WO2013059442A2 - Inhibition of retinoic acid production for hiv vaccination - Google Patents

Abstract

A method and vaccine composition compressing a siRNA and/or a shRNA that targets a retinoic acid producing enzyme and an antigen. Silencing retinoic acid producing enzymes downregulates α4β7 expression on activated T and B cells. Immunization with a retinoic acid silencing mechanism greatly enhanced anti-HIV gp140 immune responses in the vaginal tract and periphery but not in the intestine, providing a unique strategy to redistribute anti-HIV mucosal immune responses on the front line of defense against HIV-1 with concomitant suppression of α4β7high CD4+ T cells.

Description

INHIBITION OF RETINOIC ACID PRODUCTION FOR HIV VACCINATION

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 61/548,790 filed October 19, 2011, which is incorporated by reference herein in its entirety.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0002] This invention was made with government support under P30 AI36211 awarded by National Institutes of Health. The government has certain rights in the invention.

TECHNICAL FIELD

[0003] Embodiments of the invention relate to cell biology, molecular biology, and immunology. In certain embodiments, the field of the invention relates to vaccination, such as against HIV, and immunological adjuvants to such vaccination.

BACKGROUND OF THE INVENTION

[0004] Most new human immunodeficiency virus type 1 (HIV-1) infections worldwide occur via the mucosal route, thus an effective HIV-1 vaccine must elicit antiviral immune responses in the mucosa (1-3). Clinical trials of such mucosal vaccines so far have been unsuccessful (4, 5). Recent studies reveal that HIV-1 preferentially infects activated CD4+ T cells expressing the α4β7 integrin (6-10). However, conventional vaccines non- selectively induce antigen- specific a4p7high CD4+ T cell (11-19). In addition, the recently halted HIV-1 vaccine STEP trial aroused controversy about whether the Adenovirus serotype 5 (Ad5) vector-based vaccine against HIV-1 in individuals with preexisting immunity against Ad5 results in preferential expansion of Ad5-specific a4p7high CD4+ T cells (6, 7, 20, 21). These results suggest that CD4+ T cell responses induced by current AIDS vaccine candidates could generate more targets for HIV-1 and thus paradoxically enhance HIV-1 infection and disease progression. Thus it is important to explore vaccine strategies that could induce robust anti-HIV T cell and antibody responses in the periphery and mucosa without the unwanted HIV-1 susceptible a4p7high CD4+ T cells. [0005] The expression of α4β7 integrin on activated T and B cells are determined by interactions with dendritic cells (DCs). DCs produce retinoic acid (RA), principally all-trans-RA and 9- cis-RA, that induces and enhances the expression of α4β7 on activated T and B cells and imprints them for gut-homing (22, 23). However, the effect of RA on antigen presenting cell, CD4+ T cell differentiation, and the induction of adaptive immune responses remains elusive. There is clearly evidence that RA enhances Th2 responses and increases naturally occurring Foxp3+ Tregs and TGF-βΙ -mediated Foxp3+ Treg differentiation while inhibiting IL-6- mediated Thl7 differentiation (24-27). Vitamin A deficiency can result in enhanced Thl and decreased Th2 cell responses in animals (28- 29). Supplementation of vitamin A to animals suppressed IFNy-producing CD4+ and CD8+ T cells and expanded Treg (30-32). Conversely, several studies have shown that RA promotes Thl development and functions as adjuvant to augment Thl immune responses in vivo (33-37). In addition, RA inhibits the differentiation, maturation, and function of human monocyte-derived DCs (38, 39). Opposite effects of RA on DCs have also been reported, which include activation of immature DC and enhanced antigen presenting cell function in vitro and in vivo (33, 40, 41).

[0006] The production of RA by DCs occurs mainly through the intracellular oxidative metabolism of retinol via retinaldehyde, which is catalyzed by a subfamily of alcohol dehydrogenases (ADH). The ADH class III isoenzyme (ADH5) is expressed ubiquitously in DCs in all the secondary lymphoid organs. The retinal is further converted to RA by retinal dehydrogenases (RALDH), a subfamily of class I aldehyde dehydrogenases. Four classes of RALDH have been identified, and among them ALDHla2 (RALDH2) has been shown to be the major one that regulates RA production in DCs (42), indicating an essential role for ALDHla2 in the regulation of mucosal immunity. The effects of silencing ALDHla2 in DCs on the induction of mucosal immunity were investigated. It is demonstrated that silencing ALDHla2 in DCs downregulates α4β7 expression on activated T and B cells. As a result, i.n. immunization of ALDHla2- silenced lenti viral vaccine greatly enhances anti- HIV gpl40 immune responses in the vaginal tract and periphery but not in the intestine, providing a unique strategy to redistribute anti-HIV mucosal immune responses on the front line of defense against HIV-1 with concomitant suppression of c^7high CD4+ T cells. [0007] Embodiments of the present invention provide adjuvants, vaccines and related methods that are useful in eliciting immune responses, particularly immune responses against HIV antigens. Embodiments of this invention provide methods of modulating retinoic acid production through modulation of retinoic acid-producing enzymes, such as ALDHlal, ALDHla2, and ALDHla3, for example. Silencing retinoic acid-producing enzymes is useful to tip the balance from gut mucosal immunity to vaginal mucosal immunity, while enhancing systemic immune responses against HIV antigen. This effect is likely mediated by the ability of silencing retinoic acid-producing enzymes to inhibit the expression of α4β7 integrin and CCR9 on T and B lymphocytes. Furthermore, silencing retinoic acid-producing enzymes promotes Thl differentiation while inhibiting Treg differentiation, in certain embodiments. An effective HIV vaccination approach should augment anti-HIV systemic and vaginal mucosal immunity in mice without HIV-1 susceptible a4p7^high CD4⁺ T cells, as given by embodiments of the present invention.

BRIEF SUMMARY OF THE INVENTION

[0008] Embodiments of the present invention are directed to a vaccine composition, a method of inducing an immune response against an antigen in a subject, a method of preventing HIV in an individual or reducing symptoms HIV in an individual, a kit comprising the vaccine composition, and a method of vaccinating against HIV.

[0009] A general embodiment of the invention is an immunogenic composition, such as a vaccine composition, comprising: a RNA interfering molecule to a retinoic acid producing enzyme; and an antigen. The RNA interfering molecule and the antigen may be comprised in an expression vector, such as a lentivirus or an adenovirus. The retinoic acid producing enzyme may be a retinal dehydrogenase such as ALDHla2, ALDHlal, ALDHla3, ALDH8al, or a mixture thereof. The RNA interfering molecule may be a siRNA, such as a shRNA, for example, SEQ ID NO: 9. The siRNA may also be a siRNA or a pool of siRNA to (such as that targets, which may be considered that binds to) SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof. In an embodiment of the invention, the antigen is a HIV protein, such as gpl40, gpl20, gp40, p24, gag, tat, pol, or a mixture thereof. The vaccine composition may be comprised in a kit. [0010] Another general embodiment of the invention is a method of inducing an immune response against an antigen in a subject comprising the steps of: reducing expression of (such as by silencing) a retinoic acid producing enzyme in the subject and administering the antigen to the subject. The route of vaccine administration may be intranasal, intramuscular, intradermal, intravenous, subcutaneous, intraperitoneal, oral administration, or a mixture thereof. The method of silencing a retinoic acid producing enzyme may comprise administering a siRNA that targets a retinoic acid producing enzyme to the subject. In one embodiment of the invention, the siRNA and the antigen are comprised in an expression vector, such as lentivirus or adenovirus. The retinoic acid producing enzyme may be a retinal dehydrogenase, such as ALDHla2, ALDHlal, ALDHla3, ALDH8al, or a mixture thereof. The RNA interfering molecule may be a siRNA, such as a shRNA, for example, SEQ ID NO: 9. The siRNA may also be a siRNA or a pool of siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof. In an embodiment of the invention, the antigen is a HIV protein, such as gpl40, gpl20, gp40, p24, gag, tat, pol, or a mixture thereof.

[0011] An embodiment of the invention is a method of preventing HIV in an individual or reducing symptoms HIV in an individual, comprising the step of delivering a therapeutically effective amount a vaccine composition comprising: a RNA interfering molecule to a retinoic acid producing enzyme; and an antigen. The RNA interfering molecule and the antigen may be comprised in an expression vector, such as a lentivirus or an adenovirus. The retinoic acid producing enzyme may be a retinal dehydrogenase such as ALDHla2, ALDHlal, ALDHla3, ALDH8al, or a mixture thereof. The RNA interfering molecule may be a siRNA, such as a shRNA, for example, SEQ ID NO: 9. The siRNA may also be a siRNA or a pool of siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof. In an embodiment of the invention, the antigen is a HIV protein, such as gpl40, gpl20, gp40, p24, gag, tat, pol, or a mixture thereof.

[0012] An embodiment of the invention is a method of vaccinating against HIV, comprising using a RNA interfering molecule to a retinoic acid producing enzyme as an adjuvant. The retinoic acid producing enzyme may be a retinal dehydrogenase such as ALDHla2, ALDHlal, ALDHla3, ALDH8al, or a mixture thereof. The RNA interfering molecule may be a siRNA, such as a shRNA, for example, SEQ ID NO: 9. The siRNA may also be a siRNA or a pool of siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof.

[0013] The foregoing has outlined rather broadly the features and technical advantages of the present invention in order that the detailed description of the invention that follows may be better understood. Additional features and advantages of the invention will be described hereinafter which form the subject of the claims of the invention. It should be appreciated by those skilled in the art that the conception and specific embodiment disclosed may be readily utilized as a basis for modifying or designing other structures for carrying out the same purposes of the present invention. It should also be realized by those skilled in the art that such equivalent constructions do not depart from the spirit and scope of the invention as set forth in the appended claims. The novel features which are believed to be characteristic of the invention, both as to its organization and method of operation, together with further objects and advantages will be better understood from the following description when considered in connection with the accompanying figures. It is to be expressly understood, however, that each of the figures is provided for the purpose of illustration and description only and is not intended as a definition of the limits of the present invention.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] For a more complete understanding of the present invention, reference is now made to the following descriptions taken in conjunction with the accompanying drawings.

[0015] Fig. 1 illustrates lenti virus expressing ALDHla2 shRNA knocks down the expression of ALDHla2 in vitro and in vivo. (A) CDl lc+ DCs were isolated from BALB/c superficial cervical lymph nodes (CLN), mesenteric lymph nodes (MLN), spleen (SP), and BM-DCs with magnetic beads and assessed for the level of ALDHla2 mRNA with (A) RT- PCR and (B) qRT-PCR. *P<0.05, MLN versus SP, CLN, and BM. (C) BM- DCs were transduced with lenti viral vector expressing ALDHla2 shRNA (shA2) or non- silencing shRNA (shNS), and 48 h later, were subjected to qRT-PCR. *P<0.05, shA2 versus shNS. (D) Silencing of ALDHla2 expression by Lv-shA2 in vivo. Mice were immunized intranasally (i.n.) with 1x107 vp of Lv-shA2, Lv-shNS or lOOug of plasmid expressing shNS or shA2 in 20μ1 sterile PBS or PBS control. CLN single cell suspensions were prepared 48 h post injection and ALDHla2 expression was detected by qRT-PCR. Representative data from one of three experiments are presented. *P<0.05, LvshA2 versus LvshNS. **P<0.05, LvshNS versus PBS.

[0016] Fig. 2 illustrates blockade of ALDHla2 in DCs inhibits the expression of gut-homing receptors on T and B lymphocytes. BMDCs were transduced with Lv-shA2 or Lv-shNS, and co-cultured with isolated CD4+ or CD8+ T cells at a ratio of 1 : 1 in the presence of anti-CD3 and anti-CD28 antibody or with isolated B220+ B cells at a ratio of 1 : 1 in the presence of anti-mouse IgM F(ab')2. On day 5 of culture, cells were stained for α4β7 (A) and CCR9 (B) and analyzed by flow cytometry. Numbers in histogram plots indicate AMFI. Representative data from one of two experiments are presented. *P<0.05, shA2 versus shNS.

[0017] Fig. 3 shows blockade of ALDHla2 in DCs promotes Thl/Th2 but suppress Treg differentiation. (A) BMDCs were transduced with Lv-shA2 or Lv-shNS, and co-cultured with isolated CD4+ T cells at a ratio of 1 : 1 in the presence of anti-CD3 and anti-CD28 antibody with or without TGF-βΙ . On day 5 of culture, cells were stained for intracellular IFN-γ, Foxp3, and IL- 10 and analyzed by flow cytometry. (B, C) BMDCs were transduced with Lv-shA2 or Lv-shNS, and co-cultured with CDl lc+ cell-depleted splenocytes at a ratio of 1 : 1 in the presence of IL2, anti-CD3 and anti-CD28 antibodies, and anti-mouse IgM F(ab')2. On day 5 of culture, cells were stained for CD4, CD8, and B220 and analyzed by flow cytometry. The graph shows the % of cell populations (B) and the cell numbers (C) generated in each condition. Representative data from one of two experiments are presented. *P<0.05, shA2 versus shNS.

[0018] Fig. 4 shows in vivo blockade of ALDHla2 redirects gp 140- specific mucosal T cell and antibody responses from gut to vaginal tract. (A) Mice were immunized i.n. with Lv- JRFL/Lv-shA2 (JRFL/shA2), Lv-JRFL/Lv-shNS (JRFL/shNS) or PBS control twice at two-week interval. 14 days later, IFN-γ intracellular staining of vaginal or small bowel LP lymphocytes of mice was performed. Multifunctional CD8+ or CD4+ T- lymphocyte responses were assessed using ICS assays for IFN-γ, TNF-a, and IL-2. (B) A representative analysis of vaginal CD8+ T cell responses. (C, D) Collated data for each individual combination of functions and in summary by number of functions (inset). Representative data from one of three experiments are presented. *P<0.05, JRFL/shA2 versus JRFL/shNS. HIV-1 gpl40-specific slgA titers from the pooled vaginal washes (E) or stool extractions (F) of each group were quantified by capture ELISA. Representative data from one of three experiments are presented. *P<0.05, JRFL/shA2 versus JRFL/shNS.

[0019] Fig. 5 shows in vivo blockade of ALDHla2 enhances systemic gpl40- specific T cell and antibody responses. BALB/C mice were immunized i.n. with JRFL/shA2, JRFL/shNS, or PBS control twice at two-week interval. 14 days later, peripheral lymphocytes were prepared for intracellular IFN-γ staining (A, B) and multifunctional CD8+ (C) or CD4+ (D) T-lymphocyte responses were assessed using ICS assays for IFN-γ, TNF-a, and IL-2. Representative data from one of three experiments are presented. *P<0.05, JRFL/shA2 versus JRFL/shNS. HIV-1 gp 140 -specific IgGl (E) and IgG2a (F) titers from the polled sera of each group were quantified by capture ELISA. Representative data from one of three experiments are presented. *P<0.05, JRFL/shA2 versus JRFL/shNS.

[0020] Fig. 6 shows in vivo blockade of ALDHla2 enhances protection to intravaginal challenge of vaccinia virus. BALB/C mice were immunized i.n. with Lv- JRFL/shA2 (shA2), Lv-JRFL/shNS (shNS), or PBS control twice at two-week interval, followed by intravaginal challenge of 2x105 PFU vaccinia virus expressing JRFL gpl20 in two weeks. Six days later, paired ovaries were recovered for virus titration with a plaque forming assay. Representative data from one of two experiments are presented. *P<0.05, shA2 versus shNS.

[0021] Fig. 7 shows blockade of ALDHla2 in human DCs inhibits the expression of β7 on autologous CD4+ T cells. (A) ALDHla2 siRNA oligo knocks down the expression of ALDHla2 in human DCs. Human monocyte-derived DCs were transfected with ALDHla2 siRNA pool (sihA2) or non-silencing siRNA (sihNS), and 24 h later, were subjected to qRT-PCR. *P<0.05, sihA2 versus sihNS. (B) Human monocytes-derived DCs (5x103 cell/well) were transfected with siRNA oligos and treated with LPS (mDC) or medium (iDC), and co-cultured with isolated CD4+ T cells (2.5x104 cells/well) at a ratio of 1:5 in the presence of lOOU/ml of IL2 and lng/ml of anti-CD3 (OKT3) antibody in U- bottom 96-well plate. On day 6 of culture, cells were stained for β7 and gated CD4+ cells were analyzed by flow cytometry. Numbers in histogram plots indicate AMFI. *P<0.05, sihA2 versus sihNS. (C) ELISA measurement of the amounts of cytokines secreted by DC/CD4+ T cells cocultures. * P<0.05 sihA2 versus sihNS.

[0022] Fig. 8 illustrates expression of ALDHla2 by BM-derived DCs. Mouse BMDCs or DC cell lines were cultured with GM-CSF, IL-4, and LPS and levels of ALDHla2 mRNA were assessed with q- RT-PCR. *P<0.05, BMDC-GM-CSF/IL4/LPS versus BMDC only.

[0023] Fig. 9 shows expression of stimulatory molecules on the surface of DCs. Mouse BMDCs that were transduced with lenti virus (A) or human monocytes derived DCs that were transfected with oligos (B) were stained with antibodies against stimulatory molecules and analyzed by flow cytometry. Numbers in histogram plots indicate AMFI.

[0024] Fig. 10 is a comparison of systemic immune responses by i.m. and i.n. vaccination route. Balb/C mice were immunized i.n. or i.m. with Lv-JRFL twice at 2-week interval. 14 d later, peripheral lymphocytes were prepared for intracellular IFN-γ staining (A). CD8+ T cells isolated from pooled splenocytes were subjected for IFN-γ ELISPOT assays (B). HIV JRFL gpl40-specific IgGl (C) and IgG2a (D) titers from the polled sera of each group were quantified by capture ELISA. *P<0.05, i.m. versus i.n. **P<0.05, i.m. versus naive.

[0025] Fig. 11 is a comparison of mucosal immune responses by i.m. and i.n. vaccination route. Balb/C mice were immunized i.n. or i.m. with Lv-JRFL twice at 2-week interval. 14 days later, vaginal lymphocytes were prepared for intracellular IFN-γ staining (A), vaginal washes (B) or stool extracts (C) were prepared for JRFL gp 140- specific slgA ELISA. *P<0.05, i.n. versus i.m.

DETAILED DESCRIPTION OF THE INVENTION

[0026] Various features and advantageous details are explained more fully with reference to the non-limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description. Descriptions of well known starting materials, processing techniques, components, and equipment are omitted so as not to unnecessarily obscure the invention in detail. It should be understood, however, that the detailed description and the specific examples, while indicating embodiments of the invention, are given by way of illustration only, and not by way of limitation. Various substitutions, modifications, additions, and/or rearrangements within the spirit and/or scope of the underlying inventive concept will become apparent to those skilled in the art from this disclosure.

[0027] In keeping with long-standing patent law convention, the words "a" and "an" when used in the present specification in concert with the word comprising, including the claims, denote "one or more." Some embodiments of the invention may consist of or consist essentially of one or more elements, method steps, and/or methods of the invention. It is contemplated that any method or composition described herein can be implemented with respect to any other method or composition described herein.

[0028] Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device and/or method being employed to determine the value.

[0029] The term "preventing" as used herein refers to minimizing, reducing or suppressing the risk of developing a disease state or parameters relating to the disease state or progression or other abnormal or deleterious conditions.

[0030] HIV-1 preferentially infects activated CD4+ T cells expressing α4β7 integrin and conventional vaccination approaches non- selectively induce immune responses including a4p7high CD4+ T cells, suggesting that current candidate AIDS vaccines may produce more target cells for HIV-1 and paradoxically enhance HIV-1 infection and disease progression. Thus, it remains a challenge to selectively induce robust anti-HIV immunity without the unwanted HIV-1 susceptible a4p7high CD4+ T cells. Embodiments of a vaccination strategy are described that targets ALDHla2 (the mRNA sequence for ALDHla2 for mouse and human are given in SEQ ID NO: 1 and SEQ ID NO: 5, a retinoic acid producing enzyme in dendritic cells (DCs)). Other embodiments of the invention include targeting ALDHlal, (SEQ ID NO: 2 and SEQ ID NO: 6), Aldhla3 (SEQ ID NO: 3 and SEQ ID NO: 7), and Aldh8al (SEQ ID NO: 4 and SEQ ID NOL: 8). Silencing ALDHla2 in mouse bone-marrow derived DCs promoted Thl and Th2 differentiation while suppressing Treg differentiation. ALDHla2- silenced DCs effectively downregulated the expression of gut-homing receptors α4β7 and CCR9 on activated T and B lymphocytes. Consequently, intranasal immunization of a lentiviral vaccine encoding ALDHla2 shRNA and HIV-1 gpl40 redirected gp 140 -specific mucosal T cell and antibody responses from the gut to the vaginal tract, while dramatically enhancing systemic gp 140- specific immune responses, resulting in enhanced protection to intravaginal challenge with recombinant vaccinia virus. It is further demonstrated that silencing ALDHla2 in human DCs resulted in downregulation of β7 expression on activated autologous CD4+ T cells. Hence, embodiments of this invention provide a unique and effective strategy to induce a4p71ow anti-HIV immune responses.

[0031] Sequence of ALDHla2 - Mus musculus aldehyde dehydrogenase family 1, subfamily A2 (Aldhla2), mRNA - NCBI Reference sequence: NM_009022, is in (SEQ ID NO: 1). ALDHlal NCBI Ref Sequence NM_013467 Mus musculus aldehyde dehydrogenase family 1, subfamily Al (Aldhlal), mRNA (SEQ ID NO: 2). ALDHla3 NCBI Ref Sequence NM_053080 - Mus musculus aldehyde dehydrogenase family 1, subfamily A3 (Aldhla3), mRNA (SEQ ID NO: 3). ALDH8al NCBI Ref Sequence NM_178713 - Mus musculus aldehyde dehydrogenase 8 family, member Al (Aldh8al), mRNA (SEQ ID NO: 4). Human ALDH1A2, NCBI Ref Sequence: NM_003888 (SEQ ID NO: 5). Human ALDH1A1, NCBI Ref Sequence: NM_666689.4 (SEQ ID NO: 6). Human ALDH1A3, NCBI Ref Sequence: NM_000693 (SEQ ID NO: 7). Human ALDH8A1, NCBI Ref Sequence: NM_022568.3 (SEQ ID NO: 8).

[0032] Embodiments of the invention are vaccine strategies that circumvent the problem of induction of HIV-1 susceptible a4p7high CD4+ T cells by current HIV vaccine candidates. A HIV vaccine encoding ALDHla2 shRNA induces robust anti-HIV T cell and antibody responses with decreased availability of activated a4p7high CD4+ T cells for HIV virus.

[0033] There is a critical role for ALDHla2 in regulating the magnitude of adaptive anti-HIV immune responses via DCs. In vivo blockade of ALDHla2 dramatically enhances anti-HIV T cell and antibody responses in the periphery and vaginal mucosal sites, leading to enhanced protection to intravaginal challenge of virus. The mechanisms by which in vivo blockade of ALDHla2 controls the magnitude of adaptive immunity involve the reciprocal regulation of Thl and Treg differentiation through inhibition of RA production by DCs. ALDHla2-silenced DCs are not effective in producing RA that enhances Treg but inhibits Thl differentiation via activation of retinoic acid receptor and retinoid X receptor on CD4+ T cells. In addition, blockade of ALDHla2 signaling in DCs enhances DC maturation and proinflammatory cytokine production, suggesting that ALDHla2- silenced DCs might also directly regulate Th differentiation via DC-Th contact and cytokine stimulation.

[0034] In addition, in vivo blockade of ALDHla2 determines the mucosal homing phenotype of vaccine-induced gp 140 -specific T and B cells. The examples below demonstrate that in vivo blockade of ALDHla2 at the time of i.n. vaccination redirects anti- HIV mucosal immunity from the intestine to the vaginal tract. The observed redistribution of HIV-specific T and B cells is likely due to the downregulation of the expression of gut- homing receptors α4β7 and CCR9 on the activated T and B cells by the ALDHla2-silenced lentiviral vaccine. It was not observed that Lv-shA2/JRFL vaccination decreased the expression of α4β7 on the JRFL gp 140 -specific CD4+, CD8+, or B cells in the periphery or vaginal and gut mucosal sites 14 days after vaccination, compared to Lv-shNS/JRFL vaccination. It is possible that in vivo blockade of ALDHla2 only affects the expression of α4β7 on the activated T and B cells in the priming stage when the Lv-shA2-captured endogenous DCs encounter and prime T and B cells in the draining lymph nodes.

[0035] To translate the findings in the mouse to the development of a SIV vaccine or a human HIV vaccine, the expression of human ALDHla2 was inhibited in human monocyte- derived DCs using ALDHla2 siRNA oligos and demonstrated that the ALDHla2- silenced human monocyte-derived DCs induced the autologous p71ow CD4+ T cells, while promoting Thl differentiation and CD4+ T cell proliferation.

[0036] This has important implications for development of future HIV-1 vaccines. Worldwide, the HIV-1 epidemic has spread to the general population in the recent years, and the majority of new HIV-1 transmission occurs through heterosexual sex (1). Thus, an effective HIV-1 vaccine for the general population should provide protective immunity in the urogenital tract. However, while inducing anti-HIV mucosal immunity, the current HIV-1 vaccine candidates also induce unwanted HIV-1 susceptible a4p7high immune responses that provide targets for HIV-1. Although the integrin α4β7 mainly mediates homing of lymphocytes to the intestinal mucosa, it also mediates their migration to the urogenital tract to increase the number of virus targets, and leads to a higher susceptibility to HIV-1 infection on the front line. This limitation could be overcome by the vaccination strategies that silence ALDHla2 signaling in vivo. The examples blow demonstrate that in vivo blockade of ALDHla2 at the time of i.n. vaccination redistributes HIV-1 gp 120 -specific antibody and T cell responses from the intestine to the vaginal tract, indicating the induction of a4p71ow immune cells by this approach. The potential of these a4p71ow CD4+ T cells induced by ALDHla2-silenced DCs to resist HIV infection will be tested in the further studies.

[0037] The mucosal homing phenotype of vaccine-induced T and B cells are also determined by vaccine routes. While oral mucosal immunization preferentially induces the expression of α4β7 integrin on activated T and B cells to imprint them for gut-homing, intranasal mucosal immunization preferentially induces the expression of α4β1 integrin that mediates their migration to the respiratory tract as well as the urogenital mucosa (12, 57- 59). However, intranasal immunization also induces the expression of α4β7 integrin on up to 30% CD4+ T cells (12). Recent studies suggest that systemic i.m. vaccination also effectively induce T cell responses in the urogenital tract and gut mucosa (60). While the data in the examples below are in agreement with these reports, it was observed that i.m. vaccination induces significantly lower antibody responses in the urogenital tract and gut mucosa, compared to i.n. vaccination route. Thus, in embodiments of the invention, i.n. vaccination route may be essential for induction of neutralizing antibodies against HIV-1 in the urogenital tract. In summary, the ALDHla2- silencing i.n. vaccine strategy is an attractive means to prevent HIV-1 infection via induction of robust protective CTLs and antibodies in the urogenital tract and concomitant suppression of a4p7high activated CD4+ T cells which favor HIV-1 infection.

[0038] In some embodiments the vaccine composition comprises a RNA interfering molecule, such as siRNA. The RNA interfering molecule may comprise nucleic acid sequence that has 70%-100% identity to, or at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% overall identity with a portion of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, or SEQ ID NO: 8, which is at least 10 nucleic acids in length, but may vary in length from 10 to 40 nucleic acids. In some embodiments the RNA interfering molecule is 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 nucleic acids long.

RNA interference

[0039] In some embodiments, the vaccine composition comprises an RNA interfering molecule. The term "RNA interference" or "RNAi" refers generally to a process in which a double- stranded RNA molecule changes the expression of a nucleic acid sequence with which the double- stranded or short hairpin RNA molecule shares substantial or total homology. The term "RNAi agent" refers to an RNA sequence that elicits RNAi, such as small interfering RNA (siRNA). The terms "short hairpin RNA" or "shRNA" refer to an RNA structure having a duplex region and a loop region. miRNA Molecules

[0040] MicroRNA molecules ("miRNAs") are generally 21 to 22 nucleotides in length, though lengths of 19 and up to 23 nucleotides have been reported. The miRNAs are each processed from a longer precursor RNA molecule ("precursor miRNA"). Precursor miRNAs are transcribed from non-pro tem- encoding genes. The precursor miRNAs have two regions of complementarity that enable them to form a stem-loop- or fold-back-like structure, which is cleaved by an enzyme called Dicer in animals. Dicer is a ribonuclease Ill-like nuclease. The processed miRNA is typically a portion of the stem. The processed miRNA (also referred to as "mature miRNA") become part of a large complex to down- regulate a particular target gene. Examples of animal miRNAs include those that imperfectly basepair with the target, which halts translation (Olsen et al, 1999; Seggerson et al , 2002) SiRNA molecules also are processed by Dicer, but from a long, double- stranded RNA molecule. SiRNAs are not naturally found in animal cells, but they can function in such cells in a RNA-induced silencing complex (RISC) to direct the sequence-specific cleavage of an mRNA target (Denli et al., 2003).

Small interfering RNA (siRNA)

[0041] In some embodiments, siRNA is employed as the therapeutic agent.

By "small interfering RNA" is meant a nucleic acid molecule which has complementarity in a substrate binding region to a specified gene target, and which acts to specifically guide enzymes in the host cell to cleave the target RNA. That is, the small interfering RNA by virtue of the specificity of its sequence and its homology to the RNA target, is able to cause cleavage of the RNA strand and thereby inactivate a target RNA molecule because it is no longer able to be transcribed. These complementary regions allow sufficient hybridization of the small interfering RNA to the target RNA and thus permit cleavage. One hundred percent complementarity is often useful for biological activity, but complementarity as low as 90% may be employed, for example.

[0042] In some embodiments, small interfering RNAs are double stranded RNA agents that have complementary to (i.e., able to base-pair with) a portion of the target RNA (generally messenger RNA). Generally, such complementarity is 100%, but can be less if desired, such as anywhere between 90- 100%. For example, 19 bases out of 21 bases may be base -paired. In some instances, where selection between various allelic variants is desired, 100% complementary to the target gene is useful in order to effectively discern the target sequence from the other allelic sequence. When selecting between allelic targets, choice of length is also an important factor because it is the other factor involved in the percent complementary and the ability to differentiate between allelic differences.

[0043] The small interfering RNA sequence needs to be of sufficient length to bring the small interfering RNA and target RNA together through complementary base- pairing interactions. The small interfering RNA of the invention may be of varying lengths. The length of the small interfering RNA is preferably greater than or equal to ten nucleotides and of sufficient length to stably interact with the target RNA; specifically 15- 30 nucleotides; more specifically any integer between 15 and 30 nucleotides, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, and 30. By "sufficient length" is meant an oligonucleotide of greater than or equal to 15 nucleotides that is of a length great enough to provide the intended function under the expected condition. By "stably interact" is meant interaction of the small interfering RNA with target nucleic acid (e.g., by forming hydrogen bonds with complementary nucleotides in the target under physiological conditions). In some embodiments, the siRNA is siRNA against SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof.

Antisense RNA [0044] In some embodiments, antisense RNA is employed as the therapeutic agent. Antisense RNA comprises a single- stranded RNA that is complementary to another nucleic acid, such as a mRNA strand. Antisense RNA may be introduced into a cell to inhibit translation of a particular complementary mRNA by hybridizing to it and physically obstructing the translation machinery.

Vectors

[0045] The term "vector" is used to refer to a carrier nucleic acid molecule into which a nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques (see, for example, Maniatis et ah, 1988 and Ausubel et ah, 1994, both incorporated herein by reference).

[0046] The term "expression vector" refers to any type of genetic construct comprising a nucleic acid coding for a RNA capable of being transcribed. In some cases, RNA molecules are then translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host cell. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.

[0047] DNA Vaccine: In specific embodiments of the invention, the vaccines are composed of a piece of the pathogen's DNA (in a plasmid, for example) genetically engineered to produce at least one, two, or more specific proteins (antigens) from a pathogen. The plasmid DNA (pDNA) is injected into the cells of the body, where the host cells read the pDNA and produces its antigens. These antigens are recognized as foreign when produced and displayed by the host cells, and the host immune system triggers a range of immune responses. (Alarcon et ah, 1999; Robinson and Pertmer, 2000)

[0048] Thus far, several DNA vaccines have been developed and many more are under consideration. (Kutzler and Weiner, 2008) Specifically, positive results are seen for a bird flu DNA vaccine (Cinatl et ah, 2007). Veterinary DNA vaccines have been approved to: 1) protect horses from West Nile virus (Fort Dodge Animal Health Announces Approval of West Nile Virus DNA Vaccine for Horses, PR Neswire 2005-07-18); 2) protect salmon from Infectious hematopoietic necrosis virus; 3) protect piglets from perinatal mortality and morbidity due to weaning; 4) treats dogs with aggressive melanoma. A preliminary study for a DNA vaccine against multiple sclerosis was reported as being effective (Stuve et ah, 2007).

[0049] There are several advantages and disadvantages for DNA vaccines. (Alarcon et ah, 1999; Kutzler and Weiner, 2008; Robisnson and Pertmer, 2000; Sedegah et ah, 1994) The advantages include the following: subunit vaccination without risk for infection, antigen presentation by both MHC class I and II molecules, ability to polarize T- cell help toward type 1 or 2, immune response focused only on antigen(s) of interest, ease of development and production, stability of vaccine for storage and shipping, cost- effectiveness, eliminates need for peptide synthesis, expression, and purification of recombinant proteins and the use of toxic adjuvants, long term persistence of immunogen, in vivo expression ensures protein more closely resembles normal eukaryotic structure, with accompanying post-translational modifications.

[0050] DNA Vaccine Delivery: DNA vaccines have been introduced into animal tissues by several different methods. (Weiner and Kennedy, 1999) These delivery methods include the following: 1) Injection via a hypodermic needle of an aqueous solution of DNA in saline by intramuscular (IM), intradermal (ID), intravenous (IV), subcutaneous (SC), or intraperitoneal (IP) route. Although these are not specialized delivery mechanisms, they are simple, lead to permanent or semi-permanent expression, lead to pDNA spread rapidly throughout the body. 2) Gene Gun delivery of a DNA coated gold or tungsten beads via epidermal delivery (ED) through the skin or outer membrane (vaginal mucosa), or surgically exposed muscle or other organs. This method allows the DNA to be bombarded directly into cells utilizing compressed helium as an accelerant, and requires a small amount of DNA (as little as 16 ng). 3) Pneumatic (Jet) injection of an aqueous solution of DNA by ED. 4) Liposome mediated delivery of several of the above-mentioned systems but particularly IM, IV, IP, and Oral or Mucosal (Nasal, Vaginal. Regardless of these methods, several factors can influence the immune responses related to injections including age and sex and may be considered in certain embodiments of the invention.

Viral Vectors

[0051] The ability of certain viruses to infect cells or enter cells via receptor-mediated endocytosis, and to integrate into host cell genome and express viral genes stably and efficiently have made them attractive candidates for the transfer of foreign nucleic acids into cells (e.g., mammalian cells). Vaccine components of the present invention may be a viral vector that encode one or more antigenic compositions or other components such as, for example, an adjuvant. The adjuvant may be a RNA interfering molecule, such as a siRNA, that targets a retinoic acid producing enzyme, such as ALDHla2. Non-limiting examples of virus vectors that may be used to deliver a nucleic acid of the present invention are described below.

Adenoviral Vectors

[0052] A particular method for delivery of the nucleic acid involves the use of an adenovirus expression vector. Although adenovirus vectors are known to have a low capacity for integration into genomic DNA, this feature is counterbalanced by the high efficiency of gene transfer afforded by these vectors. "Adenovirus expression vector" is meant to include those constructs containing adenovirus sequences sufficient to (a) support packaging of the construct and (b) to ultimately express a tissue or cell-specific construct that has been cloned therein. Knowledge of the genetic organization or adenovirus, a 36 kb, linear, double- stranded DNA virus, allows substitution of large pieces of adenoviral DNA with foreign sequences up to 7 kb (Grunhaus and Horwitz, 1992).

AAV Vectors

[0053] The nucleic acid may be introduced into the cell using adenovirus assisted transfection. Increased transfection efficiencies have been reported in cell systems using adenovirus coupled systems (Kelleher and Vos, 1994; Cotten et ah, 1992; Curiel, 1994). Adeno-associated virus (AAV) is an attractive vector system for use in the vaccines of the present invention as it has a high frequency of integration and it can infect nondividing cells, thus making it useful for delivery of genes into mammalian cells, for example, in tissue culture (Muzyczka, 1992) or in vivo. AAV has a broad host range for infectivity (Tratschin et al, 1984; Laughlin et al, 1986; Lebkowski et al, 1988; McLaughlin et al, 1988). Details concerning the generation and use of rAAV vectors are described in U.S. Patent Nos. 5,139,941 and 4,797,368, each incorporated herein by reference.

Retroviral Vectors

[0054] Retroviruses have promise as antigen delivery vectors in vaccines due to their ability to integrate their genes into the host genome, transferring a large amount of foreign genetic material, infecting a broad spectrum of species and cell types and of being packaged in special cell-lines (Miller, 1992).

[0055] In order to construct a vaccine retroviral vector, a nucleic acid {e.g., one encoding an antigen of interest) is inserted into the viral genome in the place of certain viral sequences to produce a virus that is replication-defective. In order to produce virions, a packaging cell line containing the gag, pol, and env genes but without the LTR and packaging components is constructed {Mann et al, 1983). When a recombinant plasmid containing a cDNA, together with the retroviral LTR and packaging sequences is introduced into a special cell line (e.g., by calcium phosphate precipitation for example), the packaging sequence allows the RNA transcript of the recombinant plasmid to be packaged into viral particles, which are then secreted into the culture media (Nicolas and Rubenstein, 1988; Temin, 1986; Mann ei a/., 1983). The media containing the recombinant retroviruses is then collected, optionally concentrated, and used for gene transfer. Retroviral vectors are able to infect a broad variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al, 1975).

[0056] Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function. Lentiviral vectors are well known in the art (see, for example, Naldini et al., 1996; Zufferey et al, 1997; Blomer et al, 1997; U.S. Pat. Nos. 6,013,516 and 5,994,136). Some examples of lentivirus include the Human Immunodeficiency Viruses: HrV-l, HIV-2 and the Simian Immunodeficiency Virus: SIV. Lentiviral vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef are deleted making the vector biologically safe.

[0057] Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences. For example, recombinant lentivirus capable of infecting a non-dividing cell wherein a suitable host cell is transfected with two or more vectors carrying the packaging functions, namely gag, pol and env, as well as rev and tat is described in U.S. Pat. No. 5,994,136, incorporated herein by reference. One may target the recombinant virus by linkage of the envelope protein with an antibody or a particular ligand for targeting to a receptor of a particular cell-type. By inserting a sequence (including a regulatory region) of interest into the viral vector, along with another gene which encodes the ligand for a receptor on a specific target cell, for example, the vector is now target- specific.

Other Viral Vectors

[0058] Other viral vectors may be employed as vaccine constructs in the present invention. Vectors derived from viruses such as vaccinia virus (Ridgeway, 1988;

Baichwal and Sugden, 1986; Coupar et al., 1988), sindbis virus, cytomegalovirus and herpes simplex virus may be employed. They offer several attractive features for various mammalian cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sugden, 1986;

Coupar et al, 1988; Horwich et al, 1990).

Additional Vaccine Components

[0059] It is contemplated that an antigenic composition of the invention may be combined with one or more additional components to form a more effective vaccine.

Non-limiting examples of additional components include, for example, one or more additional antigens, immunomodulators or additional adjuvants to stimulate an immune response to an antigenic composition of the present invention and/or the additional component(s).

Immunomodulators

[0060] For example, it is contemplated that immunomodulators can be included in the vaccine to augment a cell's or a patient's {e.g., an animal's) response.

Immunomodulators can be included as purified proteins, nucleic acids encoding immunomodulators, and/or cells that express immunomodulators in the vaccine composition. The following sections list non-limiting examples of immunomodulators that are of interest, and it is contemplated that various combinations of immunomodulators may be used in certain embodiments (e.g., a cytokine and a chemokine).

Immunogenic Carrier Proteins

[0061] In certain embodiments, an antigenic composition may be chemically coupled to a carrier or recombinantly expressed with a immunogenic carrier peptide or polypetide (e.g., a antigen-carrier fusion peptide or polypeptide) to enhance an immune reaction. Exemplary and preferred immunogenic carrier amino acid sequences include hepatitis B surface antigen, keyhole limpet hemocyanin (KLH) and bovine serum albumin

(BSA). Other albumins such as ovalbumin, mouse serum albumin or rabbit serum albumin also can be used as immunogenic carrier proteins. Means for conjugating a polypeptide or peptide to a immunogenic carrier protein are well known in the art and include, for example, glutaraldehyde, m maleimidobenzoyl N hydroxysuccinimide ester, carbodiimide and bis biazotized benzidine.

Biological Response Modifiers

[0062] It may be desirable to coadminister biologic response modifiers

(BRM), which have been shown to upregulate T cell immunity or downregulate suppressor cell activity. Such BRMs include, but are not limited to, cimetidine (CIM; 1200 mg/d)

(Smith/Kline, PA); low dose cyclophosphamide (CYP; 300 mg/m2) (Johnson/ Mead, NJ), or a gene encoding a protein involved in one or more immune helper functions, such as B 7.

Adjuvants

[0063] Immunization protocols have used adjuvants to stimulate responses for many years, and as such adjuvants are well known to one of ordinary skill in the art. Some adjuvants affect the way in which antigens are presented. For example, the immune response is increased when protein antigens are precipitated by alum. Emulsification of antigens also prolongs the duration of antigen presentation. In addition to the use of an adjuvant that silences a retinoic acid producing enzyme, embodiments of the vaccine composition may also include additional adjuvants.

[0064] In one aspect, an adjuvant effect is achieved by use of an agent, such as alum, used in about 0.05 to about 0.1% solution in phosphate buffered saline. Alternatively, the antigen is made as an admixture with synthetic polymers of sugars (Carbopol®) used as an about 0.25% solution. Adjuvant effect may also be made my aggregation of the antigen in the vaccine by heat treatment with temperatures ranging between about 70° to about 101°C for a 30 second to 2 minute period, respectively. Aggregation by reactivating with pepsin treated (Fab) antibodies to albumin, mixture with bacterial cell(s) such as C. parvum, an endotoxin or a lipopolysaccharide component of Gram negative bacteria, emulsion in physiologically acceptable oil vehicles, such as mannide mono oleate (Aracel A), or emulsion with a 20% solution of a perfluorocarbon (Fluosol DA®) used as a block substitute, also may be employed.

[0065] Some adjuvants, for example, certain organic molecules obtained from bacteria, act on the host rather than on the antigen. An example is muramyl dipeptide (N acetylmuramyl L alanyl D isoglutamine [MDP]), a bacterial peptidoglycan. The effects of MDP, as with most adjuvants, are not fully understood. MDP stimulates macrophages but also appears to stimulate B cells directly. The effects of adjuvants, therefore, are not antigen specific. If they are administered together with a purified antigen, however, they can be used to selectively promote the response to the antigen.

[0066] Adjuvants have been used experimentally to promote a generalized increase in immunity against unknown antigens (e.g., U.S. Patent 4,877,611).

[0067] Various polysaccharide adjuvants may also be used. For example, the use of various pneumococcal polysaccharide adjuvants on the antibody responses of mice has been described (Yin et ah, 1989) . The doses that produce optimal responses, or that otherwise do not produce suppression, should be employed as indicated (Yin et ah, 1989). Polyamine varieties of polysaccharides are particularly preferred, such as chitin and chitosan, including deacetylated chitin.

[0068] Another group of adjuvants are the muramyl dipeptide (MDP, N acetylmuramyl L alanyl D isoglutamine) group of bacterial peptidoglycan s. Derivatives of muramyl dipeptide, such as the amino acid derivative threonyl-MDP, and the fatty acid derivative MTPPE, are also contemplated.

[0069] Another adjuvant contemplated for use in the present invention is BCG. BCG (bacillus Calmette-Guerin, an attenuated strain of Mycobacterium) and BCG cell wall skeleton (CWS) may also be used as adjuvants in the invention, with or without trehalose dimycolate. Trehalose dimycolate may be used itself. Trehalose dimycolate administration has been shown to correlate with augmented resistance to influenza virus infection in mice (Azuma et al., 1988). Trehalose dimycolate may be prepared as described in U.S. Patent 4,579,945.

[0070] BCG is an important clinical tool because of its immuno stimulatory properties. BCG acts to stimulate the reticulo-endothelial system, activates natural killer cells and increases proliferation of hematopoietic stem cells. Cell wall extracts of BCG have proven to have excellent immune adjuvant activity. Molecular genetic tools and methods for mycobacteria have provided the means to introduce foreign genes into BCG (Jacobs et al, 1987; Snapper et al, 1988; Husson et al, 1990; Martin et al, 1990).

[0071] Live BCG is an effective and safe vaccine used worldwide to prevent tuberculosis. BCG and other mycobacteria are highly effective adjuvants, and the immune response to mycobacteria has been studied extensively. With nearly 2 billion immunizations, BCG has a long record of safe use in man (Luelmo, 1982; Lotte et al, 1984). It is one of the few vaccines that can be given at birth, it engenders long-lived immune responses with only a single dose, and there is a worldwide distribution network with experience in BCG vaccination. An exemplary BCG vaccine is sold as TICE BCG (Organon Inc., West Orange, NJ).

[0072] Amphipathic and surface active agents, e.g., saponin and derivatives such as QS21 (Cambridge Biotech), form yet another group of adjuvants for use with the immunogens of the present invention. Nonionic block copolymer surfactants (Rabinovich et al, 1994; Hunter et al., 1991) may also be employed. Oligonucleotides are another useful group of adjuvants (Yamamoto et al., 1988). Quil A and lentinen are other adjuvants that may be used in certain embodiments of the present invention.

[0073] One group of adjuvants that may be used in the invention are the detoxified endotoxins, such as the refined detoxified endotoxin of U.S. Patent 4,866,034. These refined detoxified endotoxins are effective in producing adjuvant responses in mammals. Of course, the detoxified endotoxins may be combined with other adjuvants to prepare multi-adjuvant-incorporated cells. For example, combination of detoxified endotoxins with trehalose dimycolate is particularly contemplated, as described in U.S. Patent 4,435,386. Combinations of detoxified endotoxins with trehalose dimycolate and endotoxic glycolipids is also contemplated (U.S. Patent 4,505,899), as is combination of detoxified endotoxins with cell wall skeleton (CWS) or CWS and trehalose dimycolate, as described in U.S. Patents 4,436,727, 4,436,728 and 4,505,900. Combinations of just CWS and trehalose dimycolate, without detoxified endotoxins, is also envisioned to be useful, as described in U.S. Patent 4,520,019.

[0074] Another group of adjuvants that may be used in some embodiments of the present invention are those that can be encoded by a nucleic acid (e.g. , DNA or RNA). It is contemplated that such adjuvants may be encoded in a nucleic acid (e.g. , an expression vector) encoding the antigen, or in a separate vector or other construct. These nucleic acids encoding the adjuvants can be delivered directly, such as for example with lipids or liposomes.

Excipients, Salts and Auxilary Substances

[0075] An antigenic composition of the present invention may be mixed with one or more additional components (e.g., excipients, salts, etc.) which are pharmaceutically acceptable and compatible with at least one active ingredient (e.g., antigen). Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol and combinations thereof.

[0076] An antigenic composition of the present invention may be formulated into the vaccine as a neutral or salt form. A pharmaceutically acceptable salt, includes the acid addition salts (formed with the free amino groups of the peptide) and those which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acid, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. A salt formed with a free carboxyl group also may be derived from an inorganic base such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxide, and such organic bases as isopropylamine, trimethylamine, 2 ethylamino ethanol, histidine, procaine, and combinations thereof.

[0077] In addition, if desired, an antigentic composition may comprise minor amounts of one or more auxiliary substances such as for example wetting or emulsifying agents, pH buffering agents, etc. which enhance the effectiveness of the antigenic composition or vaccine.

Vaccine Preparations

[0078] Once produced, synthesized and/or purified, an antigen or other vaccine component may be prepared as a vaccine for administration to a patient. The preparation of a vaccine is generally well understood in the art, as exemplified by U.S.

Patents Nos. 4,608,251, 4,601,903, 4,599,231, 4,599,230, and 4,596,792, all incorporated herein by reference. Such methods may be used to prepare a vaccine comprising an antigenic composition comprising one or more antigens of a mucosally transmitted infection, such as HIV, and a RNA interfering molecule to a retinoic acid producing enzyme as active ingredient(s), in light of the present disclosure. In preferred embodiments, the compositions of the present invention are prepared to be pharmacologically acceptable vaccines.

[0079] Pharmaceutical vaccine compositions of the present invention may include an effective amount of one or more antigens, a RNA interfering molecule and additional agent dissolved or dispersed in a pharmaceutically acceptable carrier. The phrases "pharmaceutical or pharmacologically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, such as, for example, a human, as appropriate. The preparation of an pharmaceutical composition that contains at least one antigen to a mucosally transmitted contagion and a RNA interfering molecule to a retinoic acid producing enzyme or additional active ingredient will be known to those of skill in the art in light of the present disclosure, as exemplified by Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference. Moreover, for animal {e.g., human) administration, it will be understood that preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biological Standards.

[0080] As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives {e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, such like materials and combinations thereof, as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289- 1329, incorporated herein by reference). The vaccine composition may comprise different types of carriers depending on whether it is to be administered in solid, liquid or aerosol form, and whether it need to be sterile for such routes of administration as injection. Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.

[0081] In any case, the composition may comprise various antioxidants to retard oxidation of one or more component. Additionally, the prevention of the action of microorganisms can be brought about by preservatives such as various antibacterial and antifungal agents, including but not limited to parabens (e.g., methylparabens, propylparabens), chlorobutanol, phenol, sorbic acid, thimerosal or combinations thereof.

[0082] The vaccine composition may be formulated into a composition in a free base, neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts, e.g., those formed with the free amino groups of a proteinaceous composition, or which are formed with inorganic acids such as for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric or mandelic acid. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as for example, sodium, potassium, ammonium, calcium or ferric hydroxides; or such organic bases as isopropylamine, trimethylamine, histidine or procaine.

[0083] In embodiments where the composition is in a liquid form, a carrier can be a solvent or dispersion medium comprising but not limited to, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol, etc), lipids (e.g., triglycerides, vegetable oils, liposomes) and combinations thereof. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin; by the maintenance of the required particle size by dispersion in carriers such as, for example liquid polyol or lipids; by the use of surfactants such as, for example hydroxypropylcellulose; or combinations thereof such methods. In many cases, it will be preferable to include isotonic agents, such as, for example, sugars, sodium chloride or combinations thereof. [0084] In other embodiments, one may use eye drops, nasal solutions or sprays, aerosols or inhalants in the present invention. Such compositions are generally designed to be compatible with the target tissue type. In a non-limiting example, nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, in preferred embodiments the aqueous nasal solutions usually are isotonic or slightly buffered to maintain a pH of about 5.5 to about 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, drugs, or appropriate drug stabilizers, if required, may be included in the formulation. For example, various commercial nasal preparations are known and include drugs such as antibiotics or antihistamines.

[0085] In certain embodiments the vaccine composition is prepared for administration by such routes as oral ingestion. In these embodiments, the solid composition may comprise, for example, solutions, suspensions, emulsions, tablets, pills, capsules (e.g., hard or soft shelled gelatin capsules), sustained release formulations, buccal compositions, troches, elixirs, suspensions, syrups, wafers, or combinations thereof. Oral compositions may be incorporated directly with the food of the diet. Preferred carriers for oral administration comprise inert diluents, assimilable edible carriers or combinations thereof. In other aspects of the invention, the oral composition may be prepared as a syrup or elixir. A syrup or elixir, and may comprise, for example, at least one active agent, a sweetening agent, a preservative, a flavoring agent, a dye, a preservative, or combinations thereof.

[0086] In certain preferred embodiments an oral composition may comprise one or more binders, excipients, disintegration agents, lubricants, flavoring agents, and combinations thereof. In certain embodiments, a composition may comprise one or more of the following: a binder, such as, for example, gum tragacanth, acacia, cornstarch, gelatin or combinations thereof; an excipient, such as, for example, dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate or combinations thereof; a disintegrating agent, such as, for example, corn starch, potato starch, alginic acid or combinations thereof; a lubricant, such as, for example, magnesium stearate; a sweetening agent, such as, for example, sucrose, lactose, saccharin or combinations thereof; a flavoring agent, such as, for example peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc.; or combinations thereof the foregoing. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, carriers such as a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both.

[0087] Additional formulations which are suitable for other modes of administration include suppositories. Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum, vagina or urethra. After insertion, suppositories soften, melt or dissolve in the cavity fluids. In general, for suppositories, traditional carriers may include, for example, polyalkylene glycols, triglycerides or combinations thereof. In certain embodiments, suppositories may be formed from mixtures containing, for example, the active ingredient in the range of about 0.5% to about 10%, and preferably about 1% to about 2%.

[0088] Sterile injectable solutions are prepared by incorporating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and/or the other ingredients. In the case of sterile powders for the preparation of sterile injectable solutions, suspensions or emulsion, the preferred methods of preparation are vacuum-drying or freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered liquid medium thereof. The liquid medium should be suitably buffered if necessary and the liquid diluent first rendered isotonic prior to injection with sufficient saline or glucose. The preparation of highly concentrated compositions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area.

[0089] The composition must be stable under the conditions of manufacture and storage, and preserved against the contaminating action of microorganisms, such as bacteria and fungi. It will be appreciated that endotoxin contamination should be kept minimally at a safe level, for example, less that 0.5 ng/mg protein.

[0090] In particular embodiments, prolonged absorption of an injectable composition can be brought about by the use in the compositions of agents delaying absorption, such as, for example, aluminum monostearate, gelatin or combinations thereof.

Exemplary Vaccine Administration

[0091] The manner of administration of a vaccine may be varied widely. Any of the conventional methods for administration of a vaccine are applicable. For example, a vaccine may be conventionally administered intravenously, intradermally, intraarterially, intraperitoneally, intralesionally, intracranially, intraarticularly, intraprostaticaly, intrapleurally, intratracheally, intranasally, intravitreally, intravaginally, intratumorally, intramuscularly, intraperitoneally, subcutaneously, intravesicularlly, mucosally, intrapericardially, orally, rectally, nasally, topically, in eye drops, locally, using aerosol, injection, infusion, continuous infusion, localized perfusion bathing target cells directly, via a catheter, via a lavage, in cremes, in lipid compositions (e.g., liposomes), or by other method or any combination of the forgoing as would be known to one of ordinary skill in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing

Company, 1990, incorporated herein by reference).

[0092] A vaccination schedule and dosages may be varied on a patient by patient basis, taking into account, for example, factors such as the weight and age of the patient, the type of disease being treated, the severity of the disease condition, previous or concurrent therapeutic interventions, the manner of administration and the like, which can be readily determined by one of ordinary skill in the art.

[0093] A vaccine is administered in a manner compatible with the dosage formulation, and in such amount as will be therapeutically effective and immunogenic. For example, the intramuscular route may be preferred in the case of toxins with short half lives in vivo. The quantity to be administered depends on the subject to be treated, including, e.g., the capacity of the individual's immune system to synthesize antibodies, and the degree of protection desired. The dosage of the vaccine will depend on the route of administration and will vary according to the size of the host. Precise amounts of an active ingredient required to be administered depend on the judgment of the practitioner. In certain embodiments, pharmaceutical compositions may comprise, for example, at least about 0.1% of an active compound. In other embodiments, the an active compound may comprise between about 2% to about 75% of the weight of the unit, or between about 25% to about 60%, for example, and any range derivable therein However, a suitable dosage range may be, for example, of the order of several hundred micrograms active ingredient per vaccination. In other non-limiting examples, a dose may also comprise from about 1 microgram/kg/body weight, about 5 micro gram/kg/body weight, about 10 microgram/kg/body weight, about 50 microgram/kg/body weight, about 100 microgram/kg/body weight, about 200 microgram/kg/body weight, about 350 microgram/kg/body weight, about 500 microgram/kg/body weight, about 1 milligram/kg/body weight, about 5 milligram/kg/body weight, about 10 milligram/kg/body weight, about 50 milligram/kg/body weight, about 100 milligram/kg/body weight, about 200 milligram/kg/body weight, about 350 milligram/kg/body weight, about 500 milligram/kg/body weight, to about 1000 mg/kg/body weight or more per vaccination, and any range derivable therein. In non-limiting examples of a derivable range from the numbers listed herein, a range of about 5 mg/kg/body weight to about 100 mg/kg/body weight, about 5 microgram/kg/body weight to about 500 milligram/kg/body weight, etc., can be administered, based on the numbers described above. A suitable regime for initial administration and booster administrations {e.g., innoculations) are also variable, but are typified by an initial administration followed by subsequent inoculation(s) or other administration(s).

[0094] In many instances, it will be desirable to have multiple administrations of the vaccine, usually not exceeding six vaccinations, more usually not exceeding four vaccinations and preferably one or more, usually at least about three vaccinations. The vaccinations will normally be at from two to twelve week intervals, more usually from three to five week intervals. Periodic boosters at intervals of 1-5 years, usually three years, will be desirable to maintain protective levels of the antibodies.

[0095] The course of the immunization may be followed by assays for antibodies for the supernatant antigens. The assays may be performed by labeling with conventional labels, such as radionuclides, enzymes, fluorescents, and the like. These techniques are well known and may be found in a wide variety of patents, such as U.S. Patent Nos. 3,791,932; 4,174,384 and 3,949,064, as illustrative of these types of assays. Other immune assays can be performed and assays of protection from challenge with the vaccine composition can be performed, following immunization.

Embodiments of Kits of the Invention

[0096] Any of the compositions described herein may be comprised in a kit.

In a non-limiting example, a nanoparticle, including a gold nanoparticle, comprised with a

T cell and, optionally, a peptide or nucleic acid, may be comprised in a kit. In alternative embodiments, the gold nanoparticle is comprised with a peptide in the absence of a T cell and/or with a nucleic acid in the absence of a T cell.

[0097] The kits may comprise a suitably aliquoted composition of the present invention. In some cases, the kit comprises separate components of the composition and/or reagents suitable to assemble the components and or modify them, including linkers, for example. The components of the kits may be packaged either in aqueous media or in lyophilized form. The container means of the kits may generally include at least one vial, test tube, flask, bottle, syringe or other container means, into which a component may be placed, and preferably, suitably aliquoted. Where there are more than one component in the kit, the kit also will generally contain a second, third or other additional container into which the additional components may be separately placed. However, various combinations of components may be comprised in a vial. The kits of the present invention also will typically include a means for containing the composition and any other reagent containers in close confinement for commercial sale. Such containers may include injection or blow molded plastic containers into which the desired vials are retained.

[0098] When the components of the kit are provided in one and/or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred. However, the components of the kit may be provided as dried powder(s). When reagents and/or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means. [0099] Irrespective of the number and/or type of containers, the kits of the invention may also comprise, and/or be packaged with, an instrument for assisting with the injection/administration and/or placement of the ultimate composition within the body of an animal. Such an instrument may be a syringe, pipette, forceps, and/or any such medically approved delivery vehicle, for example.

EXAMPLES

[0100] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

EXAMPLE 1

Lentivirus expressing mouse ALDHla2 shRNA (Lv-shA2) knocks down the expression of mouse ALDHla2 in vitro and in vivo

[0101] To investigate the possible role of ALDHla2 in the regulation of a4p7high CD4+ T cell response, the expression of ALDHla2 mRNA was analyzed in various mouse tissues. Since ALDHla2 is predominantly expressed by CDl lc+ DCs (23), CDl lc+ DCs was isolated from BALB/c superficial cervical lymph nodes (CLN), mesenteric lymph nodes (MLN), spleen (SP), and bone marrow (BM)-derived DCs with magnetic beads and assessed the level of ALDHla2 mRNA with RT-PCR and Quantitative RT-PCR (qRT-PCR) assays. It was observed that ALDHla2 was expressed in BM-DCs and DCs from all LN sites with the highest level of expression in MLN-DCs (Figure 1A and IB).

[0102] To silence the expression of ALDHla2 in mouse DCs, a recombinant lentivirus expressing a short hairpin interfering RNA was generated (shRNA) for ALDHla2 (Lv-shA2) that effectively silences mouse ALDHla2 mRNA in BALB/c BM-DCs up to 90% (Figure. 1C). The levels of ALDHla2 mRNA in BM-DCs were increased by infection with lentivirus expressing a non-silencing shRNA (Lv-shNS) in vitro, indicating that the expression of ALDHla2 in DCs may be inducible with lentivirus infection (Figure 1C). Consistently, the levels of ALDHla2 mRNA in CLN-DCs were also increased in vivo 48 h after intranasal (i.n.) administration of 1x10 vp of Lv-shNS (Figure ID). I.n. administration of Lv-shA2 efficiently reduces the expression of ALDHla2 in CLN by 80% at 48 hours (Figure ID). By contrast, expression of ALDHla2 in CLN-DCs was neither increased with the i.n administration of plasmid expressing shNS nor reduced by the i.n. administration of plasmid expressing shA2, indicating that the DCs are refractory to plasmid transduction (Figure ID). This is in agreement with observation that BM-DCs are refractory to plasmid transduction in vitro.

EXAMPLE 2

Silencing ALDHla2 in mouse bone marrow (BM)-derived DCs inhibits the expression of gut-homing receptors on activated T and B lymphocytes.

[0103] Because RA controls the gut-homing specificity of T and B cells, it was investigated whether the ALDHla2-silenced DC suppressed the expression of gut- homing receptors such as the integrin α4β7 and the chemokine receptor CCR9 on activated T and B cells. The levels of ALDHla2 mRNA in BM-DCs and two mouse DC cell lines, DC2.4 and JAWSII, were compared and it was observed that levels of ALDHla2 mRNA in BM-DCs were increased by treatment with GM-CSF/IL-4 together with LPS (Fig. 8). Yokota A et al. has reported that mouse BM-DCs treated with GM-CSF/IL-4 with LPS showed increased expression of the gut-homing receptors, α4β7 and CCR9, upon antigenic stimulation (52), therefore, GM-CSF/IL4 and LPS-treated BMDC was used to prime T and B cells. Silencing ALDHla2 in mouse BM-DCs did not induce DC maturation with or without LPS stimulation (Fig. 9A). BM-DCs transfected with Lv-shA2 significantly suppressed expression of both α4β7 (Fig.. 2A) and CCR9 (Fig. 2B) on both CD4+ and CD8+ T cells in the presence of IL-2 and anti-CD3 and anti-CD28 antibodies and B220+ B cells in the presence of anti-IgM (Fab')2. Thus, silencing ALDHla2 in DCs inhibited the expression of gut homing receptors such as α4β7 and CCR9 on activated CD4+, CD8+ T and B cells. EXAMPLE 3

Silencing ALDHla2 in DCs promotes Thl and Th2 differentiation but suppresses Treg differentiation.

[0104] Given the role of RA in regulating T-cell differentiation, it was next determined whether ALDHla2- silenced BM-DCs could promote differentiation of naive CD4+ T cells to Thl cells and suppress TGF- βΐ -dependent differentiation to Foxp3+ T cells. BM-DCs infected with Lv-shA2 more efficiently induced IFN-y+ T cells and less efficiently induced Foxp3+ or IL-10+ T cells in the presence of TGF-β than BM- DCs infected with Lv-shNS (Figure. 3A). A higher frequency of Foxp3+ and IL-10+ T cells was observed but a lower frequency of IFN-y+ T cells was observed in the presence of RA, indicating that RA has reciprocal effect on Thl and Treg differentiation.

[0105] This result prompted the investigation of whether silencing ALDHla2 in DC could promote the proliferation of effector CD8+, CD4+ T cells and B cells, since the proliferation of effector T and B cells is facilitated in a Thl environment but suppressed by Treg. In addition, Cantorna T. et al. have shown that vitamin A deficiency causes impaired antibody responses (53); raising the concern that ALDHla2- silenced HIV vaccine could induce weak antibody responses against HIV antigen. To address this, DC-depleted splenocytes were co-cultured with Lv-shA2-DC or shNS-DCs for 5 days. The percentage of CD8+ T cells cultured with Lv-shA2-DCs significantly increased from less than 10% to 50%, whereas B220+ B cell population decreased from 50% to 25%, compared to that with Mock- or Lv-shNS-DCs (Figure 3B). However, the exact number of CD8+ T cells cultured with Lv-shA2-DCs significantly increased by around 30 fold, whereas CD4+ T and B220+ B cells increased by 6 and 2 fold respectively, compared to that with Mock- or Lv-shNS- DCs (Figure 3C), indicating that silencing ALDHla2 in DCs induced a biased Thl differentiation while Th2 response was also enhanced. Thus, silencing ALDHla2 in DCs significantly promoted Thl and Th2 differentiation while suppressing Treg differentiation, resulting in significant proliferation of CD8+, CD4+ T, as well as B220+ B cells.

EXAMPLE 4

In vivo blockade of ALDHla2 redirects anti-HIV mucosal immunity from intestine to vaginal tract. [0106] It was determined whether in vivo blockade of ALDHla2 at the time of i.n. HIV-1 vaccination could influence the magnitude and distribution of the mucosal immune responses. An i.n. vaccination route was used in this study, since i.m. vaccination induced robust systemic CTL and antibody responses (Fig. 10A-D) and vaginal CTL responses (Fig. 11 A) but significantly lower mucosal slgA responses in both gut and vaginal mucosa (Fig. 11B, C). In this study, groups of BALB/c mice were i.n. immunized with lentivirus expressing HIV JRFL strain Envelope gpl40 mixed with Lv-shA2 (JRFL/shA2) or with Lv-shNS (JRFL/shNS). HIV-1 JRFL strain gpl40 was used, since gpl40 induces both cytotoxic T lymphocytes (CTL) and antibody responses important for prevention and control of HIV-1 infection (54, 55). The functional status of CD8+ T cells isolated from the vaginal and gut mucosal tissues of the immunized mice was tested using intracellular staining for IFN-γ. i.n. immunization with Lv-JRFL/shA2 elicited significantly higher numbers of JRFL-specific IFN-y-producing CD8+ T cells in the vaginal tract but lower responses in the gut mucosa (Fig. 4A). The multifunctional status of both CD8+ and CD4+ T cells in the vaginal mucosa of the immunized mice was investigated using intracellular staining for IFN-γ, TNF-a, and IL-2 (Figure 4B). Lv-JRFL/shA2 elicited higher percentages of multi-functional Ι Ν-γ+, TNF-a+, IL-2+ CD8+ or CD4+ T cells in the vaginal tract than Lv-JRFL/shNS (Fig. 4C and 4D).

[0107] To compare mucosal antibody responses in the gut and urogenital tract, stool extracts and vaginal washes from immunized mice were evaluated for the presence of slgA antibodies against the JRFL gpl40 using ELISA. Compared to JRFL/shNS, JRFL/shA2 elicited significantly higher levels of JRFL-specific slgA in the urogenital tract and lower levels in the gut (Fig. 4E and 4F). No neutralizing assays were performed, since mice rarely produce antibodies with long HCDR3 finger-like structures which are critical for the broad neutralizing activity of human HIV-1 neutralizing antibodies and, thus, neutralizing assay do not reliably predict the ability of vaccines to produce HIV-1 neutralizing antibodies in mice (56). Collectively, these data indicate that in vivo blockade of ALDHla2 at the time of i.n. HIV-1 vaccination alters the localization of both cellular and humoral immune responses from the gut to the urogenital tract.

EXAMPLE 5

In vivo blockade of ALDHla2 enhances anti-HIV systemic immune responses. [0108] The effect of in vivo blockade of ALDHla2 on systemic immune responses against HIV-1 gpl40 was then investigated. Intracellular staining of peripheral CD8+ and CD4+ lymphocytes with IFN-γ, TNF-a, and IL-2 after stimulation with JRFL gpl40 protein-pulsed BM-DCs showed higher percentages of IFN-γ-ι-, TNF-a+, or IL-2+ CD8+ and CD4+ T cells in the periphery of Lv-JRFL/shA2 immunized mice, compared to Lv- JRFL/shNS or PBS immunized mice (Fig. 5 A and 5B). Importantly, Lv-JRFL/shA2 elicited a significantly higher proportion of polyfunctional gpl40-specific CD8+ and CD4+ T lymphocytes (Figure 5C and 5D). Taken together, these results indicated that in vivo blockade of ALDHla2 enhances multi-functional CD8+ and CD4+ T cells against HIV-1 gpl40 in the periphery.

[0109] To investigate the effect of in vivo blockade of ALDHla2 on the systemic anti-HIV antibody responses, groups of BALB/c mice were immunized with Lv- JRFL/shA2 or Lv- JRFL/shNS as described above. Treatment with Lv-JRFL/shA2 induced greater gpl40- specific antibody responses than did the Lv- JRFL/shNS. The gp 140- specific antibody subclass profile showed Lv-JRFL/shA2 induced a balanced Thl- and Th2- enhanced IgG response (higher IgG2a and IgGl subclasses) (Fig. 5E and 5F). Thus, local in vivo blockade of ALDHla2 significantly enhanced systemic HIV-1 gp 140- specific CD8+, CD4+ T cell, and antibody responses, indicating a critical role for ALDHla2 in negatively regulating antigen- specific systemic cellular and humoral immune responses.

EXAMPLE 6

In vivo blockade of ALDHla2 enhances protection to intravaginal challenge of recombinant gpl20-vaccinia virus.

[0110] To test the protection to intravaginal virus challenge afforded by the lentiviral vaccines, groups of BALB/c mice were immunized with Lv- JRFL/shA2 or Lv- JRFL/shNS twice at 2 week interval followed by intravaginal challenge of recombinant JRFL gpl20-vaccinia virus (vCB-28, NIAID AIDS reagent program) in two weeks. Vaccination with Lv-JRFL/shA2 resulted in around 10-fold reduction in virus titers in the ovaries in contrast to vaccination with Lv- JRFL/shNS (Figure 6) (P < 0.05). These results suggest that ALDHla2 shRNA acts as an adjuvant to improve protective immunity to intravaginal challenge of virus in mice. EXAMPLE 7

Silencing ALDHla2 in human DCs controls the maturation of human DCs and inhibits the expression of β7 on activated autologous CD4+ T lymphocytes.

[0111] The relevance of preclinical findings to primates was investigated. To silence the expression of ALDHla2 in human DCs, ON-TARGETplus siRNA SMARTpool for human ALDHla2 (sihA2) was used that effectively silences ALDHla2 mRNA in human monocyte-derived DCs up to 90% (Fig. 7A). To examine the role of ALDhla2 in regulating human DC maturation, surface expression of various co- stimulatory molecules related to antigen presentation was evaluated using flow cytometric assays and observed similar levels of CD40, CD80, and CD83 expression on sihA2-transfected monocyte- derived DCs with that on sihNS-transfected DCs (Fig. 9B). It was further investigated whether the ALDHla2- silenced human DC suppressed the expression of α4β7 on activated autologous CD4+ T cells. Both immature and LPS-matured ALDHla2- silenced DCs significantly suppressed expression of β7 on CD4+ T cells in the presence of IL-2 and anti- CD3 (OKT3) antibody (Fig. 7B). In addition, the co-culture of sihA2-transfected human monocyte- derived DCs and naive CD4+ T cells produced significantly higher levels of IFNy, IL-6, and TNFa but lower IL-10 than that of sihNS-transfected DCs and naive CD4+ T cells (Fig. 7C), indicating the generation of a Thl promoting environment. Thus, silencing ALDHla2 in human DCs inhibited the expression of β7 on activated autologous CD4+ T cells and promoted the Thl induction.

EXAMPLE 8

Methods of Examples 1-7

[0112] Mice. BALB/c mice were purchased from Jackson Laboratories and maintained in appropriate mouse facilities.

[0113] Study subjects. Blood samples were obtained from healthy volunteers after written informed consent was obtained.

[0114] Lentiviral shRNA clone and siRNA oligo. The GIPZ lentiviral shRNA clones encoding the mouse ALDHla2 small hairpin RNA sequence (5'- CCAAACATAGCCTAGATAT 3' SEQ ID NO: 9) or non-silencing control shRNA sequence (5 ' - ATCTCGCTTGGGCGAGAGTA AG 3' SEQ ID NO: 10) were purchased from Open Biosystems. The recombinant replication-deficient lentivirus were produced and titrated in 293 T cells. The mouse bone marrow DCs were transduced with lentiviral vector as described previously (43, 44). The ON-TARGETplus siRNA SMARTpool for human ALDHla2 (L-008118) and Non-targeting siRNA #3 (D-001810) were purchased from Thermo Scientific (Dharmacon RNAi Technologies). Human monocyte-derived DCs were cultured as described previously (45). At day 5, human DCs were transfected with siRNA oligos following Dharmacon' s protocol.

[0115] Quantitative RT-PCR assays. The relative expression of mouse or human ALDHla2 was evaluated by quantitative real-time RT-PCR. Pre-developed primer sets for mouse or human ALDHla2 (AX-062326 & AX-008118) and GAPDH (AX-040917 & AX-004253) were purchased from Thermo Scientific (Dharmacon RNAi Technologies).

[0116] In vitro co-culture. For mouse T cell/DC cocultures, 2.5xl0⁴ DCs were mixed with 2.5xl0⁴ CD4+ or CD8+ T cells from naive mice at a ratio of 1: 1 in 0.2 ml of medium containing 10% FCS, 300U/ml of human IL-2, and 5ug/ul anti-CD3 and anti- CD28 antibodies in 96-well round-bottom plates. For mouse B cell/DC cocultures, 2.5xl0⁴ DCs were mixed with 2.5xl0⁴ B220+ cells from naive mice at a ratio of 1: 1 in 0.2 ml of medium containing 5ug/ul anti-mouse IgM (Fab')2 (22). For human CD4+ T cell/DC cocultures, 5xl0³ monocyte-derived DCs were mixed with 2.5x10⁴ CD4+ T cells at a ratio of 1:5 in 0.2 ml of medium containing lOOU/ml of human IL-2 and lug/ul anti-CD3 (OKT3) antibody in 96-well round-bottom plates. After 5-6 days of culture, the recovered cells were enumerated by using trypan blue and subjected to cell staining.

[0117] Flow cytometric analysis. Cells were stained with FITC, PE, allophycocyanin (APC), or PerCP-conjugated mAbs in PBS containing 0.1% NaN3 and 2% FCS after preblocking FCy receptors as described in previous studies (43, 44, 46-48). For ICS, splenocytes or lymphocytes were harvested from draining or mesenteric LNs or spleens of immunized mice and cultured with JRFL gpl40 protein-loaded BM-DCs for 8 hours at 37°C. For the final 6 hours of culture, GolgiPlug (BD Biosciences, Pharmingen) was added to the supernatant. After surface staining with anti-CD8 or -CD4, cells were permeabilized and stained for intracellular cytokines. MAbs specific for mouse CD4 (RM4- 5), CD 8 (53- 6.7), CDl lc (HL3), CD40 (3/23), CD80 (16-10A1), CD86 (GL1), MHC-II, CCR9, α4β7, IL2, IFNy, TNFa, and human β7 and matched isotype controls were purchased from BD PharMingen. Stained cells were analyzed on a FACSCalibur (Becton Dickinson) flow cytometer and CELLQuest software.

[0118] Mice vaccination. For i.n. immunization, lxlO⁷ virus particle (vp) of recombinant lentiviral vector expressing JRFL gpl20 mixed with 1x10 vp of recombinant lentiviral vector expressing shA2 or shNS in 20 ul endotoxin free PBS were applied to the nares of mice anesthetized by intraperitoneal injection of 0.2 ml ketamine-xylazine (70.7 mg/kg), using a pipette (49). For i.m. immunization, the lentivirus in 50 ul PBS was injected into quadriceps of mice.

[0119] Mucosal lymphocytes isolations. The small bowel and vaginal tract were dissected free of associated connective tissues and cut into small pieces using straight scissors, and then washed three times with RPMI 1640 containing 5% FBS. Mucosal tissues were then digested by two serial 30 min incubations at 37°C in RPMI 1640 containing 5% FBS supplemented with type IV collagenase (Sigma Chemical) at 300U/ml with vigorous shaking for 30min. Pooled supernatants from serial incubations were purified on a percoll gradient (50, 51).

[0120] Enzyme-linked immunospot (ELISPOT). ELISPOT assays of isolated CD8+ T-cells from spleen were performed as described in previous studies (43, 44, 46-48). HIV-1 gpl40 proteins or an irrelevant protein (ovalbumin; Sigma)-pulsed DCs were used for T cell stimulation. T cells were isolated from splenocytes by using MACS CD 8 (Ly-2) MicroBeads (Miltenyi Biotec).

[0121] Antibody ELISA assays. To determine gp 120- specific serum IgG and mucosal slgA, sera and stools were collected from mice and vaginal lavage was obtained by rinsing the vaginal cavity with PBS. Supernatants of lavage and sera and stool extracts were then used for ELISA assays. The results are expressed as optical density (OD) values. All samples were tested in triplicate with repeated assays.

[0122] Vaccinia JRFL gpl20 protection assay. Anesthetized mice were challenged intravaginally with 2xl0⁵ PFU per mouse recombinant vCB-28 vaccinia virus expressing JRFL gpl20 (NIH AIDS reagent program) in 20 ul of PBS. Five days before intravaginal challenge, mice were subcutaneously injected with 3 mg of medroxiprogesterone acetate. After six days of intravaginal challenge, viruses were recovered from paired ovaries. Tissues were homogenized in PBS and stored at -80°C before virus titration. Virus titers were determined by plaque-forming assays on monolayer CV-1 cells for 48 hours followed by counterstaining with 5% w/v crystal violet. Virus presence was expressed as total PFUs/ovary.

[0123] Statistical Analysis. The 2-tailed Student's t-test and 95% confidence limits were used to assess results for statistical significance, defined as P < 0.05. Results are typically presented as means ± standard error.

REFERENCES

[0124] All patents and publications cited herein are hereby incorporated by reference in their entirety herein.

1. UNAIDS. AIDS epidemic update November 2009. World Health Organization. 435 2009.

2. Demberg T, Robert-Guroff M. Mucosal immunity and protection against HIV/SIV infection: strategies and challenges for vaccine design. Int Rev Immunol. 2009;28(1):20- 48.

3. Broliden K, Haase AT, Ahuja SK, Shearer GM, & Andersson J. Introduction: Back to basics: mucosal immunity and novel HIV vaccine concepts. J Intern Med. 2009;265(1):5- 17.

4. Mwau M, Cebere I, Sutton J, Chikoti P, Winstone N, Wee EG, Beattie T, Chen, YH, Dorrell L, McShane H, Schmidt C, Brooks M, Patel S, Roberts J, Conlon C, Rowland-Jones SL, Bwayo JJ, McMichael AJ, Hanke T. A human immunodeficiency virus 1 (HIV-1) clade A vaccine in clinical trials: stimulation of HIV-specific T-cell responses by DNA and recombinant modified vaccinia virus Ankara (MVA) vaccines in humans. J Gen Virol. 2004;85(Pt 4):911-919.

5. Hanke T, McMichael AJ, Samuel RV, Powell LA, McLoughlin L. Crome SJ, Edlin A. Lack of toxicity and persistence in the mouse associated with administration of candidate DNA- and modified vaccinia virus Ankara (MVA)- based HIV vaccines for Kenya.

Vaccine. 2002;21(1-2): 108-114. 6. James. Arthos. CC, Elena Martinelli, Katilyn Macleod, Donald Van Ryk, Danlan Wei, Zhen Xiao, Anthony S Fauci. HIV-1 envelop protein binds to and signals through integrin alpha4beta7, the gut mucosal homing receptor for periphearl T cells. Nat Immuno.

2008;9:9.

7. Cicala C, Martinelli E, McNally JP, Goode DJ, Gopaul R, Hiatt J, Jelicic K, Kottilil S, Macleod K, O'Shea A, Patel N, Van Ryk D, Wei D, Pascuccio M, Yi L, McKinnon L, Izulla P, Kimani J, Kaul R, Fauci AS, Arthos J. The integrin alpha4beta7 forms a complex with cell-surface CD4 and defines a T-cell subset that is highly susceptible to infection by HIV- 1. Proc Natl Acad Sci U S A. 2009;106(49):20877-20882.

8. Reeves RK, Evans T I, Gillis J, Johnson RP. Simian immunodeficiency virus infection induces expansion of alpha4beta7+ and cytotoxic CD56+ NK cells. J Virol.

2010;84(17):8959-8963.

9. Kader M, Bixler S, Roederer M, Veazey R, Mattapallil JJ. CD4 T cell subsets in the mucosa are CD28+Ki-67-HLA-DR-CD69+ but show differential infection based on alpha4beta7 receptor expression during acute SIV infection. J Med Primatol. 2009;38 Suppl 1:24-31.

10. Kader M, Wang X, Piatak M, Lifson J, Roederer M, Veazey R, Mattapallil JJ.

Alpha4(+)beta7(hi)CD4(+) memory T cells harbor most Th-17 cells and are preferentially infected during acute SIV infection. Mucosal Immunol. 2009;2(5):439-449.

11. Rojas OL, Caicedo L, Guzman C, Rodriguez LS, Castaneda J, Uribe L, Andrade Y, Pinzon R, Narvaez CF, Lozano JM, De Vos B, Franco MA, Angel J. Evaluation of circulating intestinally committed memory B cells in children vaccinated with attenuated human rotavirus vaccine. Viral Immunol. 2007;20(2):300-311.

12. Manrique M, Kozlowski PA, Wang SW, Wilson RL, Micewicz E, Montefiori DC, Mansfield K G, Carville A, Aldovini A. Nasal DNA-MVA SIV vaccination provides more significant protection from progression to AIDS than a similar intramuscular vaccination. Mucosal Immunol. 2009;2(6):536-550.

13. Neeson P, Boyer J, Kumar S, Lewis MG, Mattias L, Veazey R, Weiner D, Paterson Y. A DNA prime-oral Listeria boost vaccine in rhesus macaques induces a SIV-specific CD8 T cell mucosal response characterized by high levels of alpha4beta7 integrin and an effector memory phenotype. Virology. 2006;354(2):299-315.

14. Salerno-Goncalves R, Wahid R, Sztein MB. Immunization of volunteers with

Salmonella enterica serovar Typhi strain Ty21a elicits the oligoclonal expansion of CD8+ T cells with predominant Vbeta repertoires. Infect Immun. 2005;73(6):3521-3530.

15. Gupta S, Janani R, Bin Q, Luciw P, Greer C, Perri S, Legg H, Donnelly J, Barnett S, O'Hagan D, Polo JM, Vajdy M. Characterization of human immunodeficiency virus Gag- specific gamma interferon-expressing cells following protective mucosal immunization with alphavirus replicon particles. J Virol. 2005;79(11):7135-7145.

16. Krieg C, Maier R, Meyerhans A. Gut-homing (alpha(4)beta(7)(+)) Thl memory responses after inactivated poliovirus immunization in poliovirus orally pre- immunized donors. J Gen Virol. 2004;85(Pt 6): 1571-1579.

17. Evans DT, Chen LM, GiUis J, Lin KC, Harty B, Mazzara GP, Donis RO, Mansfield KG, Lifson JD, Desrosiers RC, Galan JE, Johnson RP. Mucosal priming of simian immunodeficiency virus-specific cytotoxic T-lymphocyte responses in rhesus macaques by the Salmonella type III secretion antigen delivery system. J Virol. 2003;77(4):2400-2409.

18. Cromwell MA, Veazey RS, Altman JD, Mansfield KG, Glickman R, Allen TM, Watkins DI, Lackner AA, Johnson RP. Induction of mucosal homing virus- specific CD8(+) T lymphocytes by attenuated simian immunodeficiency virus. J Virol. 2000;74(18):8762- 8766.

19. Herremans TM, Reimerink JH, Buisman AM, Kimman TG, Koopmans MP. Induction of mucosal immunity by inactivated poliovirus vaccine is dependent on previous mucosal contact with live virus. J Immunol. 1999;162(8):5011-5018.

20. Hutnick NA, Carnathan DG, Dubey SA, Makedonas G, Cox KS, Kierstead L, Ratcliffe S J, Robertson MN, Casimiro DR, Ertl HC, Betts MR. Baseline Ad5 serostatus does not predict Ad5 HIV vaccine-induced expansion of adenovirus- specific CD4+ T cells. Nat Med. 2009;15(8):876-878.

21. O'Brien KL, Liu J, King SL, Sun YH, Schmitz JE, Lifton MA, Hutnick NA, Betts MR, Dubey SA, Goudsmit J, Shiver JW, Robertson MN, Casimiro DR, Barouch DH. Adenovirus-specific immunity after immunization with an Ad5 HIV-1 vaccine candidate in humans. Nat Med. 2009;15(8):873-875.

22. Mora JR, Iwata M, Eksteen B, Song SY, Junt T, Senman B, Otipoby KL, Yokota A, Takeuchi H, Ricciardi-Castagnoli P, Rajewsky K, Adams DH, von Andrian UH.

Generation of gut-homing IgA-secreting B cells by intestinal dendritic cells. Science.

2006;314(5802): 1157-1160.

23. Iwata M, Hirakiyama A, Eshima Y, Kagechika H, Kato C, Song SY. Retinoic acid imprints gut-homing specificity on T cells. Immunity. 2004;21(4):527-538.

24. Mucida D, Park Y, Kim G, Turovskaya O, Scott I, Kronenberg M, Cheroutre H.

Reciprocal TH17 and regulatory T cell differentiation mediated by retinoic acid. Science. 2007;317(5835):256-260.

25. Coombes JL, Siddiqui KR, Arancibia-Carcamo CV, Hall J, Sun CM, Belkaid Y, Powrie F. A functionally specialized population of mucosal CD 103+ DCs induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism. J Exp Med. 2007;204(8): 1757-1764.

26. Sun CM, Hall JA, Blank RB, Bouladoux N, Oukka M, Mora JR, Belkaid Y. Small intestine lamina propria dendritic cells promote de novo generation of Foxp3 T reg cells via retinoic acid. J Exp Med. 2007;204(8): 1775- 1785.

27. Benson MJ, Pino-Lagos K, Rosemblatt M, & Noelle RJ. All-trans retinoic acid mediates enhanced T reg cell growth, differentiation, and gut homing in the face of high levels of co-stimulation. J Exp Med. 2007;204(8): 1765- 1774.

28. Iwata M, Eshima Y, & Kagechika H. Retinoic acids exert direct effects on T cells to suppress Thl development and enhance Th2 development via retinoic acid receptors. Int Immunol. 2003;15(8): 1017-1025.

29. Cantorna MT, Nashold FE, Hayes CE. In vitamin A deficiency multiple

mechanisms establish a regulatory T helper cell imbalance with excess Thl and insufficient Th2 function. J Immunol. 1994; 152(4): 1515-22

30. Nozaki Y, Tamaki C, Yamagata T, Sugiyama M, Ikoma S, Kinoshita K, Funauchi M. All-trans-retinoic acid suppresses interferon-gamma and tumor necrosis factor-alpha; a possible therapeutic agent for rheumatoid arthritis. Rheumatol Int.

2006;26(9):810-7

31. Bai A, Lu N, Zeng H, Li Z, ZHou X, Chen J, Liu P, Peng Z, Guo Y. All-trans retinoc acid ameliorates trinitrobenzene sulfonic acid-induced colitis by shifting Thl to Th2 profile. J Interferon Cytokine Res. 2010;30(6):399-406

32. Van YH, Lee WH, Ortiz S, Lee MH, Qing HJ, Liu CP. All-trans retinoci acid inhibits type 1 diabetes by T regulatory (Treg) - dependent suppressin of interferon- gamma-producing T cells without affecting Thl7 cells. Diabetes. 2009;58(1): 146-55

33. Depaolo RW, Abadie V, Tang F, Fehlner-Peach H, Hall JA, Wang W, Marietta EV, Kasarda DD, Waldmann TA, Murray JA, Semard C, Kupfer SS, Belkaid Y, Guandalini S, Jabri B. Co-adjuvant effects of retinoic acid and IL-15 induce inflammatory immunity to dietary antigens. Nature. 201; 471:220-224

34. Malkovsky, M., C. Dore, R. Hunt, L. Palmer, P. Chandler, and P.B. Medawar. 1983. Enhancement of specific antitumor immunity in mice fed a diet enriched in vitamin A acetate. Proc. Natl. Acad. Sci. USA. 80:6322-6326.

35. Malkovsky, M., R. Hunt, L. Palmer, C. Dore, and P.B. Medawar. 1984. Retinyl acetate-mediated augmentation of resistance to a transplantable 3- methylcholanthrene- induced fibrosarcoma. The dose response and time course. Transplantation. 38: 158-161.

36. Malkovsky, M., P.B. Medawar, D.R. Thatcher, J. Toy, R. Hunt, L.S. Rayfield, and C. Dore. 1985. Acquired immunological tolerance of foreign cells is impaired by recombinant interleukin 2 or vitamin A acetate. Proc. Natl. Acad. Sci. USA. 82:536-538.

37. Tan X, Sande JL, Pufnock JS, Blattman JN, Greenberg PD. Retinoic acid as a vaccine adjuvant enhances CD8+ T cell response and mucosal protection from viral challenge. J Virol. 2011 Jun 8.

38. Jin CJ, Hong CY, Takei M, Chung SY, Park JS, Pham TN, Choi SJ, Nam JH, Chung IJ, Kim HJ, Lee JJ. All-trans retinoic acid inhibits the differentiation, maturation, and function of human monocyte-derived dendritic cells. Leuk Res. 2010;34(4):513-520.

39. de Sousa-Canavez JM, de Oliveira Massoco C, de Moraes-Vasconcelos D, Corneta E C, Leite KR, Camara-Lopes LH. Retinoic acid inhibits dendritic cell differentiation driven by interleukin-4. Cell immunol. (2009;259(l):41-48. 40. Geissmann F, Revy P, Brousse N, Lepelletier Y, Folli C, Durandy A, Chambon P, Dy M. Retinoids regulate survival and antigen presentation by immature dendritic cells. J Exp Med. 2003;198(4):623-634

41. Meunier LK, Bohjanen JJ, Cooper KD. Retinoic acid upregulates human langerhans cell antigen presentation and surface expression of HLA-DR and CDl lc, a beta 2 integrin critically involved in T-cell activation. J. Invest. Dermatol. 1994;103:775-779.

42. Manicassamy S, Ravindran R, Deng J, Oluoch H, Denning TL, Kasturi SP, Rosenthal KM, Evavold BD, Pulendran B. Toll-like receptor 2-dependent induction of vitamin A- metabolizing enzymes in dendritic cells promotes T regulatory responses and inhibits autoimmunity. Nat Med. 2009;15(4):401-409.

43. Song XT, Evel-Kabler K, Shen L, Rollins L, Huang XF, Chen SY. A20 is an antigen presentation attenuator, and its inhibition overcomes regulatory T cell- mediated

suppression. Nat Med. 2008;14(3):258-265.

44. Evel-Kabler K, Song XT, Aldrich M, Huang XF, Chen SY. SOCS1 restricts dendritic cells' ability to break self tolerance and induce antitumor immunity by regulating IL-12 production and signaling. J Clin Invest. 2006;116(1):90-100.

45. Hong B, Ren W, Song XT, Evel-Kabler K, Chen SY, Huang XF. Human suppresor of cytokine signaling 1 controls immuno stimulatory activity of monocyte-derived dendritic cells. Cancer Res. 2009;69(20):8076-8084.

46. Song XT, Turnis, M. E., Zhou, X., Zhu, W., Hong, B. X., Rollins, L., Rabinovich, B., Chen, S. Y., Rooney, C. M., Gottschalk, S. A Thl -inducing Adenoviral Vaccine for Boosting Adoptively Transferred T Cells. Mol Ther. 2011;19(1):211- 217.

47. Turnis ME, Song, X. T., Bear, A., Foster, A. E., Gottschalk, S., Brenner, M. K., Chen, S. Y., Rooney, C. M. IRAK-M removal counteracts dendritic cell vaccinedeficits in migration and longevity. J Immunol. 2010;185(7):4223-4232.

48. Song XT, et al. An alternative and effective HIV vaccination approach based on inhibition of antigen presentation attenuators in dendritic cells. PLoS Med. 2006;3(l):el l.

49. Mozdzanowska K, Zharikova D, Cudic M, Otvos L, & Gerhard W. Roles of adjuvant and route of vaccination in antibody response and protection engendered by a synthetic matrix protein 2-based influenza A virus vaccine in the mouse. Virol. 2007; J 4: 118.

50. Kaufman DR, Bivas-Benita M, Simmons NL, Miller D, & Barouch DH. Route of adenovirus-based HIV-1 vaccine delivery impacts the phenotype and trafficking of vaccine-elicited CD8+ T lymphocytes. J Virol. 2010;84(12):5986-5996.

51. Li Z, Zhang M, Zhou C, Zhao,X, Iijima N, Frankel FR. Novel vaccination protocol with two live mucosal vectors elicits strong cell-mediated immunity in the vagina and protects against vaginal virus challenge. J Immunol. 2008;180(4):2504-2513 .

52. Yokota A, Takeuchi H, Maeka N, Ohoka Y, Kato C, Song SY, Iwata M. GM-CSF and IL-4 synergistically trigger dendritic cells to acquire retinoic acid-producing capacity. International Immunology. 2009 ;21(4).

53. Cantorna MT, Nashold FE, Hayes C E. In vitamin A deficiency multiple mechanisms establish a regulatory T helper cell imbalance with excess Thl and insufficient Th2 function. J Immunol. 1994;152(4): 1515-1522.

54. Koup RA, Safrit JT, Cao Y, Andrews CA, McLeod G, Borkowsky W, Farthing, C, Ho, D. D. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J Virol. 1994;68(7):4650- 4655.

55. Jin X, Bauer DE, Tuttleton SE, Lewin S, Gettie A, Blanchard J, Irwin CE, Safrit JT, Mittler J, Weinberger L, Kostrikis LG, Zhang L, Perelson AS, Ho DD. Dramatic rise in plasma viremia after CD8(+) T cell depletion in simian immunodeficiency virus-infected macaques. J Exp Med. 1999; 189(6):991-998.

56. Burton DR, Desrosiers RC, Doms RW, Koff WC, Kwong PD, Moore JP, Nabel GJ, Sodroski J, Wilson IA, Wyatt RT. HIV vaccine design and the neutralizing antibody problem. Nat Immunol. 2004;5(3):233-236.

57. Chakupurakal G, Onion D, Cobbold M, Mautner V, Moss PA. Adenovirus vector- specific T cells demonstrate a unique memory phenotype with high proliferative potential and coexpression of CCR5 and integrin alpha4beta7. AIDS 2010;24(2):205-210. 58. Benlahrech A, et al. Adenovirus vector vaccination induces expansion of memory CD4 T cells with a mucosal homing phenotype that are readily susceptible to HIV-1. Proc Natl Acad Sci U S A 2009;106(47): 19940-19945.

59. Kunkel EJ, Butcher EC. Plasma-cell homing. Nat Rev Immunol. 2003;3(10):822-829.

60. Kaufman DR, Liu J, Carville A, Mansfield KG, Havenga MJE, Goudsmit J, Barouch DH. Trafficking of antigen- specific CD8+ T lymphocytes to mucosal surfaces following intramuscular vaccination. J Immunol. 2008;181: 11.

[0125] Although the present invention and its advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope of the invention as defined by the appended claims. Moreover, the scope of the present application is not intended to be limited to the particular embodiments of the process, machine, manufacture, composition of matter, means, methods and steps described in the specification. As one of ordinary skill in the art will readily appreciate from the disclosure of the present invention, processes, machines, manufacture, compositions of matter, means, methods, or steps, presently existing or later to be developed that perform substantially the same function or achieve substantially the same result as the corresponding embodiments described herein may be utilized according to the present invention. Accordingly, the appended claims are intended to include within their scope such processes, machines, manufacture, compositions of matter, means, methods, or steps.

Claims

CLAIMS What is claimed is:

1. A vaccine composition comprising:

a RNA interfering molecule to a retinoic acid producing enzyme; and

an antigen.

2. The vaccine composition of claim 1, wherein the RNA

interfering molecule and the antigen are comprised in an expression vector.

3. The vaccine composition of claim 2, wherein the expression vector is a lenti virus or an adenovirus.

4. The vaccine composition of claim 1, wherein the retinoic acid producing enzyme is a retinal dehydrogenase.

5. The vaccine composition of claim 4, wherein the retinal

dehydrogenase is ALDHla2, ALDHlal, ALDHla3,

ALDH8al, or a mixture thereof.

6. The vaccine composition of claim 5, wherein the retinal

dehydrogenase is ALDHla2.

7. The vaccine composition of claim 1, wherein the RNA

interfering molecule is a siRNA.

8. The vaccine composition of claim 7, wherein the siRNA is a shRNA.

9. The vaccine composition of claim 7, wherein the siRNA is SEQ ID NO: 9.

10. The vaccine composition of claim 7, wherein the siRNA is a pool of siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof.

11. The vaccine composition of claim 7, wherein the siRNA comprises siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof.

12. The vaccine composition of claim 1, wherein the antigen is a HIV protein.

13. The vaccine composition of claim 12, wherein the HIV

protein is gpl40, gpl20, gp40, p24, gag, tat, pol, or a mixture thereof.

14. A method of inducing an immune response against an antigen in a subject comprising the steps of:

reducing expression of a retinoic acid producing enzyme in the subject and

administering the antigen to the subject.

15. The method of claim 14, wherein the route of vaccine

administration is intranasal, intramuscular, intradermal, intravenous, subcutaneous, intraperitoneal, or oral.

16. The method of claim 15, wherein the route of vaccine

administration is intranasal.

17. The method of claim 14, wherein the method of reducing expression of a retinoic acid producing enzyme comprises administering a siRNA that targets a retinoic acid producing enzyme to the subject.

18. The method of claim 17, wherein the siRNA and the antigen are comprised in an expression vector.

19. The method of claim 17, wherein the expression vector is a

lenti virus.

20. The method of claim 1, wherein the retinoic acid producing

enzyme is a retinal dehydrogenase.

21. The method of claim 20, wherein the retinal dehydrogenase is

ALDHla2, ALDHlal, ALDHla3, ALDH8al, or a mixture

thereof.

22. The method of claim 21, where in the retinal dehydrogenase is

ALDHla2.

23. The method of claim 17, wherein the siRNA sequence is a

shRNA.

24. The method of claim 17, wherein the siRNA is SEQ ID NO:

9.

25. The method of claim 17, wherein the siRNA is a pool of

siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ

ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7,

SEQ ID NO: 8, or a mixture thereof.

26. The method of claim 17, wherein the siRNA comprises

siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ

ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7,

SEQ ID NO: 8, or a mixture thereof.

27. The method of claim 14, wherein the antigen is a HIV protein.

28. The method of claim 27, wherein the HIV protein is gpl40,

gpl20, gp40, p24, gag, tat, pol, or a mixture thereof.

29. A method of preventing HIV in an individual or reducing symptoms HIV in an individual, comprising the step of delivering a therapeutically effective amount of the vaccine composition of claim 1 to the individual.

30. A kit comprising the vaccine composition of claim 1, said composition housed in a suitable container.

31. A method of vaccinating against HIV, comprising using a RNA interfering molecule to a retinoic acid producing enzyme as an adjuvant.

32. The method of claim 31, wherein the RNA interfering molecule is a siRNA.

33. The method of claim 32, wherein the siRNA is siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof.

34. The method of claim 32, wherein the siRNA is SEQ ID NO:

9.

35. The method of claim 32, wherein the siRNA is a pool of siRNA to SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, or a mixture thereof.

36. The method of claim 31, wherein the retinoic acid producing enzyme is ALDHla2, ALDHlal, ALDHla3, ALDH8al, or a mixture thereof..

37. The method of claim 36, wherein the retinoic acid producing enzyme is ALDHla2.