WO2013053732A1

WO2013053732A1 - Bcl6-mediated modulation of cortical differentiation of neuronal progenitor cells

Info

Publication number: WO2013053732A1
Application number: PCT/EP2012/070025
Authority: WO
Inventors: Pierre Vanderhaeghen; Jelle Van Den Ameele; Luca TIBERI
Original assignee: Université Libre de Bruxelles
Priority date: 2011-10-12
Filing date: 2012-10-10
Publication date: 2013-04-18

Abstract

The invention relates to methods, and corresponding uses, for modulating cortical differentiation of neuronal progenitor cells, in particular of cortical progenitors, encompassing methods for producing cortical neurons from neuronal progenitor cells, as well as methods for preventing cortical differentiation of the neuronal progenitor cells, through modulation of BCL6 activity in the neuronal progenitor cells. The invention further relates to the use of a non-human animal, which is BCL6 deficient or which comprises transgenic expression of BCL6, as a model for neural development, neural physiology or neurological diseases.

Description

BCL6-mediated modulation of cortical differentiation of neuronal progenitor cells FIELD OF THE INVENTION

The invention relates to methods for modulating cortical differentiation of neuronal progenitor cells, preferably of cortical progenitors, encompassing inter alia methods for producing cortical neurons from neuronal progenitor cells and methods for maintaining neuronal progenitor cells in an undifferentiated state. The invention further relates to the use of a non-human animal deficient in BCL6 expression as a model for neural development, neural physiology or neurological diseases.

BACKGROUND OF THE INVENTION

Readily accessible cells of the neuronal lineage, including neuronal progenitor cells and mature neurons, are desirable in various applications.

Neuronal progenitor cells are of value, e.g., in the study of neurogenesis, in screening methods for the identification of novel genes, growth and differentiation factors that have a role in neurogenesis, in the development of in vitro models of neurological disorders, and as a renewable source of mature neuronal cell types.

Neuronal cells or neurons can aid among others in the study of the normal physiological behaviour of the respective neuronal cell types, in the study of the aetiology and pathogenesis of neurological disorders, in neuron-replacement therapies for neurological disorders, or in various cell-based assays of pharmacological, neurotoxicological or other agents, etc.

In particular, cortical neurons can be useful inter alia in deciphering the normal physiology of the cerebral cortex, in the generation of representative models of, and cell-based screening platforms for, widespread cortical afflictions, including Alzheimer's disease, Huntington's disease, stroke and epilepsy, and in neuron-replacement therapies for such afflictions.

The in vitro generation of neuronal lineage cells from pluripotent stem cells offers a promising approach. For example, WO 2009/024448 in name of Universite Libre de Bruxelles, and Gaspard et al. (Nature, 2009, vol. 4, 1454-1463) teach among others in vitro methods for differentiating pluripotent stem cells into cortical-type neurons by culturing an adherent monoculture of pluripotent stem cells in a chemically defined medium that contains no morphogen, but in the presence of the sonic hedgehog inhibitor cyclopamine. Typically, these neuronal differentiation protocols allow pluripotent stem cells to proceed via the formation of neuronal progenitor cells towards neurons. Consequently, the neuronal progenitor cells will mostly emerge earlier in the differentiation process and the neurons will mainly arise later in the differentiation process. Accordingly, the duration of the protocol may be adjusted such as to maximise the proportion of the desired neuronal lineage cell type in the acquired cell cultures. So far to our knowledge, no alternative manipulations of these protocols have been described that allow to modulate the differentiation process such as to obtain cell cultures enriched for neuronal progenitor cells or differentiated neurons.

Hence, there exists a continuous need in the art to provide alternative or advantageous methods that can reliably and readily produce in vitro neuronal cell populations, in particular neuronal cell populations representative of the cerebral cortex. Particularly desirable may be such methods that allow to modulate the differentiation process in order to produce neuronal cell populations enriched for neuronal progenitor cells or for neurons, in particular cortical neurons. Also particularly wanted may be such methods that allow to depart from a comparatively well-characterised and accessible cell source.

B-cell CLL/lymphoma 6 (BCL6) is a transcriptional repressor which has emerged as a critical regulator of normal B cell development. BCL6 is also a frequently activated oncogene in the pathogenesis of human lymphoma. The BCL6 gene is found to be frequently translocated and hypermutated in diffuse large B-cell lymphoma (DLBCL) (Ye et al. Science, 1993, vol. 262, 747-750; Kerckaert et al. Nat. Gen., 1993, vol. 5, 66-70; Migliazza et al. Proc. Natl. Acad. Sci. U.S.A., 1995, vol. 92, 12520-12524). In addition to its role in lymphoid cells, BCL6 represses chemokine gene transcription in macrophages and is an important negative regulator of TH-2 type inflammation (Toney et al. Nat. Immunol., 2000, vol. 1 : 214-220).

SUMMARY OF THE INVENTION

The present invention addresses one or more of the above discussed needs in the art.

In particular, as shown in the experimental section, which includes exemplary data pertaining to embodiments of the present invention, transient over-expression of B-cell CLL/lymphoma 6 (BCL6) in neuronal progenitor cells prepared from embryonic stem cells as described in WO 2009/024448 and Gaspard et al. 2009 {supra) surprisingly had a potent neurogenic effect, characterised for example by a decrease in the proportion of Nestin/Pax6-positive radial glial cells (RGC), and conversely an increase in the number of Tbr2-positive intermediate progenitor cells (IPC) and β3-^υΝη-Π¾ -positive neurons. This indicates that BCL6 can facilitate cortical neurogenesis (i.e., corticogenesis) in neuronal progenitor cells.

Quantitative reverse transcriptase-PCR (qRT-PCR) analysis confirmed a decrease in all markers of RGC examined and an increase in markers of IPC and neurons. The inventors also succeeded to manipulate this cortical fate in vivo in mouse embryonic brain, using in utero electroporation targeting the embryonic cortex. Over-expression of BCL6 at E13 was followed by a decrease in the proportion of Pax6-positive RGC, and conversely an increase in the proportion of Tbr2-positive IPC, suggesting a BCL6-induced conversion of RGC to IPC and neurons. Taken together, this surprisingly established that BCL6 is sufficient to trigger corticogenesis.

The inventors further tested BCL6 requirement in corticogenesis using BCL6 -/- mice. Inspection of gross brain morphology at birth revealed a reduced size of the cerebral hemispheres, and a reduced thickness of the cortical plate in BCL6 -/- mice, suggestive of defective corticogenesis. Taken together, this surprisingly established that BCL6 is required to differentiate neuronal progenitor cells, in particular cortical progenitors, towards cortical neurons in vivo.

Hence, the inventors generally realised methods that allow to modulate cortical fate of neuronal progenitor cells, in particular cortical progenitors. These methods suitably modulate BCL6 activity in the neuronal progenitor cells, in particular cortical progenitors. As mentioned above, BCL6 has been suggested as a critical regulator of normal B cell development, and reported as a frequently activated oncogene in the pathogenesis of human lymphoma. In contrast, although expression of BCL6 in mouse embryonic cerebral cortex may have been observed before (Funatsu et al. Cereb Cortex, 2004, vol. 14: 1031 - 1044), no function in neural development has as yet been demonstrated or proposed for BCL6.

Taken together, the present inventors surprisingly established that modulating BCL6 activity in neuronal progenitor cells, in particular cortical progenitors, allows to modulate cortical differentiation of the neuronal progenitor cells.

Accordingly, in an aspect the invention provides use of B-cell CLL/lymphoma 6 (BCL6) activity, more particularly use of BCL6, for modulating cortical differentiation of neuronal progenitor cells.

In a related aspect, the invention provides a method for modulating cortical differentiation of neuronal progenitor cells comprising modulating BCL6 activity in the neuronal progenitor cells. Preferably, the neuronal progenitor cells as disclosed or employed throughout this specification may be positive for (i.e., may comprise expression of) at least Nestin and paired box protein Pax6.

In certain embodiments, the neuronal progenitor cells as disclosed or employed throughout this specification may be obtained or obtainable by a method comprising the steps of: i) plating mammalian pluripotent stem (mPS) cells onto a substrate which allows adherence of cells thereto; and ii) culturing the mPS cells of i) which have adhered to said substrate in a medium permissive to differentiation of the mPS cells; characterised in that during at least part of said culturing step ii) the cells are exposed to an antagonist of the sonic hedgehog (SHH) signalling pathway, preferably but without limitation cyclopamine.

Accordingly, any methods as taught herein may comprise a stage for obtaining the neuronal progenitor cells prior to modulating BCL6 activity in said neuronal progenitor cells, and may in particular at such stage contain the steps of: i) plating mammalian pluripotent stem (mPS) cells onto a substrate which allows adherence of cells thereto; and ii) culturing the mPS cells of i) which have adhered to said substrate in a medium permissive to differentiation of the mPS cells; characterised in that during at least part of said culturing step ii) the cells are exposed to an antagonist of the sonic hedgehog (SHH) signalling pathway, preferably but without limitation cyclopamine.

In certain embodiments, the invention provides the use of BCL6 activity, more particularly use of BCL6, for modulating cortical differentiation of neuronal progenitor cells, wherein BCL6 activity, more particularly BCL6, is used for producing cortical neurons from neuronal progenitor cells. Hence, in a more particular aspect, the invention provides use of BCL6 activity, more particularly use of BCL6, for producing cortical neurons from neuronal progenitor cells.

In some embodiments, the present method for modulating cortical differentiation of neuronal progenitor cells may be applied for producing cortical neurons from neuronal progenitor cells and may comprise the steps of: a) exposing neuronal progenitor cells to conditions which support neuronal survival; and b) providing BCL6 activity in said neuronal progenitor cells. Hence, in a more particular aspect, the invention provides a method for producing cortical neurons from neuronal progenitor cells comprising the steps of: a) exposing neuronal progenitor cells to conditions which support neuronal survival; and b) providing BCL6 activity in said neuronal progenitor cells. One shall appreciate that said conditions are generally such as to also allow for or permit differentiation of cells to neurons. Preferably, exposing the neuronal progenitor cells to conditions which support neuronal survival may comprise plating the neuronal progenitor cells onto a substrate which allows adherence of neuronal cells thereto.

In preferred methods for producing cortical neurons as taught herein, the BCL6 activity may be suitably provided at an early time point following exposing the neural progenitor cells to said conditions which support neuronal survival.

The start of the present methods for producing cortical neurons as taught herein, in other words the time corresponding to day 0 (t = day 0), as intended throughout this specification may suitably denote the time when the neuronal progenitor cells are first exposed to said conditions which support neuronal survival. Thus, by means of illustration but without limitation, providing BCL6 activity in the neuronal progenitor cells at day 1 (i.e., t = day 1 ) or day 2 (i.e., t = day 2) would denote that, respectively, at about 24 hours or at about 48 hours following the time t = day 0 the act providing the BCL6 activity is performed. One shall understand that, in some situations, prior to performing the present methods neuronal progenitor cells may be suitably generated (for example but without limitation, by differentiation from pluripotent or multipotent cells), cultivated and/or expanded in a medium conducive to culturing such cells. Nevertheless, also in such situations, one would be able to clearly identify or set the starting point of the present method (i.e., t = day 0), for example, but without limitation, the time when the cells are passaged or plated for performing the methods (for example but without limitation, passaged or plated onto a support conducive to attachment and adherence of neuronal cells) or the time when the cells have reached desirable cell density or degree of confluence, or the time when a medium is refreshed or exchanged for a medium intended for performing the methods, or similar. In preferred embodiments of methods for producing cortical neurons as taught herein, said BCL6 activity may be provided at least before day 4, preferably at least before day 3, more preferably at least before day 2, such as at least at day 0 and/or at day 1 , following exposing the neuronal progenitor cells to said conditions which support neuronal survival.

In further preferred embodiments of methods for producing cortical neurons as taught herein, the BCL6 activity may be provided from day 0 following exposing the neuronal progenitor cells to said conditions which support neuronal survival. In other words, the BCL6 activity may be provided (substantially) simultaneously with exposing the neuronal progenitor cells to said conditions which support neuronal survival. In certain embodiments of methods for producing cortical neurons as taught herein, the duration of the methods may be at least 1 day, preferably between 1 and 10 days, more preferably between 2 and 8 days, still more preferably between 4 and 6 days, even more preferably about 5 days, following exposing the neuronal progenitor cells to the conditions which support neuronal survival.

In further preferred embodiments of methods for producing cortical neurons as taught herein, the BCL6 activity may be provided transiently in the neuronal progenitor cells.

For example, but without limitation, the BCL6 activity may be provided from day 0 to day 4, or from day 0 to day 3, or from day 0 to day 2, or from day 0 to day 1 , or from day 1 to day 4, or from day 1 to day 3, or from day 1 to day 2, or from day 2 to day 4, or from day 2 to day 3, or from day 3 to day 4, following exposing the neuronal progenitor cells to said conditions which support neuronal survival. Preferably, the BCL6 activity may be provided from day 0 to day 4, more preferably from day 0 to day 3, and very preferably from day 0 to day 2, following exposing the neuronal progenitor cells to said conditions which support neuronal survival.

Particularly preferably, the BCL6 activity may be provided from day 0 to day 4, more preferably from day 0 to day 3, and very preferably from day 0 to day 2, following exposing the neuronal progenitor cells to said conditions which support neuronal survival, and the duration of the method may be .between 2 and 8 days, more preferably between 4 and 6 days, and very preferably about 5 days, following exposing the neuronal progenitor cells to said conditions which support neuronal survival. As well very preferably, the BCL6 activity may be provided from day 0 to day 1 following exposing the neuronal progenitor cells to said conditions which support neuronal survival and the duration of the uses or methods may be about 1 day following exposing the neuronal progenitor cells to said conditions which support neuronal survival.

In preferred embodiments of the uses or methods for producing cortical neurons as taught herein as taught herein, the BCL6 activity may be provided by increasing the amount of BCL6 in the neuronal progenitor cells, preferably by over-expressing BCL6 in the neuronal progenitor cells, more preferably by inducibly over-expressing BCL6 in the neuronal progenitor cells.

Preferably, the cortical neurons as disclosed or employed throughout this specification may be positive for at least β-tubulin III (Tuj 1 ) and Tbr1 .

As can be understood, the uses or methods for producing cortical neurons as taught herein may commonly achieve cell populations comprising or enriched for said cortical neurons, which may optionally also comprise other cell types. Accordingly, in further embodiments the uses or methods for producing cortical neurons as taught herein produce (i.e., may also be denoted as "for producing") a cell population comprising said cortical neurons. In some embodiments, such cell population may, for example, comprise intermediate progenitor cells (IPC). IPC as disclosed or employed throughout this specification may be positive for at least Tbr2.

In certain embodiments, the invention provides the use of BCL6 activity for modulating cortical differentiation of neuronal progenitor cells, wherein inhibition of BCL6 activity is used for preventing differentiation, particularly cortical differentiation, of the neuronal progenitor cells. As intended throughout this specification, by preventing (cortical) differentiation the neuronal progenitor cells are maintained in their existing, comparatively undifferentiated state. Hence, in a more particular aspect, the invention provides use of inhibition of BCL6 activity for preventing differentiation, particularly cortical differentiation, of neuronal progenitor cells.

In some embodiments, the present method for modulating cortical differentiation of neuronal progenitor cells may be applied for preventing cortical differentiation of the neuronal progenitor cells and may comprise inhibiting BCL6 activity in said neuronal progenitor cells. Hence, in a more particular aspect, the invention provides a method for preventing cortical differentiation of the neuronal progenitor cells comprising inhibiting BCL6 activity in said neuronal progenitor cells. One shall appreciate that the neuronal progenitor cells may be generally kept in conditions such as to allow for or permit their maintenance or growth.

In preferred embodiments of the uses or methods for preventing cortical differentiation of the neuronal progenitor cells as taught herein, the BCL6 activity may be inhibited by decreasing the amount of BCL6 in the neuronal progenitor cells or by providing inhibitors of BCL6, preferably small molecule inhibitors of BCL6, in the neuronal progenitor cells.

The uses or methods embodying the principles of the invention thus allow to produce cell populations comprising or enriched either for neural progenitor cells, in particular cortical progenitors, or for cortical neurons, using simple and robust techniques. When needed, such cell populations may be collected or harvested and said neural progenitor cells or cortical neurons may be further enriched or isolated there from on the basis of their distinctive characteristics (such as, for example, their marker expression as defined above) using methods generally known in the art (e.g., FACS, clonal culture). Both the neural progenitor cells or the cortical neurons may be employed in various applications, including medicinal (e.g., preventative or therapeutic) applications, such as without limitation cell therapy of neurological diseases, in particular neurological diseases which affect cortical function (cortical afflictions); cell-based drug screening or neurotoxicity assays; or they may be used as a model for studying pathology of said neurological diseases, in particular cortical afflictions, or neurogenesis, in particular corticogenesis, etc. Accordingly, in further aspects the invention provides neural progenitor cells, in particular cortical progenitors, or cortical neurons, or a cell population comprising either one or both, obtainable or directly obtained using the uses or methods of the invention.

In other aspects, the invention provides compositions, including pharmaceutical compositions, comprising the neuronal progenitor cells, in particular cortical progenitors, or the cortical neurons or the cell populations comprising either one or both as disclosed herein.

In other aspects, the invention provides the neuronal progenitor cells, in particular cortical progenitors, or the cortical neurons, or the cell populations comprising either one or both, or the pharmaceutical composition comprising the neuronal progenitor cells, in particular cortical progenitors, or the cortical neurons as disclosed herein for use in the treatment of neurological diseases, in particular cortical afflictions.

A related aspect provides the use of the neuronal progenitor cells, in particular cortical progenitors, or the cortical neurons, or the cell populations comprising either one or both, or the pharmaceutical composition comprising the neuronal progenitor cells, in particular cortical progenitors, or the cortical neurons as disclosed herein for the preparation of a medicament for treating neurological diseases, in particular cortical afflictions.

A related aspect provides a method for treating neurological diseases, in particular cortical afflictions, in a patient in need of such treatment, comprising administering a therapeutically or prophylactically effective amount of the neuronal progenitor cells, in particular cortical progenitors, or the cortical neurons, or the cell populations comprising either one or both, or the pharmaceutical composition comprising the neuronal progenitor cells, in particular cortical progenitors, or the cortical neurons as disclosed herein to said patient.

In further aspects, the invention provides uses of the neuronal progenitor cells, in particular cortical progenitors, or the cortical neurons, or the cell populations comprising either one or both as disclosed herein for cell-based assays, such as drug screening or neurotoxicity assays, or as a model for studying neurological diseases, in particular cortical afflictions or neurogenesis, in particular corticogenesis. Yet another aspect of the invention provides the use of a non-human animal, preferably non-human mammal, more preferably rodent, even more preferably mouse, which is BCL6 deficient or which comprises transgenic expression of BCL6, as a model for neural development, neural physiology or neurological diseases.

Such BCL6 deficient animal may, preferably, be genetically manipulated to lack, or to have decreased or deregulated expression or function of BCL6; for example, but without limitation, may be BCL6 -/+ or, more preferably, BCL6 -/- (knock-out) animal. Such animal comprising transgenic expression of BCL6 may comprise localised (e.g., cell(s)-, tissue(s)- or organ(s)-specific) transgenic expression of BCL6 or may comprise systemic transgenic expression of BCL6. Such animal comprising transgenic expression of BCL6 may comprise constitutive or inducible transgenic expression of BCL6. A transgene providing for such expression of BCL6 may for example be provided transiently (e.g., by in vivo electroporation or transfection) or may be stably integrated in the genome of the transgenic animal (e.g., by random or targeted insertion). In certain embodiments, any of such non-human animals may be used for studying neurogenesis, preferably corticogenesis, or for studying neural and neuronal function, or as a model of neurological diseases, in particular neurological diseases which affect cortical function. Hence, in certain embodiments, the invention provides use of a non-human animal, preferably a non-human mammal, more preferably a rodent, even more preferably a mouse, which is BCL6 deficient or which comprises transgenic expression of BCL6, as a model for corticogenesis, e.g., for studying corticogenesis.

For example, in certain embodiments, any of such non-human animals may be used for studying cerebellar morphogenesis, more particularly for studying generation, development, maturation or survival of cerebellar granule cells during cerebellar morphogenesis or for studying cell cycle exit and differentiation of cerebellar granule precursor cells during cerebellar morphogenesis or for studying apoptosis of cerebellar granule cells or cerebellar granule precursor cells during cerebellar morphogenesis. Hence, in certain embodiments, the invention provides use of a non-human animal, preferably a non-human mammal, more preferably a rodent, even more preferably a mouse, which is BCL6 deficient or which comprises transgenic expression of BCL6, as a model for cerebellar morphogenesis, e.g., for studying cerebellar morphogenesis.

Without wishing to be limited to any hypothesis, theory or model, the inventors further propose a mechanism where BCL6 regulates neurogenesis in the cortex through exclusion of MarnM (mastermind-like 1 ) from and recruitment of Sirtl (sirtuin 1 ) to the Hes5 (hairy and enhancer of split 5) promoter, and consequently deacetylation of histones at said promoter, thus triggering chromatin remodelling leading to neuronal differentiation despite ongoing Notch signalling.

In view hereof, in an aspect the invention also provides use of BCL6 activity for inhibiting the formation of the NICD (Notch intracellular domain)/Maml1 co-activator complex on a promoter (particularly on the Hes5 promoter) or for recruiting Sirtl (sirtuin 1 ) to a promoter (particularly to the Hes5 promoter) or for inducing deacetylation of histones at a promoter (particularly at the Hes5 promoter), in neuronal progenitor cells. Hereby, it is hypothesised, decrease of Hes5 transcription is initiated which may be necessary to trigger cortical differentiation of the neuronal progenitor cells. Also provided is thus a method for inhibiting the formation of the NICD/Maml1 co-activator complex on a promoter (particularly on the Hes5 promoter) or for recruiting Sirtl to a promoter (particularly to the Hes5 promoter) or for inducing deacetylation of histones at a promoter (particularly at the Hes5 promoter), in neuronal progenitor cells, comprising modulating BCL6 activity in the neuronal progenitor cells. These uses or methods may particularly involve providing BCL6 activity in said neuronal progenitor cells.

The inventors further realised that BCL6 can regulate cell cycle exit and differentiation of cerebellar granule precursor cells. Accordingly, a further aspect of the invention provides a method for modulating cell cycle exit and differentiation of cerebellar granule precursor cells comprising modulating BCL6 activity in the cerebellar granule precursor cells. The BCL6 activity may be modulated, e.g., provided or inhibited, as explained elsewhere in this application. The said cerebellar granule precursor cells may be preferably positive for at least ki67. Such methods may be applied to cerebellar granule precursor cells in vitro (e.g., in cell culture or in isolated tissue sections) or in vivo (e.g., in non-human animal models, e.g., rodent such as mouse models).

In certain preferred embodiments, the method may comprise providing BCL6 activity in said cerebellar granule precursor cells, whereby said cerebellar granule precursor cells exit cell cycle and differentiate towards cerebellar granule cells.

In other embodiments, the method may be for preventing cell cycle exit and differentiation of the cerebellar granule precursor cells and may comprise inhibiting BCL6 activity in said cerebellar granule precursor cells.

These and further aspects and preferred embodiments of the invention are described in the following sections and in the appended claims. The subject matter of appended claims is hereby specifically incorporated in this specification. BRIEF DESCRIPTION OF FIGURES

Figure 1 Neuronal differentiation of the doxycyclin-inducible MycBCL6 embryonic stem cell line A2loxBCL6 (A) Schematic representation of the neuronal differentiation protocol applied to the A2loxBCL6 embryonic stem cells. BCL6 over-expression was induced at day 12 of in vitro differentiation by addition of doxycyclin (Dox) to the culture medium. (B) qRT-PCR analysis for BCL6 expression at differentiation day 13 and 17, respectively 1 and 5 days after induction of BCL-6 over-expression.

Figure 2 BCL6 over-expression in differentiating embryonic stem cells triggers cortical neurogenesis in vitro, (a, c) Histograms show the percentage of cells expressing a given marker among all Hoechst or indicated marker positive cells at differentiation day 13 (a) or 17 (c). Data are presented as mean + s.e.m; n=3. (b, d), qRT- PCR analysis for Hes5, Hes1 , Blbp, Pax6, Ngn2 (neurogenin 2), Tbr2 (eomesodermin), Tubb3 (β-tubulin III) and Tbr1 expression at differentiation day 13 (b) or 17 (d). Data are presented as fold change normalized to the mean of non-treated cells at day 13 or 17, respectively + s.e.m; n=4. ^*P<0.05, ^**P<0.01.

Figure 3 BCL6 expression during mouse forebrain development (a-l) In-situ hybridization on frontal (a-f) and occipital (g-l) forebrain sections with sense (d-f, j-l) and antisense (a-c, g-i) probes for BCL6 at E12.5, E14.5 and E18.5. (m) Western blot analysis of dissected embryonic cortex at different stages with anti-Bcl6 and anti-Actin antibodies. Figure 4 BCL6 is sufficient to trigger cortical neurogenesis in vivo In utero electroporation was performed with pCIG-GFP either alone or with pCIG-BCL6 at E13.5. Immunofluorescence analysis of coronal sections was performed 24 hours later or at P4. Histograms show the percentage of Pax6+ (a), EdU+ (b), Tbr2+ (c) or Tbr1 + (d) cells among the cells stained for GFP. Mean + s.e.m; n=4. ^*P<0.05, ^**P<0.01.

Figure 5 BCL6 is required for cortical neurogenesis in vivo. (Aa, Ab) Brightfield images of BCL6 +/+ (Aa) and -/- (Ab) brains at P0. (Ba-d) Hoechst staining of coronal sections of BCL6 +/+ (Ba, Be) and -/- (Bb, Bd) brains at P0. Scale bars, 500 μιτι. (C) Quantification of the thickness of the cortical plate in BCL6 +/+ and -/- mice at P0 at frontal, parietal and occipital levels; n=5. (De, Df) Measurement of the radial thickness of the Tbr1 (De) and Cux1 (Df) staining in BCL6 +/+ and -/- brains at P0. (Eh-k, Fh-k) β3- tubulin and Tbr1 immunofluorescence analysis of coronal sections of BCL6 +/+ (Eh, Ej, Fh, Fj) and -/- (Ei, Ek, Fi, Fk) brains at E12.5.(Eh-k) or E15.5 (Fh-k) (G) Measurement of the thickness of the cortical plate (CP) in BCL6 +/+ and -/- brains at E15.5. (H) Quantification of apical pH3+ cells in BCL6 +/+ and -/- embryos at E15.5. ^*P<0.05, ^**P<0.01. (In, lo) Quantification of cell cycle exit (Edu+ Ki67-/EdU+) of BCL6 +/+ and -/- brains at E12.5 (In) and E15.5 (lo). EdU was injected in pregnant mice at E1 1.5 or E14.5, 24 hours before perfusion. Mean + s.e.m; n=4. (J) Quantification of Tbr2+ cells in BCL6 +/+ and -/- embryos at E15.5. Mean + s.e.m; n=4. (K) Proportion of basal among all (basal+apical) pH3+ cells in BCL6 +/+ and -/- embryos at E15.5. Mean + s.e.m; n=4. (L) Percentage of pH3+ among Tbr2+ cells of BCL6 +/+ and -/- brains at E15.5. Mean + s.e.m.; n=4.

Figure 6 Molecular mechanism of BCL6 control on cortical neurogenesis, (a, b) qRT- PCR analysis for Hes5, Hes1, Pax6, Blbp, Tbr2, Tbr1 and Tubb3 of BCL6 +/+ and -/- dissected cortex at E12.5 (a) and E15.5 (b). Data are presented as fold change normalized to the mean of WT + s.e.m; n=3. (c) qRT-PCR analysis for Notch-target genes Hes5, Hes1 and Blbp 6 hours after BCL6 over-expression at day 12 of in-vitro differentiation of A2loxBCL6-cells. Data are presented as fold change normalized to the mean of non-treated cells + s.e.m; n=3 (d) Schematic representation of the genomic region of Hes5, showing the exons and the BCL6 and CSL binding sites. Primers used to measure the enrichment following ChIP are presented by thick arrows, (e) ChIP analysis of the putative BCL6-binding site and a negative control site in the Hes5-promoter in BCL6 +/+ and -/- cortex at E12.5 with anti-NRA or anti-BCL6 antibodies, (f, g, h, i, j) ChIP analysis of the CSL binding sites in the /-/es5-promoter 6 hours after BCL6 over- expression at day 12 of in-vitro differentiation of A2loxBCL6-cells with anti-NRA and anti- NICD (f), anti-Maml1 (g), anti-Sirt1 (h), anti-H4K16ac (i) or anti-H1 .4K26ac (j) antibodies. Mean + s.e.m.; n=3. ^*P<0.05, ^**P<0.01 . (k) Proposed mechanism of action of BCL6 on Hes5 promoter during differentiation of radial glia to cortical neurons.

Figure 7 illustrates (A, B) Anti-BCL6 immunohistochemistry on sagittal section at P4 (A) and P7 (B). (C) Immunohistochemical staining for BCL6 on sagittal section at P4 and immunofluorescent co-staining with ki67. (E) Immunohistochemical staining for BCL6 on sagittal section at P7 and immunofluorescent co-staining with Calbindin D-28k. (D) and (F) represent high magnification of boxed areas in (C) and (E), respectively.

Figure 8 illustrates (A, B) Hoechst staining of BCL6 WT and KO sagittal section of cerebellum at 3 weeks. (C) Quantification of pH3 positive cells in BCL6 WT and KO sagittal section of cerebellum at P7. The quantification has been performed in four different zones of the cerebellum (A=anterior, C=central, P=posterior, N=nodular). (D,E) Immunofluorescence analysis of sagittal section of BCL6 WT (D) and KO (E) cerebella at P7 for EdU and Ki67. EdU was injected at P6, 24 hours before perfusion. (F) Quantification of cell cycle exit (Edu+ Ki67-/EdU+) of BCL6 WT and KO cerebella at P7 from boxed areas as shown in D and E. Mean + s.d.; n=3. ^*P<0.05.

Figure 9 illustrates (A, B) Hoechst and Neurodl stainings of BCL6 WT and KO sagittal section of cerebellum at P7. (C) Quantification of Active Caspase 3 positive cells in BCL6 WT and KO sagittal section of cerebellum at P7. The quantification has been performed in the complete section. Mean + s.d.; n=3. ^*P<0.05.

DETAILED DESCRIPTION OF THE INVENTION

As used herein, the singular forms "a", "an", and "the" include both singular and plural referents unless the context clearly dictates otherwise.

The terms "comprising", "comprises" and "comprised of" as used herein are synonymous with "including", "includes" or "containing", "contains", and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. The term also encompasses "consisting of" and "consisting essentially of".

The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.

The term "about" as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of +/-10% or less, preferably +/-5% or less, more preferably or less, and still more preferably +/-0.1 % or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier "about" refers is itself also specifically, and preferably, disclosed.

Whereas the term "one or more", such as one or more members of a group of members, is clear per se, by means of further exemplification, the term encompasses inter alia a reference to any one of said members, or to any two or more of said members, such as, e.g., any >3, >4, >5, >6 or >7 etc. of said members, and up to all said members.

All documents cited in the present specification are hereby incorporated by reference in their entirety. In particular, the teachings or sections of such documents herein specifically referred to are incorporated by reference.

The discussion of the background to the invention herein is included to explain the context of the present invention. This is not to be taken as an admission that any of the material referred to was published, known, or part of the common general knowledge in any country as of the priority date of any of the claims. Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the present invention. When specific terms are defined in connection with a particular aspect or embodiment, such connotation is meant to apply throughout this specification, i.e., also in the context of other aspects or embodiments, unless otherwise defined.

For general methods relating to the invention, reference is made inter alia to well-known textbooks, including, e.g., "Molecular Cloning: A Laboratory Manual, 2nd Ed." (Sambrook et al., 1989), Animal Cell Culture (R. I. Freshney, ed., 1987), the series Methods in Enzymology (Academic Press), Gene Transfer Vectors for Mammalian Cells (J. M. Miller & M. P. Calos, eds., 1987); "Current Protocols in Molecular Biology and Short Protocols in Molecular Biology, 3rd Ed." (F. M. Ausubel et al., eds., 1987 & 1995); Recombinant DNA Methodology II (R. Wu ed., Academic Press 1995).

General techniques in cell culture and media uses are outlined inter alia in Large Scale Mammalian Cell Culture (Hu et al. 1997. Curr Opin Biotechnol 8: 148); Serum-free Media (K. Kitano. 1991 . Biotechnology 17: 73); or Large Scale Mammalian Cell Culture (Curr Opin Biotechnol 2: 375, 1991 ), incorporated by reference herein. General techniques in neuronal cell cultures and media are outlined inter alia in Protocols for Neural Cell Culture (Series: Springer Protocols Handbooks; Laurie C Doering, ed., 4th edition, Humana Press, 2010); The Neuron in Tissue Culture (L. W. Haynes, ed., John Wiley & Sons, 1999); Neural cell culture: a practical approach (James Cohen, Graham Wilkin, Oxford University Press, 1996), or Culturing Nerve Cells (Gary Banker, 2nd ed., MIT Press, 1998), incorporated by reference herein.

For further elaboration of general techniques useful in the practice of this invention, the practitioner can refer to standard textbooks and reviews in cell biology, tissue culture, and embryology. Included are inter alia "Teratocarcinomas and embryonic stem cells: A practical approach" (E. J. Robertson, ed., IRL Press Ltd. 1987); "Guide to Techniques in Mouse Development" (P. M. Wasserman et al. eds., Academic Press 1993); "Embryonic Stem Cells: Methods and Protocols" (Kursad Turksen, ed., Humana Press, Totowa N.J., 2001 ); "Embryonic Stem Cell Differentiation in Vitro" (M. V. Wiles, Meth. Enzymol. 225: 900, 1993); "Properties and uses of Embryonic Stem Cells: Prospects for Application to Human Biology and Gene Therapy" (P. D. Rathjen et al., al.,1993). Differentiation of stem cells is reviewed, e.g., in Robertson. 1997. Meth Cell Biol 75: 173; Roach and McNeish. 2002. Methods Mol Biol 185: 1 -16; and Pedersen. 1998. Reprod Fertil Dev 10: 31 , incorporated by reference herein.

As noted, the present inventors have surprisingly realised uses and methods that employ modulation of B-cell CLL/lymphoma 6 (BCL6) activity to modulate cortical differentiation of neuronal progenitor cells.

The present methods and uses for modulating cortical differentiation of neuronal progenitor cells, such as for producing cortical neurons from neuronal progenitor cells or for preventing cortical differentiation of the neuronal progenitor cells are typically thought without limitation in vitro methods, i.e., carried out in vitro. The term "in vitro" generally denotes outside, or external to, a body, e.g., an animal or human body. The term "ex vivo" typically refers to tissues or cells removed from a body, e.g., an animal or human body, and maintained or propagated outside the body, e.g., in a culture vessel. The term "in vitro" as used herein should be understood to also encompass "ex vivo".

The terms "modulating", "modulation" or derivatives thereof are used in their broadest sense herein, and may particularly denote changing, modifying or adjusting in any direction and to any extent a process, property, function or variable, etc. that is said to be so modulated. For example, in respective contexts, modulating may carry the meanings of stimulating, inhibiting, preventing or providing, etc. The modulation may reflect qualitative and/or quantitative change(s), and specifically encompasses both: increase (e.g., activation or stimulation) or decrease (e.g., inhibition), of that which is being modulated.

For example, where modulation effects a determinable or measurable variable, then modulation may encompass an increase in the value of said variable by at least about 10%, e.g., by at least about 20%, preferably by at least about 30%, e.g., by at least about 40%, more preferably by at least about 50%, e.g., by at least about 75%, even more preferably by at least about 100%, e.g., by at least about 150%, 200%, 250%, 300%, 400% or by at least about 500%, compared to a reference situation without said modulation; or modulation may encompass a decrease or reduction in the value of said variable by at least about 10%, e.g., by at least about 20%, by at least about 30%, e.g., by at least about 40%, by at least about 50%, e.g., by at least about 60%, by at least about 70%, e.g., by at least about 80%, by at least about 90%, e.g., by at least about 95%, such as by at least about 96%, 97%, 98%, 99% or even by 100%, compared to a reference situation without said modulation.

With the phrase "modulating cortical differentiation of neuronal progenitor cells", is intended herein modulating, e.g., stimulating or inhibiting (preventing), the phenotypic progression of said neuronal progenitor cells towards cortical neurons through the process of differentiation.

As intended herein, the phrase "modulating BCL6 activity in neuronal progenitor cells" particularly denotes an act which modulates, e.g., provides or inhibits, the BCL6 activity as compared to the BCL6 activity (if any) endogenously present in said neuronal progenitor cells before said act was performed.

As intended herein, the phrase "providing BCL6 activity" in neuronal progenitor cells particularly denotes an act which provides, such as adds or increases, the BCL6 activity ("gain-of-function") beyond or above the BCL6 activity (if any) endogenously present in the neuronal progenitor cells before said act was performed, to ensure BCL6 activity in the neuronal progenitor cells adequate to achieve the purpose of the herein described uses or methods (i.e., in particular producing cortical neurons).

As intended herein, the phrase "inhibiting BCL6 activity" in neuronal progenitor cells particularly denotes an act which inhibits, such as reduces, abolishes or prevents, the BCL6 activity ("loss-of-function") below the BCL6 activity endogenously present in the neuronal progenitor cells before said act was performed, to ensure BCL6 activity in the neuronal progenitor cells adequately low or absent to achieve the purpose of the herein described uses or methods (i.e., in particular preventing cortical differentiation of neuronal progenitor cells).

The methods and uses as intended herein may be particularly preferably applied to animal cells, preferably to warm-blooded animal cells, more preferably to mammalian cells, such as human cells or non-human mammalian cells. The term "mammal" refers to any animal classified as such, including, but not limited to, humans, domestic and farm animals, zoo animals, sport animals, pet animals, companion animals and experimental animals, such as, for example, mice, rats, hamsters, rabbits, dogs, cats, guinea pigs, cattle, cows, sheep, horses, pigs and primates, e.g., monkeys and apes. Preferably, the methods and uses may be applied to cells from a non-human mammal, such as from a laboratory mammal, more preferably from mouse, rat, hamster or rabbit, even more preferably mouse; also preferably, the cells may be from pig; as well preferably, the cells may be from primate, such as from non-human primate; very preferably, the cells may be from a human.

The terms "progenitor" or "progenitor cell" refer generally to an unspecialised or relatively less specialised and proliferation-competent cell which can under appropriate conditions give rise to at least one relatively more specialised cell type, such as inter alia to relatively more specialised progenitor cells or eventually to terminally differentiated cells, i.e., fully specialised cells that may be post-mitotic.

The terms "neuronal progenitor" or "neuronal progenitor cell" refer to a progenitor cell that can under appropriate conditions give rise exclusively or predominantly to one or more neuronal cell {i.e. neuron) types.

The terms "cortical progenitor cell" or "cortical progenitor" refer to a neuronal progenitor cell that can under appropriate conditions give rise exclusively or predominantly to one or more neuronal cell types populating the cerebral cortex (i.e. cortical neurons), including e.g. pyramidal neurons and interneurons.

In preferred embodiments, neuronal progenitor cells as intended herein may be positive for Nestin and paired box protein PAX6. Particularly, the neuronal progenitor cells may have the phenotype of radial glial cells. More particularly, the neuronal progenitor cells may have the phenotype of cortical progenitor cells. Preferably but without limitation, the neuronal progenitor cells as intended herein may further comprise expression of any one or more or all of Hes1 (hairy and enhancer of split 1 ), Hes5 (hairy and enhancer of split 5), Blbp (fatty acid binding protein 7), Emx1 (empty spiracles homolog 1 ), Emx2 (empty spiracles homolog 2) and FoxG1 (forkhead box G1 ).

Neuronal progenitor cells may be isolated from either embryonic or adult brain tissue, including, for example, human neuronal progenitor cells isolated from post mortem human cortex, e.g., as described in Schwartz et al. 2003 (J Neurosci. Res. 74: 838-851 ), mouse neuronal progenitor cells from the Sox1 -GFP reporter mouse, e.g., as described in Barraud et al. 2005 (Eur J Neurosci. 22: 1555-1569), rat neuronal progenitor cells from the embryonic rat hippocampus, e.g., as described in Shetty 2004 (Hippocampus 14: 595- 614).

An alternative source of neuronal progenitor cells includes established cell lines of neuronal progenitor cells, such as , for example, the ReNcell VM cell line (Millipore).

In certain embodiments, neuronal progenitor cells may be derived from stem cells, such as particularly from pluripotent or multipotent stem cells, more particularly from mammalian stem cells, such as even more particularly from mammalian pluripotent or multipotent stem cells, through application of appropriate differentiation protocols.

The term "stem cell" generally refers to a progenitor cell capable of self-renewal, i.e., which can under appropriate conditions proliferate without differentiation. The term encompasses stem cells capable of substantially unlimited self-renewal, i.e., wherein at least a portion of the stem cell's progeny substantially retains the unspecialised or relatively less specialised phenotype, the differentiation potential, and the proliferation capacity of the mother stem cell; as well as stem cells which display limited self-renewal, i.e., wherein the capacity of the stem cell's progeny for further proliferation and/or differentiation is demonstrably reduced compared to the mother cell.

As used herein, the qualifier "pluripotent" denotes a stem cell capable of giving rise to cell types originating from all three germ layers of an organism, i.e., mesoderm, endoderm, and ectoderm, and potentially capable of giving rise to any and all cell types of an organism, although not able of growing into the whole organism.

As used herein, the qualifier "multipotent" denotes a stem cell capable of giving rise to at least one cell type from each of two or more different organs or tissues of an organism, wherein the said cell types may originate from the same or from different germ layers, but is not capable of giving rise to all cell types of an organism.

The term "mammalian pluripotent stem cell" or "mPS" cell generally refers to a pluripotent stem cell of mammalian origin. Prototype mPS cell is a pluripotent stem cell derived from any kind of mammalian embryonic tissue, e.g., embryonic, foetal or pre-foetal tissue, including, for example, murine embryonic stem cells, e.g., as described by Evans & Kaufman 1981 (Nature 292: 154-6) and Martin 1981 (PNAS 78: 7634-8), rat pluripotent stem cells, e.g., as described by lannaccone et al. 1994 (Dev Biol 163: 288-292), hamster embryonic stem cells, e.g., as described by Doetschman et al. 1988 (Dev Biol 127: 224- 227), rabbit embryonic stem cells, e.g., as described by Graves et al. 1993 (Mol Reprod Dev 36: 424-433), porcine pluripotent stem cells, e.g., as described by Notarianni et al. 1991 (J Reprod Fertil Suppl 43: 255-60) and Wheeler 1994 (Reprod Fertil Dev 6: 563-8), sheep embryonic stem cells, e.g., as described by Notarianni et al. 1991 {supra), bovine embryonic stem cells, e.g., as described by Roach et al. 2006 (Methods Enzymol 418: 21 - 37), human embryonic stem (hES) cells, e.g., as described by Thomson et al. 1998 (Science 282: 1 145-1 147), human embryonic germ (hEG) cells, e.g., as described by Shamblott et al. 1998 (PNAS 95: 13726), embryonic stem cells from other primates such as Rhesus stem cells, e.g., as described by Thomson et al. 1995 (PNAS 92:7844-7848) or marmoset stem cells, e.g., as described by Thomson et al. 1996 (Biol Reprod 55: 254- 259). Included in the definition of mPS cells are as well established lines of human ES cells, including lines which are listed in the NIH Human Embryonic Stem Cell Registry (http://stemcells.nih.gov/research/registry), and sub-lines thereof, such as, lines hESBGN- 01 , hESBGN-02, hESBGN-03 and hESBGN-04 from Bresagen Inc. (Athens, GA), lines Sahlgrenska 1 and Sahlgrenska 2 from Cellartis AB (Goteborg, Sweden), lines HES-1 , HES-2, HES-3, HES-4, HES-5 and HES-6 from ES Cell International (Singapore), line Miz-hES1 from MizMedi Hospital (Seoul, Korea), lines I 3, I 3.2, I 3.3, I 4, I 6, I 6.2, J 3 and J 3.2 from Technion - Israel Institute of Technology (Haifa, Israel), lines HSF-1 and HSF-6 from University of California (San Francisco, CA), lines H1 , H7, H9, H 13, H14 of Wisconsin Alumni Research Foundation / WiCell Research Institute (Madison, Wl), lines CHA-hES-1 and CHA-hES-2 from Cell & Gene Therapy Research Institute / Pochon CHA University College of Medicine (Seoul, Korea), lines H1 , H7, H9, H 13, H 14, H9.1 and H9.2 from Geron Corporation (Menlo Park, CA), lines Sahlgrenska 4 to Sahlgrenska 19 from Goteborg University (Goteborg, Sweden), lines MB01 , MB02, MB03 from Maria Biotech Co. Ltd. (Seoul, Korea), lines FCNCBS1 , FCNCBS2 and FCNCBS3 from National Centre for Biological Sciences (Bangalore, India), and lines RLS ES 05, RLS ES 07, RLS ES 10, RLS ES 13, RLS ES 15, RLS ES 20 and RLS ES 21 of Reliance Life Sciences (Mumbai, India). Other exemplary established hES cell lines include those deposited at the UK Stem Cell Bank (http://www.ukstemcellbank.org.uk/), and sub-lines thereof, e.g., line WT3 from King's College London (London, UK) and line hES-NCL1 from University of Newcastle (Newcastle, UK) (Strojkovic et al. 2004. Stem Cells 22: 790-7). Further exemplary ES cell lines include lines FC018, AS034, AS034.1 , AS038, SA1 1 1 , SA121 , SA142, SA167, SA181 , SA191 , SA196, SA203 and SA204, and sub-lines thereof, from Cellartis AB (Goteborg, Sweden).

Further within the term mPS cells are mPS cells obtainable by manipulation, such as inter alia genetic and/or growth factor and/or small molecule mediated manipulation, of non- pluripotent mammalian cells, such as somatic and particularly adult somatic mammalian cells, including the use of induced pluripotent stem (iPS) cells, as taught inter alia by Yamanaka et al. 2006 (Cell 126: 663-676), Yamanaka et al. 2007 (Cell 131 : 861 -872) and Lin et al. 2009 (Nature Methods 6: 805-808). A skilled person will appreciate that further cell lines having characteristics of mammalian, esp. mouse or human, pluripotent cells, may be established in the future, and these may too be suitable as source.

Further within the term mPS cells are mPS cells, such as ES cells, including human ES cells, obtainable from single blastomeres as described by Klimanskaya et al. 2006 (Nature, vol. 444(71 18), 481 -5), Klimanskaya et al. 2007 (Nat Protoc, vol. 2(8),1963-72), and Chung et al. 2008 (Cell Stem Cell., vol. 2(2), 1 13-7) and lines established there from.

Also within the term mPS cells are amniotic fluid stem (AFS) cells, including human AFS cells, as described inter alia in Prusa & Hengstschlaeger 2002 (Medical Science Monitor, vol. 8(1 1 ), RA253-RA257) and Rosner et al. 2012 (Stem Cells Int., vol. 2012, art. ID 741810). Examples of suitable differentiation protocols for differentiating pluripotent stem cells towards neuronal progenitor cells include, for example, but without limitation, the differentiation protocol of WO 2009/024448, WO2009/058451 , WO2006/044204, Gaspard et al. 2009 {supra), Reubinoff et al. 2001 (Nat Biotechnol. 19: 1 134-1 140), Itsykson et al. 2005 (Mol Cell Neurosci. 30: 24-36), etc.

In preferred embodiments of the uses or methods as taught herein the neuronal progenitor cells may be obtained or obtainable from mPS cells according to the differentiation protocol of Gaspard et al. 2009 {supra) or WO 2009/024448. In certain embodiments, adherent mPS cells may be cultured in DMEM/F12 medium supplemented with at least insulin and preferably also with any one or preferably all of transferrin, progesterone, putrescine, selenite, L-glutamine, MEM-nonessential amino acids, sodium pyruvate, beta-mercaptoethanol, penicillin, streptomycin and BSA, for up to 20 days, preferably for up to 16 days, more preferably for up to between 7 days and 14 days, and even more preferably for up to about 12 days, wherein during at least part of said culturing step, preferably between 2 days and 10 days, an antagonist of the sonic hedgehog (Shh) signalling pathway, preferably cyclopamine, is added to the medium.

As noted, in uses or methods embodying the principles of the invention, the neuronal progenitor cells may give rise to cortical neurons (i.e., differentiate towards cortical neurons) or may be prevented from undergoing differentiation, particularly cortical differentiation.

A progenitor cell is said to "give rise" to another, relatively more specialised, cell when, for example, the progenitor cell differentiates to become said other cell without previously undergoing cell division, or if said other cell is produced after one or more rounds of cell division and/or differentiation of the progenitor cell.

Within the present specification, the terms "differentiation", "differentiating" or derivatives thereof, denote the process by which an unspecialised or relatively less specialised cell becomes relatively more specialised. In the context of cell ontogeny, the adjective "differentiated" is a relative term. Hence, a "differentiated cell" is a cell that has progressed further down a certain developmental pathway than the cell it is being compared with. The differentiated cell may, for example, be a terminally differentiated cell, i.e., a fully specialised cell capable of taking up specialised functions in various tissues or organs of an organism, which may but need not be post-mitotic; or the differentiated cell may itself be a progenitor cell within a particular differentiation lineage which can further proliferate and/or differentiate. A relatively more specialised cell may differ from an unspecialised or relatively less specialised cell in one or more demonstrable phenotypic characteristics, such as, for example, the presence, absence or level of expression of particular cellular components or products, e.g., RNA, proteins or other substances, activity of certain biochemical pathways, morphological appearance, proliferation capacity and/or kinetics, differentiation potential and/or response to differentiation signals, electrophysiological behaviour, eic, wherein such characteristics signify the progression of the relatively more specialised cell further along the said developmental pathway.

As used herein, the term "cortical differentiation" particularly denotes the process by which neuronal progenitor cells differentiate to or become cortical neurons. The unspecialised or relatively less specialised neuronal progenitor cells may progress via intermediate progenitor cells, which can further proliferate and/or differentiate, further down to terminally differentiated cortical neurons. Alternatively, the neuronal progenitor cells may directly become cortical neurons through asymmetric self-renewing divisions (Noctor et al. 2004 Nat Neurosci. 7: 136-144).

In the context of cell ontogeny, the term "undifferentiated" is also a relative term. Hence, an "undifferentiated cell" is a cell that has progressed less in a certain developmental pathway than the cell it is being compared with. As used in the context of cortical differentiation, an "undifferentiated cell" particularly denotes a cell that has not entered into the process of cortical differentiation or that has not progressed far in said process such as, for example, a neuronal progenitor cell or a cortical progenitor. Accordingly, by preventing differentiation of a neuronal progenitor cell or a cortical progenitor, such comparatively less differentiated cells are maintained in their existing, "undifferentiated" state.

Reference to the "activity" of a target, such as, in particular, BCL6, may generally encompass any one or more aspects of the biological activity of the target, such as without limitation any one or more aspects of its biochemical activity, enzymatic activity, signalling activity and/or structural activity, e.g., within a cell, tissue, organ or an organism.

As can be understood, "modulating the activity of a target" as used herein may encompass modulating the biological activity and/or the level of the target.

Reference to the "level" of a target, such as, in particular, BCL6, may encompass the quantity and/or the availability (e.g., availability for performing its biological activity) of the target, e.g., within a cell, tissue, organ or an organism.

Preferably, modulation of the activity of a target, such as, in particular, BCL6, may be specific or selective, i.e., the activity of the target may be modulated without substantially altering the activity of random, unrelated targets. The terms "BCL6 (B-cell CLL/lymphoma 6 protein)", "LAZ3 (Lymphoma Associated Zinc finger on chromosome 3)" and "ZNF51 (Zinc Finger Protein 51 )" are synonymous and refer to a transcription factor of the POZ/zinc finger (POK) family that contains an N- terminal POZ domain and 6 C-terminai zinc finger motifs (Kerckaert et al. 1993 Nat. Gen. 5: 66-70) known as such in the art. BCL6 acts as a repressor of transcription. It binds to sequence-specific DNA and represses its transcription in addition to recruiting transcription co-repressors. Sequence-specific DNA binding is mediated through its 6 zinc fingers while the protein-protein interactions are mediated through its POZ domain.

The terms encompass BCL6 of any organism where found, and particularly of animals, preferably warm-blooded animals, more preferably vertebrates, yet more preferably mammals, including humans and non-human mammals, still more preferably humans. The terms particularly encompass BCL6 with a native sequence, i.e., one of which the primary sequence is the same as that of BCL6 found in or derived from nature. A skilled person understands that native sequences of BCL6 may differ between different species due to genetic divergence between such species. Moreover, native sequences of BCL6 may differ between or within different individuals of the same species due to normal genetic diversity (variation) within a given species. Also, native sequences of BCL6 may differ between or even within different individuals of the same species due to post- transcriptional modifications, including alternative splicing, or post-translational modifications. Any such variants or isoforms of BCL6 are intended herein. Accordingly, all sequences of BCL6 found in or derived from nature are considered "native". The terms encompass BCL6 when forming a part of a living organism, organ, tissue or cell, when forming a part of a biological sample, as well as when at least partly isolated from such sources. The terms also encompass BCL6 when produced by recombinant or (semi- )synthetic means.

Exemplary human BCL6 protein sequence may be as annotated under NCBI Genbank (http://www.ncbi.nlm.nih.gov/) accession number NP_001 124317.1 (isoform 1 ) (sequence version 1 ), NP_001697.2 (isoform 1 ) (sequence version 2) or NP_001 128210.1 (isoform 2) (sequence version 1 ). Exemplary human BCL6 mRNA (cDNA) sequence may be as annotated under NCBI Genbank accession number NM_001706.4 (transcript variant 1 ) (sequence version 4), NM_001 130845.1 (transcript variant 2) (sequence version 1 ) or NM_001 134738.1 (transcript variant 3) (sequence version 1 ). Exemplary mouse BCL6 protein sequence may be as annotated under NCBI Genbank accession number NP_033874.1 (sequence version 1 ). Exemplary mouse BCL6 mRNA (cDNA) sequence may be as annotated under NCBI Genbank accession number NM_009744.3 (sequence version 3).

The present methods typically involve culturing (e.g., maintaining and/or propagating and/or differentiating) the cells and cell populations taught herein in the presence of cell or tissue culture media, such as, for example, using liquid or semi-solid (e.g., gelatinous), and preferably liquid cell or tissue culture media. Such culture media can desirably sustain the maintenance (e.g., survival, genotypic, phenotypic and/or functional stability) and/or propagation of the cells or cell populations.

Typically, a culture medium may comprise a basal medium formulation as known in the art. Various basal media formulations are available, e.g., from the American Type Culture Collection (ATCC) or from Invitrogen (Carlsbad, California). By means of example and without limitation, basal media formulations may include Minimum Essential Medium (MEM), Dulbecco's Modified Eagle's Medium (DMEM), alpha modified Minimum Essential Medium (alpha-MEM), Basal Medium Essential (BME), Nutrient Mixture F-12 (Ham), Iscove's Modified Dulbecco's Medium (IMDM), RPMI 1640 Medium, Neurobasal Medium and modifications and/or combinations thereof. Compositions of basal media are generally known in the art and it is within the skill of one in the art to modify or modulate concentrations of media and/or media supplements as necessary for the cells cultured.

Such basal media formulations contain ingredients necessary for mammalian cell development, which are known per se. By means of illustration and not limitation, these ingredients may include inorganic salts (in particular salts containing Na, K, Mg, Ca, CI, P and possibly Cu, Fe, Se and Zn), physiological buffers (e.g., HEPES, bicarbonate or phosphate buffers), pH indicators, sources of carbon (e.g., glucose, sodium pyruvate, sodium acetate), and may further also comprise reducing agents or antioxidants (e.g., glutathione), vitamins, nucleotides, nucleosides and/or nucleic acid bases, ribose, deoxyribose, amino acids, etc.

For use in culture, basal medium formulations can be supplied with one or more further components. For example, additional supplements can be used to supply the cells with further necessary trace elements and substances for optimal growth and expansion. Further antioxidant supplements may be added, e.g., β-mercaptoethanol. While many basal media already contain amino acids, some amino acids may be supplemented later, e.g., non-essential amino acids, L-glutamine, which is known to be less stable when in solution, or a stabilized form dipeptide from L-glutamine, i.e. L-alanyl-L-glutamine (such as sold under the trade name GlutaMAX™). A medium may be further supplied with antibiotic and/or antimycotic compounds, such as, typically, mixtures of penicillin and streptomycin, and/or other compounds, exemplified but not limited to, amphotericin, ampicillin, gentamicin, bleomycin, hygromycin, kanamycin, mitomycin, mycophenolic acid, nalidixic acid, neomycin, nystatin, paromomycin, polymyxin, puromycin, rifampicin, spectinomycin, tetracycline, tylosin, and zeocin. Protein factors such as insulin, transferrin or bovine serum albumin may also be used to supplement culture media. Lipids and lipid carriers can also be used to supplement cell culture media. Such lipids and carriers can include, but are not limited to cyclodextrin, cholesterol, linoleic acid conjugated to albumin, linoleic acid and oleic acid conjugated to albumin, unconjugated linoleic acid, linoleic-oleic- arachidonic acid conjugated to albumin, oleic acid unconjugated and conjugated to albumin, among others.

In some uses and methods embodying the principles of the invention, neuronal progenitor cells may be exposed to conditions which support neuronal survival. For example, the culture medium may particularly support survival and/or growth of both neuronal progenitor cells and the resulting neuronal cells, in particular cortical neurons.

Accordingly, in a preferred embodiment, a basal medium formulation employed in producing cortical neurons from neuronal progenitor cells, in particular cortical progenitors, may be chosen from DMEM, Nutrient Mixture F-12 or Neurobasal medium, or any mixture thereof. In a particularly preferred embodiment, a basal medium formulation employed to produce cortical neurons from neuronal progenitor cells, in particular cortical progenitors, may be a mixture of DMEM, Nutrient Mixture F-12 and Neurobasal medium, more preferably ½:½:1 , vol/vol/vol {i.e. DMEM/F12/Neurobasal medium).

Such suitable basal medium formulation, such as preferably DMEM/F12/Neurobasal medium, may preferably comprise further components, more preferably any one, even more preferably any two or more, and still more preferably all components chosen from: L- alanyl-L-glutamine or glutamine, non-essential amino acids, sodium pyruvate, beta- mercaptoethanol, bovine serum albumin (BSA) and a mixture of penicillin and streptomycin. Such components may be preferably present as follows: L-alanyl-L- glutamine or glutamine - usually at final concentration between about 0,5 mM and about 10 mM, preferably between about 1 mM and about 5 mM, more preferably about 2 mM; non-essential amino acids - usually at final concentration between about 0,01 mM and about 1 mM, preferably between about 0,05 mM and about 0,5 mM, more preferably between about 0,08 mM and about 0.12 mM, such as at about 0,1 mM; sodium pyruvate - usually at final concentration between about 0,1 mM and about 10 mM, preferably between about 0,5 mM and about 5 mM, more preferably between about 0,8 mM and about 1 ,2 mM, such as at about 1 mM; beta-mercaptoethanol - usually at final concentration between about 10 μΜ and about 1 mM, preferably between about 50 μΜ and about 500 μΜ, more preferably between about 80 μΜ and about 120 μΜ, such as at about 100 μΜ; BSA - usually at final concentration between about 50 μg/ml and about 5 mg/ml, preferably between about 100 μg/ml and about 1 mg/ml, more preferably between about 250 μg ml and about 750 μg ml, such as at about 500 μg ml; penicillin/streptomycin - usually at final concentration between about 5 U/ml and about 500 U/ml, preferably between about 10 U/ml and about 100 U/ml, more preferably between about 25 U/ml and about 75 U/ml, such as at about 50 U/ml.

In a further preferred embodiment, a suitable basal medium formulation, such as preferably DMEM/F12/Neurobasal medium, may comprise further components supporting neuronal cell survival, more preferably any one, even more preferably any two or more, and still more preferably all components chosen from: insulin, transferrin, progesterone, putrescine and selenite. Such components may be preferably present as a mixture of insulin, transferrin, progesterone, putrescine, selenite such as sold as N-2 Supplement - usually at final concentration of 1 x, or such components may be added each separately or in any combination as follows: transferrin - usually at final concentration between about 10 mg/L and about 1 g/L, preferably between about 20 mg/L and about 500 mg/L, more preferably between about 50 mg/L and about 200 mg/L, such as at about 100 mg/L; insulin - usually at final concentration between about 100 μg/L and about 50 mg/L, preferably between about 500 μg/L and about 20 mg/L, more preferably between about 1 mg/L and 10 mg/L, such as about 5 mg/L; progesterone - usually at final concentration between about 1 ng/L and about 10 ng/L, preferably between about 5 ng/L and 7.5 ng/L about, more preferably between about 6.0 ng/L and about 6.5 ng/L, such as at about 6.3 ng/L; putrescine - usually at final concentration between about and about, such as at about 16.1 1 mg/L; selenite - usually at final concentration between about 1 ng/L and about 10 ng/L, preferably between about 2.5 ng/L and about 7.5 ng/L, more preferably between about 5 ng/L and about 5.5 ng/L, such as at about 5.2 ng/L.

Further components are known to promote neuronal survival and may be supplied to the basal medium formulation. Such components may include without limitation one or more of biotin, DL alpha-tocopheral acetate, DL alpha-tocopherol, BSA (preferably fatty acid free fraction V), catalase, insulin, transferrin, superoxide dismutase, corticosterone, D- galactose, ethanolamine, glutathione (reduced), L-carnitine, linoleic acid, linolenic acid, progesterone, putrescine, selenite, thyronine ,such as, e.g. components of the B-27 Supplement (Brewer et al. 1993. J Neurosci Res. 35: 567-576). Such components may be preferably be present as mixture, such as sold as B-27 Supplement - usually at final concentration of 1 x.

In a particularly preferred embodiment, a suitable basal medium formulation for producing cortical neurons from neuronal progenitor cells, in particular cortical neurons, such as, preferably, DMEM/F12/Neurobasal medium, may further comprise any one, preferably any two or more, and more preferably all components chosen from: L-alanyl-L-glutamine or glutamine, non-essential amino acids, sodium pyruvate, beta-mercaptoethanol, bovine serum albumin (BSA), penicillin, streptomycin, insulin, transferrin, progesterone, putrescine, selenite, biotin, DL alpha-tocopheral acetate, DL alpha-tocopherol, catalase, superoxide dismutase, corticosterone, D-galactose, ethanolamine, glutathione (reduced), L-carnitine, linoleic acid, linolenic acid and thyronine.

In a further preferred embodiment, exposing the neuronal progenitor cells to conditions which support neuronal survival may comprise allowing (e.g., through plating) the neuronal progenitor cells to adhere or attach to a substrate which allows adherence of neuronal cells thereto.

The terms "plating", "seeding" or "inoculating" generally refer to introducing a cell population into an in vitro environment. Typically, said environment may be provided in a system suitably delimited from the surroundings, such as in a culture vessel known per se, e.g., cell culture flask, well plate or dish. Said environment comprises at least a medium, typically a liquid medium. The medium may be fresh, i.e., not previously used for culturing of cells, or may comprise at least a portion conditioned by prior culturing of cells therein, e.g., culturing of the cells which are being plated or antecedents thereof, or culturing of cells unrelated to the cells being plated.

As noted, the neuronal progenitor cells may be plated onto a substrate which allows adherence of neuronal cells thereto. Laminin and poly-lysine, such as poly-L-lysine, are substrates classically used for in vitro adhesion of primary neural and neuronal cell cultures and are known to allow neurite outgrowth. Hence, a suitable substrate which allows adherence of neuronal cells thereto may be a substrate, such as, for example, tissue-culture plastic or glass, coated with poly-lysine and/or laminin. Accordingly, a preferred embodiment of the uses or methods taught herein for producing cortical neurons from neuronal progenitor cells, in particular cortical progenitors, comprises plating the neuronal progenitor cells to a substrate coated with poly-lysine, preferably poly-L-lysine and/or laminin. The uses or methods for producing cortical neurons from neuronal progenitor cells rely on providing BCL6 activity in the neuronal progenitor cells.

Without limitation, an agent able to provide BCL6 activity may be able to effect or increase the expression of BCL6 nucleic acid or polypeptide in the neuronal progenitor cells (BCL6 "overexpression"). For example, such agent may comprise, consist essentially of or consist of a recombinant nucleic acid comprising a sequence encoding BCL6 polypeptide operably linked to one or more regulatory sequences allowing for expression of said sequence encoding BCL6 polypeptide in the neuronal progenitor cells (expression construct). Introduction (e.g., by transfection or transduction) of such agent to neuronal progenitor cells shall effect the expression of BCL6 polypeptide in the cells. Such recombinant nucleic acid may be comprised in a suitable vector.

By "encoding" is meant that a nucleic acid sequence or part(s) thereof corresponds, by virtue of the genetic code of an organism in question to a particular amino acid sequence, e.g., the amino acid sequence of one or more desired proteins or polypeptides.

Preferably, a nucleic acid encoding one or more proteins, polypeptides or peptides may comprise one or more open reading frames (ORF) encoding said one or more proteins, polypeptides or peptides. An "open reading frame" or "ORF" refers to a succession of coding nucleotide triplets (codons) starting with a translation initiation codon and closing with a translation termination codon known per se, and not containing any internal in- frame translation termination codon, and potentially capable of encoding a protein, polypeptide or peptide. Hence, the term may be synonymous with "coding sequence" as used in the art.

An "operable linkage" is a linkage in which regulatory sequences and sequences sought to be expressed are connected in such a way as to permit said expression. For example, sequences, such as, e.g., a promoter and an ORF, may be said to be operably linked if the nature of the linkage between said sequences does not: (1 ) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter to direct the transcription of the ORF, (3) interfere with the ability of the ORF to be transcribed from the promoter sequence.

The precise nature of regulatory sequences or elements required for expression may vary between expression environments, but typically include a promoter and a transcription terminator, and optionally an enhancer.

Reference to a "promoter" or "enhancer" is to be taken in its broadest context and includes transcriptional regulatory sequences required for accurate transcription initiation and where applicable accurate spatial and/or temporal control of gene expression or its response to, e.g., internal or external (e.g., exogenous) stimuli. More particularly, "promoter" may depict a region on a nucleic acid molecule, preferably DNA molecule, to which an RNA polymerase binds and initiates transcription. A promoter is preferably, but not necessarily, positioned upstream, i.e., 5', of the sequence the transcription of which it controls. Typically, in prokaryotes a promoter region may contain both the promoter per se and sequences which, when transcribed into RNA, will signal the initiation of protein synthesis (e.g., Shine-Dalgarno sequence).

In embodiments, promoters contemplated herein may be constitutive or inducible.

The terms "terminator" or "transcription terminator" refer generally to a sequence element at the end of a transcriptional unit which signals termination of transcription. For example, a terminator is usually positioned downstream of, i.e., 3' of ORF(s) encoding a polypeptide of interest. For instance, where a recombinant nucleic acid contains two or more ORFs, e.g., successively ordered and forming together a multi-cistronic transcription unit, a transcription terminator may be advantageously positioned 3' to the most downstream ORF.

The term "vector" generally refers to a nucleic acid molecule, typically DNA, to which nucleic acid segments may be inserted and cloned, i.e., propagated. Hence, a vector will typically contain one or more unique restriction sites, and may be capable of autonomous replication in a defined host or vehicle organism such that the cloned sequence is reproducible. Vectors may include, without limitation, plasmids, phagemids, bacteriophages, bacteriophage-derived vectors, PAC, BAC, linear nucleic acids, e.g., linear DNA, viral vectors, etc., as appropriate. Expression vectors are generally configured to allow for and/or effect the expression of nucleic acids or ORFs introduced thereto in a desired expression system, e.g., in vitro, in a host cell, host organ and/or host organism. For example, expression vectors may advantageously comprise suitable regulatory sequences.

A vector such as an expression vector as intended herein may for example be an autonomously replicating vector (i.e., a vector which exists as an extra chromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid) or a vector which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated, depending on whether transient or stable (e.g., constitutive or inducible) transfection of the sequence of interest into the host cell is pursued. As used herein, the term "transfection" refers to the introduction of a foreign material like exogenous nucleic acids, typically DNA, into eukaryotic cells by any means of transfer. Different methods of transfection are known in the art and include, but are not limited to, calcium phosphate transfection, electroporation, lipofectamine transfection, DEAE- Dextran transfection, microinjection or virally mediated transfection, i.e. transduction. "Transient transfection" refers to methods of transfection in which the exogenous nucleic acid is not stably incorporated into the recipient host cell's chromosomal DNA and functions for only a limited time. Stably transfection refers to the permanent expression of the transgene due to the integration of the transgene into the genome of the host cell. In a preferred embodiment, provision of BCL6 activity may be performed by stably transfecting said neuronal progenitor cells with an inducible expression vector comprising the BCL6 gene sequence.

With "inducible expression vector" is meant herein an expression vector wherein the transgene is under the control of an inducible promoter, i.e. a promoter which activation requires either the presence of a particular compound, i.e. the inducer, or a defined external condition, e.g. elevated temperature. Transient expression of BCL6 may then be achieved by e.g. adding a suitable inducer such as doxycyclin to the medium wherein the neuronal progenitor cells are cultured. Non-limiting examples of such inducible expression vectors include, but are not limited to, the tetracyclin or doxycyclin induced expression systems, Rheo switch systems, CRE-LOX inducible systems, FRT system, IPTG-LAC inducible systems, ecdysone inducible systems, or the cumate repressor/operator systems.

In another example, an agent able to provide BCL6 activity may suitably comprise, consist essentially of or consist of BCL6 polypeptide, such as preferably isolated or recombinant BCL6 polypeptide, for example suitably formulated for introduction to the neuronal progenitor cells. Such may be suitably obtained through expression by host cells or host organisms, transformed with an expression construct encoding and configured for expression of said protein, polypeptide or peptide in said host cells or host organisms, followed by purification of the protein, polypeptide or peptide. Expression constructs are discussed above. In this context, the terms "host cell" and "host organism" may suitably refer to cells or organisms encompassing both prokaryotes, such as bacteria, and eukaryotes, such as yeast, fungi, protozoan, plants and animals. Contemplated as host cells are inter alia unicellular organisms, such as bacteria (e.g., E. coli, Salmonella tymphimurium, Serratia marcescens, or Bacillus subtilis), yeast (e.g., Saccharomyces cerevisiae or Pichia pastoris), (cultured) plant cells (e.g., from Arabidopsis thaliana or Nicotiana tobaccum) and (cultured) animal cells (e.g., vertebrate animal cells, mammalian cells, primate cells, human cells or insect cells). Contemplated as host organisms are inter alia multi-cellular organisms, such as plants and animals, preferably animals, more preferably warm-blooded animals, even more preferably vertebrate animals, still more preferably mammals, yet more preferably primates; particularly contemplated are such animals and animal categories which are non-human.

Alternatively, an agent able to provide BCL6 activity may comprise, consist essentially of or consist of a factor, preferably a transcription factor that stimulates the expression of endogenous BCL6.

Where a reference is made herein to certain peptides, polypeptides or proteins (such as, e.g., BCL6 polypeptide or protein or agents for use herein), such peptides, polypeptides or proteins may be preferably of animal origin, more preferably of mammalian origin, such as of non-human mammalian or human origin, preferably may be of same origin as the cells (neuronal progenitor cells) being treated. By means of example and without limitation, human neuronal progenitor cells may be exposed to human BCL6 polypeptide, whereas mouse neuronal progenitor cells may be exposed to mouse BCL6 polypeptide. Said peptides, polypeptides or proteins may be, e.g., isolated from biological sources, produced by recombinant means, or produced by synthetic means.

Where a reference is made herein to certain peptides, polypeptides or proteins (such as, e.g., BCL6 polypeptide or protein or agents for use herein), such reference is to be understood as also encompassing functional fragments and/or variants of said peptides, polypeptides or proteins.

The term "fragment" generally denotes a N- and/or C-terminally truncated form of a peptide, polypeptide or proteins. Preferably, a fragment may comprise at least about 30%, e.g., at least 50% or at least 70%, preferably at least 80%, e.g., at least 85%, more preferably at least 90%, and yet more preferably at least 95% or even about 99% of the amino acid sequence length of said peptide, polypeptide or protein.

The term "variant" of a recited given peptide, polypeptide or protein to peptides, polypeptides or proteins the amino acid sequence of which is substantially identical (i.e., largely but not wholly identical) to the sequence of said recited peptide, polypeptide or protein, e.g., at least about 85% identical, e.g., preferably at least about 90% identical, e.g., at least 91 % identical, 92% identical, more preferably at least about 93% identical, e.g., 94% identical, even more preferably at least about 95% identical, e.g., at least 96% identical, yet more preferably at least about 97% identical, e.g., at least 98% identical, and most preferably at least 99% identical.

Sequence identity may be determined using suitable algorithms for performing sequence alignments and determination of sequence identity as know per se. Exemplary but non- limiting algorithms include those based on the Basic Local Alignment Search Tool (BLAST) originally described by Altschul et al. 1990 (J Mol Biol 215: 403-10), such as the "Blast 2 sequences" algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250), for example using the published default settings or other suitable settings (such as, e.g., for the BLASTN algorithm: cost to open a gap = 5, cost to extend a gap = 2, penalty for a mismatch = -2, reward for a match = 1 , gap x_dropoff = 50, expectation value = 10.0, word size = 28; or for the BLASTP algorithm: matrix = Blosum62, cost to open a gap = 1 1 , cost to extend a gap = 1 , expectation value = 10.0, word size = 3).

The term "functional" denotes that fragments and/or variants at least partly retain the biological activity or functionality of the recited peptides, polypeptides or proteins. Preferably, such functional fragments and/or variants may retain at least about 20%, e.g., at least 30%, or at least 40%, or at least 50%, e.g., at least 60%, more preferably at least 70%, e.g., at least 80%, yet more preferably at least 85%, still more preferably at least 90%, and most preferably at least 95% or even 100% or higher of the activity (such as, e.g., ability to induce or inhibit a pathway or signalling) of the corresponding peptides, polypeptides or proteins. Particularly, a functional fragment or variant of BCL6 would retain, to at least a certain degree, the ability to stimulate cortical differentiation of neuronal progenitor cells in the present methods or uses.

Where a reference is made herein to certain substances or molecules or biological molecules such as peptides, polypeptides or proteins (such as, e.g., BCL6 polypeptide or protein or agents for use herein), such reference is to be understood as also encompassing functional (i.e., adequately achieving the desired effect or function) derivatives and analogues of substances or molecules or biological molecules. For example, such derivatives or analogues may encompass chemical modifications (e.g., additions, omissions or substitutions of atoms and/or moieties) , and/or biological modifications (e.g., post-expression modifications including, for example, phosphorylation, glycosylation, lipidation, methylation, cysteinylation, sulphonation, glutathionylation, acetylation, oxidation of methionine to methionine sulphoxide or methionine sulphone, and the like). As noted, the uses or methods taught herein allow to produce cortical neurons. The term "cortical neuron" as used herein refers to a cell having characteristics associated with the phenotype of a native, specialised {i.e. mature, post-mitotic) neuronal type populating the cerebral cortex, including, for example, pyramidal neurons and interneurons.

In a preferred embodiment, said cortical neurons are positive for at least β-tubulin III and Tbr1 (T-box brain 1 ). Preferably but without limitation, the cortical neurons as intended herein may further comprise expression of any one or more or all of CTIP2 (B-cell leukemia/lymphoma 1 1 B), reelin , Fezf2 (Fez family zinc finger 2), Satb2 (special AT-rich sequence binding protein 2) and Cux1 (cut-like homeobox 1 ).

The expression - for example, the presence or absence or quantity - of markers as discussed throughout this specification by cells or cell populations can be detected and/or measured using any suitable technique known in the art, such as without limitation immunological techniques including immunocytochemistry, immunofluorescence, flow cytometry and fluorescence activated cell sorting (FACS), immunoblotting including inter alia Western blots, dot blots and slot blots, immunoassays including inter alia ELISA (enzyme-linked immunosorbent assay) and RIA (radioimmunoassay) or by any suitable biochemical assay of enzyme activity, or by any suitable technique of detecting and/or measuring the marker mRNA including Northern blots, semi-quantitative or quantitative RT-PCR, array or microarray expression analysis, and so forth. Principles of the above assays are known in the art, and are further set out in the methodology guides cited elsewhere in this specification, and further inter alia in Ed Harlow and David Lane, "Antibodies - A Laboratory Manual", 1 ^st ed., Cold Spring Harbor Laboratory Press 1988, ISBN 0879693142; J.M. Polak, "Introduction to Immunocytochemistry" 3^rd ed., Garland Science 2003, ISBN 1859962084; M.A. Hayat, "Microscopy, Immunohistochemistry, and Antigen Retrieval Methods: For Light and Electron Microscopy", 1 ^st ed., Springer 2002, ISBN 0306467704; John R. Crowther, "The ELISA Guidebook", 1 st ed., Humana Press 2000, ISBN 0896037282; Stephen A. Bustin, "A-Z of Quantitative PCR", 1^st ed., International University Line 2004, ISBN 0963681788; Anton Yuryev, "PCR Primer Design", 1^st ed., Humana Press 2007, ISBN 158829725X; and others. Sequence data including gene, transcript and protein sequence data for markers mentioned in this disclosure are generally known and can be retrieved from public databases such as for example GenBank (http://www.ncbi.nlm.nih.gov/entrez) and UniProtKB/Swiss-Prot (http://www.expasy.org).

Where a cell is said to be positive for or to express a particular marker, this means that a skilled person will conclude the presence or evidence of a distinct signal (e.g., antibody- detectable or detection by reverse transcription polymerase chain reaction) for that marker when carrying out the appropriate measurement compared to suitable controls (e.g., cells known or expected not to express the marker, i.e., to be negative for said marker, i.e., "negative control"). Where the method allows for quantitative assessment of the marker, positive or expressing cells may on average generate a signal that is significantly different (e.g., higher) from such negative control, e.g., but without limitation, at least 1 .5-fold higher than such signal generated by the negative control, e.g., at least 2-fold, at least 4- fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40- fold, at least about 50-fold, at least about 100-fold, or at least about 200-fold higher or even higher.

Where a cell is said to be negative for or to not express (or substantially not express) a particular marker, this means that a skilled person will conclude the absence of a distinct signal (e.g., antibody-detectable or detection by reverse transcription polymerase chain reaction) for that marker when carrying out the appropriate measurement compared to suitable controls (e.g., cells known or expected to express the marker, i.e., "positive control"; or cells known or expected not to express the marker, i.e., to be negative for said marker, i.e., negative control). Where the method allows for quantitative assessment of the marker, negative or non-expressing (or substantially non-expressing) cells may on average generate a signal that is comparable to or is not significantly different from such negative control, e.g., but without limitation, which is less than 1.5-fold of the signal generated by the control, e.g., less than 1 .4-fold, less than 1.3-fold, less than 1.2-fold or less than 1.1 -fold or even lower than the signal generated by the control.

The uses or methods for preventing differentiation of neuronal progenitor cells rely on inhibiting BCL6 activity in the neuronal progenitor cells.

In an embodiment, an agent able to inhibit BCL6 activity may be able to decrease the expression of BCL6 nucleic acid or polypeptide in the neuronal progenitor cells. Non- limiting examples of agents capable to inhibit BCL6 activity may comprise, consist essentially of or consist of an antisense agent, such as, e.g., antisense DNA or RNA oligonucleotide, a construct encoding the antisense agent, or an RNA interference agent, such as siRNA or shRNA, or a ribozyme or vectors encoding such, etc.

The term "antisense" generally refers to a molecule designed to interfere with gene expression and capable of specifically binding to an intended target nucleic acid sequence. Antisense agents typically encompass an oligonucleotide or oligonucleotide analogue capable of specifically hybridising to the target sequence, and may typically comprise, consist essentially of or consist of a nucleic acid sequence that is complementary or substantially complementary to a sequence within genomic DNA, hnRNA, mRNA or cDNA, preferably mRNA or cDNA corresponding to the target nucleic acid. Antisense agents suitable herein may typically be capable of hybridising to their respective target at high stringency conditions, and may hybridise specifically to the target under physiological conditions.

The term "ribozyme" generally refers to a nucleic acid molecule, preferably an oligonucleotide or oligonucleotide analogue, capable of catalytically cleaving a polynucleotide. Preferably, a "ribozyme" may be capable of cleaving mRNA of a given target protein, thereby reducing translation thereof. Exemplary ribozymes contemplated herein include, without limitation, hammer head type ribozymes, ribozymes of the hairpin type, delta type ribozymes, etc. For teaching on ribozymes and design thereof, see, e.g., US 5,354,855, US 5,591 ,610, Pierce et al. 1998 (Nucleic Acids Res 26: 5093-5101 ), Lieber et al. 1995 (Mol Cell Biol 15: 540-551 ), and Benseler et al. 1993 (J Am Chem Soc 1 15: 8483-8484).

"RNA interference" or "RNAi" technology is routine in the art, and suitable RNAi agents intended herein may include inter alia short interfering nucleic acids (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules as known in the art. For teaching on RNAi molecules and design thereof, see inter alia Elbashir et al. 2001 (Nature 41 1 : 494-501 ), Reynolds et al. 2004 (Nat Biotechnol 22: 326-30), http://rnaidesigner.invitrogen.com/rnaiexpress, Wang & Mu 2004 (Bioinformatics 20: 1818-20), Yuan et al. 2004 (Nucleic Acids Res 32(Web Server issue): W130-4), by M Sohail 2004 ("Gene Silencing by RNA Interference: Technology and Application", 1 ^st ed., CRC, ISBN 0849321417), U Schepers 2005 ("RNA Interference in Practice: Principles, Basics, and Methods for Gene Silencing in C.elegans, Drosophila, and Mammals", 1 ^st ed., Wiley-VCH, ISBN 3527310207), and DR Engelke & JJ Rossi 2005 ("Methods in Enzymology, Volume 392: RNA Interference", 1 ^st ed., Academic Press, ISBN 0121827976).

In another embodiment, an agent able to inhibit BCL6 activity may be able to decrease the biological activity of BCL6 polypeptide in the neuronal progenitor cells. Non-limiting examples of agents capable to inhibit BCL6 activity may comprise, consist essentially of or consist of a small molecule inhibitor, or a synthetic peptide inhibitor, or a peptomimetic inhibitor, or a dominant negative variant etc.

The term "small molecule" refers to compounds, preferably organic compounds, with a size comparable to those organic molecules generally used in pharmaceuticals. The term excludes biological macromolecules (e.g., proteins, nucleic acids, etc.). Preferred small organic molecules range in size up to about 5000 Da, e.g., up to about 4000, preferably up to 3000 Da, more preferably up to 2000 Da, even more preferably up to about 1000 Da, e.g., up to about 900, 800, 700, 600 or up to about 500 Da. With the term "small molecule inhibitor" of a target, such as, in particular, BCL6, is meant herein a small molecule that binds with high affinity to the target and inhibits the activity of the target. Suitable small molecule inhibitors of BCL6 may be the ones described in inter alia WO2008/066887 or Cerchietti et al. 2010 (Cancer Cell 17: 400-41 1 ). For example, a particularly suitable compound identified by the latter is Compound 79-6.

With "synthetic peptide inhibitor" of a target is meant herein a recombinant peptide agent designed to mimic a corresponding biological peptide that modulates the biological activity of the target. Suitable synthetic peptide inhibitors of BCL6 may be, for example but without limitation, the BCL6 peptide inhibitors (BPI) described in Cherchietti et al. 2009 (Blood 1 13: 3397-3405).

The terms "peptidomimetic" or "peptomimetic" refers to a non-peptide agent that is a topological analogue of a corresponding peptide. Methods of rationally designing peptidomimetics of peptides are known in the art. A suitable peptomimetic inhibitor may be, for example, the retroinverso BCL6 peptide inhibitor (RI-BPI) described in Cherchietti et al. 2009 (Blood 1 13: 3397-3405).

As can be understood, the uses or methods of the above explained aspects may yield cell populations comprising or enriched for either neuronal progenitor cells or cortical neurons. For example, an enriched or substantially homogeneous cell population directly obtained or obtainable according to the methods of the invention may comprise at least 40%, preferably at least 50%, more preferably at least 60% and even more preferably at least 70%, at least 80% or more of either neuronal progenitor cells, in particular cortical progenitors, or cortical neurons.

Cell populations comprising or enriched for cortical neurons obtained or obtainable according to the uses or methods disclosed herein may further comprise intermediate progenitor cells.

With "intermediate progenitor cell" is meant herein a transient progenitor cell of the cortical neuron lineage which is a relatively more specialized progenitor cell than the neuronal progenitor cell, in particular the cortical progenitor, from which it is derived, and which under appropriate conditions may give rise exclusively or predominantly to one or more cortical neuron types. In a preferred embodiment, said intermediate progenitor cells are positive for at least Nestin and Tbr2.

As can be appreciated, neuronal progenitor cells, in particular cortical progenitors, or cortical neurons may be further enriched or isolated from cell populations directly obtained or obtainable according to the uses or methods disclosed herein on the basis of their distinctive characteristics (such as, for example, their marker expression and/or other phenotypic properties taught herein) using methods generally known in the art (e.g., FACS, clonal culture, panning, immunomagnetic cell separation, eic), thereby yielding isolated neuronal progenitor cells, in particular cortical progenitors, or cortical neurons or substantially pure (e.g., >85% pure, preferably >90% pure, more preferably >95% pure or even >99% pure) subpopulations of neuronal progenitor cells, in particular cortical progenitors, or cortical neurons. Accordingly, also disclosed herein are isolated neuronal progenitor cells, in particular cortical progenitors, or cortical neurons and substantially pure populations of neuronal progenitor cells, in particular cortical progenitors, or cortical neurons.

Further contemplated are the progeny of the herein taught neuronal progenitor cells, in particular cortical progenitors, or cortical neurons, including genetically or otherwise modified derivatives of said cells.

Also provided are downstream derivatives of the herein taught neuronal progenitor cells, in particular cortical progenitors, or cortical neurons, including without limitation: isolated nucleic acids (e.g., DNA, total RNA or mRNA), isolated or cloned DNA or cDNA, isolated proteins or antigens, isolated lipids, or isolated extracts (e.g., nuclear, mitochondrial, microsomal, etc.) from said cortical neurons.

The invention also provides a composition, preferably a pharmaceutical composition, comprising neuronal progenitor cells, in particular cortical progenitors, or cortical neurons or cell populations comprising such, obtainable or directly obtained according to the uses or methods disclosed herein.

Apart from said neuronal progenitor cells, in particular cortical progenitors, or cortical neurons or cell populations, such composition may comprise one or more other components. For example, components may be included that can maintain or enhance the viability of the cells or cell populations. By means of example and without limitation, such components may include salts to ensure substantially isotonic conditions, pH stabilisers such as buffer system(s) (e.g., to ensure substantially neutral pH, such as phosphate or carbonate buffer system), carrier proteins such as for example albumin, media including basal media and/or media supplements, serum or plasma, nutrients, carbohydrate sources, preservatives, stabilisers, anti-oxidants or other materials well known to those skilled in the art.

Also disclosed are methods of producing said compositions by admixing the herein taught cells or cell populations with one or more additional components as above. The compositions may be for example liquid or may be semi-solid or solid (e.g., may be frozen compositions or may exist as gel or may exist on solid support or scaffold, eic). Cryopreservatives such as inter alia DMSO are well known in the art.

In an embodiment, the composition as defined herein may be a pharmaceutical composition. Said pharmaceutical composition may thus comprise the herein taught neuronal progenitor cells, in particular cortical progenitors, or cortical neurons or cell populations as the active ingredient, and one or more pharmaceutically acceptable carrier/excipient.

Also disclosed are methods of producing said pharmaceutical compositions by admixing the herein taught cells or cell populations with one or more pharmaceutically acceptable carrier/excipient.

Preferably, the pharmaceutical compositions may comprise a therapeutically effective amount of the herein taught cells or cell populations. The term "therapeutically effective amount" refers to an amount which can elicit a biological or medicinal response in a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, and in particular can prevent or alleviate one or more of the local or systemic symptoms or features of a disease or condition being treated.

The term "pharmaceutically acceptable" as used herein is consistent with the art and means compatible with the other ingredients of a pharmaceutical composition and not deleterious to the recipient thereof.

As used herein, "carrier" or "excipient" includes any and all solvents, diluents, buffers (such as, e.g., neutral buffered saline or phosphate buffered saline), solubilisers, colloids, dispersion media, vehicles, fillers, chelating agents (such as, e.g., EDTA or glutathione), amino acids (such as, e.g., glycine), proteins, disintegrants, binders, lubricants, wetting agents, emulsifiers, sweeteners, colorants, flavourings, aromatisers, thickeners, agents for achieving a depot effect, coatings, antifungal agents, preservatives, stabilisers, antioxidants, tonicity controlling agents, absorption delaying agents, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Such materials should be non-toxic and should not interfere with the activity of the cells or cell populations. The precise nature of the carrier or excipient or other material will depend on the route of administration. For general principles in medicinal formulation, the reader is referred to Cell Therapy: Stem Cell Transplantation, Gene Therapy, and Cellular Immunotherapy, by G. Morstyn & W. Sheridan eds., Cambridge University Press, 1996. Liquid pharmaceutical compositions may generally include a liquid carrier such as water or a pharmaceutically acceptable aqueous solution. For example, physiological saline solution, tissue or cell culture media, dextrose or other saccharide solution or glycols such as ethylene glycol, propylene glycol or polyethylene glycol may be included.

Such pharmaceutical compositions may contain further components ensuring the viability of the cells therein. For example, the compositions may comprise a suitable buffer system (e.g., phosphate or carbonate buffer system) to achieve desirable pH, more usually near neutral pH, and may comprise sufficient salt to ensure iso-osmotic conditions for the cells to prevent osmotic stress. For example, suitable solution for these purposes may be phosphate-buffered saline (PBS), sodium chloride solution, Ringer's Injection or Lactated Ringer's Injection, as known in the art. Further, the composition may comprise a carrier protein, e.g., albumin (e.g., bovine or human albumin), which may increase the viability of the cells. Preferably, to ensure exclusion of non-human animal material, the albumin may be of human origin (e.g., isolated from human material or produced recombinantly). Suitable concentrations of albumin are generally known. Further, the composition may include one or more of a neuro-protective molecule, a neuro-regenerative molecule, a retinoid, growth factor, astrocyte/glial cells, anti-apoptotic factor, or factor that regulates gene expression in the cells therein. Such substances may render the cells independent of their environment.

Further suitably pharmaceutically acceptable carriers or additives are well known to those skilled in the art and for instance may be selected from proteins such as collagen or gelatine, carbohydrates such as starch, polysaccharides, sugars (dextrose, glucose and sucrose), cellulose derivatives like sodium or calcium carboxymethylcellulose, hydroxypropyl cellulose or hydroxypropylmethyl cellulose, pregeletanized starches, pectin agar, carrageenan, clays, hydrophilic gums (acacia gum, guar gum, arabic gum and xanthan gum), alginic acid, alginates, hyaluronic acid, polyglycolic and polylactic acid, dextran, pectins, synthetic polymers such as water-soluble acrylic polymer or polyvinylpyrrolidone, proteoglycans, calcium phosphate and the like.

For example, the pharmaceutical composition taught herein may be in the form of a parenterally acceptable aqueous solution, which is pyrogen-free and has suitable pH, isotonicity and stability. Those of relevant skill in the art are well able to prepare suitable solutions using, for example, isotonic vehicles such as Sodium Chloride, Ringer's Injection, or Lactated Ringer's Injection. A composition may be prepared using artificial cerebrospinal fluid.

By means of example and not limitation, the cells, cell populations or pharmaceutical compositions as taught herein may be administered to a subject systemically or locally.

In a further aspect, the invention relates to an arrangement comprising a surgical instrument or device for administration of a composition to a subject at a site of tissue dysfunction or lesion, and further comprising the cells or cell populations as taught herein, or a pharmaceutical composition comprising said cells or cell populations, wherein the arrangement is adapted for administration of the pharmaceutical composition at the site of tissue dysfunction or lesion. For example, a suitable surgical instrument may be capable of injecting a liquid composition comprising cells or cell populations as disclosed herein at the site of neural dysfunction or lesion. Cells may be implanted into a patient by any technique known in the art (e.g. Freed et al. 1997. Cell Transplant 6: 201 -202; Kordower et al. 1995. N Engl J Med 332: 1 1 18-1 124; Freed et al. 1992. N Engl J Med 327: 1549- 1555).

In an embodiment the pharmaceutical cell preparation as defined above may be administered in a form of liquid composition.

Where administration of neuronal progenitor cells, in particular cortical progenitors, or cortical neurons or cell populations as taught herein to a patient is contemplated, it may be preferable that the cells or cell populations are selected such as to maximise the tissue compatibility between the patient and the administered cells, thereby reducing the chance of rejection of the administered cells by patient's immune system (graft vs. host rejection). For example, advantageously the cells or cell cultures may be typically selected which have either identical HLA haplotypes (including one or preferably more HLA-A, HLA-B, HLA-C, HLA-D, HLA-DR, H LA-DP and HLA-DQ; preferably one or preferably all HLA-A, HLA-B and HLA-C) to the patient, or which have the most HLA antigen alleles common to the patient and none or the least of HLA antigens to which the patient contains preexisting anti-HLA antibodies. In a preferred example, the neuronal progenitor cells, in particular cortical progenitors, cortical neurons and cell populations may be derived from autologous pluripotent stem cells, e.g. iPS cells derived from somatic cells of the patient, by applying appropriated differentiation protocols as taught herein.

Furthermore, the invention contemplates the neuronal progenitor cells, in particular cortical progenitors, the cortical neurons, the cell populations or the pharmaceutical compositions taught herein for use in therapy, or their use for the manufacture of a medicament for the treatment of neurological diseases, in particular cortical afflictions. The invention also contemplates the neuronal progenitor cells, in particular cortical progenitors, the cortical neurons, the cell populations or the pharmaceutical compositions taught herein for use in the treatment of neurological disease, in particular cortical afflictions.

Neurological diseases to be treated using the cells and cell populations taught herein may involve neuronal dysfunction and/or degeneration, damage or loss, in particular but not limited to cortical areas, and in particular affecting one or more types of cortical pyramidal neurons or cortical inhibitory interneurons. Such ailments may include, without limitation, Alzheimer's disease, Huntington's chorea, Parkinson's disease, dementia, HIV dementia, stroke, epilepsy, multiple sclerosis, traumatic brain injury, cerebral ischemia, cerebral haemorrhage, and the like.

The invention also provides a method for treating a neurological disease, in particular a cortical affliction, in a patient in need of such treatment, comprising administering a therapeutically effective amount (i.e., an amount sufficient to elicit a desired local or systemic effect) of the neuronal progenitor cells, in particular cortical progenitors, the cortical neurons, the cell populations or the pharmaceutical compositions taught herein to said patient.

As used herein, the terms "treat" or "treatment" refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) an undesired physiological change or disorder, such as the development of a neurological or neuropsychiatric disease, in particular a cortical affliction. Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms, diminishment of extent of disease, stabilised (i.e., not worsening) state of disease, delay or slowing of disease progression and occurrence of complications, amelioration or palliation of the disease state. "Treatment" can also mean prolonging survival as compared to expected survival if not receiving treatment.

Except when noted, "subject" or "patient" are used interchangeably and refer to animals, preferably vertebrates, more preferably mammals, and specifically includes human patients and non-human mammals. As used herein, a phrase such as "a subject in need of treatment" includes subjects, such as mammalian or human subjects, that would benefit from treatment of a given disease, preferably a neurological or neuropsychiatric disease. Such subjects will typically include, without limitation, those that have been diagnosed with the disease, those prone to have or develop the said disease and/or those in whom the disease is to be prevented.

Said cells or cell populations may be transplanted or injected to the patient as disclosed elsewhere in this specification, allowing allogeneic, autologous or xenogeneic cellular therapy.

The cells or cell populations taught herein may be used alone or in combination with any of the known therapies for neurological diseases. The cells or cell populations taught herein can thus be administered alone or in combination with one or more active compounds. The administration may be simultaneous or sequential in any order.

In an embodiment, the neuronal progenitor cells, in particular cortical progenitors, the cortical neurons or the cell populations taught herein may represent in vitro models for neurological diseases, in particular cortical afflictions. Said neuronal progenitor cells, cortical neurons or cell populations may be derived from subjects having a neurological disease of interest, or the cells or populations may be derived from healthy subjects and further manipulated to display a pathological phenotype of interest. For example, such manipulation may include contacting said cells or populations externally with an agent, e.g., a chemical or biological agent, known or suspected of causing a pathological phenotype of interest. Exemplary agents may include, without limitation, neurotoxins, agents modulating neurotransmission, metabolites, drugs, antisera, viral agents etc. In another example, such manipulation may include transiently or stably transforming the cells (e.g., by transfection or transduction as known in the art) with a recombinant construct encoding an RNA or protein agent known or suspected of causing a pathological phenotype of interest, or an agent (e.g., an RNAi agent or a dominant negative variant) that can suppress the expression of an endogenous gene known or suspected to contribute to a disease of interest. Exemplary agents to be expressed may include, without limitation, disease-causative proteins such as mutant huntingin, mutant presenilins or APP, etc.

In another aspect, the invention provides use of the neuronal progenitor cells, in particular cortical progenitors, the cortical neurons or the cell populations taught herein, optionally and preferably wherein said cells or populations represent models for neurological diseases, particularly cortical afflictions, in any variety of screening assays, particularly in vitro screening assays, such as, e.g., in assays of biological effects of candidate pharmacological substances and compositions; assays of cellular toxicity, genotoxicity or carcinogenicity of chemical or biological agents; assays allowing the study of normal neuronal function and of the aetiology of neurological diseases, and the like. Cell-based in vitro screening assays can be carried out as generally known in the art. For example, cells grown in a suitable assay format (e.g., in multi-well plates or on coverslips, etc.) are contacted with a candidate agent (e.g., a potential pharmacological agent) and the effect of said agent on one or more relevant readout parameters is determined and compared to a control. Relevant readout parameters may greatly vary depending on the type of assay and may include, without limitation, neuronal survival, occurrence of apoptosis or necrosis, altered morphology (e.g., number, length and/or arborisation of neural projections), elecrophysiological behavriour, gene expression, etc. Hence, in an embodiment the invention provides a screening assay to identify pharmacological agents for the treatment of a neurological disease phenotype, comprising contacting the neuronal progenitor cells, in particular cortical progenitors, the cortical neurons or the cell populations taught herein which display said disease phenotype with a candidate pharmacological agent, and determining alleviation of said disease phenotype when said agent is administered. The invention also relates to so-identified pharmacological agents. The methods taught herein are also suitable for in vitro carrying out and analysis of progression of neuronal differentiation, particularly differentiation towards cortical fate, as well as for screening assays for modulators of said differentiation.

The invention also provides methods for introducing, such as for example injecting or implanting, neuronal progenitor cells, in particular cortical progenitors, cortical neurons as taught herein or cell populations comprising such, into a non-human experimental animal, and also provides the so-modified animal.

In the present invention, the neuronal progenitor cells, in particular cortical neurons or cortical neurons, may be stably or transiently transfected or transformed with a nucleic acid of interest prior to further use, e.g., in therapy, screening or research. Nucleic acid sequences of interest may include, but are not limited to, e.g., those encoding gene products which enhance the survival, growth, differentiation and/or functioning of the neuronal progenitor cells or cortical neurons, such as without limitation neurotropic factors (e.g., NGF, BDNF or GDNF); anti-apoptotic molecules (e.g., Bcl2); axon regenerating, elongating or guiding molecules (e.g., ephrins), and the like.

Another aspect of the present invention relates to the use of a non-human animal, preferably a non-human mammal, more preferably a rodent, even more preferably a mouse, which is BCL6 deficient or which comprises transgenic expression of BCL6, as a model for neural development, neural physiology or neurological diseases. Methods for achieving transgene expression in experimental animals are routinely known, as are methods for producing heterozygous (+/-) or homozygous (-/-) animals deficient in a desired gene function.

An exemplary knock-out (BCL6 KO, BCL6 -/-) transgenic mouse has been disclosed by Ye et al. 1997 (Nat. gen 16: 161 -170). The inventors have shown that the BCL6 -/- model of Ye et al. 1997 (supra) shows deficient development of the cerebral cortex. Accordingly, this model may be particularly useful for studying neurogenesis, in particular corticogenesis. Alternatively, an animal model having impaired neurogenesis, such as that of Ye et al. 1997 (supra), may serve as a model for studying neurological diseases, such as without limitation neurodegenerative diseases, and may allow to study the contribution of BCL6 to the disease process, or may be useful for screening potential pharmaceutical agents.

While the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art in light of the foregoing description. Accordingly, it is intended to embrace all such alternatives, modifications, and variations as follows in the spirit and broad scope of the appended claims.

EXAMPLES

Example 1 : Experimental procedures

Embryonic stem cell culture

ICE (A2lox.Cre) mouse embryonic stem cells (ESC) were routinely propagated on irradiated mouse embryonic fibroblasts (MEFs) in Dulbecco's Modified Eagle's Medium (DMEM) (Invitrogen) supplemented with 15% ES-certified fetal bovine serum (FBS) (Invitrogen), 0.1 mM non-essential amino acids (Invitrogen), 1 mM sodium pyruvate (Invitrogen), 0.1 mM β-mercaptoethanol (Sigma), 50 U/ml penicillin/streptomycin and 10³ U/ml leukemia inhibitor factor (LIF) (ESGRO).

Generation of the doxycyclin-inducible MycBCL6 ESC line A2loxBCL6

The doxycyclin-inducible MycBCL6 embryonic stem cell line A2loxBCL6 was generated overall as described in lacovino et al. 2009 (Stem Cells Dev. 18: 783-792). Briefly, the coding sequence of murine BCL6 was cloned by polymerase chain reaction (PCR) from cDNA with an N-terminal Myc-tag into the p2lox plasmid (Kyba et al., 2002. Cell 109:29- 37). 5x10⁶ ICE (A2lox.Cre) ESC were electroporated with the p2lox-MycBCL6 vector allowing unidirectional recombination of the transgene in the HPRT-locus. Clones were screened by immunofluorescence against BCL6 after 24 hours in the absence or presence of 1 μg ml doxycyclin to verify transgene expression. Results were confirmed in 2 independent clones.

In vitro neuronal differentiation

For differentiation, ESC were plated at low density (20x10³/ml) on gelatine-coated coverslips and cultured as described in Gaspard et al., 2009 (Nat Protoc 4:1454-1463). Briefly, ES medium was changed to defined default medium (DDM) on differentiation day 0 (in the context of this experimental section, "differentiation day 0" is used to denote the time when ES cells are subjected to the overall differentiation protocol, see Figure 1 a; as said below, on day 12 the cells are then plated on N2/B27 medium, and the latter time point would thus embody one example of the term "t = day 0" as employed elsewhere in this specification). DDM consists of DMEM/F12 + GlutaMAX™ (Sigma) supplemented with N-2 Supplement (1x, Sigma; 10 nM human transferrin, 0.861 nM insulin recombinant full chain, 0.02 nM progesterone, 0.0301 nM putrescine), 0.1 mM non-essential amino acids, 1 mM sodium pyruvate, 500 μg ml bovine serum albumin (BSA), 0.1 mM β- mercaptoethanol (Sigma), 50 U/ml penicillin/streptomycin. Medium was changed every two days. On differentiation day 2, the medium was replaced with DDM supplemented with 1 μΜ cyclopamine (Calbiochem). On differentiation day 10, the medium was replaced with DDM only (no cyclopamine). After 12 days of differentiation, cells were trypsinized, dissociated and plated on poly-L-lysine (33 μg/ml in PBS for 2h at room temperature; Beckton-Dickinson) and laminin (3 μg/ml in PBS for 2h at room temperature; Becton- Dickinson) coated sterilised glass coverslips (VWR, Menzl) and allowed to grow in N2/B27 medium, to allow improved survival of the neurons than in DDM alone. N2/B27 medium consists of a 1 :1 mixture of DDM and Neurobasal (Invitrogen) supplemented with B27 supplement (1 x, without vitamin A; Invitrogen), 2 mM glutamine (Invitrogen) and 50 U/ml penicillin/streptomycin. Medium was changed every two days.

RNA isolation and qRT-PCR

For total RNA preparation, cells or dissected cortex (at least 2 brains for each genotype) were lysed in RLT (Qiagen) + 1 % β-mercaptoethanol, and RNA was isolated using RNeasy RNA preparation minikit (Qiagen) according to the manufacturer's instructions. Reverse transcription was done using Superscript II kit and protocol (Invitrogen). Quantitative PCR (qPCR) was performed in duplicate using Power SybrGreen Mix and a 7500 Real-Time PCR System (Applied Biosystems). Results are presented as linearized Ct-values normalized to the housekeeping gene TBP and the indicated reference value (2^" ^ΔΔα). The primers used are summarized in Table 1. Table 1.

In situ RNA hybridization

In situ RNA hybridization using digoxigenin-labelled RNA probes on brain cryosections was performed as described by Vanderhaeghen et al. 2000 (Nat Neurosc. 3: 358:365). All hybridization results obtained with antisense probes were compared with control sense probes. In situ hybridization probe for BCL6: from bp 999 to 1739 of the protein coding sequence (CDS) of the mouse BCL6 mRNA (cDNA) sequence as annotated under NCBI Genbank accession number NM 009744.3 (sequence version 3).

Western Blot analysis, ChIP (Chromatin Immunoprecipitation) and ChlP-qPCR

Western Blot analysis was performed as previously described on dissected E10.5, E12.5, E14.5, E15.5, E16.5 and E18.5 cortex as described in Rustighi et al. 2009 (Nat Cell Biol. 1 1 : 133-142). ChIP was performed as described in Rustighi et al. 2009 (supra) on differentiating ES cells or dissected E12.5 or 15.5 cortex. ChlP-qPCR analysis was performed using primers summarized in Table 2. For each primer set, qPCR was performed in duplicate. Results were analyzed comparing the particular antibody to the input.

Table 2.

Forward primer Reverse primer

BCL6C atgcagaggggtttactgac gtatctggactgctcttg

hIP + (SEQ ID NO: 21 ) (SEQ ID NO: 22) CSLChI ggcagcatattgaggcg ggacagagccaggcgtcccg

P + (SEQ ID NO: 23) (SEQ ID NO: 24)

BCL6C cagggtaggggaagagatcc gtggaagggagggcatttat

hIP - (SEQ ID NO: 25) (SEQ ID NO: 26)

Immunofluorescence staining

Cells were fixed in 4% paraformaldehyde for 30 minutes and washed three times in phosphate-buffered saline (PBS). Mouse embryos and pups were fixed by perfusion with 4% paraformaldehyde and where appropriate cryoprotected in 30% sucrose (Merck). Immunostaining was performed on coverslips (cells), 20 μηη thick cryosections or 60-100 μηη thick vibratome sections. Blocking of unspecific antibody activity and permeabilisation was done in PBS supplemented with 5% horse serum (Invitrogen), 0.3% Triton X-100 (Sigma) and 3% BSA (Sigma). Antibody solution consisted of PBS supplemented with 1 % horse serum, 0.1 % Triton X-100 and 3% BSA. Primary antibodies were incubated overnight at 4°C and secondary during 2 hours at room temperature. Nuclei were stained with bisbenzimide (Hoechst#33258; Sigma). Coverslips and sections were mounted with glycergel (DAKO).

Antibodies

Primary antibodies used were the following: Tuj1 (MMS435P; Covance), Tbr2 (ab23345; Abeam), Cux1 (sc-13024; Santa Cruz Biotechnology); Bcl6 (sc-858; Santa Cruz

Biotechnology) Ki67 (ab15580; Abeam), GFP (ab13970; Abeam), Nestin (ab6142;

Abeam), pH3 (10543; Abeam), Ctip2 (ab18465; Abeam), Tbr1 (Eurogentec), Pax6

(PRB278P; Covance), Cleaved Casp3 (MAB835; R&D), N1 ICD (2421 ; Cell Signaling),

Sirtl (sc-15404; Santa Cruz Biotechnology), H 1.4K26Ac (H7789; Sigma), H4K16Ac (07- 329; Millipore). Secondary antibodies were donkey anti-mouse, anti-goat or anti-rabbit coupled to cyanin 3 or cyanin 5 (Jackson Immunoresearch) or to AlexaFluor 488

(Molecular Probes).

Imaging

Pictures of the in situ RNA hybridization and immunofluorescence staining were acquired with an Axioplan2 Zeiss microscope and a Spot RT camera, and converted in false colours and overlaid using Adobe Photoshop software.

Quantitative studies of cell proliferation, cell cycle exit

For ethynyl deoxyuridine (EdU) labeling, timed-pregnant female mice were injected intraperitoneally with a single pulse (50 mg/kg body weight) of EdU and sacrificed after 24 h. In utero electroporation

In utero surgery and electroporation was performed as described in Saito and Nakatsuji 2001 (Dev Biol 240: 237-246). Briefly, timed pregnant CD1 mice (Charles River) at embryonic day E13.5 were anesthetised and their uterus exposed. Two microliters of DNA solution (1 μg μl) was injected into one lateral ventricle of in utero embryos, and 5 to 8 electric pulses, at 30 V, were delivered using forceps-type electrodes. Each electroporation result was confirmed in several embryos derived from at least three operated pregnant mice.

BCL6 -/- mice

The BCL6 -I- mice were as described in Ye et al. 1997 (Nat. gen. 16: 161 -170). Animal care and procedures were in compliance with local ethical committees and institutional guidelines.

Statistical analysis

Unless stated otherwise, data are presented as mean + standard error of the mean of at least three biologically independent experiments or embryos from at least three different litters. For quantification of cell numbers in vitro, at least 200 cells were counted in five different fields from at least three biologically independent experiments; for in vivo cell counting, all positive cells were counted within a 100μηι wide area of the cortex at three rostro-caudal levels, carefully matched between animals. Data from these quantifications are presented as mean + standard error of the mean. For quantification of pH3, all positive cortical progenitors were counted per brain section. Proportions were compared using Chi-square test. Student's t-test was used for comparing data of measurements of cortical plate/layer thickness, ChIP and RT-qPCR experiments.

Example 2: Over-expression of BCL6 in differentiating mouse embryonic stem cells is sufficient to trigger cortical neurogenesis in vitro

The neuronal differentiation protocol was applied to the doxycyclin-inducible MycBCL6 ESC line A2loxBCL6, which allows induction of the Myc-tagged BCL6 upon doxycyclin (Dox) addition to the culture medium. BCL6 over-expression was induced through addition of Dox to the culture medium at differentiation day 12 (Fig.1 a). Figure 1 b shows BCL6 expression in the differentiating A2loxBCL6 cells that were exposed to Dox relative to its expression in differentiating A2loxBCL6 cells that were not exposed to Dox at differentiation days 13 and 17. BCL6 over-expression revealed a potent neurogenic effect. 1 day (Fig. 2a, b) and 5 days (Fig. 2c, d) following Dox addition to the culture medium the proportion of Nestin/Pax6- positive radial glial cells (RGC) decreased, and conversely the number of Tbr2-positive intermediate progenitor cells (IPC) and β3-ίι ιιΝη- Γ¾Γΐ -positive neurons increased as compared to cultures that were not exposed to Dox (Fig. 2a, c). qRT-PCR analysis confirmed a decrease in all markers of RGC (Pax6) examined and an increase in markers of IPC (Tbr2) and neurons (Tubb3, Tbr1 ) (Fig.2b,d).

These data indicate that over-expression of BCL6 in differentiating ESC at the onset of active neurogenesis is sufficient to trigger cortical differentiation.

Example 3: BCL6 triggers cortical neurogenesis in vivo

To confirm the finding of Experiment 1 that BCL6 is sufficient to trigger cortical differentiation, BCL6 function in neurogenesis was further explored in vivo.

We first examined expression of BCL6 in the mouse embryonic brain using in situ RNA hybridization. BCL6 was found to be expressed in the cerebral cortex from E12, while it was not detectable in other parts of the forebrain (Fig. 3a-l). At later stages, BCL6 was mostly confined to the cortical plate that contains differentiated neurons, as previously described by Funatsu et al. 2004 (Cereb Cortex. 14: 1031 -1044) and Leamey et al. 2008 (Cereb Cortex. 18: 53-66), but at earlier stages (E12-E14), it was also present in the intermediate and subventricular zones, containing IPC and differentiating neurons (Fig. 3a, b). Notably, BCL6 was expressed at highest levels in the anterior-most (frontal/parietal) parts of the neocortex, while it was barely detectable in the most posterior (occipital) parts except in the hippocampus (Fig. 3g-i). Western blot analysis confirmed that the BCL6 protein was expressed in the developing cortex throughout corticogenesis (Fig. 3m). BCL6 is thus induced during the transition from neuronal progenitor cells to differentiating cortical neurons, consistent with a role in this process.

To further test this hypothesis we applied in utero electroporation targeting the embryonic cortex (Fig. 4). Over-expression of BCL6 at E13 was followed by a decrease in the proportion of Pax6-positive RGC and EdU-positive cycling cells, and conversely an increase in the proportion of Tbr2-positive IPC (Fig. 4a-c), suggesting a BCL6-induced conversion of RGC to IPC and neurons. This was confirmed by analysis of the electroporated brains at postnatal day 4 (P4), showing an increase in the proportion of Tbr1 -positive cortical neurons (Fig. 4d): BCL6-electroporated neurons displayed mostly a fate of early-born Tbr1 -positive deep layer cortical neurons, instead of later born Cux1 - positive upper layer neurons, indicative of precocious neurogenesis induced by BCL6. Taken altogether, without wishing to be limited to any hypothesis, theory or model, these results indicate that BCL6 is sufficient to trigger cortical neurogenesis in vivo.

Example 4: BCL6 is required in cortical neurogenesis

We tested BCL6 requirement in corticogenesis using BCL6 -/- mice. BCL6 -/- mice and control +/+ littermates were examined during embryogenesis until birth. Inspection of gross brain morphology at birth revealed a reduced size of the cerebral hemispheres (Fig. 5a, b) and a reduced thickness of the cortical plate (Fig. 5Ba-d, 5C) in BCL6 -/- mice, suggestive of defective corticogenesis. The layer pattern of the mutant cortex appeared unaffected, but all cortical layers seemed to be reduced, as shown by a similar decrease in the thickness of Tbr1/Ctip2-positive deep layers (Fig. 5De) and Cux1 -positive upper layers (Fig. 5Df). The defect was largely restricted to the frontal/parietal parts of the cortex, while occipital cortex was overall preserved, in correlation with the areal pattern of expression of BCL6. Cortical plate reduction was already detectable at embryonic stages E12.5 (Fig. 5Eh-k) and E15.5 (Fig. 5Fh-k, 5G), suggesting an early developmental defect that could result from dysregulation in neural cell proliferation, survival or differentiation.

Apoptosis rates in cortical cells, assessed by number of activated caspase 3-positive cells, were found to be similar in BCL6 -/- and control littermates at both E12.5 and E15.5. The proliferation of RGC, which mostly occurs at the apical side of the ventricular zone, appeared to be largely unaffected in BCL6 -/- cortex, based on comparable numbers of pH3-positive apical cells (Fig. 5H) and Pax6-positive RGC. Strikingly however, we found a strong reduction of cell cycle exit rates at both E12.5 and E15.5, selectively in the frontal and parietal cortex of BCL6 -/- embryos (Fig. 5ln, 5lo), indicating defective transition from NPC to postmitotic neurons. The proportion of IPC, that specifically express Tbr2 and divide at the basal side of the VZ/SVZ (Kowalczyk et al. 2009 Cereb Cortex 19: 2439- 2450), was also decreased in the BCL6 -/- cortex (Fig. 5J-K). The proportion of pH3- positive cells among Tbr2-positive IPC was however similar (Fig. 5L), suggesting a defect in the generation, rather than the proliferation of Tbr2-positive IPC.

Taken together, without wishing to be limited to any hypothesis, theory or model, these data indicate that BCL6 is required for the proper transition from RGC to IPC and postmitotic neurons, which accounts for the reduced number of cortical neurons generated in the BCL6 -/- cortex. Example 5: Molecular mechanism of BCL6 control on cortical neurogenesis.

To start dissecting the molecular mechanism of BCL6 control on cortical neurogenesis, we profiled a panel of genes related to neurogenesis by qRT-PCR in BCL6 -/- cortex (Fig. 6a, b). While this analysis confirmed down-regulation of genes normally expressed in IPC (Tbr2) and neurons (Tbr1 and Tubb3), the only gene normally expressed in RGC that was consistently altered was Hes5, which showed up-regulation at both E12.5 and E15.5. Hes5 is a well known Notch target gene, which together with Hes1 is required for RGC self-renewal and is sufficient to inhibit cortical neurogenesis (Ohtsuka et al. 2001 J Biol Chem 276: 30467-30474; Ohtsuka et al. 1999 EMBO J 18: 2196-2207).

In silico inspection of the Hes5 promoter revealed the presence of a bona fide BCL6 binding site located <1 kb upstream to the transcriptional starting point (Fig. 6d), suggesting that BCL6 could directly bind to the Hes5 promoter. Chromatin Immunoprecipitation (ChIP) experiments in BCL6 +/+ and -/- E12.5 embryonic cortex with an antibody against BCL6 revealed a specific enrichment directly on this site (Fig. 6e), which could in principle lead to transcriptional repression. Consistent with this hypothesis, Hes5 was strongly repressed already 6 hours following BCL6 over-expression during in vitro ESC-corticogenesis (Fig. 6c).

BCL6 was recently shown to repress Notch-dependent genes during left-right asymmetry patterning in Xenopus, through a direct binding competition mechanism between NICD, BCL and Maml1 (Sakano et al. 2010 Developmental Cell 18: 450-462). By ChIP we examined N1 ICD and MarnM recruitment to the Hes5 promoter during in vitro ESC- corticogenesis, following short (6 hours) pulses of DOX. This led to a strong enrichment of MarnM (Fig.6g), with no detectable difference in NICD recruitment (Fig.6f). These data indicate that BCL6 inhibits the formation of the NICD/Maml1 co-activator complex on the Hes5 promoter, thus initiating the decrease of Hes5 transcription necessary to trigger RGC differentiation.

However the transition from NPC to neurons is thought to be irreversible, at least in physiological contexts. This would imply additional, likely epigenetic mechanisms accounting for the stable repression of Notch-dependent targets normally expressed in RGC, even in the presence of ongoing Notch signalling in IPC and neurons. Sirtl was previously shown to induce repressive chromatin remodelling and facilitate heterochromatin formation by deacetylation of histone H4 lysine 16 (H4K16Ac) and histone H 1.4 lysine 26 (H 1.4K26Ac) (Mulligan et al. 201 1 Molecular cell 42: 689-699; Vaquero et al. 2004 Molecular cell 16: 93-105). A direct link between BCL6, Sirtl and histone acetylation patterns on the Hes5 promoter was revealed by transient overexpression of BCL6 during ESC-corticogenesis in vitro, looking at Sirtl recruitment and acetylation of its histone targets. This elicited a rapidly increased recruitment of Sirtl at the Hes5 promoter, six hours following BCL6 induction (Fig. 6h), and a converse decrease in H4K16Ac and H 1.4K26Ac acetylation marks (Fig. 6i, 6j).

Altogether, without wishing to be limited to any hypothesis, theory or model, our data lead to a model (Fig. 6k) where BCL6 acts as an essential lever of neurogenesis in the cortex, through exclusion of MarnM and recruitment of Sirtl to the Hes5 promoter, thus triggering chromatin remodelling leading to neuronal differentiation despite ongoing Notch signalling.

Example 6: BCL6 is involved in cerebellar development

The cerebellum is an excellent system for studying neuronal development. In the adult mouse, it is a relatively simple laminated structure consisting of three layers: the molecular layer, the Purkinje cell layer, and the granular layer. This part of the brain is essential for fine motor control movement and posture of the body. The cerebellar granule precursor cells are derived from the posterior edge of the cerebellar anlage close to the rhombic lip in mice as early as E10.5 and migrate to the pial surface of the developing cerebellum forming the external granular layer (EGL). During postnatal cerebellar development, granule precursor cells that have exited the cell cycle migrate radially along the Bergmann glial fibers to form the internal granular layer (IGL). Finally, the postnatal development of the cerebellum is completed by P21.

BCL6 has not previously been demonstrated or suggested to participate in cerebellar granule cell development during cerebellar morphogenesis.

During cerebellar development we found that BCL6 is expressed from postnatal day 4 (P4) in the inner layer of cerebellar external granular layer (EGL), where the postmitotic pre-migratory neurons are situated (Fig. 7 A,B). However, BCL6 is not detectable in the outer EGL, which consists of dividing granule precursor cells (Fig. 7 C,D), but co-localizes with granule precursor cells (stained with ki67) in the inner EGL. BCL6 expression is also detected in postmigratory cells in the internal granular layer (IGL) (Fig. 7 E,F). The expression of BCL6 is also not detectable in the Purkinje cells, identified with anti- Calbindin D-28k immunoreactivity at P7 (Fig. 7E,F). Differential expression patterns from inner EGL to IGL suggests that BCL6 is expressed in new born granule neurons and in post-migratory neurons in IGL.

Morphological observations revealed that the overall size of BCL6 knockout (KO) mouse cerebellum is smaller than wild-type littermates at 3 weeks after birth (Fig. 8 A,B). Since the postnatal development of the cerebellum start at P0 and is completed by P21 we decided to analyze the effect of BCL6 loss of function during this period. As shown in Figure 8C the number of PH3 positive cells is comparable between WT and KO animals, suggesting that BCL6 is not required for granule precursor cells proliferation. However, in BCL6 KO mice there is less cell cycle exit which should result in less production of granular neurons (Fig. 8 D-F). Indeed Neurodi staining show a clear decrease in granular neurons present in the inner EGL (Fig. 9 A,B). Taken together the described data suggest a possible role for BCL6 in generating granular neurons, but do not explain the reduction in cerebellar size observed at 3 weeks.

To address this point, we performed Active Caspase 3 staining on P0 and P7 cerebellum. As shown in Figure 9C quantification of the staining revealed an increased number of apoptotic cells in P7 postnatal BCL6 KO.

Finally we performed gain of function of BCL6 using transfection of granule cell precursors and found that its overexpression resulted in reduced number of neural progenitor cells, again consistent with a role in triggering cell cycle exit and differentiation.

Overall these data suggest that BCL6 is required for the proper generation and survival of granule cell neurons.

Claims

1 . Use of B-cell CLL/lymphoma 6 (BCL6) for modulating cortical differentiation of neuronal progenitor cells.

2. A method for modulating cortical differentiation of neuronal progenitor cells comprising modulating BCL6 activity in the neuronal progenitor cells.

3. The use according to claim 1 or the method according to claim 2, wherein the neuronal progenitor cells are positive for at least Nestin and paired box protein Pax6.

4. The use according to any one of claims 1 or 3 or the method according to any one of claims 2 or 3, wherein the neuronal progenitor cells are obtained or obtainable by a method comprising the steps of: i) plating mammalian pluripotent stem (mPS) cells onto a substrate which allows adherence of cells thereto; and ii) culturing the mPS cells of i) which have adhered to said substrate in a medium permissive to differentiation of the mPS cells; characterised in that during at least part of said culturing step ii) the cells are exposed to an antagonist of the sonic hedgehog (SHH) signalling pathway, preferably cyclopamine.

5. The use according to any one of claims 1 , 3 or 4, wherein BCL6 is used for producing cortical neurons from neuronal progenitor cells.

6. The method according to any one of claims 2 to 4 for producing cortical neurons from neuronal progenitor cells comprising the steps of: a) exposing neuronal progenitor cells to conditions which support neuronal survival; and b) providing BCL6 activity in said neuronal progenitor cells.

7. The method according to claim 6, wherein the BCL6 activity is provided at least before day 4, preferably at least before day 3, more preferably at least before day 2, such as at least at day 0 and/or at day 1 , following exposing the neuronal progenitor cells to said conditions which support neuronal survival.

8. The method according to any one of claims 6 or 7, wherein the BCL6 activity is provided from day 0 following exposing the neuronal progenitor cells to said conditions which support neuronal survival.

9. The method according to any one of claims 6 to 8, wherein the BCL6 activity is provided transiently in the neuronal progenitor cells.

10. The method according to any one of claims 6 to 9, wherein the duration of the method is between 1 and 10 days, preferably between 2 and 8 days, more preferably between 4 and 6 days, more preferably about 5 days, following exposing the neuronal progenitor cells to said conditions which support neuronal survival.

1 1. The use according to claim 5 or the method according to any one of claims 6 to 10, wherein the BCL6 activity is provided by increasing the amount of BCL6 in the neuronal progenitor cells, preferably by over-expressing BCL6 in the neuronal progenitor cells, more preferably by inducibly over-expressing BCL6 in the neuronal progenitor cells.

12. The use according to any one of claims 5 or 1 1 or the method according to any one of claims 6 to 1 1 , wherein the cortical neurons are positive for at least β-tubulin III (Tuj 1 ) and

T-box brain 1 (Tbr1 ).

13. The use according to any one of claims 1 , 3 or 4, wherein inhibition of BCL6 activity is used for preventing differentiation of the neuronal progenitor cells.

14. The method according to any one of claims 2 to 4 for preventing differentiation of the neuronal progenitor cells comprising inhibiting BCL6 activity in said neuronal progenitor cells.

15. The use according to claim 13 or the method according to claim 14, wherein the BCL6 activity is inhibited by decreasing the amount of BCL6 in the neuronal progenitor cells or by providing inhibitors of BCL6, preferably small molecule inhibitors of BCL6, in the neuronal progenitor cells.

16. Use of a non-human animal, preferably a non-human mammal, more preferably a rodent, even more preferably a mouse, which is BCL6 deficient or which comprises transgenic expression of BCL6, as a model for corticogenesis.

17. Use of a non-human animal, preferably a non-human mammal, more preferably a rodent, even more preferably a mouse, which is BCL6 deficient or which comprises transgenic expression of BCL6, as a model for cerebellar morphogenesis.

18. A method for modulating cell cycle exit and differentiation of cerebellar granule precursor cells comprising modulating BCL6 activity in the cerebellar granule precursor cells.

19. The method according to claim 18 comprising providing BCL6 activity in said cerebellar granule precursor cells, whereby said cerebellar granule precursor cells exit cell cycle and differentiate towards cerebellar granule cells.

20. The method according to claim 18 for preventing cell cycle exit and differentiation of the cerebellar granule precursor cells comprising inhibiting BCL6 activity in said cerebellar granule precursor cells.