WO2013062887A1

WO2013062887A1 - Substituted pyridine derivatives useful as gpr131 agonists

Info

Publication number: WO2013062887A1
Application number: PCT/US2012/061267
Authority: WO
Inventors: Robert J. Devita; Shrenik K. Shah; Ravi Kurukulasuriya; Selena FUNG; Vincent J. Colandrea; Jason W. Szewczyk
Original assignee: Merck Sharp & Dohme Corp.
Priority date: 2011-10-26
Filing date: 2012-10-22
Publication date: 2013-05-02

Abstract

Compounds of structural Formula (I) are inhibitors of GPR131. The compounds of the present invention are useful for the prevention and treatment of conditions related to the activity of GPR131 such as abnormal metabolism, including obesity; diabetes; metabolic syndrome; obesity related disorders; and diabetes related disorders.

Description

TITLE OF THE INVENTION

SUBSTITUTED PYRIDINE DERIVATIVES USEFUL AS GPR131 AGONISTS

FIELD OF THE INVENTION

The present invention relates to substituted pyridine derivatives useful as GPR131 agonists and the use of such compounds to control, prevent, and/or treat conditions or diseases mediated by GPR131 activity. The compounds of the present invention are useful for the control, prevention and treatment of conditions and diseases such as obesity, diabetes, metabolic syndrome, obesity related disorders, and diabetes related disorders.

BACKGROUND OF THE INVENTION

GPR131, also known as GPCR131, GPBAR1, BG37, TGR5, RUP43, hGPCR19 and M- BAR, is a cell surface G-protein-coupled receptor that responds to hydrophobic bile acids ("BAs") such as cholic acid and cholic acid derivatives. GPR131 is expressed at elevated levels in the adipose, bone marrow, heart, kidney, liver, lymph node, mammary gland, placenta, rectum, small intestine, spleen, stomach, and uterus. GPR131 is conserved among mammals. (Kawamata, etal., J. Bio. Chem., 2003, 278, 9435-9440).

GPR131 regulates glucose metabolism and energy homeostatis. BA activated GPR131 has been shown to promote the secretion of glucagon-like-peptide-1 ("GLP-1"), which in turn stimulates insulin secretion in the pancreas in a glucose-dependent manner. The effects of the GPR131 and its ligand are reported, in an intestinal tract cell line, to promote the secretion of a GLP-1 which serves to reduce blood glucose level. Katsuma, S. et al, Biochemical and

Biophysical Research Communications, 2005, 329, 386-390. The GLP-1 is a peptide hormone released by an L cell which is an intestinal secreting cell present in the ileum, large intestine and the like, and was demonstrated to induce insulin secretion depending on the blood glucose level. Accordingly, a compound having a GLP-1 secretion-promoting effect is expected to be used as a therapeutic agent for diabetes which can avoid a risk of hypoglycemia due to overdose. In addition, since the GLP-1 has an ability of inducing pancreatic β cells in proliferation and its differentiation from stem cells, GPR131 agonism is suggested to be effective in delaying apoptosis of β cells in Type II diabetes and in sustaining the effect of islet implantation in Type I diabetes. Watanabe S. et al, Nature 2006, 439, 484-489. Moreover, GLP-1 also regulates gastric emptying and promotes satiety leading to decrease food intake, accordingly activated GPR131 is expected to promote weightloss. GPR131 is also known to be expressed in skeletal muscle. This organ is important in energy consumption. A D2 gene (type 2 iodothyronine deiodinase: an enzyme required in cells to convert thyroide hormone into its active form) is also expressed in skeletal muscle. An increase in cAMP concentration due to activation of GPR131 is known to serve to activate the D2, thus stimulating energy metabolism. Wannatabe, et al, Nature 2006, 439, 484-489.

Additionally, BA activated GPR131 in adipocytes and myocytes enhances energy expenditure. Wannatabe, et al, Nature 2006, 439, 484-489. This effect involves the cAMP- dependent induction of type 2 iodothyronine deiodinase ("D2"), which increases mitochondrial activity and oxidative phophorylation in adipose tissue. Consistent with the role of GPR131 in the control of energy metabolism, female GPR131 knock-out mice were shown to be predisposed to weight gain when fed a high fat diet, indicating that the lack of GPR131 decreases energy expenditure and elicits obesity (Maruyama, T., et al., J. Endocrinol. 2006, 191, 197-205).

In conclusion, small molecule GPR131 agonists represent a new class of non-peptidergic GLP-1 secretagogues with potential for the management of diabetes, obesity and associated comorbidities.

SUMMARY OF THE INVENTION

The present invention is directed to compounds of structural Formula I:

I

or pharmaceutically acceptable salt thereof.

Compounds of Formula I are agonists of GPR131 and as such are useful in the treatment, control or prevention of diseases, disorders or conditions responsive to the modulation of GPR131. In particular, the compounds of Formula I act as agonists of GPR131 useful in the treatment, control or prevention of diseases, disorders or conditions responsive to the activation of GPR131, such as diabetes, obesity and metabolic syndrome, including obesity related disorders and diabetes related disorders. The present invention also relates to pharmaceutical compositions comprising the compounds of the present invention and a pharmaceutically acceptable carrier.

The present invention also relates to methods for the treatment, control, or prevention of disorders, diseases, or conditions responsive to activation of GPR131 in a subject in need thereof by adrninistering the compounds and pharmaceutical compositions of the present invention.

The present invention also relates to methods for the treatment, control, or prevention of diabetes, obesity, and metabolic syndrome, including obesity related disorders and diabetes related disorders by administering the compounds and pharmaceutical compositions of the present invention.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is concerned with compounds useful as agonists

Compounds of the present invention are described by structural Formula I:

I

and pharmaceutically acceptable salts thereof, wherein

X is N orN^O^";

Ring A is phenyl or a six-membered heteroaryl ring containing 1-2 N atoms, wherein phenyl or the six-membered heteroaryl ring is optionally substituted by one to four R¹;

Ring B is a five-membered heteroaryl containing 1-3 N, O, or S atoms, wherein the five- membered heteroaryl ring is optionally substituted by one to two R⁶;

Ring C is phenyl or six-membered heteroaryl ring containing 1-2 N atoms, wherein phenyl or the six-membered heteroaryl ring is optionally substituted by one to four R ;

each R¹ is selected from the group consisting of:

(1 ) Ci^alkyl, wherein said alkyl is optionally substituted with hydroxyl, or C_1-6alkoxyl,

(2) haloC_1-6alkyl,

(3) C_1-6alkoxyl,

(4) thioC_1-6alkoxyl, (5) C3.₆cycloalkoxyl,

(6) haloC_1-6alkoxyl,

(7) hydroxyl,

(8) halogen,

(9) C_1-6alkyl-S(0)_k-, wherein k is 1 or 2,

(10) NR⁴R⁵, and

(11) C(0)NR⁴R⁵,

each R² is selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl, and

(3) haloC_1-6alkyl;

each R³ is selected from the group consisting of:

(1) C_1-6alkyl, wherein said alkyl is optionally substituted with hydroxyl, or amino,

(2) haloC_1-6alkyl,

(3) C_1-6alkoxyl,

(4) haloC_1-6alkoxyl,

(5) C_3-6cycloalkoxyl,

(6) halogen,

(7) CHO,

(8) COOH,

(9) C(0)NR⁴R⁵,

(10) C_1-6alkylC(0)-,

(11) cyano, and

(12) C_1-6alkyl-S(0)p-, wherein p is 1 or 2;

R⁴ and R⁵ are independently selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl,

(3) haloC^alkyl, and

(4) C_1-6alkyl-S(0)₂-;

each R⁶ is selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl, and

(3) haloC_1-6alkyl; and n is 1, 2, or 3.

In one embodiment of the present invention, X is N or N^-O^". In one class of this embodiment, X is N. In another class of this embodiment, X is N^-O^".

In one embodiment of the present invention, Ring A is phenyl or a six-membered heteroaryl ring containing 1 -2 N atoms, wherein phenyl or the six-membered heteroaryl ring is unsubstituted or substituted by one to four R¹.

In one class of this embodiment, Ring A is phenyl, wherein the phenyl is unsubstitued or substituted by one to four R¹.

In one class of this embodiment, Ring A is pyridine, pyridazine, pyrirnidine, or pyrazine, wherein the ring is unsubstituted or substituted by one to four R¹.

In another subclass of this class, Ring A is a pyridine, unsubstituted or substituted by One to four R¹.

In one class of this embodiment, Ring A is phenyl, pyridine, pyridazine, pyrirnidine, or pyrazine, wherein the ring is unsubstituted or substituted by one to four R¹.

In one class of this embodiment, Ring A is phenyl or pyridine, wherein the ring is unsubstituted or substituted by one to four R¹.

In one embodiment of the present invention, Ring B is a five-membered heteroaryl containing 1-3 N, O, or S atoms, wherein the five-membered heteroaryl is substituted by one to two R⁶.

In a class of this embodiment, Ring B is selected from the group consisting of:

, wherein q is 1 or 2.

In a class of this embodiment, Ring B is selected from the group consisting of:

In a subclass of this class, Ring A is phenyl, optionally substituted by one to four R¹; and Ring C is phenyl, optionally substituted by one to four R . In a subclass of this class, Ring A is phenyl, optionally substituted by one to four R¹; and Ring C is pyridinyl, optionally substituted by one to four R³.

In a subclass of this class, Ring A is pyridine, optionally substituted by one to four R¹; and Ring C is phenyl, optionally substituted by one to four R³.

In a subclass of this class, Ring A is pyridine, optionally substituted by one to four R¹; and Ring C is pyridinyl, optionally substituted by one to four R³.

In another class of this embodiment, Ring B is

In another class of this embodiment, Ring B is -~ .

In another class of this embodiment, Ring B is

In one embodiment of the present invention, Ring C is phenyl or six-membered heteroaryl ring containing 1 -2 N atoms, wherein phenyl or the six-membered heteroaryl ring is optionally substituted by one to four R .

In one class of this embodiment, Ring C is phenyl, pyridine, pyrazine, pyridazine, or pyrimidine, wherein the phenyl, pyridine, pyrazine, pyridazine, or pyrimidine is optionally substituted by one to four R .

In one class of this embodiment, Ring C is phenyl or pyridine, wherein phenyl or pyridine is optionally substituted by one to four R .

In another class of this embodiment, Ring C is phenyl, optionally substituted by one to four R³.

In a subclass of this class, Ring A is phenyl, optionally substituted by one to four R³. In a sub-subclass of this subclass, X is N.

In a subclass of this class, Ring A is pyridine, optionally substituted by one to four R³. In a sub-subclass of this subclass, X is N.

In yet another class of this embodiment, Ring C is pyridine, optionally substituted by one to four R³.

In a subclass of this class, Ring A is phenyl, optionally substituted by one to four R³.

In a sub-subclass of this subclass, X is N.

In a subclass of this class, Ring A is pyridine, optionally substituted by one to four R . In a sub-subclass of this subclass, X is N.

In one class of this embodiment, Ring C is

or ₅ optionally substituted by one to four R³. In a subclass of this class, Ring C is nally substituted by one to four R³

Γη another subclass of this class, Ring C is ₅ optionally substituted by one to four

R³.

In one class of this embodiment, Ring C is

In one embodiment of the present invention, each R¹ is selected from the group consisting of alkyl, wherein said alkyl is optionally substituted with hydroxyl or Q-galko yl, C^alkoxyl, thio C_1-6alkoxyl, C₃.6cycloalkoxyl, haloC_1-6alkoxyl, hydroxyl, halogen,

wherein k is 1 or 2, NR⁴R⁵, and CONR⁴R⁵. In a class of this embodiment, each R¹ is selected from the group consisting of fluoro, chloro, methyl, ethyl, trifluoromethyl, hydroxymethyl,

methoxymethyl, hydroxy, methoxy, ethoxy, isopropyloxy, trifluoromethyloxy, cyclopropyloxy, thio-methoxy, benzyloxy, (methyl)₂N-, (acetyl)NH-, N,N-dimethylcarboxamido, pivalamido, methanesulfonamido and methylsulfonyl.

In one embodiment of the present invention, each R² is selected from the group consisting of hydrogen, C_1-6alkyl, and haloC_1-6alkyl. In a class of this embodiment, each R² is selected from the group consisting of hydrogen and methyl.

In one embodiment of the present invention, each R³ is selected from the group consisting of alkyl, wherein said alkyl is optionally substituted with hydroxyl or amino,

ealkoxyl, haloC_1-6alkoxyl, C_3-6cycloalkoxyl, halogen, CHO, COOH, C(0)NR⁴R⁵, C_1-6alkylC(0)-, cyano, and C_1-6alkyl-S(0)_p-, wherein p is 1 or 2. In one class of this embodiment, each R³ is selected from the group consisting of chloro, bromo, fluoro, iodo, methyl, trifluoromethyl, t- butyl, methoxy, trifluoromethoxy, cyclopropyloxy, aminomethyl, 1-hydroxyethyl, Ci^alkylC(0)- , COOH, formyl, cyano, carboxamido, N-methylcarboxamido, N,N-methylcarboxamido, methanesulfonyl, and t-butylbutan-3-enoate.

In one embodiment of the present invention, n is 1, 2, or 3. In one class of this

embodiment, n is 1. In another class of this embodiment, n is 2. In yet another class of this embodiment, n is 3.

In one embodiment of the present invention, Ring B is selected from the group consisting of:

, wherein q is 1 or 2;

each R¹ is selected from the group consisting of fluoro, chloro, methyl, ethyl,

trifluoromethyl, hydroxymethyl, methoxymethyl, hydroxy, methoxy, ethoxy, isopropyloxy, trifluoromethyloxy, cyclopropyloxy, thio-methoxy, benzyloxy, (methyl)₂N-, (acetyl)NH-, N,N- dimethylcarboxamido, pivalamido, methanesulfonamido and methylsulfonyl;

each R² is selected from the group consisting of hydrogen and methyl; and each R³ is selected from the group consisting of chloro, bromo, fluoro, iodo, methyl, trifluoromethyl, t-butyl, methoxy, trifluoromethoxy, cyclopropyloxy, aminomethyl, 1- hydroxyethyl, acetyl, COOH, formyl, cyano, carboxamido, N-methylcarboxamido, N,N- methylcarboxamido, methanesulfonyl, and t-butylbutan-3-enoate.

In a subclass of this class, Ring C is phenyl or pyridine, wherein the phenyl or pyridine is optionally substituted by one to three R .

In a subclass of this class, Ring C is phenyl, optionally substituted by one to three R³. In a subclass of this class, Ring C is pyridine, optionally substituted by one to three R . In a subclass of this class, Ring C is

In one embodiment of the present invention, the compounds include those of Formulas I- - I-m:

wherein k is 1-4; m is 1-3, and q is 1-2; and wherein X, R¹, R², R³, R⁶, and n are defined herein, or a pharmaceutically acceptable salt thereof.

In one embodiment of the present invention, the compounds include those of Formula I-n:

I-n

wherein k is 1-3; m is 1-3; and wherein Ring B, X, R¹, R², R³, and n are defined herein, a pharmaceutically acceptable salt thereof.

In one embodiment of the present invention, the compounds include those of Formula I

I-o

In one embodiment of the present invention, the compounds include those of Formula I-p:

In one embodiment of the present invention, the compounds include those of Formula I-q:

I-q

wherein k is 1-3; m is 1-3; and wherein Ring B, X, R¹, R², R³, and n are defined herein, or a pharmaceutically acceptable salt thereof.

As used herein the following definitions are applicable.

"Alkyl", as well as other groups having the prefix "alk", such as alkoxy and alkanoyl, means carbon chains which may be linear or branched, and combinations thereof, unless the carbon chain is defined otherwise. Examples of alkyl groups include methyl, ethyl, propyl, isopropyl, butyl, sec- and tert-butyl, pentyl, hexyl, heptyl, octyl, nonyl, and the like. When no number of carbon atoms is specified, C 1-6 is intended.

The term "alkoxy" refers to straight or branched chain alkoxides of the number of carbon atoms specified (e.g., Ci-6 alkoxy), or any number within this range [i.e., methoxy (MeO-), ethoxy, isopropoxy, etc.].

The term "alkylthio" or "thioalkoxyl" refers to straight or branched chain alkylsulfides of the number of carbon atoms specified (e.g., Ci-6 alkylthio), or any number within this range [i.e., methylthio (MeS-), ethylthio, isopropylthio, etc.].

The term "alkylsulfonyl" refers to straight or branched chain alkylsulfones of the number of carbon atoms specified (e.g., Ci_6 alkylsulfonyl), or any number within this range [i.e., methylsulfonyl (MeS02-), ethylsulfonyl, isopropylsulfonyl, etc.].

"Cycloalkyl" means mono- or bicyclic or bridged saturated carbocyclic rings, each having from 3 to 14 carbon atoms. Examples of cycloalkyl include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, and decahydronaphthyl, and the like.

"Aryl" means a monocyclic, bicyclic or tricyclic ring system containing 5-14 carbon atoms, wherein at least one of the rings is aromatic. Aryl thus includes ring systems in which an aromatic ring is fused to a non-aromatic ring, such as a cycloalkyl or cycloalkenyl ring.

Examples of aryl include phenyl, naphthalene, biphenyl, indane and 5,6,7,8- tetrahydronaphthalene, and the like. In one embodiment of the present invention, aryl is phenyl, naphthalene, biphenyl, indane, and 5,6,7,8-tetrahydronaphthalene. In another embodiment of the present invention, aryl is phenyl, naphthalene, indane and 5,6,7,8-tetrahydronaphthalene. In one class of this embodiment, aryl is phenyl and naphthalene. In another class of this embodiment, aryl is phenyl. In another class of this embodiment, aryl is naphthalene.

"Heteroaryl" means a monocyclic, bicyclic or tricyclic ring system containing 5-14 carbon atoms and containing 1 , 2, 3, 4 or 5 heteroatoms selected from N, NH, O and S wherein at least one of the heteroatom containing rings is aromatic. Heteroaryls thus includes heteroaryls fused to other kinds of rings, such as aryls, cycloalkyls and heterocycles that are not aromatic.

Heteroaryl includes ring systems in which an aromatic heteroatom containing ring is fused to a non-aromatic ring, such as a cycloalkyl, cycloalkenyl, cycloheteroalkyl or cycloheteroalkenyl ring, and also includes ring systems in which an aryl ring is fused to a non-aromatic heteroatom containing ring, such as a cycloheteroalkyl or cycloheteroalkenyl ring. Examples of heteroaryls include: pyrazole, pyridine, pyrazine, pyrrole, pyrimidine, pyridazine, benzoimidazole, quinoline, isothiazole, isoquinoline, indole, indazole, carbazole, benzotriazole, benzofuran, benzothiazole, benzothiophene, benzoisooxazole, oxazole, oxadiazole, furan, benzoxazole, isoxazole, indoline, isoindoline, tetrazole, imidazole, oxadiazole (in particular, l,3,4-oxadiazol-2-yl and 1,2,4- oxadiazol-3-yl), thiazole, thiophene, thiadiazole, triazole, triazine, tetrazole, thiene,

benzothiazole, bernzopyrazole, benzothiadiazole, dihydrobenzofuran, indazole, isoindole, dihydrobenzothiene, indolizine, cinnoline, phthalazine, quinazoline, naphthyridine, carbazole, quinoxaline, purine, isobenzylfuran, benzothiene, isoquinoline, dibenzofuran, isothiazole, imidazopyridine, benzodioxole, dihydropyridine, dihydropyrrolopyridine, dihydrobenzooxazine, benzodioxole, benzodioxine, pyrrolopyridine, triazolopyridine, dihydropyridooxazine, dihydrobenzoxazine, dihydroindole, dihydroisoindole, dihydrobenzoimidazole, dihydroquinoline, tetrahydroisoquinoline, tetrahydrocyclopentaindole, tetrahydroquinoxaline, and

tetrahydropyridine. For heterocycloalkyl and heteroaryl groups, rings and ring systems containing from 3-15 atoms are included, forming 1-3 rings.

"Halogen" includes fluorine, chlorine, bromine and iodine. Chlorine and fluorine are generally preferred. Fluorine is most preferred when the halogens are substituted on an alkyl or alkoxy group (e.g. CF3O and CF3CH2O). In one embodiment of the present invention, halogen is selected from fluorine, chlorine, and bromine.

"Oxo" means the functional group "=0" which is an oxygen atom connected to the molecule via a double bond, such as, for example, (1) "C=(0)", that is a carbonyl group; (2) "S=(0)", that is, a sulfoxide group; and (3) "N=(0)", that is, an JV-oxide group, such as pyridyl- N-oxide.

In choosing compounds of the present invention, one of ordinary skill in the art will recognize that the various substituents, i.e. R.1, R^, etc., are to be chosen in conformity with well- known principles of chemical structure connectivity and stability. When any variable (e.g., Rl , Ra, etc.) occurs more than one time in any constituent or in Formula I, its definition on each occurrence is independent of its definition at every other occurrence. Also, combinations of substituents and/or variables are permissible only if such combinations result in stable compounds. A squiggly line across a bond in a substituent variable represents the point of attachment.

Under standard nomenclature used throughout this disclosure, the functional group adjacent to the point of attachment is described first, with our without a bond followed by the terminal portion of the designated side chain. For example, a -Ci-5 alkylcarbonylamino Ci_ 6 alkyl substituent is equivalent to:

O

II

-C^alkyl - C-NH-C._|_₆alkyl

The term "substituted" shall be deemed to include multiple degrees of substitution by a named substitutent. Where multiple substituent moieties are disclosed or claimed, the

substituted compound can be independently substituted by one or more of the disclosed or claimed substituent moieties, singly or plurally. By independently substituted, it is meant that the (two or more) substituents can be the same or different.

The terms "compounds of structural Formula I" and "Formula I" include the compounds of structural formulas I-a - I-q, and If, and pharmaceutically acceptable salts thereof.

Compounds of structural Formula I may be separated into their individual

diastereoisomers by, for example, fractional crystallization from a suitable solvent, for example methanol or ethyl acetate or a mixture thereof, or via chiral chromatography using an optically active stationary phase. Absolute stereochemistry may be determined by X-ray crystallography of crystalline products or crystalline intermediates which are derivatized, if necessary, with a reagent containing an asymmetric center of known absolute configuration. Alternatively, any stereoisomer of a compound of the general structural Formula I may be obtained by

stereospecific synthesis using optically pure starting materials or reagents of known absolute configuration. Compounds of the Formula I may be separated into diastereoisomeric pairs of enantiomers by, for example, fractional crystallization from a suitable solvent, for example MeOH or ethyl acetate or a mixture thereof. The pair of enantiomers thus obtained may be separated into individual stereoisomers by conventional means, for example by the use of an optically active amine as a resolving agent or on a chiral HPLC column. Alternatively, any enantiomer of a compound of the general Formula I may be obtained by stereospecific synthesis using optically pure starting materials or reagents of known configuration.

If desired, racemic mixtures of the compounds may be separated so that the individual enantiomers are isolated. Racemic mixtures can be separated into their individual enantiomers by any of a number of conventional methods, which include chiral chromatography,

derivatization with a chiral auxiliary followed by separation by chromatography or

crystallization, and fractional crystallization of diastereomeric salts. The separation can be carried out by methods well known in the art, such as the coupling of a racemic mixture of compounds to an enantiomerically pure compound to form a diastereomeric mixture, followed by separation of the individual diastereomers by standard methods, such as fractional crystallization or chromatography. The coupling reaction is often the formation of salts using an

enantiomerically pure acid or base. The diasteromeric derivatives may then be converted to the pure enantiomers by cleavage of the added chiral residue. The racemic mixture of the compounds can also be separated directly by chromatographic methods utilizing chiral stationary phases, which methods are well known in the art.

Some of the compounds described herein contain olefinic double bonds, and unless specified otherwise, are meant to include both E and Z geometric isomers.

Some of the compounds described herein may exist as tautomers, which have different points of attachment of hydrogen accompanied by one or more double bond shifts. For example, a ketone and its enol form are keto-enol tautomers. The individual tautomers as well as mixtures thereof are encompassed with compounds of the present invention.

In the compounds of structural Formula I, the atoms may exhibit their natural isotopic abundances, or one or more of the atoms may be artificially enriched in a particular isotope having the same atomic number, but an atomic mass or mass number different from the atomic mass or mass number predominately found in nature. The present invention is meant to include all suitable isotopic variations of the compounds of structural Formula I. For example, different isotopic forms of hydrogen (H) include protium ( H) and deuterium ( H). Protium is the predominant hydrogen isotope found in nature. Enriching for deuterium may afford certain therapeutic advantages, such as increasing in vivo half-life or reducing dosage requirements, or may provide a compound useful as a standard for characterization of biological samples.

Isotopically-enriched compounds within structural Formula I, can be prepared without undue experimentation by conventional techniques well known to those skilled in the art or by processes analogous to those described in the Schemes and Examples herein using appropriate isotopically-enriched reagents and/or intermediates.

It will be understood that, as used herein, references to the compounds of structural Formula I are meant to also include the pharmaceutically acceptable salts, and also salts that are not pharmaceutically acceptable when they are used as precursors to the free compounds or their pharmaceutically acceptable salts or in other synthetic manipulations. The compounds of the present invention may be administered in the form of a pharmaceutically acceptable salt.

The term "pharmaceutically acceptable salt" refers to salts prepared from

pharmaceutically acceptable non-toxic bases or acids including inorganic or organic bases and inorganic or organic acids. Salts of basic compounds encompassed within the term

"pharmaceutically acceptable salt" refer to non-toxic salts of the compounds of this invention which are generally prepared by reacting the free base with a suitable organic or inorganic acid. Representative salts of basic compounds of the present invention include, but are not limited to, the following: acetate, benzenesulfonate, benzoate, bicarbonate, bisulfate, bitartrate, borate, bromide, camsylate, carbonate, chloride, clavulanate, citrate, edetate, edisylate, estolate, esylate, fumarate, gluceptate, gluconate, glutamate, hexylresorcinate, hydrobromide, hydrochloride, hydroxynaphthoate, iodide, isothionate, lactate, lactobionate, laurate, malate, maleate, mandelate, mesylate, methylbromide, methylnitrate, methylsulfate, mucate, napsylate, nitrate, N- methylglucamine ammonium salt, oleate, oxalate, pamoate (embonate), palmitate, pantothenate, phosphate/diphosphate, polygalacturonate, salicylate, stearate, sulfate, subacetate, succinate, tannate, tartrate, teoclate, tosylate, triethiodide and valerate. Furthermore, where the compounds of the invention carry an acidic moiety, suitable pharmaceutically acceptable salts thereof include, but are not limited to, salts derived from inorganic bases including aluminum, ammonium, calcium, copper, ferric, ferrous, lithium, magnesium, manganic, mangamous, potassium, sodium, zinc, and the like. Particularly preferred are the ammonium, calcium, magnesium, potassium, and sodium salts. Salts derived from pharmaceutically acceptable organic non-toxic bases include salts of primary, secondary, and tertiary amines, cyclic amines, and basic ion-exchange resins, such as arginine, betaine, caffeine, choline, N,N- dibenzylethylenediamine, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, emanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glucamine, glucosamine, histidine, isopropylamine, lysine, memylglucamine, morpholine, piperazine, piperidine, polyamine resins, procaine, purines, theobromine, triethylamine, trimethylamine, tripropylamine, tromethamine, and the like.

Also, in the case of a carboxylic acid (-COOH) or alcohol group being present in the compounds of the present invention, pharmaceutically acceptable esters of carboxylic acid derivatives, such as methyl, ethyl, or pivaloyloxymethyl, or acyl derivatives of alcohols, such as acetyl, pivaloyl, benzoyl, and aminoacyl, can be employed. Included are those esters and acyl groups known in the art for modifying the solubility or hydrolysis characteristics for use as sustained-release or prodrug formulations.

Furthermore, some of the crystalline forms for compounds of the present invention may exist as polymorphs and as such are intended to be included in the present invention. In addition, some of the compounds of the instant invention may form solvates with water or common organic solvents. Such solvates are encompassed within the scope of this invention.

The compounds of Formula I are effective as agonists of GPR131. The compounds of

Formula I are therefore useful for the treatment, control and/or prevention of diseases, disorders or conditions responsive to the inhibition of the GPR131, including but not limited to: abnormal metabolism, obesity, diabetes, metabolic syndrome, obesity related disorders, diabetes related disorders, hypertension, dyslipidemia, stroke, gallbladder disease, cardiovascular disease, osteoarthritis, rheumatoid arthritis, hypercholesterolemia, stable angina, unstable angina, artherosclerosis, sleep apnea, respiratory problems, cancer, and stroke.

One aspect of the present invention provides a method for the treatment or prevention of disorders, diseases or conditions responsive to the activation of GPR131 in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.

Another aspect of the present invention provides a method for the treatment or prevention of obesity, diabetes, an obesity related disorder or a diabetes related disorder in a subject in need thereof which comprises administering to said subject a therapeutically or prophylactically effective amount of a GPR131 agonist of Formula I. Another aspect of the present invention provides a method for the treatment or prevention of obesity in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof. Another aspect of the present invention provides a method for reducing food intake in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof. Another aspect of the present invention provides a method for reducing body fat mass in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof. Another aspect of the present invention provides a method for losing weight in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.

In one embodiment, the invention provides a use of a compound of formula I, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for use in treating a condition selected from the group consisting of diabetes and obesity.

Another aspect of the present invention provides a method for the treatment or prevention of an obesity-related disorder selected from the group consisting of: overeating, binge eating, hypertension, elevated plasma insulin concentrations, insulin resistance, hyperlipidemia, endometrial cancer, breast cancer, prostate cancer, colon cancer, kidney cancer, osteoarthritis, obstructive sleep apnea, heart disease, abnormal heart rhythms and arrythmias, myocardial infarction, congestive heart failure, coronary heart disease, sudden death, stroke, polycystic ovary disease, craniopharyngioma, metabolic syndrome, insulin resistance syndrome, sexual and reproductive dysfunction, infertility, hypogonadism, hirsutism, obesity-related gastro-esophageal reflux, Pickwickian syndrome, inflammation, systemic inflammation of the vasculature, arteriosclerosis, hypercholesterolemia, hyperuricaemia, lower back pain, gallbladder disease, gout, constipation, irritable bowel syndrome, inflammatory bowel syndrome, cardiac

hypertrophy, left ventricular hypertrophy, in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.

Another aspect of the present invention provides a method for the treatment or prevention of diabetes, in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.

Another aspect of the present invention provides a method for the treatment or prevention of a diabetes related disorder in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof. Another aspect of the present invention provides a method for the treatment or prevention of a diabetes related disorder selected from the group consisting of: hyperglycemia, low glucose tolerance, insulin resistance, obesity, lipid disorders, dyslipidemia, hyperlipidemia,

hypertriglyceridemia, hypercholesterolemia, low HDL levels, high LDL levels, atherosclerosis and its sequelae, vascular restenosis, irritable bowel syndrome, inflammatory bowel disease, including Crohn's disease and ulcerative colitis, other inflammatory conditions, pancreatitis, abdominal obesity, neurodegenerative disease, retinopathy, nephropathy, neuropathy, Syndrome X, and ovarian hyperandrogenism (polycystic ovarian syndrome), in a subject in need thereof which comprises administering to the subject a therapeutically or prophylactically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.

The present invention also relates to methods for treating or preventing obesity by administeRing A compound of Formula I in combination with a therapeutically or

prophylactically effective amount of another agent known to be useful to treat or prevent the condition. The present invention also relates to methods for treating or preventing diabetes by administeRing A compound of Formula I in combination with a therapeutically or

prophylactically effective amount of another agent known to be useful to treat or prevent the condition. The present invention also relates to methods for treating or preventing obesity related disorders by administeRing A compound of Formula I in combination with a therapeutically or prophylactically effective amount of another agent known to be useful to treat or prevent the condition.

Yet another aspect of the present invention relates to the use of a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt or ester thereof, and a therapeutically effective amount of at least one agent selected from the group consisting of:

simvastatin, mevastatin, ezetimibe, atorvastatin, sitagliptin, metformin, sibutramine, orlistat, Qnexa, topiramate, phentermine, losartan, losartan with hydrochlorothiazide, or rimonabant, or a pharmaceutically acceptable salt or ester or prodrug thereof, for the manufacture of a medicament useful for the treatment, control, or prevention of obesity, diabetes, a diabetes related disorder, or an obesity-related disorder in a subject in need of such treatment.

Another aspect of the present invention provides a pharmaceutical composition comprising a compound of Formula I, and a pharmaceutically acceptable carrier.

In one embodiment, the invention provides a compound according to formula I for use as a medicament. Yet another aspect of the present invention relates to the use of a compound of Formula I for the manufacture of a medicament useful for the treatment or prevention, or suppression of a disease mediated by GPR131 in a subject in need thereof.

In one embodiment, the invention provides a compound according to formula I for use in the treatment of diabetes or obesity. In one class, the invention provides a compound according to formula I for use in the treatment of diabetes. In one class, the invention provides a compound according to formula I for use in the treatment of obesity.

Yet another aspect of the present invention relates to the use of a compound of Formula I for the manufacture of a medicament useful for the treatment or prevention, or suppression of a disease mediated by GPR131 , wherein the disease is selected from the group consisting of obesity, diabetes, an obesity-related disorder and a diabetes related disorder in a subject in need thereof.

Yet another aspect of the present invention relates to the use of a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof, and a therapeutically effective amount of an agent selected from the group consisting of an insulin sensitizer, an insulin mimetic, a sulfonylurea, an a-glucosidase inhibitor, a dipeptidyl peptidase 4 (DPP-4) inhibitor, a glucagons like peptide 1 (GLP-1) agonist, a HMG-CoA reductase inhibitor, a serotonergic agent, a β3 -adrenoreceptor agonist, a neuropeptide Yl antagonist, a neuropeptide Y2 agonist, a neuropeptide Y5 antagonist, a pancreatic lipase inhibitor, a cannabinoid CBi receptor antagonist or inverse agonist, a melanin-concentrating hormone receptor antagonist, a melanocortin 4 receptor agonist, a bombesin receptor subtype 3 agonist, a ghrelin receptor antagonist, PYY, PYY3-.36, and a NK-1 antagonist, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament useful for the treatment, control, or prevention of obesity, diabetes or an obesity-related disorder in a subject in need of such treatment. Yet another aspect of the present invention relates to the use of a therapeutically effective amount of a compound of Formula I, and pharmaceutically acceptable salts and esters thereof, and a therapeutically effective amount of an agent selected from the group consisting of an insulin sensitizer, an insulin mimetic, a sulfonylurea, an α-glucosidase inhibitor, a dipeptydyl peptidase 4 inhibitor, a glucagon-like peptide 1 agonist, a HMG-CoA reductase inhibitor, a serotonergic agent, a β3- adrenoreceptor agonist, a neuropeptide Yl antagonist, a neuropeptide Y2 agonist, a neuropeptide Y5 antagonist, a pancreatic lipase inhibitor, a cannabinoid CBi receptor antagonist or inverse agonist, a melanin-concentrating hormone receptor antagonist, a melanocortin 4 receptor agonist, a bombesin receptor subtype 3 agonist, a ghrelin receptor antagonist, PYY, PYY3-.36, and a NK- 1 antagonist, or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for treatment or prevention of obesity, diabetes, an obesity related disorder or a diabetes related disorder which comprises an effective amount of a the compound of Formula I, and an effective amount of the agent, together or separately. Yet another aspect of the present invention relates to a product containing a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof; and and a therapeutically effective amount of an agent selected from the group consisting of an insulin sensitizer, an insulin mimetic, a sulfonylurea, an a-glucosidase inhibitor, a HMG-CoA reductase inhibitor, a serotonergic agent, a β3- adrenoreceptor agonist, a neuropeptide Yl antagonist, a neuropeptide Y2 agonist, a neuropeptide Y5 antagonist, a pancreatic lipase inhibitor, a cannabinoid CBi receptor antagonist or inverse agonist, a melanocortin 4 receptor agonist, a melanin-concentrating hormone receptor antagonist, a bombesin receptor subtype 3 agonist, a ghrelin receptor antagonist, PYY, PYY3-.36, and a NK- 1 antagonist, or a pharmaceutically acceptable salt thereof, as a combined preparation for simultaneous, separate or sequential use in obesity, diabetes, an obesity-related disorder or a diabetes related disorder.

The compounds of Formula I can be provided in kit. Such a kit typically contains an active compound in dosage forms for administration. A dosage form contains a sufficient amount of active compound such that a beneficial effect can be obtained when administered to a patient during regular intervals, such as 1, 2, 3, 4, 5 or 6 times a day, during the course of 1 or more days. Preferably, a kit contains instructions indicating the use of the dosage form for weight reduction (e.g., to treat obesity) and the amount of dosage form to be taken over a specified time period.

Compounds of Formula I are agonists of GPR131 and as such are useful in the treatment, control or prevention of diseases, disorders or conditions responsive to the modulation of GPR131. Such diseases, disorders or conditions include, but are not limited to, abnormal metabolism, obesity, diabetes, metabolic syndrome, obesity related disorders, diabetes related disorders, hypertension, dyslipidemia, stroke, gallbladder disease, cardiovascular disease, osteoarthritis, rheumatoid arthritis, hypercholesterolemia, stable angina, unstable angina, artherosclerosis, sleep apnea, respiratory problems, cancer, and stroke. Such diseases, conditions and disorders also include non-obese overweight conditions and normal weight conditions where weight control or management is desired in order to prevent an obese or overweight condition from developing, or to maintain a healthy weight. The compounds of Formula I, and compositions thereof, are useful for the treatment or prevention of disorders associated with excessive food intake, such as obesity and obesity-related disorders. The obesity herein may be due to any cause, whether genetic or environmental.

The obesity-related disorders herein are associated with, caused by, or result from obesity. Examples of obesity-related disorders include overeating, binge eating, bulimia nervosa, hypertension, type 2 diabetes, elevated plasma insulin concentrations, hyperinsulinemia, insulin resistance, glucose intolerance, dyslipidemia, hyperlipidemia, endometrial cancer, breast cancer, prostate cancer, kidney cancer, colon cancer, osteoarthritis, obstructive sleep apnea,

cholelithiasis, cholecystitis, gallstones, gout, gallbladder disease, abnormal heart rhythms and arrythmias, myocardial infarction, congestive heart failure, coronary heart disease, angina pectoris, sudden death, stroke, metabolic syndrome, psychological disorders (depression, eating disorders, distorted bodyweight, and low self esteem), and other pathological conditions showing reduced metabolic activity or a decrease in resting energy expenditure as a percentage of total fat- free mass, e.g, children with acute lymphoblastic leukemia. Further examples of obesity-related disorders are sexual and reproductive dysfunction, such as polycystic ovary disease, infertility, hypogonadism in males and hirsutism in females, gastrointestinal motility disorders, such as obesity-related gastro-esophageal reflux, respiratory disorders, such as obesity-hypoventilation syndrome (Pickwickian syndrome), cardiovascular disorders, inflammation, such as systemic inflammation of the vasculature, arteriosclerosis, hypercholesterolemia, hyperuricaemia, lower back pain, gallbladder disease, gout, and kidney cancer. Additionally, the present compounds are useful in the treatment of any condition in which it is desirable to lose weight or to reduce food intake. Additionally, the present compounds are useful in the treatment of any condition in which it is desirable to enhance cognition and memory, such as Alzheimer's Disease. The compositions of the present invention are also useful for reducing the risk of secondary outcomes of obesity, such as reducing the risk of left ventricular hypertrophy. Therefore, the present invention provides methods of treatment or prevention of such diseases, conditions and/or disorders modulated by GPR131 in an animal which comprises administering to the animal in need of such treatment a compound of Formula I, in particular a therapeutically or

prophylactically effective amount thereof.

The term "agonist" as used herein means a composition of matter which when

administered to a mammal, such as a human, agonizes the biological activity attributable to the level or presence of an endogenous compound in the mammal. Activation of GPR131 includes, but is not limited to, agonizing the biological activity of the GPR131. The term "subject" means a mammal. One embodiment of the term "mammal" is a "human," said human being either male or female. The instant compounds are also useful for treating or preventing obesity and obesity related disorders in cats and dogs. As such, the term "mammal" includes companion animals such as cats and dogs. The term "mammal in need thereof refers to a mammal who is in need of treatment or prophylaxis as determined by a researcher, veterinarian, medical doctor or other clinician.

The term "composition", as in pharmaceutical composition, is intended to encompass a product comprising the active ingredient(s), and the inert ingredient(s) that make up the carrier, as well as any product which results, directly or indirectly, from combination, complexation or aggregation of any two or more of the ingredients, or from dissociation of one or more of the ingredients, or from other types of reactions or interactions of one or more of the ingredients. Accordingly, the pharmaceutical compositions of the present invention encompass any composition made by admixing a compound of the present invention and a pharmaceutically acceptable carrier.

The term "metabolic syndrome", also known as syndrome X, is defined in the TT ird

Report of the National Cholesterol Education Program Expert Panel on Detection, Evaluation and Treatment of High Blood Cholesterol in Adults (ΑΤΡ-ΠΙ). E.S. Ford et al., JAMA, vol. 287 (3), Jan. 16, 2002, pp 356-359. Briefly, a person is defined as having metabolic syndrome if the person has three or more of the following symptoms: abdominal obesity, hypertriglyceridemia, low HDL cholesterol, high blood pressure, and high fasting plasma glucose. The criteria for these are defined in ATP-IH.

The term "diabetes," as used herein, includes both insulin-dependent diabetes mellitus (i.e., JJDDM, also known as type I diabetes) and non-insulin-dependent diabetes mellitus (i.e., NIDDM, also known as Type Π diabetes). Type I diabetes, or insulin-dependent diabetes, is the result of an absolute deficiency of insulin, the hormone which regulates glucose utilization. Type II diabetes, or insulin-independent diabetes (i.e., non-insulin-dependent diabetes mellitus), often occurs in the face of normal, or even elevated levels of insulin and appears to be the result of the inability of tissues to respond appropriately to insulin. Most of the Type II diabetics are also obese. The compositions of the present invention are useful for treating both Type I and Type II diabetes. The compositions are especially effective for treating Type Π diabetes. The compounds or combinations of the present invention are also useful for treating and/or preventing gestational diabetes mellitus. Diabetes is characterized by a fasting plasma glucose level of greater than or equal to 126 mg/dl. A diabetic subject has a fasting plasma glucose level of greater than or equal to 126 mg/dl. Prediabetes is characterized by an impaired fasting plasma glucose (FPG) level of greater than or equal to 110 mg/dl and less than 126 mg/dl; or impaired glucose tolerance; or insulin resistance. A prediabetic subject is a subject with impaired fasting glucose (a fasting plasma glucose (FPG) level of greater than or equal to 110 mg/dl and less than 126 mg/dl); or impaired glucose tolerance (a 2 hour plasma glucose level of >140 mg/dl and <200 mg/dl); or insulin resistance, resulting in an increased risk of developing diabetes.

"Diabetes related disorders" are diseases, disorders and conditions that are related to Type 2 diabetes, and therefore may be treated, controlled or in some cases prevented, by treatment with the compounds of this invention: (1) hyperglycemia, (2) low glucose tolerance, (3) insulin resistance, (4) obesity, (5) lipid disorders, (6) dyslipidemia, (7) hyperlipidemia, (8)

hypertriglyceridemia, (9) hypercholesterolemia, (10) low HDL levels, (11) high LDL levels, (12) atherosclerosis and its sequelae, (13) vascular restenosis, (14) irritable bowel syndrome, (15) inflammatory bowel disease, including Crohn's disease and ulcerative colitis, (16) other inflammatory conditions, (17) pancreatitis, (18) abdominal obesity, (19) neurodegenerative disease, (20) retinopathy, (21) nephropathy, (22) neuropathy, (23) Syndrome X, (24) ovarian hyperandrogenism (polycystic ovarian syndrome), and other disorders where insulin resistance is a component. In Syndrome X, also known as Metabolic Syndrome, obesity is thought to promote insulin resistance, diabetes, dyslipidemia, hypertension, and increased cardiovascular risk.

Therefore, agonists of GPR131 may also be useful to treat hypertension associated with this condition.

Treatment of diabetes mellitus refers to the administration of a compound or combination of the present invention to treat diabetes. One outcome of treatment may be decreasing the glucose level in a subject with elevated glucose levels. Another outcome of treatment may be improving glycemic control. Another outcome of treatment may be decreasing insulin levels in a subject with elevated insulin levels. Another outcome of the treatment of diabetes is to reduce an increased plasma glucose concentration. Another outcome of the treatment of diabetes is to reduce an increased insulin concentration. Still another outcome of the treatment of diabetes is to reduce an increased blood triglyceride concentration. Still another outcome of the treatment of diabetes is to increase insulin sensitivity. Still another outcome of the treatment of diabetes may be enhancing glucose tolerance in a subject with glucose intolerance. Still another outcome of the treatment of diabetes is to reduce insulin resistance. Another outcome of the treatment of diabetes is to lower plasma insulin levels. Still another outcome of treatment of diabetes is an improvement in glycemic control, particulary in type 2 diabetes.

Prevention of diabetes mellitus, in particular diabetes associated with obesity, refers to the administration of a compound or combination of the present invention to prevent or treat the onset of diabetes in a subject in need thereof. A subject in need of preventing diabetes in a pre- diabetic subject.

"Obesity" is a condition in which there is an excess of body fat. The operational definition of obesity is based on the Body Mass Index (BMI), which is calculated as body weight per height in meters squared (kg/m2). "Obesity" refers to a condition whereby an otherwise healthy subject has a Body Mass Index (BMI) greater than or equal to 30 kg/m2, or a condition whereby a subject with at least one co-morbidity has a BMI greater than or equal to 27 kg/m2. An "obese subject" is an otherwise healthy subject with a Body Mass Index (BMI) greater than or equal to 30 kg/m2 or a subject with at least one co-morbidity with a BMI greater than or equal to 27 kg/m2. A "subject at risk of obesity" is an otherwise healthy subject with a BMI of 25 kg/m2 to less than 30 kg/m2 or a subject with at least one co-morbidity with a BMI of 25 kg/m2 to less than 27 kg/m2.

The increased risks associated with obesity occur at a lower Body Mass Index (BMI) in Asians. In Asian countries, including Japan, "obesity" refers to a condition whereby a subject with at least one obesity-induced or obesity-related co-morbidity, that requires weight reduction or that would be improved by weight reduction, has a BMI greater than or equal to 25 kg/m2. In Asian countries, including Japan, an "obese subject" refers to a subject with at least one obesity- induced or obesity-related co-morbidity that requires weight reduction or that would be improved by weight reduction, with a BMI greater than or equal to 25 kg/m2. In Asia-Pacific, a "subject at risk of obesity" is a subject with a BMI of greater than 23 kg/m2 to less than 25 kg/m2.

As used herein, the term "obesity" is meant to encompass all of the above definitions of obesity.

Obesity-induced or obesity-related co-morbidities include, but are not limited to, diabetes, non-insulin dependent diabetes mellitus - type II (2), impaired glucose tolerance, impaired fasting glucose, insulin resistance syndrome, dyslipidemia, hypertension, hyperuricacidemia, gout, coronary artery disease, myocardial infarction, angina pectoris, sleep apnea syndrome,

Pickwickian syndrome, fatty liver; cerebral infarction, cerebral thrombosis, transient ischemic attack, orthopedic disorders, arthritis deformans, lumbodynia, emmeniopathy, and infertility. In particular, co-morbidities include: hypertension, hyperlipidemia, dyslipidemia, glucose intolerance, cardiovascular disease, sleep apnea, diabetes mellitus, and other obesity-related conditions.

Treatment of obesity and obesity-related disorders refers to the administration of the compounds or combinations of the present invention to reduce or maintain the body weight of an obese subject. One outcome of treatment may be reducing the body weight of an obese subject relative to that subject's body weight immediately before the administration of the compounds or combinations of the present invention. Another outcome of treatment may be preventing body weight regain of body weight previously lost as a result of diet, exercise, or pharmacotherapy. Another outcome of treatment may be decreasing the occurrence of and/or the severity of obesity-related diseases. The treatment may suitably result in a reduction in food or calorie intake by the subject, including a reduction in total food intake, or a reduction of intake of specific components of the diet such as carbohydrates or fats; and/or the inhibition of nutrient absorption; and in weight reduction in subjects in need thereof. The treatment may also result in an alteration of metabolic rate, such as an increase in metabolic rate, rather than or in addition to an inhibition of the reduction of metabolic rate; and/or in minimization of the metabolic resistance that normally results from weight loss.

Prevention of obesity and obesity-related disorders refers to the administration of the compounds or combinations of the present invention to reduce or maintain the body weight of a subject at risk of obesity. One outcome of prevention may be reducing the body weight of a subject at risk of obesity relative to that subject's body weight immediately before the

administration of the compounds or combinations of the present invention. Another outcome of prevention may be preventing body weight regain of body weight previously lost as a result of diet, exercise, or pharmacotherapy. Another outcome of prevention may be preventing obesity from occurring if the treatment is administered prior to the onset of obesity in a subject at risk of obesity. Another outcome of prevention may be decreasing the occurrence and/or severity of obesity-related disorders if the treatment is administered prior to the onset of obesity in a subject at risk of obesity. Moreover, if treatment is commenced in already obese subjects, such treatment may prevent the occurrence, progression or severity of obesity-related disorders, such as, but not limited to, arteriosclerosis, Type Π diabetes, polycystic ovary disease, cardiovascular diseases, osteoarthritis, hypertension, dyslipidemia, insulin resistance, hypercholesterolemia,

hypertriglyceridemia, and cholelithiasis. The terms "administration of and or "administering" a compound should be understood to mean providing a compound of the invention or a prodrug of a compound of the invention to a subject in need of treatment. The administration of the compounds of the present invention in order to practice the present methods of therapy is carried out by administeRing A therapeutically effective amount of the compound to a subject in need of such treatment or prophylaxis. The need for a prophylactic administration according to the methods of the present invention is determined via the use of well known risk factors.

The term "therapeutically effective amount" as used herein means the amount of the active compound that will elicit the biological or medical response in a tissue, system, subject, mammal, or human that is being sought by the researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the disorder being treated. The novel methods of treatment of this invention are for disorders known to those skilled in the art. The term "prophylactically effective amount" as used herein means the amount of the active compound that will elicit the biological or medical response in a tissue, system, subject, mammal, or human that is being sought by the researcher, veterinarian, medical doctor or other clinician, to prevent the onset of the disorder in subjects as risk for obesity or the disorder. The therapeutically or prophylactically effective amount, or dosage, of an individual compound is determined, in the final analysis, by the physician in charge of the case, but depends on factors such as the exact disease to be treated, the severity of the disease and other diseases or conditions from which the patient suffers, the chosen route of administration, other drugs and treatments which the patient may concomitantly require, and other factors in the physician's judgement.

Administration and Dose Ranges

Any suitable route of administration may be employed for providing a subject or mammal, especially a human with an effective dosage of a compound of the present invention. For example, oral, rectal, topical, parenteral, ocular, pulmonary, nasal, and the like may be employed. Dosage forms include tablets, troches, dispersions, suspensions, solutions, capsules, creams, ointments, aerosols, and the like. Preferably compounds of Formula I are administered orally or topically.

The effective dosage of active ingredient employed may vary depending on the particular compound employed, the mode of administration, the condition being treated and the severity of the condition being treated. Such dosage may be ascertained readily by a person skilled in the art. Generally satisfactory results are obtained when the compounds of Formula I are administered at a daily dosage of from about 0.001 milligram to about 50 milligrams per kilogram of animal body weight, preferably given in a single dose or in divided doses two to six times a day, or in sustained release form. In the case of a 70 kg adult human, the total daily dose will generally be from about 0.07 milligrams to about 3500 milligrams. This dosage regimen may be adjusted to provide the optimal therapeutic response.

In the case where an oral composition is employed, a suitable dosage range is, e.g. from about 0.01 mg to about 1500 mg of a compound of Formula I per day, preferably from about 0.1 mg to about 600 mg per day, more preferably from about 0.1 mg to about 100 mg per day. For oral administration, the compositions are preferably provided in the form of tablets containing from 0.01 to 1,000 mg, preferably 0.01, 0.05, 0.1, 0.5, 1, 2.5, 5, 10, 15, 20, 25, 30, 40, 50, 100, 250, 500, 600, 750, 1000, 1250 or 1500 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated.

For use where a composition for intranasal administration is employed, intranasal formulations for intranasal administration comprising 0.001 - 10% by weight solutions or suspensions of the compounds of Formula I in an acceptable intranasal formulation may be used.

For use where a composition for intravenous administration is employed, a suitable dosage range is from about 0.001 mg to about 50 mg, preferably from 0.01 mg to about 50 mg, more preferably 0.1 mg to 10 mg, of a compound of Formula I per kg of body weight per day. This dosage regimen may be adjusted to provide the optimal therapeutic response. It may be necessary to use dosages outside these limits in some cases.

For the treatment of diseases of the eye, ophthalmic preparations for ocular administration comprising 0.001-1% by weight solutions or suspensions of the compounds of Formula I in an acceptable ophthalmic formulation may be used.

The magnitude of prophylactic or therapeutic dosage of the compounds of the present invention will, of course, vary depending on the particular compound employed, the mode of administration, the condition being treated and the severity of the condition being treated. It will also vary according to the age, weight and response of the individual patient. Such dosage may be ascertained readily by a person skilled in the art.

Combination Therapy Compounds of Formula I may be used in combination with other drugs that may also be useful in the treatment or amelioration of the diseases or conditions for which compounds of Formula I are useful. Such other drugs may be administered, by a route and in an amount commonly used therefor, contemporaneously or sequentially with a compound of Formula I. In the treatment of patients who have Type 2 diabetes, insulin resistance, obesity, metabolic syndrome, and co-morbidities that accompany these diseases, more than one drug is commonly administered. The compounds of this invention may generally be administered to a patient who is already taking one or more other drugs for these conditions. Often the compounds will be administered to a patient who is already being treated with one or more antidiabetic compound, such as metformin, sulfonylureas, and/or PPAR agonists, when the patient's glycemic levels are not adequately responding to treatment.

When a compound of Formula I is used contemporaneously with one or more other drugs, a pharmaceutical composition in unit dosage form containing such other drugs and the compound of Formula I is preferred. However, the combination therapy also includes therapies in which the compound of Formula I and one or more other drugs are administered on different overlapping schedules. It is also contemplated that when used in combination with one or more other active ingredients, the compound of the present invention and the other active ingredients may be used in lower doses than when each is used singly. Accordingly, the pharmaceutical compositions of the present invention include those that contain one or more other active ingredients, in addition to a compound of Formula I.

Examples of other active ingredients that may be administered in combination with a compound of Formula I, and either administered separately or in the same pharmaceutical composition, include, but are not limited to:

(a) PPAR gamma agonists and partial agonists, including both glitazones and non- glitazones (e.g. troglitazone, pioglitazone, englitazone, MCC-555, rosiglitazone, balaglitazone, netoglitazone, T-131, LY-300512, LY-818, and compounds disclosed in WO02/08188,

WO2004/020408, and WO2004/020409.

(b) biguanides, such as metformin and phenformin;

(c) protein tyrosine phosphatase- IB (PTP-1B) inhibitors;

(d) dipeptidyl peptidase-IV (DPP-4) inhibitors, such as sitagliptin, MK-3102, S YR-472, teneligliptin, KRP104, TS021, AMG222, SK0403, LC15-0444, vildagliptin, saxagliptin, alogliptin, denagliptin, carmegliptin, dutogliptin, melogliptin, and linagliptin;

(e) insulin or insulin mimetics; (f) sulfonylureas such as tolbutamide, glimepiride, glipizide, and related materials;

(g) a-glucosidase inhibitors (such as acarbose);

(h) agents which improve a patient's lipid profile, such as (i) HMG-CoA reductase inhibitors (lovastatin, simvastatin, rosuvastatin, pravastatin, fluvastatin, atorvastatin, rivastatin, itavastatin, ZD-4522 and other statins), (ii) bile acid sequestrants (cholestyramine, colestipol, and dialkylaminoalkyl derivatives of a cross-linked dextran), (iii) niacin receptor agonists, nicotinyl alcohol, nicotinic acid, or a salt thereof, (iv) PPARa agonists, such as fenofibric acid derivatives (gemfibrozil, clofibrate, fenofibrate and bezafibrate), (v) cholesterol absorption inhibitors, such as ezetimibe, (vi) acyl CoA holesterol acyltransferase (ACAT) inhibitors, such as avasimibe, (vii) CETP inhibitors, such as torcetrapib, and (viii) phenolic antioxidants, such as probucol;

(i) PPARa/γ dual agonists, such as muraglitazar, tesaglitazar, farglitazar, and JT-501 ; (j) PPAR6 agonists, such as those disclosed in W097/28149;

(k) anti-obesity compounds, such as fenfluramine, dexfenflurarnine, phentkarnine, subitramine, orlistat, neuropeptide Y Y5 inhibitors, MC4R agonists, cannabinoid receptor 1 (CB- 1) antagonists/inverse agonists (e.g., rimonabant and taranabant), and β3 adrenergic receptor agonists;

(1) ileal bile acid transporter inhibitors;

(m) agents intended for use in inflammatory conditions, such as aspirin, non-steroidal anti-inflammatory drugs, glucocorticoids, azulfidine, and cyclooxygenase-2 (Cox-2) selective inhibitors;

(n) glucagon receptor antagonists;

(o) GLP-1;

(p) GUM;

(q) GLP-1 analogs and derivatives, such as exendins, (e.g., exenatide and liruglatide); (r) Ι ΐβ-hydroxysteroid dehydrogenase- 1 (HSD-1) inhibitors;

(s) inhibitors of cholesteryl ester transfer protein (CETP), such as torcetrapib; (t) SSTR3 antagonists;

(u) other SSTR5 antagonists;

(v) acetyl Co A carboxylase- 1 and/or -2 inhibitors;

(w) AMPK activators;

(x) agonists of GPR-119;

(y) glucokinase agonists; and (z) FGF-21 agonists.

The above combinations include combinations of a compound of the present invention not only with one other active compound, but also with two or more other active compounds. Non-limiting examples include combinations of compounds having Formula I with two or more active compounds selected from biguanides, sulfonylureas, HMG-CoA reductase inhibitors, other PPAR agonists, PTP-1B inhibitors, DPP-4 inhibitors, and cannabinoid receptor 1 (CB1) inverse agonists/antagonists.

Antiobesity compounds that can be combined with compounds described herein include fenfluramine, dexfenfluramine, phentermine, sibutramine, orlistat, neuropeptide Yi or Y5 antagonists, cannabinoid CB1 receptor antagonists or inverse agonists, melanocortin receptor agonists, in particular, melanocortin-4 receptor agonists, ghrelin antagonists, bombesin receptor agonists, and melanin-concentrating hormone (MCH) receptor antagonists. For a review of anti- obesity compounds that can be combined with compounds described herein, see S. Chaki et al., "Recent advances in feeding suppressing agents: potential therapeutic strategy for the treatment of obesity," Expert Opin. Ther. Patents. 11: 1677-1692 (2001); D. Spanswick and K. Lee, "Emerging antiobesity drugs," Expert Opin. Emerging Drugs, 8: 217-237 (2003); and J.A.

Fernandez-Lopez, et al., "Pharmacological Approaches for the Treatment of Obesity," Drugs. 62: 915-944 (2002).

Neuropeptide Y5 antagonists that can be combined with compounds described herein include those disclosed in U.S. Patent No. 6,335,345 (1 January 2002) and WO 01/14376 (1

March 2001); and specific compounds identified as GW 59884A; GW 569180A; LY366377; and CGP-71683A.

Cannabinoid CB1 receptor antagonists that can be combined with compounds described herein include those disclosed in PCT Publication WO 03/007887; U.S. Patent No. 5,624,941, such as rimonabant; PCT Publication WO 02/076949, such as SLV-319; U.S. Patent No.

6,028,084; PCT Publication WO 98/41519; PCT Publication WO 00/10968; PCT Publication WO 99/02499; U.S. Patent No. 5,532,237; U.S. Patent No. 5,292,736; PCT Publication WO 03/086288; PCT Publication WO 03/087037; PCT Publication WO 04/048317; PCT Publication WO 03/007887; PCT Publication WO 03/063781; PCT Publication WO 03/075660; PCT Publication WO 03/077847; PCT Publication WO 03/082190; PCT Publication WO 03/082191; PCT Publication WO 03/087037; PCT Publication WO 03/086288; PCT Publication WO 04/012671; PCT Publication WO 04/029204; PCT Publication WO 04/040040; PCT Publication WO 01/64632; PCT Publication WO 01/64633; and PCT Publication WO 01/64634. Suitable melanocortin-4 receptor (MC4R) agonists include, but are not limited to, those disclosed in US 6,294,534, US 6,350,760, 6,376,509, 6,410,548, 6,458,790, US 6,472,398, US 5837521, US 6699873, which are hereby incorporated by reference in their entirety; in US Patent Application Publication Nos. US 2002/0004512, US2002/0019523, US2002/0137664,

US2003/0236262, US2003/0225060, US2003/0092732, US2003/109556, US 2002/0177151, US 2002/187932, US 2003/0113263, which are hereby incorporated by reference in their entirety; and in WO 99/64002, WO 00/74679, WO 02/15909, WO 01/70708, WO 01/70337, WO

01/91752, WO 02/068387, WO 02/068388, WO 02/067869, WO 03/007949, WO 2004/024720, WO 2004/089307, WO 2004/078716, WO 2004/078717, WO 2004/037797, WO 01/58891, WO 02/070511, WO 02/079146, WO 03/009847, WO 03/057671, WO 03/068738, WO 03/092690, WO 02/059095, WO 02/059107, WO 02/059108, WO 02/059117, WO 02/085925, WO

03/004480, WO 03/009850, WO 03/013571, WO 03/031410, WO 03/053927, WO 03/061660, WO 03/066597, WO 03/094918, WO 03/099818, WO 04/037797, WO 04/048345, WO

02/018327, WO 02/080896, WO 02/081443, WO 03/066587, WO 03/066597, WO 03/099818, WO 02/062766, WO 03/000663, WO 03/000666, WO 03/003977, WO 03/040107, WO

03/040117, WO 03/040118, WO 03/013509, WO 03/057671, WO 02/079753, WO 02//092566, WO 03/-093234, WO 03/095474, and WO 03/104761.

Specific compounds of use in combination with a compound of the present invention include: simvastatin, mevastatin, ezetimibe, atorvastatin, sitagliptin, metformin, sibutramine, orlistat, Qnexa, topiramate, naltrexone, bupriopion, phentermine, and losartan, losartan with hydrochlorothiazide.

Examples of other anti-obesity agents that can be employed in combination with a compound of Formula I, II, III or IV are disclosed in "Patent focus on new anti-obesity agents," Exp. Opin. Ther. Patents, 10: 819-831 (2000); "Novel anti-obesity drugs," Exp. Opin. Invest. Drugs, 9: 1317-1326 (2000); and "Recent advances in feeding suppressing agents: potential therapeutic strategy for the treatment of obesity, Exp. Opin. Ther. Patents, 11 : 1677-1692 (2001). The role of neuropeptide Y in obesity is discussed in Exp. Opin. Invest. Drugs, 9: 1327-1346 (2000). Cannabinoid receptor ligands are discussed in Exp. Opin. Invest. Drugs, 9: 1553-1571 (2000).

The instant invention also includes administration of a single pharmaceutical dosage formulation which contains both a compound of Formula I in combination with a second active ingredient, as well as administration of each active agent in its own separate pharmaceutical dosage formulation. Where separate dosage formulations are used, the individual components of the composition can be administered at essentially the same time, i.e., concurrently, or at separately staggered times, i.e. sequentially prior to or subsequent to the administration of the other component of the composition. The instant invention is therefore to be understood to include all such regimes of simultaneous or alternating treatment, and the terms "administration" and "administering" are to be interpreted accordingly. Administration in these various ways are suitable for the present compositions as long as the beneficial pharmaceutical effect of the combination of the compound of Formula I and the second active ingredient is realized by the patient at substantially the same time. Such beneficial effect is preferably achieved when the target blood level concentrations of each active ingredient are maintained at substantially the same time. It is preferred that the combination of the compound of Formula I and the second active ingredient be co-administered concurrently on a once-a-day dosing schedule; however, varying dosing schedules, such as the compound of Formula I once a day and the second active ingredient once, twice or more times per day or the compound of Formula I three times a day and the second active ingredient once, twice or more times per day, is also encompassed herein. A single oral dosage formulation comprised of both a compound of Formula I and a second active ingredient is preferred. A single dosage formulation will provide convenience for the patient, which is an important consideration especially for patients with diabetes or obese patients who may be in need of multiple medications.

The compounds in the combinations of the present invention may be administered separately, therefore the invention also relates to combining separate pharmaceutical

compositions into a kit form. The kit, according to this invention, comprises two separate pharmaceutical compositions: a first unit dosage form comprising a prophylactically or therapeutically effective amount of the compound of Formula I, or a pharmaceutically acceptable salt or ester thereof, and a pharmaceutically acceptable carrier or diluent in a first unit dosage form, and a second unit dosage form comprising a prophylactically or therapeutically effective amount of the second active ingredient or drug, or a pharmaceutically acceptable salt or ester thereof, and a pharmaceutically acceptable carrier or diluent in a second unit dosage form. In one embodiment, the kit further comprises a container. Such kits are especially suited for the delivery of solid oral forms such as tablets or capsules. Such a kit preferably includes a number of unit dosages. Such kits can include a card having the dosages oriented in the order of their intended use. An example of such a kit is a "blister pack". Blister packs are well known in the packaging industry and are widely used for packaging pharmaceutical unit dosage forms. If desired, a memory aid can be provided, for example in the form of numbers, letters, or other markings or with a calendar insert, designating the days or time in the treatment schedule in which the dosages can be administered.

Pharmaceutical Compositions

Another aspect of the present invention provides pharmaceutical compositions which comprise a compound of Formula I, as an active ingredient or a pharmaceutically acceptable salt thereof, and may also contain a pharmaceutically acceptable carrier and optionally other therapeutic ingredients. The term "pharmaceutically acceptable salts" refers to salts prepared from pharmaceutically acceptable non-toxic bases or acids including inorganic bases or acids and organic bases or acids.

The compositions include compositions suitable for oral, rectal, topical, parenteral (including subcutaneous, intramuscular, and intravenous), ocular (ophthalmic), pulmonary (nasal or buccal inhalation), or nasal administration, although the most suitable route in any given case will depend on the nature and severity of the conditions being treated and on the nature of the active ingredient. They may be conveniently presented in unit dosage form and prepared by any of the methods well-known in the art of pharmacy.

In practical use, the compounds of Formula I can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. The carrier may take a wide variety of forms depending on the form of preparation desired for adrninistration, e.g., oral or parenteral (including intravenous). In preparing the compositions for oral dosage form, any of the usual pharmaceutical media may be employed, such as, for example, water, glycols, oils, alcohols, flavoRing Agents, preservatives, coloRing Agents and the like in the case of oral liquid preparations, such as, for example, suspensions, elixirs and solutions; or carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents and the like in the case of oral solid preparations such as, for example, powders, hard and soft capsules and tablets, with the solid oral preparations being preferred over the liquid preparations.

Because of their ease of administration, tablets and capsules represent the typical oral dosage unit form, in which case solid pharmaceutical carriers are typically employed. If desired, tablets may be coated by standard aqueous or nonaqueous techniques. Such compositions and preparations should contain at least 0.1 percent of active compound. The percentage of active compound in these compositions may, of course, be varied and may conveniently be between about 2 percent to about 60 percent of the weight of the unit. The amount of active compound in such therapeutically useful compositions is such that an effective dosage will be obtained. The active compounds can also be administered intranasally as, for example, liquid drops or spray.

The tablets, pills, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch or gelatin; excipients such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose or saccharin. When a dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier such as a fatty oil.

Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar or both. A syrup or elixir may contain, in addition to the active ingredient, sucrose as a sweetening agent, methyl and

propylparabens as preservatives, a dye and a flavoring such as cherry or orange flavor.

Compounds of Formula I may also be adrninistered parenterally. Solutions or

suspensions of these active compounds can be prepared in water suitably mixed with a surfactant such as hydroxy-propylcellulose. Dispersions can also be prepared in glycerol, liquid

polyethylene glycols and mixtures thereof in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.

The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g. glycerol, propylene glycol and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.

Preparation of Compounds of the Invention

The compounds of Formula I of the present invention can be prepared according to the procedures of the following Schemes and Examples, using appropriate materials and are further exemplified by the following specific examples. Moreover, by utilizing the procedures described herein, one of ordinary skill in the art can readily prepare additional compounds of the present invention claimed herein. The compounds illustrated in the examples are not, however, to be construed as forming the only genus that is considered as the invention. The Examples further illustrate details for the preparation of the compounds of the present invention. Those skilled in the art will readily understand that known variations of the conditions and processes of the following preparative procedures can be used to prepare these compounds. The instant compounds are generally isolated in the form of their pharmaceutically acceptable salts, such as those described previously hereinabove. The free amine bases corresponding to the isolated salts can be generated by neutralization with a suitable base, such as aqueous sodium

hydrogencarbonate, sodium carbonate, sodium hydroxide, and potassium hydroxide, and extraction of the liberated amine free base into an organic solvent followed by evaporation. The amine free base isolated in this manner can be further converted into another pharmaceutically acceptable salt by dissolution in an organic solvent followed by addition of the appropriate acid and subsequent evaporation, precipitation, or crystallization. All temperatures are degrees Celsius unless otherwise noted. All temperatures are degrees Celsius unless otherwise noted. Mass spectra (MS) were measured by electrospray ion-mass spectroscopy (ESMS).

The phrase "standard peptide coupling reaction conditions" means coupling a carboxylic acid with an amine using an acid activating agent such as EDC, DCC, and BOP in an inert solvent such as dichloromethane in the presence of a catalyst such as HOBT. The use of protecting groups for the amine and carboxylic acid functionalities to facilitate the desired reaction and minimize undesired reactions is well documented. Conditions required to remove protecting groups are found in standard textbooks such as Greene, T, and Wuts, P. G. M., Protective Groups in Organic Synthesis, John Wiley & Sons, Inc., New York, NY, 1991. CBZ and BOC are commonly used protecting groups in organic synthesis, and their removal conditions are known to those skilled in the art. For example, CBZ may be removed by catalytic hydrogenation in the presence of a noble metal or its oxide such as palladium on activated carbon in a protic solvent such as methanol or ethanol. In cases where catalytic hydrogenation is contraindicated due to the presence of other potentially reactive functionalities, removal of CBZ groups can also be achieved by treatment with a solution of hydrogen bromide in acetic acid or by treatment with a mixture of TFA and dimethylsulfide. Removal of BOC protecting groups is carried out with a strong acid, such as trifluoroacetic acid, hydrochloric acid, or hydrogen chloride gas, in a solvent such as methylene chloride, methanol, or ethyl acetate.

Abbreviations used in the following Schemes and Examples: aq.: aqueous; API-ES: atmospheric pressure ionization-electrospray (mass spectrum term); Ac: acetate; AcCN: acetonitrile; Boc: tert-butyloxycarbonyl; Celite™: diatomaceous earth; CDI: carbonyl diimidazole; d: day(s); DCM: dichloromethane; DEAD: diethyl azodicarboxylate; DIPEA: N,N-diisopropylethylamine (Hunig's base); DMAP: 4-dimethylaminopyridine; DMF: N,N-dimemylformamide; DMSO: dimethylsulfoxide; EDC: l-ethyl-3-(3- dimethylarru^opropyl)-carbodiimide hydrochloride; EPA: ethylene polyacrylamide (a plastic); eq: equivalent(s); EtOAc: ethyl acetate; EtOH: ethanol; g: gram(s); h or hr: hour(s); Hex: hexane; HOBt: 1-hydroxybenzotriazole; HPLC: high pressure liquid chromatography;

HPLC/MS: high pressure liquid chromatography/mass spectrum; in vacuo: rotary evaporation under diminished pressure; IBX: 2-iodosobenzoic acid; iPrOH or lPA: isopropyl alcohol; EPAC or IP Ac: isopropyl acetate; KHMDS: potassium hexamethyldisilazide; L: liter; LC: Liquid chromatography; LC-MS: liquid chromatography-mass spectrum; LDA: lithium diisopropylamide; M: molar; Me: methyl; MeCN: methylcyanide; Mel: methyl iodide; MeOH: methanol; MHz: megahertz; mg: milligram; min: minute(s); ml or mL: milliliter; mmol: millimole; MPLC: medium-pressure liquid chromatography; MS or ms: mass spectrum; MTBE: methyl tert-butyl ether; N: normal; NaHMDS: sodium

hexamethyldisilazide; run: nanometer; NMR: nuclear magnetic resonance; NMM: N- methylmorpholine; PyBOP: (benzotriazol-l-yloxy)tripyrrolidinophosphonium

hexafluorophosphate; R : retention time; rt or RT: room temperature; satd.: saturated; SFC: super critical fluid chromatography; TEA: triethylamine; TFA: trifluoroacetic acid; TFAA: trifluoroacetic acid anhydride; THF: tetrahydrofuran; TLC or tic: thin layer chromatography; Ts: toluene sulfonyl; and TsOH: toluene sulfonic acid.

General Procedures.

The LC-MS analyses were preformed by one of three methods. Method A - Waters Xterra

C-18, 3.5 micron 2.1x20 mm column eluting at 1.5 mL/min with a solvent gradient of 10 to 98% B over 3.25 min, followed by 0.75 min at 98% B: solvent A = 0.05% TFA in water; solvent B = 0.05% TFA in acetonitrile. Method B - Waters Xterra C-18, 3.5 micron 2.1x20 mm column eluting at 1.5 mL/min with a solvent gradient of 10 to 98% B over 1.25 min, followed by 0.75 min at 98% B: solvent A = 0.05% TFA in water; solvent B = 0.05% TFA in acetonitrile. Method

C- Waters Acquity UPLC C-18, 1.7 micron 2.1x50 mm column eluting at niL/min with a gradient of 5-100% MeCN in water with 0.1% TFA over 2 min. All three methods utilized electrospray ionization and positive ion detection for mass analysis. iH-NMR spectra were obtained on a 500 MHz VARIAN Spectrometer in CDCI3 or CD3OD as indicated and chemical shifts are reported as δ using the solvent peak as reference and coupling constants where reported are in hertz (Hz). The GPR131 agonists of formula I, particularly the agonists of Examples 1-92, exihibit EC50 values of A (less than or equal to 10 nM), B (greater than or equal to 10 nM but less than 100 nM), C (greater than or equal to 100 nM but less than 1000 nM) and D (greater than or equal to 1000 nM but less than 10,000 nM).

Several methods for preparing the compounds of this invention are illustrated in the following Schemes and Examples. Starting materials are either commercially available or made by known procedures in the literature or as illustrated. The present invention further provides processes for the preparation of compounds of structural Formula I as defined above. In some cases the order of carrying out the foregoing reaction schemes may be varied to facilitate the reaction or to avoid unwanted reaction products. The following schemes and examples are provided for the purpose of illustration only and are not to be construed as limitations on the disclosed invention. All temperatures are degrees Celsius unless otherwise noted.

Compounds of the present invention may be prepared using procedures analogous to the procedures exemplified in Schemes 1, 2, 3, 4, 5, and 6.

SCHEME 2

SCHEME 4

SCHEME 5

SCHEME 6

3 -(5-( 3.5-Bis(trifluoromethvnphenylV 1 H-imidazol- 1 -ylV4-cMoropyridine fL-002423 S06) Step A: N-((3,5-Bis(trifluoromethyl)phenvOmefa^

To 3,5-bis(trifluoromethyl)benzaldehyde (1 g, 4.13 mmol) in 1 ,2-Dichloroethane (10 ml), 3-amino-4-chloropyridine (0.53 g, 4.12 mmol) was added and heated to reflux. After 10 min, 0.5 g of MgS04 was added and heating was continued overnight. The reaction was cooled, diluted with ether and filtered through Na2S04. The filtrate was concentrated and the residue was purified on a flash column using 20-50% EtOAc-hexane to isolate 540 mg of N-((3,5- bis(trifluoromethyl)phenyl)methylene)-4-chloropyridine-3-amine. iH NMR (500 MHz, CDCI3): δ 7.48 (lH,d),8.08 (s, 1H), 8.32 (s, IH), 8.45 (m, 3H), 8.58 (s, IH). Step B: 3-(5-(3 ,5-Bis(trifluoromethyr)phenylV 1 H-imidazol- 1 -yl)-4-chloropyridine mine

To a solution of N-((3,5-bis(trifluoromethyl)phenyl)methylene)-4-chloropyridine- 3-amine (540 mg, 1.531 mmol) in THF (4 ml), lH-benzotriazol-lylmethyl isocyanide (400 mg, 2.53 mmol) was added and the solution was cooled in a -20 °C bath. To this reaction potassium t-butoxide (1M, 5 ml, 5.00 mmol) was added dropwise. The reaction turned dark as the base was added. After stirring for 30 min while the bath warmed to 0 °C, the reaction was quenched with water and extracted with EtOAc. The organic layer was washed with brine, dried and

concentrated. The residue was purified on a flash column using 50-100% EtOAc-hexane followed by 10% MeOH-EtOAc to isolate 237 mg of 3-(5-(3,5-bis(trifluoromethyl)phenyl)-lH- imidazol-l-yl)-4-chloropyridine. lH NMR (500 MHz, CDCI3): δ 7.54 (m, 4H), 7.76 (s, lH), 7.78 (s, 1H), 8.61 (s, 1H), 8.67 (d, 1H).

3-(5-(3,5-Bisitrifluoromethyl)phenyl)-lH-in^ (L-

002398442) In a microwave vial 2-methoxyphenylboronic acid (70 mg, 0.461 mmol),

Pd2(dba)3 (6 mg, 6.55 μιηοΐ), tricyclohexylphosphine (5 mg, 0.018 mmol) and K3P04 (120 mg, 0.565 mmol) were added. The vial was evacuated and filled with N2 (3x), and a solution of 3-(5- (3, 5-bis(trifluoromethyl)phenyl)-l H-imidazol- l-yl)-4-chloropyridine (120 mg, 0.306 mmol) in 1.5 ml of dioxane was added followed by 0.8 ml of water. The reaction was flushed with N2, the vial was sealed and heated in a microwave at 120 °C for 30 min. The reaction was diluted with EtOAc, washed with water, brine, dried and concentrated. The residue was purified on a prep TLC plate using 94:5:1 CH2C12-MeOH-NH40H to give 3-(5-(3,5-bis(trifluoromethyl)phenyl)- lH-imidazol-l-yl)-4-(2-methoxyphenyl)pyridine. LC-MS m/e = 464.2, RT =1.91 min, iH NMR (500 MHz, CDCI3): δ 3.41 (s, 3H), 6.4 (br S, 1H), 6.6-7.8 (m, 9H), 8.76 (m, 2H). hGPR131 EC50 (nM) = A.

3 -(5-( 3 ,5 -BisCtrifluoromethyllphenvD- 1 H-imidazol- 1 -yl)-4-(4-fluoro-2-methoxyphenyl)pyridine (L-002398441 To 3 -(5-(3 ,5 -bis(trifluoromethyl)phenyl)- 1 H-imidazol- 1 -yl)-4-chloropyridine (153 mg, 0.391 mmol) in 2 ml of dioxane, 4-fluoro-2-methoxy-phenylboronic acid (130 mg, 0.765 mmol), Na2C03 (100 mg, 0.943 mmol) and 0.8 ml of water were added. N2 gas was bubbled through the solution, PdC12(dppf)-CH2C12 adduct (20 mg, 0.024 mmol) was added and the mixture degassed for 5 min. The vial was sealed and heated in a microwave at 120 °C for 30 min. The reaction was not complete, so another 130 mg of 4-fluoro-2-methoxy-phenylboronic acid, 100 mg of Na2C03 and 24 mg of PdC12-DPPF were added and heated in a microwave for 30 min. The reaction was diluted with EtOAc, washed with water, brine, dried and concentrated. The residue was purified on a prepTLC plate using 94:5:1 CH2C12-MeOH-NH40H but the product was not pure so it was rechromatographed on prepTLC plate using the same solvent to give 3-(5-(3,5-bis(trifluoromethyl)phenyl)-lH-imidazol-l-yl)-4-(4-fluoro-2- methoxyphenyl)pyridine. LC-MS m/e = 482.1, RT = 1.94 min, iHNMR (500 MHz, CDCI3); δ

-7.8 (m, 6H), 8.76 (m, 2H). hGPR131 EC50 (nM) = A.

3 - { 5 -[3 -iodo-5-(trifluoromethyl)phenyl] - 1 H-imidazol- 1 -yl } -4-(2-methoxyphenyl)pyridine

Step A: 4-(2-memoxyphenyl)p idm-3-aniine

To apre-mixed solution of tris(dibenzylideneacetone)dipalladium (5.83mmol, 5.34g) and 2-dicyclohexylphosphino-2',6'-dimethoxybiphenyl (11.67mmol, 4.79g) in dioxane (120mL) was added 4-chloropyridin-3 -amine (117mmol, 15g), 2M Na2C03 (351mmol) and 2- methoxyboronic acid (152mmol, 23.05g). The mixture was diluted with an additional lOOmL of dioxane and refluxed for 36 h. The reaction was complete as judged by LCMS and TLC. The solution was allowed to cool to RT and diluted with EtOAc (lOOmL). The organic layer was washed with water and brine and dried with MgS0₄. The solution was filtered and concentrated under vacuum. The crude product was purified by chromatography on silica gel, eluting with EtOAc / Hexane to afford the title compound (17g). LC/MS: m/e 201.2 (M+H). 1H NMR (500 MHz, CDC1₃): δ 8.17 (IH, s), 8.08 (IH, d), 7.43 (1, t), 7.27 (IH, dd), 7.09 (IH, t), 7.05 (IH, d), 7.04 (IH, s), 3.85 (3H, s), 3.78 (2H, s). Step B: 3-i5-r3-iodo-5-(^,trifluoromethyl phenyll-lH-imidazol-l-vU-4-(2- methoxyphenvDpyridine

A solution of 4-(2-methoxyphenyl)pyridin-3-amine (14.98mmol, 3.0g) and 3- iodo-5-(trifluoromethyl)benzaldehyde (16.48mmol, 4.94g) in toluene (30mL) was refluxed in a dean-stark apparatus for 16 h. The reaction was judged complete by TLC. The solution was cooled to RT, concentrated under vacuum and the crude product was purified by chromatography on silica gel, eluting with EtOAc / Hexane to afford the imine intermediate (7.3g).

A solution of this imine (15.14mmol, 7.3g) and lH-benzotriazol-lylmethyl isocyanide (18.92mmol, 2.99g) in THF (30mL) was cooled to 0°C and potassium tert-butoxide in THF (22.71mmol) was slowly added to the solution. The mixture was allowed to warm to RT. After stirring for 1 h, the reaction was complete as judged by LCMS. The solution was poured into water (50mL) and the two layers were partitioned. The organic layer was diluted with EtOAc (30mL) and washed with water and brine, dried with MgS0₄, filtered and concentrated under vacuum. The crude product was purified by chromatography on silica gel, eluting with MeOH / DCM to afford the title compound. LC/MS: m/e 522.0 (M+H). 1H NMR (500 MHz, CDC1₃): δ 8.75 (IH, d), 8.74 (IH, s), 7.74 (1, s), 7.70 (IH, s), 7.35 (IH, d), 7.30 (IH, t), 7.21 (IH, s), 7.13 (IH, s), 6.90 (IH, s), 6.73 (IH, t), 6.70 (IH, d), 6.46 (IH, s), 3.43 (3H, s). hGPR131 EC50 (nM) = A.

EXAMPLE 4

3-{l-[4-(2-memoxyphenyl)pyridm-3-yl]-lH-imidazol-5-yl}-5-(trifl

To a solution of 3-{5-[3-iodo-5-(trifluoromethyl)phenyl]-lH-imidazol-l-yl}-4-(2- methoxyphenyl)pyridine (0.518mmol, 270mg) in DMF (3mL) was added

tris(dibenzylideneacetone)dipalladium (0.052mmol, 47.4mg), Ι,Γ- bis(diphenylphosphino)ferrocene (0.104mmol, 51.4mg) and zinc cyanide (0.518mmol, 60.8mg). The reaction was stirred at 120°C for 16 h. Reaction was complete as judged by LCMS. Cooled the solution to RT and diluted with EtO Ac (3 OmL). Wash with water and brine. Dried the organic layer with MgS0₄, filtered the solution and concentrate under vacuum. The crude product was purified by reverse phase HPLC to afford the title compound. LC/MS : m/e 421.1 (M+H)⁺. 1H NMR (500 MHz, CDC1₃): δ 8.78 (1H, d), 8.76 (1H, s), 7.74 (1, s), 7.71 (1H, s), 7.37 (1H, d), 7.32 (2H, m), 7.18 (3H, m), 6.72 (2H, m), 3.43 (3H, s). hGPR131 EC50 (nM) = B.

1 -[3-{ 1 -[4-(2-methoxyphenyl)pyridin-3-yl]- lH-imidazol-5-yl} -5- (trifluoromethyl)phenyl]methanamine.

A solution of 3 - { 1 - [4-(2-methoxyphenyl)pyridin-3 -yl] - 1 H-imidazol-5 -yl } -5 - (trifluoromethyl)benzonitrile (0.048mmol, 20mg) in THF (3mL) was cooled to 0°C. 1M DIBAL- H in toluene (0.143mmol, 143uL) was slowly added. The solution was then heated to 65°C for 5 min. Reaction was complete as judged by LCMS. Cooled the solution to RT and quenched with a few drops of aq. 15% NaOH. The solution was then dried with MgS0₄, filtered, and concentrated under vacuum. The crude product was purified by reverse phase HPLC to afford the title compound. LC/MS: m/e 425.1 (M+H)⁺. hGPR131 EC50 (nM) = D.

l-[3-{l - [4-(2-methoxyphenyl)pyridin-3 -yl] - 1 H-imidazol-5 -yl } -5- (trifluoromethyl)phenyl]methylsulfone

To a solution of 3-{5-[3-iodo-5-(trifluoromemyl)phenyl]-lH-imidazol-l-yl}-4-(2- methoxyphenyl)pyridine (0.576mmol, 300mg) in DMSO (3mL) was added methanesulfinic acid sodium salt (0.691mmol, 71mg), Cul (0.058mmol, 1 lmg) and L-proline (0.115mmol, 13mg). The reaction was stirred at 80°C for 16 h. Reaction was complete as judged by LCMS. Cooled the solution to RT and diluted with EtOAc (30mL) and water (30mL). The two phases were partitioned and the organic layer was dried with MgS0₄. The solution was filtered and concentrated under vacuum. The crude product was purified by reverse phase HPLC to afford the title compound. LC/MS: m/e 474.0 (M+H)⁺. 1H NMR (500 MHz, CDC1₃): δ 8.73 (IH, d), 8.71 (IH, s), 7.98 (1, s), 7.71 (IH, s), 7.48 (IH, s), 7.36 (IH, d), 7.27 (3H, m), 6.69 (2H, d), 6.49 (IH, s), 3.40 (3H, s), 2.95 (3H, s). hGPR131 EC50 (nM) = B.

3 - { 1 -[4-(2-methoxyphenyl)pyridin-3 -yl]- 1 H-imidazol-5-yl} -5-(trifluoromethyl)benzoic acid To a solution of 3-{l-[4-(2-methoxyphenyl)pyridin-3-yl]-lH-imidazol-5-yl}-5- (trifluoromethyl)benzonitrile (1.18mmol, 500mg) in MeOH (3mL) was added 5N NaOH

(300uL). The solution was refluxed for 16 h and judged complete by LCMS and TLC. Cooled the solution to RT and quenched the reaction with IN HCl till pH 6. The solution was extracted with EtOAc (60 mL) and the organic layer was dried with MgS0₄, filtered, and concentrated under vacuum. The crude product was purified by reverse phase HPLC to afford the title compound. LC/MS: m/e 440.0 (M+H)⁺. 1H NMR (500 MHz, DMSO-de): δ 8.99 (IH, s), 8.89 (IH, s), 8.79 (IH, d), 8.02 (1, s), 7.73 (IH, s), 7.45 (IH, s), 7.43 (2H, d), 7.24 (2H, m), 7.17 (IH, s 6.81 (IH, d), 6.61 (IH, m), 3.34 (3H, s). hGPR131 EC50 (nM) = C.

3 - { 1 - [4-(2-methoxyphenyl)pyridin-3 -yl] - 1 H-imidazol-5 -yl } -5-(trifluoromethyl)benzamide To a solution of 3-{l-[4-(2-methoxyphenyl)pyridin-3-yl]-lH-imidazol-5-yl}-5-

(trifluoromethyl)benzoic acid (0.364mmol, 160mg) in DMF (2mL) was added DIEA

(1.092mmol, 191uL), HBTU (0.728mmol, 276mg), and ammonia in dioxane (2.185mmol). The solution was heated to 80°C. After stirred for 15 min, the reaction was judged complete by LCMS. The solution was allowed to cool to RT and diluted with ethyl acetate (30mL). The organic layer was washed with water and brine and dried with MgS0₄. The solution was filtered and concentrated under vacuum. The crude product was purified by reverse phase HPLC to afford the title compound. LC/MS: m/e 439.0 (M+H)⁺. 1H NMR (500 MHz, DMSO-d₆): δ 8.81 (IH, s), 8.70 (IH, d), 8.06 (IH, s), 7.99 (IH, s), 7.95 (IH, s), 7.52 (2H, m), 7.38 (IH, d), 7.24 (IH, s), 7.21 (IH, t), 6.98 (IH, s), 6.75 (IH, d), 6.61 (IH, m), 6.38 (IH, m), 3.33 (3H, s).

hGPR131 EC50 (nM) = C.

l-[3-{l-[4-(2 -methoxyphenyl)pyridin-3 -yl] - 1 H-imidazol- 5 -yl } -5 -(trifluoromethyl)phenyl] ethanol

To a solution of 3- {5-[3-iodo-5-(trifluoromethyl)phenyl]-l H-imidazol- l-yl}-4-(2- methoxyphenyl)pyridine (0.863mmol, 450mg) in THF (5mL) at -78°C was added

isopropylmagnesiurn chloride (5.18mmol, 2.59mL) and stirred for 30min. Then acetaldehyde (10.36mmol, 456mg) was added to the solution and the flask was allow to slowly warm to rt. After 1 h the reaction was judged completed by LCMS. The mixture was slowly quenched with sat. ammonium chloride and diluted with EtOAc (30mL). The two phases were partitioned and the organic layer was washed with water and brine and dried with MgS0₄. The solution was filtered and concentrated under vacuum. The crude product was purified by reverse phase HPLC to afford the title compound. LC/MS: m/e 440.0 (M+H)⁺. 1H NMR (500 MHz, CDC1₃): δ 8.72 (1H, d), 8.71 (1H, s), 7.65 (1, s), 7.48 (1H, s), 7.35 (1H, d), 7.26 (1H, d), 7.14 (1H, s), 6.95 (2H, m), 6.70 (2H, m), 6.49 (1H, m), 4.78 (1H, q), 3.43 (3H, s), 1.36 (3H, d). hGPR131 EC50 (nM) = C.

l-[3-{l-[4-(2-methoxyphenyl)pyridin-3-yl]-lH-imidazol-5-yl}-5- (trifluoromethyl)pheny 1] ethanone A solution of l-[3-{l-[4-(2-methoxyphenyl)pyridin-3-yl]-lH-imidazol-5-yl}-5-

(trifiuoromethyl)phenyl]ethanol (0.046mmol, 20mg) in DCM (5mL) was cooled to 0°C and then Dess-Martin periodinane (0.068mmol, 29mg) was added. The reaction was slowly warmed to rt. After stirring for 15 min the reaction was judged completed by LCMS. The mixture was poured into IN HaOH (25mL) and extracted with ethyl acetate (50mL). The organic layer was washed with water and brine and dried with MgS0₄. The solution was filtered and concentrated under vacuum. The crude product was purified by reverse phase HPLC to afford the title compound.

LC/MS: m/e 438.0 (M+H)⁺. 1H NMR (500 MHz, CDC1₃): δ 8.75 (1H, d), 8.74 (1H, s), 8.01 (1, s), 7.71 (1H, s), 7.46 (1H, s), 7.35 (1H, d), 7.26-7.17 (3H, m), 6.67 (2H, m), 6.44 (1H, m), 3.39 (3H, s), 2.43 (3H, s). hGPR131 EC50 (nM) = B.

3 '-(5 -(3 ,5-Bis(trifluoromethvDphenvD- 1 H-imidazol- 1 -vD-2-methoxy -3.4'-bipyridine

In a microwave tube a solution of 3-(5-(3,5-bis(trifluoromethyl)phenyl)-lH- imidazol-l-yl)-4-chloropyridine (100 mg, 0.255 mmol) and 2-methoxy-3-pyridineboronic acid in 2 ml of dioxane and 0.8 ml of water was degassed and tetralds(triphenylphosphine)palladium (15 mg, 0.013 mmol) was added. The mixture was further degassed and heated in a microwave at 150 °C for 20 min. The solution was partitioned between water and EtOAc. The organic layer was washed with brine, dried and concentrated. The residue was purified by prep TLC using 12:8:2 mixture of hexane-EtOAc-MeOH to afford the title compound. iH NMR (500 MHz, CD30D): 6 3.5 (s, 3H), 6.7- 8.95 (m, 11H). hGPR131 EC50 (nM) = A.

3-(5-( 3.5-Bis( trifluoromethyl phenylV 1 H-imidazol- 1 -ylV4-(2-hvdroxyphenyl pyridine To 3-(5-(3,5-bis(trifluoromethyl)phenyl)- 1 H-imidazol- 1 -yl)-4-(2- methoxyoxyphenyl)pyridine (65 mg, 0.140 mmol, example 1), pyridine hydrochloride (330 mg, 2.86 mmol) was added and the mixture was heated in microwave at 200 °C for 30 min. The reaction was -60% complete but could not heat the vial again in the microwave because the volume of the solid was too small. So the vial was heated in an oil bath at 200 °C for 45 min more. The reaction was cooled and the solid was partitioned between water-EtOAc. The organic layer was washed with brine, dried and concentrated. The residue was purified on a prep TLC plate using 94:5:lCH2C12-MeOH-NH40H to give 3-(5-(3,5-bis(trifluoromethyl)phenyl)-lH- imidazol-l-yl)-4-(2-hydroxyphenyl)pyridine. LC-MS m/e = 450.0, RT =2.15 min, lH NMR (500 MHz, CDCI3): δ 6.19 (d, 1H), 6.50 (t, 1H), 6.89 (d, 1H), 7.10 (s, 2H), 7.13 (s, 1H), 7..17 (td,

1H), 7.36 (d, 1H), 7.71 (s, 1H), 7.96 (s, 1H), 8.83 (d, 1H), 8.89 (s, 1H). hGPRDl EC50 (nM) = C.

3-(5-(3.5-Bis(trifluoromethyl phenyl)-lH-imidazol-l-ylV4-(2-methoxyphenyl pyridm^ A solution of 3-(5-(3,5-bis(trifluoromethyl)phenyl)-lH-imidazol-l-yl)-4-(2- methoxyphenyl)pyridine (60 mg, 0.129 mmol, example 1) in CH2C12 (1 ml), was treated with meta-chloroperbenzoic acid (mCPBA,35 mg, 0.142 mmol). After 1.5 hr -50% of SM was consumed so another 35 mg of mCPBA was added and stirred overnight. The reaction was diluted with CH2C12, washed with aq. Na2C03, brine, dried and concentrated. The residue was purified on a prep TLC plate using 94:5:1 CH2C12-MeOH-NH40H to give 3-(5-(3,5- bis(trifluoromemyl)phenyl)-lH-imidazol-l-yl)-4-(2-methoxyphenyl)pyridine-N-oxide. LC-MS m/e = 480.0, RT =2.10 min, lH NMR (500 MHz, CDCI3): δ 3.40 (s, 3H), 6.3 (br, 1H), 6.6.3 (m,

2H), 7.05-7.4 (m, 5H), 7.70 (s, 1H), 7.77 (s, 1H), 8.34 (d, 1H), 8.51 (s, 1H). hGPR131 EC50 (nM) = C.

3-(l-(3.5-Bis(trifluoromethyl)phenyin

Step A: 4-Chloro-N-methoxy-N-methyl-nicotinamide

To 4-chloro-nicotinic acid (1 g, 6.35 mmol) in MeCN (15 ml), Et3N (1 ml, 7.17 mmol) was added. After 5 min, CDI (1.1 g, 6.78 mmol) was added in portions. The mixture was heated in a 80 °Cbath for 1.5 hr and N,0-dimethylhydroxylaminehydrochloride (0.65 g, 6.66 mmol) were added. Heating was continued for 2 hr and the reaction was allowed to cool overnight. The solution was concentrated to ~5 ml and the residue was partitioned between water-EtOAc. The aq. Layer was extracted with EtOAc and the combined organic layer was washed with brine, dried and concentrated. The residue was chromatographed on a flash column using 50-100% EtOAc-hexane to yield 4-cWoro-N-memoxy-N-memyl-m^otinamide. lH NMR (500 MHz, CDCI3): δ 3.43 (br s, 3H), 3.5 (br s, 3H), 7.4 (d, 1H), 8.56 (d, 1H), 8.59 (s, 1H).

Step B: 4-(2-memoxyphenyl)-N-methoxy-N-memylnicotinamide

In a microwave vial 2-methoxy-phenylboronic acid (340 mg, 2.237 mmol), Pd2(dba)3 (25 mg, 0.027 mmol), tricyclohexylphosphine (25 mg, 0.089 mmol) and K3P04 (600 mg, 2.83 mmol) were added. The vial was evacuated and filled with N2 (3x), and a solution of 4- chloro-N-methoxy-N-methyl-nicotinamide (300 mg, 1.495 mmol) in dioxane (3 ml) was added followed by water (1.5 ml). The solution was degassed; the vial was sealed and heated in a microwave at 120 °C for 30 min. The reaction was diluted with EtOAc, washed with water, brine, dried and concentrated. The residue was purified on a flash column using 30-100%

EtOAc-hexane, followed by 10% MeOH-EtOAc to isolate 410 mg of 4-(2-methoxyphenyl)-N- methoxy-N-methylnicotinamide. lH NMR (500 MHz, CDCI3): δ 3.1 (br s, 3H), 3.4 (br S, 3H), 3.78 (s, 3H), 6.95-7.45 (m, 5H), 8.68 (d, 1H), 8.74 (s, 1H).

Step C: N-(T4-(2-Memoxyphenyl pyridin-3-yl meth^ A solution of 4-(2-methoxyphenyl)-N-methoxy-N-methylnicotinarnide (410 mg, 1.506 mmol) in THF (5 ml) was cooled in an ice bath and LAH (40 mg, 1.054 mmol) was added in portions. Gas evolution was observed. After stirring for 30 min the reaction was not complete so another 10 mg of LAH was added and stirred for 10 min. Excess LAH was quenched with acetone, the reaction was diluted with ~10 ml of ether and IN NaOH was added until Al salts separated. Solid Na2S04 was added to the mixture to absorb water and Al salts and the solution was filtered through more Na2S04. The filtrate was concentrated leaving 398 mg of crude aldehyde. To this material, 3,5-bis (trifluoromethyl)amTine (345 mg, 1.506 mmol) was added, the liquid was stirred for 30 min and MgS04 (30 mg, 0.249 mmol) was added. After 30 min TLC showed imine but mostly aldehyde so another 30 mg of MgS04 was added and the reaction was heated in a 100 °C bath for 6 hr. The reaction was cooled, diluted with EtOAc and filtered through a pad of Na2S04. The filtrate was concentrated and the residue was purified on a flash column using 10-60% EtOAc-hexane to give N-((4-(2-methoxyphenyl)pyridin-3-yl)methylene)- 3,5-bis(trifluoromethyl)aniline. iH NMR (500 MHz, CDCI3): δ 3.83 (s, 3H), 7.06 (d, 1H), 7.15 (t, 1H), 7.2-7.55 (m, 5 H), 7.72 (s, 1H), 8.29 (s, 1H), 8.79 (d, 1H), 9.45 (s, 1H).

Step D: 3-(l-(3.5-Bisrtrifluoromethvnphenyl lH-imidazol-5-yl -4-r2- methoxyphenvDpyridine To N-((4-(2-methoxyphenyl)pyridin-3 -yl)methylene)-3 ,5 - bis(trifluoromethyl)aniline (320 mg, 0.75 mmol) in DME (5 ml), p-toluenesulfonylmethyl isocyanide (TosMIC) (165 mg, 0.85 mmol) was added. After the solid dissolved, potassium t- butoxide (180 mg, 1.6 mmol) was added. A precipitate was formed and the mixture was brown. After 5 min, the reaction was heated in 85 °C bath for 30 min, when TLC indicated complete reaction. The solution was cooled and partitioned between water, EtOAc. The organic layer was washed with satd. NaHC03, brine, dried and concentrated. The residues were combined and purified on prep TLC plates using 94:5:1 CH2C12-MeOH-NH40H but the product was not pure. So it was repuriifed on a flash column using a gradient of CH2C12 to 10% B in CH2C12 where B was 78:20:2 CH2C12-MeOH-NH40H to yield 3-(l-(3,5-bis(trifluoromethyl)phenyl)-lH- imidazol-5-yl)-4-(2-methoxyphenyl)pyridine. LC-MS m/e = 464.0, RT =2.06 min, iH NMR (500 MHz, CDCI3): δ 3.4 (s, 3H), 6.62 (d, IH), 6.76 (t, IH), 7.07 (s, 2H), 7.24 (t, IH), 7.3 (m, 3H),

7.64 (s, IH), 7.74 (s, 1H),8.66 (d, IH), 8.8 (s, IH). hGPR131 EC50 (nM) = A.

3-(4-(3,5-Bis(trifluoromemyl pheny (L-

002433103

A solution of 2-(3,5-bis(trifluoromemyl)phenyl)-l-(4-(2-memoxyphenyl)pyridin- 3-yl)ethanone in 1 ml of N,N-dimethylformamide dimethyl acetal and 0.01 ml of DMF was heated in a microwave at 150 °C for 30 min. The reaction was diluted with toluene, concentrated, diluted and concentrated again to remove all DMF-acetal. The residue was dissolved in 1 ml of EtOH, hydroxylamine hydrochloride (100 mg. 1.439 mmol) was added and the mixture heated in a microwave at 100 oc for 30 min. The reaction was concentrated and the residue was partitioned between water-EtOAc. The organic layer was washed with brine, dried and concentrated. The rsidue was purified on a prep TLC plate using 50% EtOAc-hexane to yield 3-(4-(3,5- bis( fluoromethyl)phenyl)-isoxazol-3-yl)-4-(2-methoxyphenyl)pyridine. LC-MS m/e = 465.0, RT =2.56 min, lH NMR (500 MHz, CDCI3): δ 3.44 (s, 3H), 6.6 (m, 3H), 7.1 -7.4 (m, 4H), 7.69

(s, 1H), 8.34 (s, 1H), 8.81 (, 1H), 8.95 (s, 1H). hGPR131 EC50 (nM) = A.

E 18

3 -(4-(3 ,5-Bis(trifluoromethyl)phenyl - 1 H-imidazol-5 -ylV4-(2-methoxyphenyl)pyridine

-(5-(3,5-Bis(trifluoromethyl^

3-(4-(3,5-Bis(trifluoromethyl^

Step A: 2-(3,5-bis(trifluoromethyl)phenyl)-l-(4-(2-methoxyphenyl)pyridin-3- yl)ethandione To 2-(3,5-bis(trifluoromethyl)phenyl)-l-(4-(2-methoxyphenyl)pyridin-3- yl)ethanone (500 mg, 1.138 mmol), DMSO (3 ml) was added. After all solid dissolved, NBS (250 mg, 1.405 mmol) was added and stirred for 2.5 days. The reaction was diluted with -10 ml of water. The color changed from yellow to dark brown when water was added. After stirring for 20 min, the solution was extracted with EtO Ac-ether. The organic layer was washed with water, aq. NaHS03, brine, dried and concentrated leaving 494 mg of 2-(3,5- bis(trifluoromethyl)phenyl)-l-(4-(2-methoxyphenyl)pyridin-3-yl)ethandione as a dark solid which was used without purification. lH NMR (500 MHz, CDCI3): δ 3.51 (s, 3H), 6.37 (d, IH),

6.88 (t, IH), 7.09 (t, IH), 7.12 (d, IH), 7.31 (d, IH), 8.07 (s, IH), 8.19 (s, 2H), 8.87 (d, IH), 9.11 (s, IH).

Step B: 3-(4-(3 -BisrtrifluoromemvnphenylVlH-imidazol-5-ylV4-r2- methoxyphenvDpyridine, 3-(5-(3.5-Bis(trifluoromethyl phenyl)-l,3-oxazol-4-vn-4-(2- methoxyphenvDpyridine and 3-(4-(3,5-Bis(trifluoromethyl)phenyl)-l .3-oxazol-5-yl)-4-(2- methoxyphenvDpyridine To 2-(3 ,5-bis(trifluoromethyl)phenyl)- 1 -(4-(2-methoxyphenyl)pyridin-3- yl)ethandione (300 mg, 0.662 mmol), formamide (3 ml, 75 mmol) and paraformaldehyde (120 mg, 4.00 mmol) were added and the mixture was heated in a 210 °C bath for 1 hr. The reaction was cooled, partitioned between water and EtOAc. The organic layer was washed with water, brine, dried and concentrated. The residue was purified on a flash column using 10-30% B in CH2C12 where B was 78:20:2 CH2C12-MeOH-NH40H to isolate three impure products. Bottom spot was purified by reverse phase HPLC to yield 3-(4-(3,5-bis(trifluoromethyl)phenyl)-lH- imidazol-5-yl)-4-(2-methoxyphenyl)pyridine. LC-MS m/e = 464.0, RT =1.68 min, lH NMR (500 MHz, CDCI3): 6 3.43 (s, 3H), 6.65-7.8 (m, 11H), 8.6 (br s, 1H). hGPR131 EC50 (nM) = B. The middle spot was purified by reverse phase HPLC to obtain 3-(5-(3,5- bis(trifluoromemyl)phenyl)-l,3-oxazol-4-yl)-4-(2-memoxyphenyl)pyridine; LC-MS m/e = 465.0, RT =1.91 min, lH NMR (500 MHz, CDCI3): δ 3.43 (s, 3H), 6.63 (d, 1H), 6.73 (t, 1H), 6.89 (d,

1H), 7.14 (t, 1H), 7.36 (d, 1H), 7.57 (s, 2H), 7.72 (s, 1H), 7.99 (s, 1H), 8.73 (d, IH), 8.81 (s, 1H). hGPR131 EC50 (nM) = B.

;and top spot was purified by reverse phase HPLC to isolate 3-(4-(3,5- bis(trifluoromethyl)phenyl)-l,3-oxazol-5-yl)-4-(2-methoxyphenyl)pyridine. LC-MS m/e = 465.0, RT =2.08 min, lH NMR (500 MHz, CDCI3): δ 3.45 (s, 3H), 6.66 (d, IH), 6.71 (t, 1H), 6.82 (d,

1H), 7.16 (t, IH), 7.38 (d, IH), 7.66 (s, 2H), 7.69 (s, IH), 7.99 (s, IH), 8.8 (m, 2H).

hGPR131 EC50 (nM) = B.

4-(2-memoxyphenyl)-3-{l-[2-cyclopropoxy-5-(trifluoromethoxy)phenyl]-lH-pyrazol-5- yl} pyridine

Step A: Di-tert-butyl- 1 - [2-(cyclopropyloxy)-5 -(rtfluoromethoxy)phenyl]hvdrazme- 1 ,2- dicarboxylate

To a pre-mixed solution of lithium chloride (0.698mmol, 29.6mg) and isopropylmagnesium chloride (0.698mmol, 349uL) in THF (15mL) at -78°C was added 1- (cyclopropyloxy)-2-iodo-4-(trifluoromethoxy)benzene (0.581mmol, 200mg) in THF. The solution was stirred for 30 min and then di-tert-butyl azodicarboxylate (2.325mmol, 535mg) was slowly added. The mixture was allowed to stir at -78°C for 15 min and then slowly warmed to RT where it was stirred for an additional 1 h. The solution was poured into sat. ammonium chloride (40mL) and diluted with ethyl acetate (50mL). The two phases were partitioned and the organic layer was washed with water and brine and dried with MgS0₄. The solution was filtered and concentrated under vacuum. The crude product was purified by chromatography on silica gel, eluting with EtOAc / Hexane to afford the title compound (140mg). LC/MS: m/e 449.0 (M+H).

Step B; ^-ecvclopropyloxy^-S- trifluoromethoxylphenyllhvdrazine

A solution of Di-tert-butyl-l-[2-(cyclopropyloxy)-5- (trifluoromethoxy)phenyl]hydrazine-l,2-dicarboxylate (0.312mmol, 140mg) in neat TFA (ImL) was stirred for 30 min and then concentrated under vacuum. The residual oil was used as crude. LC/MS: m/e 249.1 (M+H).

Step C: 4-(2-methoxyphenvD-3 - { 1 - r2-cvclopropoxy-5 -(trifluoromethoxy)phenyll - 1 H- pyrazol-5-yl I pyridine

A solution of (3E)-4-(dimethylamino)-l-[4-(2-memoxyphenyl)pyridin-3-yl]but-3- en-l-on (0.051mmol, 15mg) and [2-(cyclopropyloxy)-5-(trifluoromethoxy)phenyl]hydrazine (0.253mmol, 62.8mg) in neat acetic acid (ImL) was stirred at 80°C for 1 h. The reaction was judged complete by LCMS. The solution was allowed to cool to RT and concentrated under vacuum. The residual oil was diluted with ethyl acetate (20mL) and washed with water and brine. The organic layer was dried with MgS0₄, filtered and concentrated under vacuum. The crude product was purified by chromatography on silica gel, eluting with EtOAc / Hexane to afford the title compound. LC/MS: m/e 468.1 (M+H).

1H NMR (500 MHz, CDC1₃): 6 8.66 (IH, s), 8.55 (IH, d), 7.70 (IH, d), 7.28 (IH, s), 7.24 (IH, t), 7.07 (IH, s), 7.06 (IH, d), 6.77 (IH, t), 6.72 (IH, d), 6.65 (IH, d), 6.46 (IH, d), 6.43 (IH, d), 3.47 (3H, s), 3.27 (IH, m), 1.67 (IH, s), 1.06 (IH, d), 0.58 (2H, m).

hGPR131 EC50 (nM) = C.

3-{l-[3,5-Bis(trifluoromethvDphe

Step A: 1 - [4-(2-MethoxyphenvDpyridin-3 -yl] ethanone

3-Acetyl pyridine (5.0 g, 41.2 mmol) and Cul (0.393 g, 2.06 mmol) was dissolved in 180 ml of THF and cooled to -15°C. Acetyl chloride (3.24 g, 41.3 mmol) in 2 ml of THF was added dropwise over 5 minutes. The reaction was stirred at -15°C for 20 minutes. A 1.0 M solution of 2-Methoxyphenylmagnesium bromide in THF (41.2 mmol) was added dropwise over 10 minutes at -15°C. After stirring for 20 minutes, the reaction was partitioned between NH4CI (10% wt) and EtOAc. The organic phase was washed with sat. NaHC0₃, brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 : 1 Hexanes and EtOAc to isolate 4.5 g of the acyl dihydropyridine intermediate. The intermediate was dissolved in 50 ml of anhydrous THF and KOTMS (2.1 g, 49.8 mmol) was added and stirred at 23°C. The reaction was partitioned between EtOAc and brine. The organics phase was dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 :1 Hexanes and EtOAc to isolate the title compound as brown viscous oil. LC-MS m/z: 228 [M+l].

Step B: l-[4-(2-Methoxyphenyl)pyridin-3-yllbutane-l,3-dione

LiHMDS (1.0M in hexanes, 1 ml) and 2 ml of anhydrous THF were cooled to - 78°C and l-[4-(2-methoxyphenyl)pyridin-3-yl]ethanone (0.1 g, 0.44 mmol) added dropwise in lml of THF and stirred for 30 min while wanning to ambient temperature. Acytel chloride (0.11 g, 1.45 mmol) in 2 ml of THF was added and reaction heated to 70°C for 2 hrs. The reaction was partitioned between EtOAc and Ν¾01 (10% wt). The organics were washed with brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 : 1 Hexanes and EtOAc to isolate the title compound as a brown oil. LC-MS m/z: 270 [M+l] Step C: B-il- S.S-Bisf fluoromethvnphenyll-B-memyl-lH-pyrazol-S-vU^- - methoxyphenvDpyridine l-[4-(2-Methoxyphenyl)pyridin-3-yl]butane-l,3-dione (0.020 g, 0.074 mmol) and [3,5-bis(trifluoromethyl)phenyl]hydrazine (0.02 g, 0.082 mmol) was dissolved in 1 ml of AcOH and reaction heated to 100°C for 2 hrs. The reaction was concentrated and partitioned between EtOAc and NaHC0₃ (10% wt). The organics were washed with brine, dried and concentrated. The title compound was purified by reverse phase HPLC on a C- 18 column using a gradient of 10% ACN-water(0.1% TFA) to 90% ACN-water (0.1% TFA) to obtain 3-{l-[3,5- bis(trifluoromemyl)phenyl]-3-memyl-lH-pyrazol-5-yl}-4-(2-methoxyphenyl)pyridme as a foamy solid. LC-MS m/z: 478 [M+l]. hGPR131 EC50 (nM) = B

3-il-r3.5-Bis(trifluoromethyl)phenyll-lH-pyrazol-5-yl)-4-(2-memoxyphenyl)pyridme

Step A: (2EV3-(Dimethylammo -l- 4-(2-memoxyphenvnpyridin-3-yl1prop-2-en-l-one l-[4-(2-Methoxyphenyl)pyridin-3-yl]ethanone (1.9 g, 8.36 mmol) was dissolved in N,N-dimethylformamide dimethyl acetal (7.1 g, 60 mmol) and 2 ml of DMF and heated to 100°C for 4 hrs. The reaction was concentrated and residue partitioned between EtOAc and water. The organics were washed with brine, dried and concentrated to collect the title compound as a brown solid. LC-MS m/z: 283 [M+l]

Step B: 3-(l- .5-bis(trifluoromethvnphenyll-lH-pyrazol-5-vn-4-(2- methoxyphenvDpyridine

(2E)-3-(dimethylammo)-l-[4-(2-memoxyphenyl)pyridin-3-yl]prop-2-en-l-one (0.3 g, 1.06 mmol) and [3,5-bis(trifluoromethyl)phenyl]hydrazine (0.3 g, 1.2 mmol) were dissolved in 2 ml of AcOH and heated to 100°C for 2 hrs. The reaction was concentrated and partitioned between EtOAc and NaHC0₃ (15% wt). The organics were washed with brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 :1 Hexanes and EtOAc to isolate the title compound as light brown oil. Further purification by reverse phase HPLC on a C- 18 column using a gradient of 10% ACN-water(0.1% TFA) to 80% ACN-water (0.1% TFA) followed by free basing provided 3-{l-[3,5- bis( fluoromethyl)phenyl]-lH-pyrazol-5-yl}-4-(2-methoxyphenyl)pyridine. LC-MS m/z: 464 [M+l]. hGPR131 EC50 (nM) = A

4-(2-MethoxyphenylV3 - (1 - [4-(trifluoromethoxy)phenyl] - 1 H-pyrazol-5 -yl } pyridine

(2E)-3 -(Dimethylamino)- 1 - [4-(2-methoxyphenyl)pyridin-3 -yl]prop-2-en- 1 -one (0.05 g, 0.18 mmol) and [4-(trifluoromethoxy)phenyl]hydrazine (0.04 g, 0.2 mmol) was dissolved in 1 ml of AcOH and heated to 100°C for 2 hrs. The reaction was concentrated and partitioned between EtOAc and NaHCC>3. The organics were washed with brine, dried and concentrated. Purification by reverse phase HPLC on a C- 18 column using a gradient of 10% ACN-water(0.1% TFA) to 80% ACN-water (0.1% TFA) provided 4-(2-methoxyphenyl)-3-{l-[4- (trifluoromethoxy)phenyl]-lH-pyrazol-5-yl}pyridine-TFA. LC-MS m/z: 412 [M+l]. hGPR131 EC50 (nM) = B

3-{5-[3,5-Bis(trifluoromethvnphenyl1-lH-pyrazol-l-yl)-4-(2-memoxyphenyl pyri Step A: 4-Chloro-3 -hvdrazinylpyridine A solution of sodium nitrite (0.5 g, 7.5 mmol) in 3 ml of water was added to a solution of 4-chloropyridine-3 -amine (1 g, 7.8 mmol) in 6N HCl (7 ml) at OoC. The reaction was stirred for 45 min at OoC and a solution of SnC12 (4.5 g, 19.4 mmol) in 6N HCl (7 ml) was added and reaction stirred for a further 3 hrs while gradually warming to ambient temperature. The pH of the reaction was adjusted to 14 with 40% NaOH solution and product extracted with iPAc. The organics were washed with brine, died and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 100% EtOAc to isolate the title compound as an off white solid. LC-MS m/z: 144 [M+l]

Step B: (2E)- 1 - [3 ,5-Bis(trifluoromethyl phenyl]-3 -(dimethylamino)prop-2-en- 1 -one l-[3,5-Bis(trifluoromethyl)phenyl]ethanone (0.2 g, 0.8 mmol) was dissolved in N,N-dimethylformamide dimethyl acetal (1.6 g, 13.4 mmol) and DMF (0.2 ml) and heated to 100°C for 12 hrs. The reaction was concentrated and partitioned between EtOAc and water. The organics were washed with brine, dried and concentrated to provide the title compound as a dark brown solid. LC-MS m/z: 312 [M+l]

Step C: 3-i5- 3.5-Bis(trifluoromemyl)phenyll-lH-pwazol-l-yll-4-cMoropyridine

3 - { 5- [3 ,5-Bis(trifluoromethyl)phenyl] - 1 H-pyrazol- 1 -yl } -4-(2-methoxyphenyl)pyridine (0.3 g, 0.96 mmol) and 2E)-l-[3,5-bis(Mfluoromethyl)phenyl]-3-(dimethylamino)prop-2-en-l- one (0.13 g, 0.87 mmol) were dissolved in 1 ml of 3:1 EtOH:lN HCl and heated to 80°C for 2 hrs. The reaction was concentrated and residue partitioned between EtOAc and NaHC0₃ (15% wt). The organics were washed with brined, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 :1 Hexanes and EtOAc to isolate the title compound as a brown oil. LC-MS m/z: 392 [M+l]

Step D: 3-(5-r3.5-Bis(trifluoromethyl phenyll-lH-pyrazol-l-vn-4-(2- methoxyphenvDpyridine

3-{5-[3,5-Bis(trifluoromethyl)phenyl]-lH-pyrazol-l-yl}-4-chloropyridine (0.06 g, 0.14 mmol), 2-Methoxyphenylboronic acid (0.03 g, 0.21 mmol), sodium carbonate (0.030 g, 0.3 mmol) and tetrakis(triphenylphosphine)palladium(0) (0.02 g, 0.014 mmol) were charged and vessel evacuated and purged with nitrogen. Added nitrogen degassed 3:1 dioxane and water (1.5 ml) and reaction heated to

100°C for 2 hrs. Reaction was partitioned between EtOAc and water. The organics were washed with brine, dried and concentrated. The title compound was purified by reverse phase HPLC on a C-18 column using a gradient of 10% ACN-water(0.1% TFA) to 90% ACN-water (0.1% TFA) to obtain 3 - { 5 - [3 ,5-bis(trifluoromethyl)phenyl] - 1 H-pyrazol- 1 -yl} -4-(2- methoxyphenyl)pyridine-TFA as a off white solid. LC-MS m/z: 464 [M+l]. hGPR131 EC50 (nM) = A

3 - { 4-f 3.5-Bis(trifluoromethyl phenyl] - 1 H-pyrazol-3 -yl ) -4-(2-methoxyphenyl)pyridine

Step A: (2E -l-[3_<5-Bis trifluoromethyl)phenyil-3-rdimethylamino)-2-(2'- methoxybiphenyl-3 -yDprop-2-en- 1 -one l-[3,5-Bis(trifluoromethyl)phenyl]-2-(2'-methoxybiphenyl-3-yl)ethanone (0.09 g, 0.2 mmol) was dissolved in a mixture of N,N-dimethylformamide dimethyl acetal (1.3 g, 10.9 mmol) and DMF (0.5 ml) and reaction heated to 100°C for 12 hrs. The reaction was

concentrated and partitioned between EtOAc and half saturated brine. The organics were washed with brine, dried and concentrated to collect the product as light brown viscous oil. LC-MS m/z: 494 [M+l]

Step B : 3 - ( 4- \ 3 ,5-bis( trifluoromethvDphenyll - 1 H-pyrazol-3 -yl } -4-(2-methoxyphenyl)pyridine

(2E)-l-[3,5-Bis(trifluoromethyl)phenyl]-3-(dimethylamino)-2-(2'- methoxybiphenyl-3-yl)prop-2-en-l-one (0.07 g, 0.15 mmol) and hydrazine (0.05 g, 1.5 mmol) was dissolved in AcOH (2 ml) and heated to 100°C for 2 hrs. The solvent was concentrated and residue taken in EtOAc. The organics were washed with NaHC0₃, then brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 : 1 Hexanes and EtOAc followed by 9: 1 DCM-MeOH to isolate the product as light brown oil. The title compound was further purified by reverse phase HPLC on a C- 18 column using a gradient of 10% ACN-water(0.1% TFA) to 90% ACN-water (0.1% TFA) to obtain 3-{4-[3,5- bis(trifluoromemyl)phenyl]-lH-pyrazol-3-yl}-4-(2-memoxyphenyl)pyridme after free basing as a foamy solid. LC-MS m/z: 464 [M+l]. hGPR131 EC50 (nM) = A

3 - { 5 - [3.5 -Bis(trifluoromethyl)phenyl] - 1 H- 1 ,2,3-triazol-4-yl I -4-(2-methoxyphenyl)pyridine Step A: 3 -Bromo-4-iodopyridine

Diisopropyl amine (1.2 g, 11.8 mmol) in anhydrous THF (50 ml) was cooled to - 78°C and BuLi in hexanes (11.8 mmol) was added drop wise. The reaction was stirred for 30 minutes at -78°C and neat 3-bromopyridine (2.06 g, 13.04 mmol) was added and stirred for a further 1 hr. A solution of iodine (6.02 g, 23.7 mmol) in THF (50 ml) was cannulated and the reaction stirred for 3 hrs at -78°C. The reaction was quenched to a solution of EtOAc and sodium bisulfite (10% wt). The organics were washed with water, brine then dried and product isolated from 4:1 Hexanes and EtOAc as an off white solid. LC-MS m/z: 283 [M+l] Step B: 3-Bromo-4-(2-methoxyphenyl)pyridine

3-Bromo-4-iodopyridine (2.2 g, 7.8 mmol), 2-Methoxyphenylboronic acid (1.3 g, 8.6 mmol), sodium carbonate (1.7 g, 15.6 mmol) and tetrakis(triphenylphosphine)palladium(0) (0.22 g, 0.19 mmol) were charged and vessel evacuated and purged with nitrogen. Added nitrogen degassed 3:1 solution of dioxane and water (15 ml) and reaction heated to 100°C for 2 hrs. Reaction was partitioned between EtOAc and water. The organics were washed with brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1:1 Hexanes and EtOAc to isolate the product as a glassy solid. LC-MS m z: 264 [M+l] Step C: 3- { [3 ,5-Bis(trifluoromethyl)phenyl]ethvnyl I -4-(2-memoxyphenyl)pyridine

3-Bromo-4-(2-methoxyphenyl)pyridine (0.2 g, 0.76 mmol), l-ethynyl-3,5- bis(trifluoromethyl)benzene (0.22 g, 0.91 mmol), palladium acetate (0.02 g, 0.07 mol), X-Phos (0.072 g, 0.15 mmol), cesium carbonate (0.74 g, 2.3 mmol) were charged and vessel evacuated and purged with nitrogen. Added nitrogen degassed acetonitrile (4 ml) and reaction heated to 80°C for 12 hrs. The reaction was diluted with EtOAc and washed with water, brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1:1 Hexanes and EtOAc to isolate the product as a off white solid. LC-MS m/z: 422 [M+l]

Step D: 3-i5-r3.5-Bis(trifluoromethvnphenyll-lH-1.2.3-triazol-4-yll-4-(2- methoxyphenyDpyridine

3-{[3,5-Bis(trifluoromethyl)phenyl]ethynyl}-4-(2-memoxyphenyl)pyridine (0.07 g, 0.15 mmol) and sodium azide (0.05 g, 0.77 mmol) in DMSO (2 ml) were heated to 100°C for 12 hrs. The reaction was diluted with EtOAc, washed with water, brine, dried and concentrated. The title compound was isolated by reverse phase HPLC on a C- 18 column using a gradient of 10% ACN-water(0.1% TFA) to 90% ACN-water (0.1% TFA) to obtain 3-{5-[3,5- bis(trifluoromemyl)phenyl]-lH-l,2,3- azol-4-yl}-4-(2-methoxyphenyl)pyridine after free basing as a white solid. LC-MS m/z: 465 [M+l]. hGPR131 EC50 (nM) = A

3-{4-r3,5-Bis(trifluoromethyl phenyl]-4H-

Step A: N'- [3 ,5 -Bis( trifluoromethypphenyll -N,N-dimethylimidoformamide

3,5-Bis(trifluoromethyl)aniline (0.3 g, 1.3 mmol) in N,N-dimethylformamide dimethyl acetal (1.0 g, 8.4 mmol) and DMF (0.2 ml) was heated to 100°C for 2 hrs. Reaction was diluted with EtOAc and washed with half saturated brine, dried and concentrated to provide crude product as dark viscous oil. LC-MS m/z: 285 [M+l]

Step B: 3-(4-r3.5-Bis(trifluoromemyl phenyl]-4H-1.2.4-triazol-3-yllpyridine Nicotinic hydrazide (0.12 g, 0.87 mmol) and N'-[3,5-bis(trifluoromethyl)phenyl]- N,N-dimethylimidoformamide (0.23 g, 0.81 mmol) in AcOH (1.5 ml) was heated to 100°C for 2 hrs. The reaction was concentrated and taken up in EtOAc. The organics were washed with sodium bicarbonate, brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 : 1 Hexanes and EtOAc followed by 9: 1 DCM and MeOH to isolate the product as a white solid. LC-MS m/z: 359 [M+l]

Step C: 3-i4-r3.5-Bisrtrifluoromethvnphenyl1-4H-1.2.4-triazol-3-vU-4-(2- methoxyphenvDpyridine

3-{4-[3,5-Bis(trifluoromethyl)phenyl]-4H-l,2,4-triazol-3-yl}pyridine (0.09 g, 0.25 mmol) and Cul (0.02 g, 0.105 mmol) in 2 ml of THF was cooled to 0°C and acetyl chloride ( 0.045 g, 0.57 mmol) in THF (1 ml) was added to the reaction drop wise and stirred at 0°C for 20 minutes. A 1.0 M solution of 2-Methoxyphenylmagnesium bromide in THF (0.5 mmol) was added dropwise over 10 minutes at 0°C. After stirring for 20 minutes, the reaction was partitioned between NH₄CI (10% wt) and EtOAc. The organic phase was washed with sat. NaHC0₃, brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1:1 Hexanes and EtOAc to isolate the acyl dihydropyridine intermediate. The intermediate was dissolved in 2 ml of anhydrous THF and KOTMS (0.095 g, 0.75 mmol) was added and stirred at 23°C. The reaction was partitioned between EtOAc and brine. The organics phase was dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 :1 Hexanes and EtOAc followed by 9:1 DCM and MeOH to isolate the product. Further purification by reverse phase HPLC on a C-l 8 column using a gradient of 10% ACN-water(0.1% TFA) to 90% ACN-water (0.1% TFA) provided the title compound 3-{4-[3,5-bis(trifluoromethyl)phenyl]-4H-l,2,4-triazol-3-yl}-4-(2- methoxyphenyl)pyridine after free basing as a white solid. LC-MS m/z: 465 [M+l], hGPR131 EC50 (nM) = B

3-i5-[3,5-bis(trifluoromethyl)phenyl]-lH-pyrazol-4-yll-4-(2-memoxyphenyl)pyridine Step A: 5-[3,5-bis(trifluoromethyl)phenvn-lH-pyrazole

2E)- 1 - [3 , 5 -Bis(trifluoromethyl)phenyl] -3 -(dimethylamino)prop-2-en- 1 -one from Example 23 (0.34 g, 1.09 mmol) and hydrazine (0.09 g, 2.73 mmol) in AcOH (2 ml) was heated to 100°C for 2 hrs. Reaction was concentrated and diluted with EtOAc. The organics were washed with NaHC0₃, brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 :1 Hexanes and EtOAc to collect the product as a white solid. LC-MS m/z: 281 [M+l]

Step B: 5- [3 ,5 -Bis(trifluoromethvDphenyl] -4-iodo- 1 H-pyrazole

5-[3,5-Bis(trifluoromethyl)phenyl]-lH-pyrazole (0.44 g, 1.6 mmol) and N- iodosuccinimide (1.08 g, 4.8 mmol) in acetonitrile (20 ml) was stirred at ambient temperature for 14 hrs. The reaction was diluted with EtOAc and sodium bisulfite (15% wt) and stirred for 15 min. The organics were separated, washed with NaHC0₃, brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 :1 Hexanes and EtOAc to collect the product as a light brown oil. LC-MS m/z: 406 [M+l]

Step C: 5-[3.5-Bis(trifluoromethyl)phenyl]-4-iodo-l-l^

1 H-pyrazole

5-[3,5-Bis(trifluoromethyl)phenyl]-4-iodo-lH-pyrazole (0.18 g, 0.45 mmol) in THF (2 ml) was added to a suspension of 60% NaH (0.032 g, 0.8 mmol) in THF (1.5 ml) at 0°C. The reaction was warmed to ambient temperature and stirred for 30 minutes. [2- (chloromemoxy)emyl](trimethyl)silane (0.09 g, 0.53 mmol) in THF (2 ml) was added drop wise to the reaction and stirred for a further 2 hrs. The reaction was quenched with NH4CI (10% wt) and extracted with EtOAc. The organics were washed with brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 4: 1 Hexanes and EtOAc to collect the product as a light brown viscous oil. LC-MS m/z: 537 [M+l]

Step D: 3-Γ5-Γ3.5-Bis(trifluoromethvnphenyll - 1 - ( r2-(trimethylsilvnethoxy1methvU - 1 H- pyrazol-4-yl pyridine

5- [3 ,5 -Bis(trifluoromethyl)phenyl] -4-iodo- 1 - { [2- (trimethylsilyl)ethoxy]methyl}-lH-pyrazole (0.18 g, 0.34 mmol), 3-pyridineboronic acid (0.063 g, 0.515 mmol), sodium carbonate (0.073 g, 0.68 mmol) and

tetrakis(triphenylphosphine)palladium(0) (0.019 g, 0.017 mmol) were charged and vessel evacuated and purged with nitrogen. Added nitrogen degassed 3 : 1 solution of dioxane and water (2.5 ml) and reaction heated to 100°C for 2 hrs. Reaction was partitioned between EtOAc and water. The organics were washed with brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1:1 Hexanes and EtOAc to collect the product as a viscous oil. LC-MS m/z: 488 [M+l]

Step E: 3 - ( 5-Γ3.5-Bis(trifluoromethyl phenyll - 1 H-pyrazol-4-vU -4-(2- methoxyphenvDpyridine

3-(5-[3,5-Bis(trifluoromethyl)phenyl]- 1 - { [2-(trimethylsilyl)ethoxy]methyl}-lH- pyrazol-4-yl)pyridine (0.13 g, 0.25 mmol), and Cul (0.02 g, 0.1 mmol) in 3 ml of THF was cooled to 0°C and acetyl chloride ( 0.04 g, 0.5 mmol) in THF (1 ml) was added to the reaction drop wise and stirred at 0°C for 20 minutes. A 1.0 M solution of 2-Methoxyphenylmagnesium bromide in THF (0.6 mmol) was added dropwise over 10 minutes at 0°C. After stirring for 20 minutes, the reaction was partitioned between NH₄C1 (10% wt) and EtOAc. The organic phase was washed with NaHC0₃, brine, dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 : 1 Hexanes and EtOAc to isolate the acyl dihydropyridine intermediate. The intermediate was dissolved in 2 ml of anhydrous THF and KOTMS (0.095 g, 0.75 mmol) was added and stirred at 23°C. The reaction was partitioned between EtOAc and brine. The organic phase was dried and concentrated. The crude product was purified by flash column using a gradient of 100% Hexanes to 1 : 1 Hexanes and EtOAc. The column isolated product was taken in MeOH (1 ml) and concentrated HC1 (0.5 ml) and heated to 80°C for 12 hrs. The reaction was concentrated and product purified by reverse phase HPLC on a C-18 column using a gradient of 10% ACN-water(0.1% TFA) to 90% ACN-water (0.1% TFA) provided the title compound after free basing as a white solid. LC-MS m/z: 464 [M+l].

hGPR131 EC50 (nM) = A The following compounds were synthesized following similar procedures as described above.

GPRl 31 Activity Assay

The utility of the compounds in accordance with the present invention as agonists of GPRl 31 activity may be demonstrated by the following assays:

Experiment 1 : Gene Cloning

Primers were synthesized from the regions before and after the base sequence of an ORF of GPRl 31 , which is a known GPCR in GenBank Accession No. NM_001077194 (human) and No. NM l 74985 (mouse), and an RT-PCR was conducted to clone the gene. The primers had the following base sequences. hGPRl 31_F12:CCCCTGTCCCCAGGACCAAGATG (SEQ.ID.No.1) hGPRl 31_R15 : TT AGTTC AAGTCC AGGTCGAC ACTGCTTT (SEQ.ID.No.2)

mGPRl 3 I F 12 :GTGCC AAGACCC ATGATGAC ACCC (SEQ.ID.No.3) mGPRl 31_R13 : CTAATTC AAGTCC AGGTCAATGCTGC (SEQ.ID.No.4) A human fetus marathon-ready cDNA (CLONTECH: presently TaKaRa) as a human GPR131 receptor gene and a cDNA reverse-transcribed from a mouse BAT tissue-derived RNA as a mouse GPR131 receptor were employed as samples in the PCR.

The PCR involved amplification using 94°C for 9 minutes followed by 94°C for 30 seconds and then 68°C for 3 minutes which were repeated for 26 cycles in AmpliTaq Gold (Roche). The PCR products thus amplified were cloned using pCR2.1-TOPOTA cloning kit (Invitrogen). Verification of the base sequences were based on the base sequencing after electrophoresis using BigDye Terminator Cycle Sequencing Ready Reaction Kit ver.3.0 and DNA sequencer 377 (Applied Biosynthesis). The GPR131 receptor gene cloned into a pCR2.1- TOPO vector was cut out from the vector using a restriction enzyme BamHl and EcoRV, and then subcloned into the BAMHl and EcoRl recognition sites in an eukaryotic expression vector pIREShyg3 (Clonetech).

Experiment 2: Expression Cell Production

Using LIPOFECTAMINE (Invitrogen), the cDNA of the GPR131 receptor was transfected to HEK/CRE-BLA cells, from which drug-resistant cells were isolated to obtain cell lines exhibiting stable expression of the GPR131. The HECK cells expressing the GPR131 were cultured in a DMEM/F12 medium containing 10% fetal bovine serum, 100 units/mL penicillin, 0.1 mg/mL streptomycin sulfate, 250 μg/mL Hygromycin.

Experiment 3: Intracellular cAMP Content Assay

On the day of the measurement, 10,000 human GPR131 -expressing HEK cells in each well of a 384- well plate (Coning) were exposed to a test compound in the presence of 100 μΜ Ro-20-1724, and assayed for the intracellular cAMP content by HitHunter XS+ kit (Discoverx), whereby examining the agonistic effects.

The GPR131 agonists of formula I, particularly the agonists of Examples 1-92, exihibit EC50 values of A (less than or equal to 10 nM), B (greater than or equal to 10 nM but less than 100 nM), C (greater than or equal to 100 nM but less than 1000 nM) and D (greater than or equal to 1000 nM but less than 10,000 nM). Based on the results, the compounds according to the invention have the GPR131 agonistic effects and are useful in treating and/or preventing diabetes, obesity, and hyperlipidemia. While the invention has been described and illustrated in reference to certain preferred embodiments thereof, those skilled in the art will appreciate that various changes, modifications and substitutions can be made therein without departing from the spirit and scope of the invention. For example, effective dosages other than the preferred doses as set forth hereinabove may be applicable as a consequence of variations in the responsiveness of the subject or mammal being treated for severity of bone disorders caused by resorption, or for other indications for the compounds of the invention indicated above. Likewise, the specific pharmacological responses observed may vary according to and depending upon the particular active compound selected or whether there are present pharmaceutical carriers, as well as the type of formulation and mode of administration employed, and such expected variations or differences in the results are contemplated in accordance with the practices of the present invention. It is intended, therefore, that the invention be limited only by the scope of the claims which follow and that such claims be interpreted as broadly as is reasonable.

Claims

WHAT IS CLAIMED IS:

1. A compound of structural Formula I:

I

or a pharmaceutically acceptable salt thereof, wherein

X is N orN⁺-0^';

Ring B is a five-membered heteroaryl containing 1-3 N, O, or S, wherein the five-membered heteroaryl, wherein the five-membered heteroaryl ring is substituted by one to two R⁶;

Ring C is phenyl or six-membered heteroaryl ring containing 1-2 N atoms, wherein phenyl or the six-membered heteroaryl ring is pyridine is optionally substituted by one to four R ; each R¹ is selected from the group consisting of:

(1) C_1-6alkyl, wherein said alkyl is optionally substituted with hydroxyl, or Q.

₆alkoxyl,

(2) haloC^alkyl,

(3) C_1-6alkoxyl,

(4) thioCi-ealkoxyl,

(5) C3-6cycloalkoxyl,

(6) haloC_1-6alkoxyl,

(7) hydroxyl,

(8) halogen,

(9) C_1-6alkyl-S(0)k-, wherein k is 1 or 2,

(10) NR⁴R⁵; and

(11) C(0)NR⁴R⁵,

is selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl, and (3) haloC_1-6alkyl;

each R³ is selected from the group consisting of:

(1) C_1-6alkyl, wherein said alkyl is optionally substituted with hydroxyl or amino,

(2) haloC_1-6alkyl,

(3) C_1-6alkoxyl,

(4) haloC_1-6alkoxyl,

(5) C_3-6cycloalkoxyl,

(6) halogen,

(7) CHO,

(8) COOH,

(9) C(0)NR⁴R⁵,

(10) C_1-6alkylC(0)-,

(11) cyano, and

(12) C_1-6alkyl-S(0)_p-, wherein p is 1 or 2;

R⁴ and R⁵ are independently selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl,

(3) haloCi-ealkyl, and

(4) C_1-6alkyl-S(0)₂-;

each R⁶ is selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl, and

(3) haloC_1-6alkyl; and

n is 1, 2, or 3.

2. The compound of Claim 1 wherein Ring B is selected from the group consisting of:

wherein q is 1 or 2; or a pharmaceutically acceptable salt thereof.

3. The compound of Claim 2, wherein Ring B is selected from the group consisting

4. The compound of any of Claims 1-3, wherein Ring A is phenyl, pyridine, pyridazine, pyrimidine, or pyrazine, wherein the ring is optionally substituted by one to four R¹, or a pharmaceutically acceptable salt thereof.

5. The compound of Claims 4, wherein Ring A is phenyl or pyridine, wherein the ring is optionally substituted by one to four R¹, or a pharmaceutically acceptable salt thereof.

6. The compound of Claim 5, wherein Ring A is phenyl, wherein wherein the phenyl is optionally substituted by one to four R¹, or a pharmaceutically acceptable salt thereof.

7. The compound of Claim 5, wherein Ring A is pyridine, wherein wherein the pyridine is optionally substituted by one to four R¹, or a pharmaceutically acceptable salt thereof. compound of Claim 4, wherein Ring A is selected from the group consisting

9. The compound of any of Claims 1-8, wherein wherein Ring C is phenyl or pyridine, optionally substituted by one to four R .

10. The compound of Claim 9, wherein Ring C is phenyl, optionally substituted by one to four R³.

11. The compound of Claim 9, wherein Ring C is pyridine, optionally substituted by one to four R³.

12. The compound of Claim 9, wherein Ring C is

13. A compound of structural Formula I-n:

or a pharmaceutically acceptable salt thereof, wherein

Ring B is a five-membered heteroaryl containing 1-3 N, O, or S, wherein the five-membered heteroaryl, wherein the five-membered heteroaryl ring is substituted by one to two R⁶; each R¹ is selected from the group consisting of:

₆alkoxyl,

(3) C_1-6alkoxyl,

(4) thioC_1-6alkoxyl,

(5) C₃_₆cycloalkoxyl,

(6) haloQ-ealkoxyl,

(7) hydroxyl,

(8) halogen,

(9) Ci-ealkyl-SiC k-, wherein k is 1 or 2,

(10) NR⁴R⁵, and

(11) C(0)NR⁴R⁵;

each R² is selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl, and

(3) haloC_1-6alkyl;

each R³ is selected from the group consisting of:

(1) Ci-ealkyl, wherein said alkyl is optionally substituted with hydroxyl or amino,

(2) haloC_1-6alkyl,

(3) C_1-6alkoxyL

(4) haloC_1-6alkoxyl,

(5) C3-6cycloalkoxyl,

(6) halogen,

(7) CHO,

(8) COOH,

(9) C(0)NR⁴R⁵,

(10) C_1-6alkylC(0)-,

(11) cyano, and (12) C_1-6alkyl-S(0)_p-, wherein p is 1 or 2;

R⁴ and R⁵ are independently selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl,

(3) haloC_1-6alkyl, and

each R⁶ is selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl, and

(3) haloC_1-6alkyl;

k is independently 1, 2, or 3;

m is 1, 2, or 3; and

n is 1, 2, or 3.

14. A compound of structural Formula I-o:

I-o

or a pharmaceutically acceptable salt thereof, wherein

(1) C^alkyl, wherein said alkyl is optionally substituted with hydroxyl, or Ci.

₆alkoxyl,

(2) haloC_1-6alkyl,

(3) C_1-6alkoxyl,

(4) thioQ-ealkoxyl,

(5) C3-₆cycloalkoxyl,

(6) haloC_1-6alkoxyl, (7) hydroxyl,

(8) halogen,

(9) C_1-6alkyl-S(0)_k-, wherein k is 1 or 2,

(10) NR⁴R⁵, and

(11) C(0)NR⁴R⁵;

each R² is selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl, and

(3) haloC_1-6alkyl;

each R³ is selected from the group consisting of:

(2) haloC_1-6alkyl,

(3) C_1-6alkoxyl,

(4) haloC_1-6alkoxyl,

(5) C_3-6cycloalkoxyl,

(6) halogen,

(7) CHO,

(8) COOH,

(9) C(0)NR⁴R⁵,

(10) C_1-6alkylC(0)-,

(11) cyano, and

(12) C_1-6alkyl-S(0)_p-, wherein p is 1 or 2;

R⁴ and R⁵ are independently selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl,

(3) halod-ealkyl, and

(4) C_1-6alkyl-S(0)₂-;

each R⁶ is selected from the group consisting of:

(1) hydrogen,

(2) C_1-6alkyl, and

(3) haloC_1-6alkyl;

k is independently 1, 2, or 3;

m is 1, 2, or 3; and n is 1, 2, or 3.

15. The compound of Claim 1 selected from the group consisting of

-95-

₅

,or a pharmaceutically acceptable salt thereof.

16. A pharmaceutical composition comprising a compound of any of Claims combination with a pharmaceutically acceptable carrier.

17. A compound according to any of Claims 1-15 for use as a medicament.

18. A compound according to any of Claims 1 -15 for use in the treatment of diabetes or obesity.

19. Use of a compound of any of Claims 1 - 15, or a pharmaceutically acceptable salt thereof, in the manufacture of a medicament for use in treating a condition selected from the group consisting of diabetes and obesity.

20. A method for the threatment of a condition selected from the group consisting of diabetes and obesity comprising administering to an individual a pharmaceutical composition comprising the compound of any of Claims 1-15.