-1, blebbistatin and L-ascorbic acid were purchased from Sigma.

Flow Cytometry and Immunocvtochemistry

[0083] Cardiogenic EBs were dissociated into single cells by trypsinization (0.04% Trypsin / 0.03% EDTA Solution; Promocell) for 15 minutes at 37°C. The cells were fixed in 3.6% PFA (paraformaldehyde) for 15 minutes at room temperature and rinsed twice in phosphate-buffered saline (PBS) by centrifugation (300g, 5 minutes). The cell pellets were resuspended in 100 μΐ of blocking/permeabilization buffer (PBS / 2% BSA / 2% FBS / 0.1 % NP40) for 45 minutes at room temperature and then incubated (1 hour or overnight) with the primary antibodies or isotype controls. The cells where washed in two changes of blocking/permeabilization buffer or PBS and incubated with the secondary antibody rabbit anti-mouse Alexa-647-conjugate for 45 minutes at room temperature. Finally, the cells were washed twice with, and resuspended in, 400 μΐ of PBS prior to flow cytometry analysis. The Primary antibodies used in the study were: anti-cardiac troponin T (CTNN2; clone 13-11, Thermo Fisher Scientific, Waltham, MA), anti-sarcomeric alpha-actinin (Clone EA-53, Sigma- Aldrich, St Louis, MO), anti-CD31 (Invitrogen, Carlsbad, CA), anti-CD34 (Miltenyi Biotec, Auburn, CA), Smooth muscle heavy chain (clone SMMS-1; DAKO, Carpinteria, CA) and cardiac ventricular myosin light chain 2 (MLC2v; clone F109.3E1, Enzo Life Sciences, Farmingdale, NY). FACS analysis was carried out using a BD LSR analyzer (BD

Biosciences) at the Mount Sinai Shared FACS Facility and data were analyzed with the FlowJo software (Tree Star, Ashland, OR).

[0084] For immunofluorescence, dissociated cardiomyocytes were cultured on matrigel- coated coverslips for 4-5 days and then were fixed with 3.6% paraformaldehyde. The fixed cells were permeabilized in blocking/permeabilization buffer for 45 min and then stained with mouse primary antibody anti-cardiac troponin T overnight at 4°C, washed three times with PBS and then stained with Alexa Fluor-595 anti-mouse IgG for 45 min in PBS. Finally, the cardiomyocytes were counterstained with DAPI for 15 min. Confocal imaging was performed using a Leica SP5 confocal system.

Gene Expression Analysis

[0085] Relative gene expression was determined using two-step quantitative real-time PCR. Total RNA was isolated with the RNeasy Isolation kit (Qiagen, Valencia, CA) with on- column DNase I treatment to eliminate contaminating genomic DNA using RNase-free DNase Set (Qiagen, Valencia, CA) according to the manufacturer's instructions. About 1 μg total RNA from each sample was reverse-transcribed using the Superscript® VILO™ cDNA Synthesis Kit (Invitrogen, Carlsbad, CA) according to the manufacturer's protocol.

Quantitative RT-PCR reactions were performed with iTaq Fast SYBR Green Supermix (Bio- Rad, Hercules, CA) on an ABI Prism 7500 Real Time PCR System using standard

parameters. The primer sets used in this study are listed in Table 2. For each set of primers, a no-template control and a no-reverse-amplification control were included. Post- amplification dissociation curves were performed to verify the presence of a single amplification product and the absence of primer-dimers. Fold changes in gene expression were determined using the comparative C_T method (AACt) with normalization to the B2M housekeeping gene as an endogenous control.

Table 2. Real Time qPCR sequences

Gene Forward Sequence Sequence Reverse Sequence Sequence

(5'-»3') Identifier (5'-»3') Identifier

(SEQ ID (SEQ ID NO) NO)

ISLl GCAGAGTGACATAGATCAGCCTG 1 GCCTCAATAGGACTGGCTAC 2 CA

BRY GCTGTGACAGGTACCCAACC 3 CATGCAGGTGAGTTGTCAGA 4

A

HAND1 CAAGGATGCACAGTCTGGCGAT 5 GCAGGAGGAAAACCTTCGTG 6

CT

CTNT AAGAGGCAGACTGAGCGGGAAA 7 AGATGCTCTGCCACAGCTCCT 8

T

NKX2.5 CACCTCAACAGCTCCCTGAC 9 AATGCAAAATCCAGGGGACT 10

MESP1 CTGTTGGAGACCTGGATGC 11 CGTCAGTTGTCCCTTGTCAC 12

GATA4 GCAGCCAGAGTCCCTCAG 13 CTGGCTTTTTGCCTCCTG 14

TBX5 CGATTCGAAACCCGAGAG 15 GAAACACTTTGATTCCCTCCA 16

MYL2 GCAGGCGGAGAGGTTTTC 17 AGTTGCCAGTCACGTCAGG 18

FLK1 GGAACCTCACTATCCGCAGAGT 19 CCAAGTTCGTCTTTTCCTGGG 20

C

SMMHC GTCCAGGAGATGAGGCAGAAAC 21 GTCTGCGTTCTCTTTCTCCAG 22

C

MIXL1 CCCGACATCCACTTGCGCGAG 23 GGAAGGATTTCCCACTCTGAC 24

G

B2M GGGATCGAGACATGTAAGCAG 25 CAAGCAAGCAGAATTTGGAA 26

Genetic Labeling of hESC-derived Ventricular Cardiomvocvtes

[0086] Single cells were isolated from cardiogenic EBs and were plated at low density on a Matrigel-coated coverslip and cultured at 37°C, 5% C0₂ /20% 0₂ with the medium containing 80% DMEM, 20% FBS defined (HyClone), 1 mM L-glutamine, 1% NEAA. The next day, cells were transduced with recombinant lentiviral vector in which the short fragment (250 base pairs) of the human myosin light chain (MLC)-2v promoter drove the expression of tdTomato (LV-MLC2v-tdTomato; MOI=5) 12 . Subsequent functional assays were performed on 7-15 days post-transduction at physiological temperature.

Action Potential (AP) Characterization

[0087] Action potentials (APs) of chemically induced ventricular cardiomyocytes

(ciVCMs) were recorded using the whole-cell configuration of the patch-clamp technique (HEKA Instruments Inc. Southboro, MA, USA) at 37°C. The voltage-clamp mode was employed with cell capacitance and series resistance (> 70%) on-line compensated. The current-clamp mode with 100-lOOOpA pulse of 5 ms delivered to the cells was employed with cell capacitance and series resistance (> 70%) on-line compensated. AP parameters such as the resting membrane potential (RMP), upstroke velocity and AP duration were analyzed as described.⁴⁰' ⁴⁴ Patch pipettes were prepared from 1.5 mm thin- walled borosilicate glass capillaries using a Sutter micropipette puller P-97, and had typical resistance of 4-6 ΜΩ with an internal solution containing (in mM): 110 K-aspartate, 20 KC1, 1 MgCl₂, 0.1 Na-GTP, 5 Mg-ATP, 5 Na₂ -phosphocreatine, 1 EGTA, 10 HEPES, pH adjusted to 7.3 with KOH. The composition of external Tyrode's solution (in mM): 140 NaCl, 5 KC1, 1 CaCl₂, 1 MgCl₂, 10 glucose, 10 HEPES, pH adjusted to 7.4 with NaOH. Confocal Ca Imaging

[0088] The intracellular Ca²⁺ ([Ca²⁺] transients were analyzed by loading the

cardiomyocytes with Fluo-3 (5μΜ; Invitrogen, Carlsbad, CA) for 30 minutes at 37°C in Tyrode's solution (in mM: 140 NaCl, 5 KC1, 1 MgCl₂, 1.25 CaCl₂, 10 HEPES and 10 D- glucose at pH 7.4), followed by imaging with a laser scanning confocal microscope

(Olympus FV300) or with a spinning disc laser confocal microscope (Perkin Elmer). The electrically induced Ca²⁺ transients (E[Ca²⁺] were triggered by pulses generated from a field generator (40ms pulse duration; 40 V/cm; 0.2 Hz) and the caffeine-induced Ca²⁺ transients (C[Ca²⁺]i) were stimulated with rapid administration to the bath of a droplet of caffeine (lOmM) without interrupting the imaging process. The amplitudes of Ca²⁺ transients, which are defined as background- subtracted fluorescence intensity changes (F) normalized to background- subtracted baseline fluorescence (F0), the transients rise (V max upstroke), and the transients decay (V max decay) of the electrically induced and caffeine-induced transients were acquired and analyzed.

Microelectrode Array Recordings

[0089] A high-resolution microelectrode array recording system (Multichannel Systems, Reutlingen, Germany) was used to characterize the electrophysiological properties of hESC- derived cardiomyocytes. 33 At day 21 post-differentiation, cardiogenic EBs or

cardiomyocytes were plated on fibronectin-coated microelectrode array plates that consisted of a 50x50 mm glass substrate with an embedded 1.4x1.4 mm matrix of 60 titanium nitride- gold contact electrodes with an inter-electrode distance of 200 μιη. The extracellular field potentials (FP) were recorded simultaneously from all 60 electrodes and then band-pass- filtered from 1 to 10 kHz. Recordings were performed in serum-free culture medium at 37°C. Following baseline recordings, escalating doses of isoproterenol (10^~9 mol/1 to 10^"6 mol/1; or sotalol (10^~9 mol/1 to 10^"5 mol/1; Sigma, St Louis, MO) were tested. The solution was static during the recording period and the temperature was kept at 37°C. Data were analyzed off-line to determine interspike interval, FP max (peak-to-peak amplitude) and FP min using the MC_Rack data analysis software according to manufacturer' s instructions (Multi-Channel Systems, Reutlingen, Germany).

Optical Mapping

[0090] CiVCMs were plated on Matrigel-coated coverslips for 72 hours to allow establishment of intercellular electrical junctions. The cells were loaded with 2 mM di-4- ANEPPS (Invitrogen, Carlsbad, CA) for 10 minutes at room temperature in Tyrode's solution, consisted of (niM) 140 NaCl, 5 KC1, 1 MgCl₂ , 1 CaCl₂ , 10 glucose, and 10 HEPES at pH 7.4. A halogen light filtered by a 515+35 nm band-pass filter excited the voltage- sensitive dye. The emission was filtered by a 590 nm long-pass filter. AP conduction through a hESC-CM monolayer was measured using MiCam Ultima optical mapping system

(SciMedia) with a IX objective and IX condensing lens to yield a 10x10 mm field-of-view. A co-axial point stimulation electrode at 1.5 Hz, 8 V, and 10 ms pulse duration stimulated the cells. Data were collected at room temperature with a sampling rate of 0.2 kHz and analyzed using BV Ana software (SciMedia).

[0091] Alternatively, at 21 to 25 days post-differentiation, cardiomyocyte monolayers were prepared by plating single-cell preparations on matrigel-coated coverslips at a density of 10⁵ cells per cm . After 96 hours, the cells were incubated with the voltage- sensitive dye di-4- ANEPPS (2 mM) (Invitrogen, Carlsbad, CA) for 10 minutes at room temperature in Tyrode's solution. The cells were stimulated with co-axial point stimulation electrode (typically 1.5 Hz, 8 V/cm, 10 ms duration). Fluorescence images were acquired with the MiCam Ultima optical mapping system (SciMedia, Costa Mesa, CA) using a IX objective and IX

condensing lens in a 10 x 10 mm field-of-view. Optical mapping image processing and data analysis were again performed with the BV_Analyzer software (SciMedia, Costa Mesa, CA).

Statistical Analysis

[0092] Statistical significance was analyzed with the Student's unpaired t-test. The electrophysiology datasets were analyzed using the Kolmogorov-Smirnov test. P<0.05 was considered significant.

Example 2

Direct differentiation ofhESCs toward ventricular cardiomyocytes

[0093] Cardiac differentiation was initiated by enzymatic dissociation of hESCs maintained in feeder cell-free, serum-free culture and subsequent formation of "cardiogenic" embryoid bodies (EBs) in suspension culture in a chemically defined media. Cell viability and EB formation was enhanced by inhibition of actin-myosin contraction mediated by blebbistatin, a small molecule inhibitor of programmed cell death commonly observed in dissociated hESCs.¹⁹' ²⁰ Next, the application of a small molecule inhibitor of the canonical Wnt pathway was combined with recombinant growth factors BMP4 and Activin A in a direct differentiation method, or protocol, having two stages. In Stage 1 (days 2-4.5), hESCs were directed to form cardiovascular progenitors. In Stage 2 (days 4.5-8), cells were further differentiated to ventricular cardiomyocytes (Table 1). [0094] During differentiation in vitro, hESCs transit through a series of developmental stages that parallel those found in the embryo. 21 The protocol was refined through a time course studies using quantitative RT-PCR analysis to investigate the kinetics of the gene expression of pluripotency (Fig. la), mesoderm (Fig. lb), primitive streak-like (Fig.lc), cardiac mesodermal (Fig. Id), cardiac progenitors (Fig.le-j) and cardiomyocyte markers (Fig.lk-1). In Stage 1, the addition of optimal concentrations of human recombinant growth factors BMP4 (hrBMP4) (10 ng/ml) and Activin A (hr Activin- A) induced a rapid decrease in the level of expression of NANOG (Fig. la), one of the key regulators of pluripotency 22 , which became almost undetected by day 4.5, confirming the effective differentiation of hESCs. The expression of the transcription factor T 23 (also known as Brachyury) was used to monitor the onset of mesoderm induction and MIXL1 24 marked the formation of a primitive streak-like population. The activation of the BMP and Nodal signaling by the addition of hrBMP4) and hrActivin-A, respectively, induced a rapid but transient up-regulation in gene expression of both T and MIXL1, which peaked at day 2. After this time, their levels were decreased, being undetected at day 4.5 (Fig. lb and Fig.lc, respectively).

[0095] An early cardiac mesoderm population was generated by day 4.5, as indicated by the increased expression of MESP1 (Fig. Id), one of the earliest markers of cardiovascular specification.²⁵'²⁶ Concomitantly, the expression of key cardiovascular specification genes (NKX2.5, GATA4, HAND1, TBX5, ISLl, FLK1)²⁷ were upregulated (Fig. le-j) , signifying the formation of cardiac progenitor cells. Interestingly, during mouse cardiogenesis the transcriptional signature of ISL1⁺/NKX2.5⁺/FLK1⁺ defines a multipotent cardiovascular progenitor, which can give rise to the major lineages of the mature heart: cardiomyocytes, endothelial and smooth muscle cells. 28 Taken together, these results demonstrated that the molecular events at Stage 1 of the differentiation system recapitulate the early steps of the cardiovascular lineage commitment.

[0096] The molecular analysis of Stage 1 was used to define the optimal time window for the next phase. Stage 2 was initiated at day 4.5, by the addition of small molecule IWR-1, a Wnt/p-catenin pathway antagonist²⁹, i.e., r R-1, which is a specific canonical Wnt/p-catenin pathway antagonist. The effect of rWR-1 was assessed at the molecular level. Expression levels of NKX2.5 were progressively increased, beginning on day 6 and plateaued from day 9 to day 15 (Fig. If). Meanwhile, the expression of ISLl was transiently up-regulated from day 4.5 to day 9, but significantly decreased by day 15 compared to control treated cells (Fig. le), which most likely indicates the commitment of undifferentiated cardiac progenitors to the cardiomyocyte lineage. Furthermore, the results indicated that by day 9 the inhibition of the canonical Wnt/p-catenin pathway significantly enhanced cardiogenesis marked by the induction of cardiac- specific structural genes, cardiac troponin-T (also known as TNNT2) and ventricular myosin light chain 2 (also known as MLC2v) when compared to DMSO treated cells (Fig. Ik and Fig.11, respectively). There was no difference in the expression levels of GATA4 (Figl.i), TBX5 (Fig. lh) and FLK1 (Fig.lj) between IWR-1 and control treated cells during the course of differentiation. Taken together, these results indicate that chemically mediated inhibition of the canonical Wnt pathway by the timed delivery of the inhibitor IWR-1, significantly enhanced terminal differentiation of cardiomyocytes imitating the normal human cardiac developmental program.

Example 3

Phenotypic characterization of cardiomyocyte differentiation

[0097] As a first step, cardiomyocyte (e.g., ciVCM) differentiation efficiency was assessed based on the contractile activities of these cells, as well as immuno staining with antibodies for cardiomyocyte- specific markers. The earliest beating EBs in IWR-1 treated cells were observed at day 7. The number of spontaneously contracting EBs significantly increased from about 8% at day 7 to nearly 100% by day 15 (Fig. 7n). In contrast, we observed only a modest proportion of beating EBs (about 10%) in the DMSO treated cells at day 15 (Fig. 7n). Next, we determined the percentage of cardiomyocytes in the differentiated population using FACS analysis at day 21 (Figure 2). The results indicated that a high percentage of cells expressed the cardiomyocyte-specific markers, TNNT2 (86.42 + 2.10%; Fig.2b) and a- sarcomeric actinin (86.50 + 2.39%; also known as ACTN2) (Fig. 2c). Greater than 80% of the cells were positive for MLC2v (Fig.2e), a left ventricular chamber- specific structural protein expressed in both human and rodent hearts. 30 Immunofluorescent staining of TNNT2 confirmed the purity of the cardiomyocytes, which displayed well- organized sarcomeres (Fig. 2d-e).

[0098] A two- stage protocol was also investigated to determine if it was more efficient than existing methods for the differentiation of hESCs towards cardiomyocytes. To this end, a comparison between the present protocol (hereafter referred to as IWR-1) and the protocol described by Yang et al.⁶ (hereafter referred to as the DKK-1 protocol), which utilized a cocktail of cytokines including the recombinant protein DKK- 1 (also known as dickkopf related protein- 1), a secreted factor that functions as a negative regulator of the canonical

WNT signaling, 38 was performed. Phenotypic and molecular analyses were employed in order to compare the populations derived by the two different protocols. By flow cytometry, a significant increase in the cardiomyocyte differentiation efficiency in IWR-1 (n=6) when compared to DKK-1 treated cells (n=4), as assessed by TNNT2 expression (89.42 + 5.94 % versus 29.48 + 2.49%, p=0.001; Fig. 2f), was observed. In the absence of either inhibitor, TNNT2 was expressed in 20.64 + 3.79% (n=4) of the cells at the end of the protocol (Fig. 2f). Furthermore, we assessed the gene expression of cardiomyocyte markers at day 21 post- differentiation by quantitative RT-PCR. The analysis revealed that there was a significant increase in mRNA transcript levels of the cardiomyocyte- specific genes TNNT2 (9-fold, P < 0.001), NKX2.5 (26-fold; P < 0.001), IRX4 (17-fold: P < 0.001) and MLC2v (56-fold; P < 0.001) in the IWR-1 treated cells when compared to DKK-1 treated cells (Fig. 2g).

[0099] To determine whether other cardiovascular lineages were generated in the r R-1 treated cells, specific markers of smooth muscle and endothelium were analyzed by flow cytometry. The results indicated that about 7% of the population at day 21 were positive for smooth muscle heavy chain (also known as MYH11) (Fig. 2g and 13a-b), a structural protein which is a major component of the contractile apparatus specifically expressed in smooth muscle cells. 31 The expression of CD31 and CD34, typically associated with vascular endothelial cells, was also analyzed. CD31 and CD34 were expressed in less than about 1% of the total cell population (Fig. 2i and 13c-d). Taken together, these results demonstrate that the directed differentiation protocol results in a nearly pure population of ventricular cardiomyocytes with very few non-cardiomyocyte cells, such as smooth muscle and endothelial cells. In addition, the cardiomyocyte phenotype was verified by

immunofluorescent staining for the cardiac- specific myofilament proteins CTNN2 (Fig. 3a-c) and MLC2v (Fig.3d-f). The analyses revealed that most, if not all, of the cells expressed both proteins and displayed well- organized striated structures (Fig. 3).

[0100] To further validate our method, the cardiomyocyte differentiation efficiency of the disclosed protocol was evaluated in three additional cell lines, i.e., the H7 (WA07) and HI (WA01) hESC lines, and the SKiPS-31.3 induced pluripotent stem cell (iPSC) line that was derived from human dermal fibroblasts. Under the same differentiation conditions developed in the HES2 line, the H7 cells generated >90% and the HI line generated >80%

cardiomyocytes, as assessed by flow cytometric analysis for TNNT2 or ACTN2 expression (Fig. 14). Similarly, when the protocol was applied to the SKiPS-31.3 cells, a high proportion of TNNT2-positive or ACTN2-positive cells (>90%) were observed (Fig. 15).

[0101] Taken together these results demonstrate that the small molecule-mediated directed differentiation protocol disclosed herein generated a nearly pure population of

cardiomyocytes, with few non-cardiomyocyte cells, such as smooth muscle and endothelial cells, present in the final cultures. Example 4

Electrophysiological Characterization of ciVCMs

[0102] Existing differentiation protocols generate a population of heterogeneous cardiomyocytes that are classified into atrial-, ventricular- and nodal-like subtypes based on their electrophysiological properties. The patch-clamp method was used to analyze the action potential (AP) and electrophysiological properties of the cardiomyocytes generated in the protocol disclosed herein. The AP waveforms were classified into atrial-, ventricular-, or nodal-like cell types based on the AP parameters (see Table 5 for a complete set of the criteria). Electrophysiological characterization of AP recordings from single cells revealed a homogeneous AP phenotype with 100% of the cells displaying the typical ventricular- like AP parameters (Fig. 9a, b and Table 1) (hereafter referred to as ciVCMs). No atrial-like or nodal-like subtypes were observed. Moreover, the AP parameters displayed by the ciVCMs were comparable to cultured fetal ventricular cardiomyocytes and expressed the major cardiac ion-channel genes hERG, CACNA1C and SCN5 (Fig. 16).

[0103] The electrophysiological properties of cardiomyocytes derived from the H7 hESC line were also evaluated. Analysis of the AP parameters obtained from single H7 -derived cardiomyocytes revealed a homogeneous population of ventricular-like cardiomyocytes (Fig. 17 and Table 6). These results demonstrated that that the ventricular specification of the cardiomyocytes derived with the disclosed protocol was not due to an intrinsic propensity of the HES2 line used in the development of the protocol.

[0104] To evaluate electrophysiological properties at multicellular levels, ciVCM monolayers were generated and examined with an optical mapping technique 23 ' 33 (Fig. 9c-f). When optically mapped, confluent monolayers of ciVCMs showed systematic propagation of APs (Fig. 4h-j). Consistent with patch-clamp recordings, the confluent monolayers showed morphologies that resembled each other (Fig. 9d). Further, AP recordings obtained from distal sites on confluent monolayers of ciVCMs exhibited a conduction velocity of 2.15 + 0.35 cm/s (n=5) as shown by the depolarizing wavefront (dF/dt) in the isochronal conduction contour map of Fig. 9c. Confluent monolayer preparations also exhibited an AP duration at 90% repolarization (APD 90) of 363+53.7 ms (Fig. 4k) that was unimodally distributed, indicating a homogeneous population with properties comparable to native ventricular preparations. ³⁴

[0105] Furthermore, the electrophysiological properties of the ciVCMs was evaluated at the multicellular level using an optical mapping technique 23 (Fig. 9c-f) by generating ciVCM monolayers. Consistent with single-cell patch-clamp analysis, the AP recordings obtained from distal sites on confluent monolayers of ciVCMs displayed morphologies that resembled each other (Fig. 9d) and the AP duration at 90% repolarization (APD 90) was unimodally distributed, indicating a homogeneous population.

[0106] Additionally, to corroborate the ventricular-like phenotype, electrophysiological recordings were taken of single cell preparations labeled with a genetic marker of the ventricular fate. To accomplish this end, ciVCMs were transduced with a recombinant lentiviral vector containing a short fragment of the MLC2v promoter 13, 35 that drives the expression of tdTomato. All of the tdTomato-positive cells exhibited ventricular-like AP waveforms (Fig. 18).

[0107] To further demonstrate that the disclosed protocol enhanced the differentiation of ventricular-like cardiomyocytes, the electrophysiological properties of the cardiomyocytes generated with the disclosed protocol were compared to those of cells generated as described by Yang et al.⁶ The cardiomyocyte phenotypes were classified as nodal-, atrial-, or ventricular-like based on the AP morphology and parameters (Table 5). Electrophysiological characterization of individual cells using the patch-clamp method showed that the DKK-1 protocol of Yang et al.⁶ generated a heterogeneous population consisting of atrial-, ventricular- and nodal-like phenotypes, whereas all the cardiomyocytes derived with the disclosed IWR-1 protocol were classified as ventricular-like (Fig. 10a, b and Fig. 19). In addition, a frequency distribution analysis was performed using the AP parameters of the individual cardiomyocytes that were differentiated with either the r R-1 or the DKK-1 protocol. The frequency distribution of the APD 90 (Fig. lOc-d) and the action potential amplitude (APA) (Fig. lOe-f) values were significantly different between the disclosed r R- 1 protocol and the DKK-1 protocol (APD90: P=0.001 and APA: P=0.04; Kolmogorov- Smirnov test). In the disclosed IWR-1 protocol, the APD 90 and APA values were unimodally distributed (Fig. 10c and Fig. lOe, respectively). In contrast the DKK-1 protocol produced a differentiated population that was multimodally distributed.

[0108] Taken together, these data demonstrate that small molecule-mediated directed differentiation of hESCs in accordance with the disclosure promotes the ventricular specification of hESC-derived cardiomyocytes. Example 5

Functional characterization ofciVCMs

[0109] For chemically derived cardiomyocytes to be useful, it is important to examine their functional properties beyond the expression of cardiomyocyte- specific markers. Therefore, electrophysiological and Ca²⁺ recordings were made in single-cell preparations transduced with a recombinant lentiviral vector in which short fragment of the MLC2v promoter drives the expression of tdTomato (LV-MLC2v-tdTomato). 12 Consistent with the immuno staining analyses, >80% of LV-MLC2v-tdTomato-transduced cells (30- to 50-day-old) were td- Tomato-positive, validating the ventricular phenotype. Furthermore, all cells displayed typical ventricular-like action potentials (APs) regardless of their automaticity and intensity of fluorescent reporter signal (Fig. 4a, b). This classification was based on such AP properties as the maximum rate of rise (dV/dtmax), duration (APD), amplitude (APA) and prominence of phase 4 depolarization (Figure 4a, b and Table 3).

[0110] Table 3. AP characteristics of electrically paced (0.5Hz) and spontaneously firing ventricular-like hESC-derived cardiomyocytes. Data are mean ± SE. APD50/APD90, AP duration measured at 50% or 90% repolarization; MDP, maximum diastolic potential.

[0111] Ca ⁺ homeostasis is crucial for excitation-contraction coupling and subsequently, the contractile properties of functional cardiomyocytes. 32 The ciVCMs were analyzed to determine if they possessed functional excitation-contraction coupling by examining the intracellular Ca²⁺ transients using fast line-scan confocal imaging on ciVCMs loaded with the Ca²⁺ indicator Fluo-3. The analysis revealed rhythmical Ca²⁺ transients recorded from electrically stimulated ciVCMs (Fig. 4c). Caffeine responsiveness, an indicator of functional sarcoplasmic reticulum (SR), was also assessed. Caffeine application elicited a rapid release of Ca²⁺ from intracellular stores (Fig. 4d) characterized by a larger Ca²⁺ amplitude transient compared to non- stimulated cells (AF/FO; 1.24+0.13 versus 1.69+0.25; p > 0.05)(Fig.4e) as well as an increase in maximum upstroke velocity (V max upstroke; 2.88+1.69 versus 2.18+0.24 s -1 , p < 0.05) (Fig. 4f) and maximum decay velocity (V max decay; 1.31+0.40 versus 1.11+0.15 s -1 ; p >0.05) (fig. 4g).

[0112] The example establishes that the chemically induced ventricular cardiomyocytes exhibit the functional properties of native ventricular cardiomyocytes, providing evidence of the use of such cells in prophylactic and therapeutic methodologies as well as the utility of such cells in ex vivo and in vitro assays for modulators of cardiac function.

Example 6

Chronotropic Responses to Pharmacological Compounds

[0113] The beta adrenergic signaling cascade is an important regulator of myocardial function, which serves as the most powerful regulatory mechanism to enhance myocardial performance in response to stress or exercise.³⁵'⁴¹ A positive inotropic response to β- adrenergic stimulation requires appropriate surface membrane receptors coupled to a signaling pathway that stimulates the appropriate ion channels, receptors and myofilament proteins. Gene expression analysis confirmed the expression of the beta-1 and beta-2 adrenergic receptors (also known as ADRB 1 and ADRB2, respectively) in the ciVCMs at the end of the differentiation protocol.

[0114] In addition to demonstrating beta-adrenergic receptor expression in ciVCMs, these cells were shown to have functional beta-adrenergic signaling. More particularly, the chronotropic effects of isoproterenol, a β-adrenergic agonist, and sotalol, an alpha-adrenergic agonist, were studied with a microelectrode array technique. 33 Upon isoproterenol stimulation, spontaneously contracting ciVCMs produced a positive chronotropic response in a dose-dependent manner, while sotalol negatively affected the beating rate (Fig. 5). These results demonstrate the presence and functionality of the β-adrenergic receptor- signaling pathway in the ciVCMs.

[0115] Table 4. Directed differentiation protocol summary. l-Ascorbic Aeiti Sleb&istatirt 8MP4 Aeiivirt A

0 - 1 50 10

3,5 + 50

[0116] Table 5. Action potential (AP) parameters used for the classification of hESC- derived cardiomyocyte subtypes. The cardiomyocytes were categorized into nodal-, atrial-, or ventricular-like phenotypes, based on their electrophysiological properties, such as the APA (V), dV/dt (mV/ms), APD50 (ms) and APD90 (ms). The nodal-like AP subtype was assigned to cells that exhibited: i) a prominent phase-4 depolarization, ii) a slow upstroke (dV/dt), iii) a small APA, iv) relatively depolarized MDP and v) were spontaneously firing. The atrial- and ventricular-like types of action potentials differed by the shape of their plateau phases and the AP duration. The atrial-like are triangle- shaped with shorter AP durations than the ventricular-like cells. The ventricular-like exhibit more pronounced plateau phases and longer AP durations. APA: action potential amplitude; dV/dt: maximum upstroke velocity; APD90: action potential duration at 90% repolarization; APD50: action potential duration at 50% repolarization.

[0117] Table 6. AP parameters of spontaneously-firing and quiescent H7-derived cardiomyocytes. APs from n=20 cells were recorded and classified according to the criteria that are summarized in Table 5. All cells were classified as ventricular- like. Values are mean + s.e. APA: action potential amplitude; dV/dt: maximum upstroke velocity; APD90: action potential duration at 90% repolarization; APD50: action potential duration at 50% repolarization; MDP: maximum diastolic potential for spontaneous-firing cardiomyocytes; RMP: resting membrane potential for quiescent cardiomyocytes.

[0118] Each of the references cited below is incorporated by reference herein in its entirety. The references are cited throughout this disclosure using superscripted numbers corresponding to the following numbered reference list.

REFERENCES

[0119] 1. Evans, S.M., Yelon, D., Conlon, F.L. & Kirby, M.L. Myocardial lineage development. Circ Res 107, 1428-1444 (2010).

[0120] 2. Olson, E.N. Gene regulatory networks in the evolution and development of the heart. Science 313, 1922-1927 (2006).

[0121] 3. Noseda, M., Peterkin, T., Simoes, F.C., Patient, R. & Schneider, M.D.

Cardiopoietic factors: extracellular signals for cardiac lineage commitment. Circ Res 108, 129-152 (2011).

[0122] 4. Kehat, I. et al. Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes. J Clin Invest 108, 407-414 (2001). [0123] 5. Laflamme, M.A. et al. Cardiomyocytes derived from human embryonic stem cells in pro-survival factors enhance function of infarcted rat hearts. Nat Biotechnol 25, 1015-1024 (2007).

[0124] 6. Yang, L. et al. Human cardiovascular progenitor cells develop from a KDR+ embryonic- stem-cell-derived population. Nature 453, 524-528 (2008).

[0125] 7. He, J.Q., Ma, Y., Lee, Y., Thomson, J.A. & Kamp, T.J. Human embryonic stem cells develop into multiple types of cardiac myocytes: action potential characterization. Circ Res 93, 32-39 (2003).

[0126] 8. Mummery, C. et al. Differentiation of human embryonic stem cells to cardiomyocytes: role of coculture with visceral endoderm-like cells. Circulation 107, 2733- 2740 (2003).

[0127] 9. Xu, C, Police, S., Rao, N. & Carpenter, M.K. Characterization and enrichment of cardiomyocytes derived from human embryonic stem cells. Circ Res 91, 501-508 (2002).

[0128] 10. Anderson, D. et al. Transgenic enrichment of cardiomyocytes from human embryonic stem cells. Mol Ther 15, 2027-2036 (2007).

[0129] 11. Kita-Matsuo, H. et al. Lentiviral vectors and protocols for creation of stable hESC lines for fluorescent tracking and drug resistance selection of cardiomyocytes. PLoS One 4, e5046 (2009).

[0130] 12. Huber, I. et al. Identification and selection of cardiomyocytes during human embryonic stem cell differentiation. FASEB J 21, 2551-2563 (2007).

[0131] 13. Ao, A., Hao, J. & Hong, C.C. Regenerative chemical biology: current challenges and future potential. Chem Biol 18, 413-424 (2011).

[0132] 14. Wu, X., Ding, S., Ding, Q., Gray, N.S. & Schultz, P.G. Small molecules that induce cardiomyogenesis in embryonic stem cells. J Am Chem Soc 126, 1590-1591 (2004).

[0133] 15. Takahashi, T. et al. Ascorbic acid enhances differentiation of embryonic stem cells into cardiac myocytes. Circulation 107, 1912-1916 (2003).

[0134] 16. Sadek, H. et al. Cardiogenic small molecules that enhance myocardial repair by stem cells. Proc Natl Acad Sci U S A 105, 6063-6068 (2008).

[0135] 17. Diamandis, P. et al. Chemical genetics reveals a complex functional ground state of neural stem cells. Nat Chem Biol 3, 268-273 (2007). [0136] 18. Borowiak, M. et al. Small molecules efficiently direct endodermal

differentiation of mouse and human embryonic stem cells. Cell Stem Cell 4, 348-358 (2009).

[0137] 19. Chen, G., Hou, Z., Gulbranson, D.R. & Thomson, J.A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell 7, 240-248 (2010).

[0138] 20. Ohgushi, M. et al. Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell 7, 225-239 (2010).

[0139] 21. Keller, G.M. In vitro differentiation of embryonic stem cells. Curr Opin Cell Biol 7, 862-869 (1995).

[0140] 22. Jaenisch, R. & Young, R. Stem cells, the molecular circuitry of pluripotency and nuclear reprogramming. Cell 132, 567-582 (2008).

[0141] 23. Kispert, A., Herrmann, B.G., Leptin, M. & Reuter, R. Homologs of the mouse Brachyury gene are involved in the specification of posterior terminal structures in

Drosophila, Tribolium, and Locusta. Genes Dev 8, 2137-2150 (1994).

[0142] 24. Ng, E.S. et al. The primitive streak gene Mixll is required for efficient haematopoiesis and BMP4-induced ventral mesoderm patterning in differentiating ES cells. Development 132, 873-884 (2005).

[0143] 25. Saga, Y., Kitajima, S. & Miyagawa-Tomita, S. Mespl expression is the earliest sign of cardiovascular development. Trends Cardiovasc Med 10, 345-352 (2000).

[0144] 26. Bondue, A. et al. Mespl acts as a master regulator of multipotent

cardiovascular progenitor specification. Cell Stem Cell 3, 69-84 (2008).

[0145] 27. Buckingham, M., Meilhac, S. & Zaffran, S. Building the mammalian heart from two sources of myocardial cells. Nat Rev Genet 6, 826-835 (2005).

[0146] 28. Moretti, A. et al. Multipotent embryonic isll+ progenitor cells lead to cardiac, smooth muscle, and endothelial cell diversification. Cell 127, 1151-1165 (2006).

[0147] 29. Chen, B. et al. Small molecule-mediated disruption of Wnt-dependent signaling in tissue regeneration and cancer. Nat Chem Biol 5, 100-107 (2009).

[0148] 30. Chuva de Sousa Lopes, S.M. et al. Patterning the heart, a template for human cardiomyocyte development. Dev Dyn 235, 1994-2002 (2006). [0149] 31. Glukhova, M.A., Frid, M.G. & Koteliansky, V.E. Developmental changes in expression of contractile and cytoskeletal proteins in human aortic smooth muscle. J Biol hem 265, 13042-13046 (1990).

[0150] 32. Bers, D.M. Cardiac excitation-contraction coupling. Nature 415, 198-205 (2002).

[0151] 33. Weinberg, S., Lipke, E.A. & Tung, L. In vitro electrophysiological mapping of stem cells. Methods Mol Biol 660, 215-237 (2010).

[0152] 34. Glukhov, A.V. et al. Transmural dispersion of repolarization in failing and nonfailing human ventricle. Circ Res 106, 981-991 (2010).

[0153] 35. Feldman, D.S., Carnes, C.A., Abraham, W.T. & Bristow, M.R. Mechanisms of disease: beta-adrenergic receptors— alterations in signal transduction and

pharmacogenomics in heart failure. Nat Clin Pract Cardiovasc Med 2, 475-483 (2005).

[0154] 36. Ueno, S. et al. Biphasic role for Wnt/beta-catenin signaling in cardiac specification in zebrafish and embryonic stem cells. Proc Natl Acad Sci U S A 104, 9685- 9690 (2007).

[0155] 37. Naito, A.T. et al. Developmental stage-specific biphasic roles of Wnt/beta- catenin signaling in cardiomyogenesis and hematopoiesis. Proc Natl Acad Sci U S A 103, 19812-19817 (2006).

[0156] 38. Gessert, S. & Kuhl, M. The multiple phases and faces of wnt signaling during cardiac differentiation and development. Circ Res 107, 186-199 (2010).

[0157] 39. Ludwig, T.E. et al. Feeder-independent culture of human embryonic stem cells. Nat Methods 3, 637-646 (2006).

[0158] 40. Moore, J.C. et al. Distinct cardiogenic preferences of two human embryonic stem cell (hESC) lines are imprinted in their proteomes in the pluripotent state. Biochem Biophys Res Commun 372, 553-558 (2008)

[0159] 41. Galende E, Karakikes I, Edelmann L, Desnick RJ, Kerenyi T, Khoueiry G, Lafferty J, McGinn JT, Brodman M, Fuster V, Hajjar RJ, Polgar K. Amniotic fluid cells are more efficiently reprogrammed to pluripotency than adult cells. Cell Reprogram.

2010;12: 117-125

[0160] 42. Ludwig TE, Bergendahl V, Levenstein ME, Yu J, Probasco MD, Thomson JA. Feeder-independent culture of human embryonic stem cells. Nat Methods. 2006;3:637-646 [0161] 43. Huber I, Itzhaki I, Caspi O, Arbel G, Tzukerman M, Gepstein A, Habib M, Yankelson L, Kehat I, Gepstein L. Identification and selection of cardiomyocytes during human embryonic stem cell differentiation. FASEB J. 2007;21:2551-2563

[0162] 44. Moore JC, Fu J, Chan YC, Lin D, Tran H, Tse HF, Li RA. Distinct cardiogenic preferences of two human embryonic stem cell (hesc) lines are imprinted in their proteomes in the pluripotent state. Biochem Biophys Res Commun. 2008;372:553-558

[0163] 45. Weinberg S, Lipke EA, Tung L. In vitro electrophysiological mapping of stem cells. Methods Mol Biol. 2010;660:215-237.

[0164] The disclosed subject matter has been described with reference to various specific and preferred embodiments and techniques. It should be understood, however, that many variations and modifications may be made while remaining within the spirit and scope of the disclosed subject matter.

Claims

CLAIMS WHAT IS CLAIMED IS:

1. A method of generating a cardiovascular progenitor cell comprising culturing a stem cell in feeder cell-free, serum-free growth medium comprising blebbistatin to form an embryoid body comprising a cardiovascular progenitor cell, wherein the growth medium lacks Rho-associated kinase and a P38 inhibitor.

2. The method according to claim 1 wherein the stem cell is selected from the group consisting of an embryonic stem cell, an induced pluripotent stem cell and an adult stem cell.

3. The method according to claim 2 wherein the stem cell is an embryonic stem cell.

4. The method according to claim 3 wherein the embryonic stem cell is Brach⁺, FLK1^".

5. The method according to claim 3 wherein the cardiovascular progenitor cell exhibits an increased expression of MESP1 compared to an embryonic stem cell.

6. The method according to claim 5 wherein the cardiovascular progenitor cell further comprises upregulated expression of a protein selected from the group consisting of NKX2.5, GATA4, HAND1, TBX5, ISL1 and FLK-1 compared to the expression level in an embryonic stem cell.

7. The method according to claim 6 wherein the cardiovascular progenitor cell further comprises upregulated expression of NKX2.5, GATA4, HAND1, TBX5, ISL1 and FLK-1 compared to the expression levels in an embryonic stem cell.

8. The method according to claim 3 wherein the culturing step is performed for about 4.5 days.

9. The method according to claim 3 wherein the yield of cardiovascular progenitor cells is selected from the group consisting of greater than 30%, greater than 40%, greater than 50%, greater than 60%, greater than 70%, greater than 80% and greater than 90%.

10. The method according to claim 3 wherein the embryonic stem cell is a human embryonic stem cell.

11. The method according to claim 3 wherein the growth medium is human embryonic stem cell-qualified Matrigel in TeSRl medium.

12. A method of generating a cardiomyocyte comprising:

(a) culturing a stem cell in feeder cell-free, serum-free growth medium comprising blebbistatin to form an embryoid body; and

(b) differentiating an embryonic stem cell by incubating the stem cell in differentiation medium comprising a Wnt-1 pathway inhibitor, BMP-4, and Activin A, wherein at least one of the growth medium and the differentiation medium lacks Rho- associated kinase and a P38 inhibitor.

13. The method according to claim 12 wherein the stem cell is selected from the group consisting of an embryonic stem cell, a pluripotent stem cell and an adult stem cell.

14. The method according to claim 13 wherein the stem cell is an embryonic stem cell.

15. The method according to claim 14 wherein the Wnt pathway inhibitor is IWR-1.

16. The method according to claim 14 wherein the differentiation medium comprises about 10 ng/ml BMP4.

17. The method according to claim 14 wherein the differentiation medium comprises less than 30 ng/ml Activin A.

18. The method according to claim 14 wherein the level of ISL1 is lower in the cardiomyocyte than in an embryonic stem cell.

19. The method according to claim 14 wherein the expression level of a protein selected from the group consisting of cardiac troponin-T and ventricular myosin light chain 2 is higher in the cardiomyocyte than in an embryonic stem cell.

20. The method according to claim 14 wherein the cardiomyocyte exhibits a MYH11⁺, CD31^", CD34^", ADRB1⁺, ADRB2⁺ phenotype.

21. The method according to claim 14 wherein the cardiomyocyte exhibits a TNNT2⁺, ACTN2⁺, MLC2v⁺ phenotype.

22. The method according to claim 14 wherein the cardiomyocyte is a ventricular cardiomyocyte.

23. The method according to claim 14 wherein the embryonic stem cell is a human embryonic stem cell.

24. The method according to claim 14 wherein a clinical grade preparation of cardiomyocytes is generated in the absence of genetic manipulation and cell sorting.

25. The method according to claim 14 wherein the cardiomyocytes are generated from autologous embryonic stem cells and wherein the cardiomyocytes are greater than 90% pure.

26. The method according to claim 14 wherein the differentiation medium is StemPro34.

27. A method of transplanting autologous cardiomyocytes comprising administering to a subject a therapeutically effective amount of cardiomyocytes generated according to claim 14.

28. The method according to claim 27 wherein the subject is a human.

29. A method of screening for compound toxicity comprising: (a) incubating cardiomyocytes generated according to claim 14 in the presence or absence of the compound; and

(b) determining the toxicity of the compound by measuring the viability of the cardiomyocytes exposed to the compound compared to cardiomyocytes not exposed to the compound.

30. A method of identifying a cardiovascular therapeutic comprising:

(a) incubating a stem cell in the presence or absence of a compound in differentiation medium comprising a Wnt-1 pathway inhibitor, BMP-4, and Activin A, wherein the differentiation medium lacks Rho-associated kinase and a P38 inhibitor; and

(b) identifying a compound as a cardiovascular therapeutic if the yield of functional cardiomyocytes is greater in the presence compared to the absence of the compound.

31. The method according to claim 30 wherein the stem cell is selected from the group consisting of an embryonic stem cell, an induced pluripotent stem cell and an adult stem cell.

32. The method according to claim 31 wherein the stem cell is an embryonic stem cell.