WO2013039378A1

WO2013039378A1 - A method for regulating cytosolic isoprenoid biosynthesis in hevea brasiliensis

Info

Publication number: WO2013039378A1
Application number: PCT/MY2012/000214
Authority: WO
Inventors: Alam MAQSUDUL; Mohd Najimudin MOHD NAZALAN; Jennifer Ann SAITO; Biswavas Misra BISWAPRIYA
Original assignee: Universiti Sains Malaysia
Priority date: 2011-09-15
Filing date: 2012-07-23
Publication date: 2013-03-21
Also published as: MY169821A

Abstract

The present invention discloses an isolated polynucleotide encoding an enzyme for catalyzing cytosolic biosynthesis of isopentenyl diphosphate, dimefhylallyl diphosphate or the combination thereof in the plant of Hevea brasiliensis, comprising nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ' ID NO. 9 or any complementary sequence thereof; and a method for enhancing cytoplasmic availability and functionality of the enzyme, comprising the steps of predicting catalytic domain, signal peptide or membrane-spanning domain of the enzyme; introducing a point mutation to the predicted catalytic domain, signal peptide or membrane-spanning transmembrane domain; and expressing the mutated catalytic domain, signal peptide or membrane-spanning transmembrane domain in a plant cell, tissue or organ of Hevea brasiliensis. The present invention also relates to an isolated polypeptide encoded by the polynucleotide, a recombinant gene construct comprising the polynucleotide, a transformant and a transgenic plant comprising the recombinant gene construct, with enhanced production of cytosolic isoprenoid towards rubber production.

Description

A METHOD FOR REGULATING CYTOSOLIC ISOPRENOID

BIOSYNTHESIS IN HEVEA BRASILIENSIS

FIELD OF INVENTION

The present invention relates to the specific genes encoding for a series of enzymes involved in the cytosolic biosynthesis of isoprenoids in the plant of Hevea brasiliensis. More particularly, the present invention provides the polynucleotide sequences of the genes encoding for the series of enzymes involved in the cytosolic biosynthetic pathway of isoprenoids, as well as methods for regulating the cytosolic biosynthesis of isoprenoids via mevalonate (MVA) pathway, and thus the biosynthesis of rubber, by conducting specific genetic intervention in the cytosolic pool of isoprenoids in H. brasiliensis.

BACKGROUND OF THE INVENTION

Rubber tree has been an important industrial crop for natural rubber production throughout the decades. It is reported that the world supply of natural rubber is barely keeping up with the estimated global demand for 12 million tons of natural rubber in 2020. In order to keep up with such increase of the global demand, further improvement of natural rubber production has become a necessary. One of the strategies taken by the industry to promote the natural rubber production is to rapidly expand the rubber plantations throughout the Montane main lands in South East Asia regions. Another strategy developed is a molecular biology approach, whereby the rubber biosynthesis process of the rubber tree is explored and improved.

Natural rubber is cytoplasm of laticifer cell. It is synthesized by at least 2,000 species of plants belonging to 300 genera. Non-Hevea plant species with abilities to produce natural rubber include the Russian Dandelion {Taraxacum kok-saghyz) and Euphorbia lactiflua. However, H. brasiliensis is deemed the only economically-viable source of iral rubber due to its good yield of rubber and the excellent physical properties of the rubber products. Latex is a biodegradable polymer yielding the natural rubber. It is widely used worldwide, because of its excellent properties in terms of high elasticity and mechanical strength including high resistance to impact and tear as well as low heat build-up during deformation. High yields of latex can be obtained from the H. brasiliensis clone RRIM 600, which is a clone evolved by the Rubber Research Institute of Malaysia (RRIM) from parent clones Tjir 1 & PB 86. This clone has an above average initial latex yield and a very high level of subsequent yield. In general, rubber biosynthesis consists of 6 major steps, which include the sucrose import and degradation, glycolysis, acetyl-CoA biosynthesis, prenyl diphosphate synthesis via mevalonate (MVA) pathway in cytosol, geranylgeranyl pyrophosphate synthesis in mitochondria, and rubber polymerization on rubber particle membrane. In recent years, biosynthesis of natural rubber is known to be biochemically related to the biosynthesis of isoprenoids, as the significant metabolites in the biosynthetic pathway of rubber, which are the isopentenyl diphosphate (ΓΡΡ) and dimethylallyldiphosphate (DMAPP), can be synthesized by these two independent isoprenoid biosynthetic pathways, namely the MVA pathway which takes place in the cytosol, and the methylerythritol phosphate (MEP) pathway which is localized in the plastids.

Isoprenoids, also known as terpenoids, are derived from IPP units, which are the acyclic C₅ precursor, known as 2, 3-methyl butane. The head-to-tail addition of isoprenoid units forms the basis of biosynthesis of terpenoids. The first biosynthetic pathway identified, namely the MVA pathway, is operative in bacteria, fungi, mammals and plants. Whilst, the MEP pathway is conserved in both eubacteria and higher plants. Principal MVA-derived isoprenoid end products in plants are sterols, brassinosteroids (steroid hormones), dolichol (involved in protein glycosylation), and the prenyl groups used for protein prenylation and cytokinin biosynthesis; while the plastidial MEP pathway produces IPP and DMAPP for the biosynthesis of photosynthesis-related isoprenoids (carotenoids and the side chains of chlorophylls, plastoquinones, and phylloquinones) as well as hormones (gibberellins and abscisic d). In spite the compartmentalization of these two pathways. MVA-derived precursors can be used for the synthesis of isoprenoids in the plastid, and MEP- derived precursors can also be exported to the cytosol in at least some plants, tissues or developmental stages.

As set forth in the preceding description, IPP and its isomer DMAPP are significant metabolites in the biosynthetic pathway of natural rubber, as natural rubber is a polymer of IPP units condensed sequentially in cis-configuration by the cis-prenyl transferases group of enzymes, whereas DMAPP is one of the initiator molecules which is required to prime the subsequent extensive prenyl chain elongation. Therefore, the regulation of the biosynthesis of natural rubber or its immediate precursors can be achieved by genetic intervening the synthesis of the series of enzymes involved in the biosynthesis of isoprenoids in H. brasiliensis. The cytosolic biosynthesis of isoprenoids takes place in the cytosol of the plant cell by a MVA pathway. The series of enzymes involved includes acetoacetyl-CoA transferase (AACT), hydroxymethylglutaryl-CoA synthase (HMGCS), hydroxymethylglutaryl- CoA reductase (HMGR), mevalonate kinase (MVK) and 5-diphosphomevalonate decarboxylase (PMD). It is known in the art that the biosynthesis of IPP by the MVA pathway is cytoplasm based and initiated by the condensation of 2-acetyl-CoA molecules to yield acetoacetyl-CoA, which is catalysed by AACT. AACT belongs to a large family of acyl-CoA-metabolizing enzymes which provides an intermediate in the biosynthesis of membrane sterols in animals, plants, yeasts, and fungi, and of poly(3- hydroxybutyric acid), a carbon- and energy- storage compound in eubacteria. In the second step of the MVA pathway, the addition of another molecule of acetyl-CoA to acetoacetyl-CoA is catalyzed by 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) synthase or HMGCS to yield HMG-CoA. HMGCS belongs to a large protein family comprising other acetyl-CoA condensing enzymes, such as acyl carrier protein synthase of fatty acid biosjoithesis and chalcone synthase of plant phenylpropanoid metabolism. It is also shown in the MVA pathway of several bacteria such as Enterococcus faecalis. In the subsequent step of the MVA pathway, HMG-CoA is reduced to MVA by HMG- CoA reductase or HMGR. The C-terminal region of this HMGR enzyme exhibits extensive sequence identity among different organisms: whereas the N-terminal domain, however, is highly divergent. HMGRs are found in eukaryotes, archaebacteria and some eubacteria. Subsequently, MVA is phosphorylated by MVK to yield phosphomevalonate, which is further phosphorylated, by PMK to form MVA diphosphate. MVK catalyses the phosphorylation of mevalonate at C5, i.e. catalyses transfer of ATP's γ-phosphoryl to the C5 hydroxyl oxygen of mevalonic acid, resulting in formation of mevalonate 5 -phosphate and ADP. The reaction was characterized in yeast, and the protein is found in eukaryotes, archaea and certain eubacteria. The conversion of mevalonate diphosphate to IPP with the concomitant release of C0₂ is catalysed by phosphomevalonate kinase (PMK) and PMD, lead to the conversion of mevalonate phosphate to IPP, and these two enz3'mes are poorly conserved across genomes.

It is shown in the prior art that the genes encoding the enzymes involved in the MVA pathway have been found or cloned from a number of organisms, including plants, and these genes encode polypeptides (enzymes) with certain conserved regions of homology. However, none of the existing technologies discloses the polynucleotide sequences or polypeptides encoded thereof for these series of isoprenoid biosynthetic genes or enzymes which are specifically found in or derived from the cytosolic isoprenoid pool, especially from the plant of H. brasiliensis. There is also no successful technique provided in the prior art to elucidate these related enzymes. Apart from that, the prior art also has not provided or suggested any method for constructing a MVA pathway for H. brasiliensis, nor method for regulating the biosynthesis of isoprenoids via the MVA pathway of this plant.

In view of the fact that the series of enzymes involved in the MVA pathway could play an important role in the biosynthetic pathway . of rubber, it is desirable for the industry to provide a genetic approach relating the biosynthesis of rubber in plant by . exploring and utilizing the molecular biology and genetic information of this series of ymes. Besides, a species-specific approach is also preferable in order to yield a cost-effective result as the rubber biosynthetic pathway and genetic makeup of each species of plant are potentially varied among one another.

SUMMARY OF INVENTION

The primary object of the present invention is to provide the polynucleotide sequences encoding for a series of enzymes, including AACT, HMGCS, HMGR, MV and PMD which are involved in the cytosolic biosynthesis of isoprenoids via MVA pathway, in the plant of H. brasiliensis.

Another object of the present invention is to provide the molecular biology and genetic information of the genes and enzymes, set forth in the primary object to be exploited for the regulation of the cytosolic biosynthesis of isoprenoids in the plant of H. brasiliensis, which potentially regulates the production of natural rubber in the plant.

Still another object of the present invention is to provide the isolated polypeptides encoded by the polynucleotide sequences provided, which is the series of enzymes involved in the cytosolic biosynthetic pathway of isoprenoids to form IPP and DMAPP, which are the precursors in the biosynthetic pathway of natural rubber.

Yet another object of the present invention is to manipulate or regulate the biosynthesis of cis-polyisoprene (natural rubber) in H. brasiliensis, in vitro ox in vivo, by genetically intervening the MVA biosynthetic pathway of isoprenoids, particularly the IPP and DMAPP.

Further object of the present invention is to produce a transgenic plant of H. brasiliensis with increased cytosolic isoprenoid production, which potentially promotes increased yield of natural rubber, by manipulation of cellular levels of the series of enzymes involved in the cytosolic isoprenoid biosynthetic pathway. Another further object of the present invention is to provide a method for increasing the expression or activity level of the series of enzymes involved in the cytosolic biosynthetic pathway of isoprenoids by genetic intervention, such as introduction of point mutation.

Still another further object of the present invention is to provide a potential commercially feasible way to increase the yield of rubber in order to keep up with the increasing global demand on rubber-based products.

At least one of the preceding objects is met, in whole or in part, by the present invention, in which one of the embodiments of the present invention describes an isolated polynucleotide encoding an enzyme for catalyzing cytosolic biosynthesis of IPP, DMAPP or the combination thereof in the plant of H. brasiliensis, comprising nucleotide sequence set forth in SEQ ID NO. 1 , SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9 or any complementary sequence thereof.

According to the preferred embodiment of the present invention, the plant of H. brasiliensis is clone RRIM 600.

Another embodiment of the present invention is a method for enhancing cytoplasmic availability and functionality of an enzyme encoded by a polynucleotide having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, comprising the steps of predicting catalytic domain, signal peptide or membrane-spanning domain of the enzyme; introducing a point mutation to the predicted catalytic domain, signal peptide or membrane-spanning domain; and expressing the mutated catalytic domain, signal peptide or membrane- spanning transmembrane domain in a plant cell of Hevea brasiliensis. Accordingly, the mutated domain can also be expressed in targeted tissues and organs of the plant.

■;^' . ^'■ . ^" .

Still another embodiment of the present invention is a recombinant gene construct comprising a polynucleotide template having nucleotide sequence set forth in SEQ ID . 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, and a promoter region operably-linked to enhance expression of the polynucleotide template; wherein the polynucleotide template is expressible in a host cell to produce an enzyme which catalyzes cytosolic biosynthesis of IPP, DMAPP or the combination thereof.

Yet another embodiment of the present invention discloses a transformant comprising a recombinant gene construct capable of overexpressing a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9 to produce an enzyme which catalyzes cytosolic biosynthesis of IPP, DMAPP or the combination thereof.

Further embodiment of the present invention is a transgenic plant of H. brasiliensis with enhanced cytosolic biosynthesis of IPP, DMAPP or the combination thereof, comprising a recombinant gene construct having an expressible nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9.

In yet another embodiment of the present invention, an isolated polypeptide for catalyzing cytosolic biosynthesis of IPP, DMAPP or the combination thereof in the plant of H. brasiliensis is disclosed, wherein the isolated polypeptide comprises amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8 or SEQ ID NO. 10. Another further embodiment of the present invention is a method for catalyzing the biosynthesis of IPP, DMAPP or the combination thereof for enhancing the biosynthesis of natural rubber from its precursors, comprising the step of introducing an isolated polypeptide having amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10 or SEQ ID NO. 12 into a plant cell in vivo or in intro.

One skilled in the art will readily appreciate that the present invention is well adapted carry out the objects and obtain the ends and advantages mentioned, as well those inherent therein. The embodiments described herein are not intended limitations on the scope of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

For the purpose of facilitating an understanding of the invention, there is illustrated in the accompanying drawing the preferred embodiments from an inspection of which when considered in connection with the following description, the invention, its construction and operation and many of its advantages would be readily understood and appreciated.

Figure is the nucleotide sequence SEQ ID NO. 1 of the polynucleotide

encoding the enzyme AACT of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention.

Figure 2 is the amino acid sequence SEQ ID NO. 2 of the polypeptide encoded by the SEQ ID NO. 1 of Figure 1.

Figure 3 is the nucleotide sequence SEQ ID NO. 3 of the polynucleotide

encoding the enzyme HMGCS of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention. Figure 4 is the amino acid sequence SEQ ID NO. 4 of the polypeptide encoded by the SEQ ID NO. 3 of Figure 3.

Figure 5 is the nucleotide sequence SEQ ID NO. 5 of the polynucleotide

encoding the enzyme HMGR of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention.

Figure 6 is the amino acid sequence SEQ ID NO. 6 of the polypeptide encoded by the SEQ ID NO. 5 of Figure 5. is the nucleotide sequence SEQ ID NO. 7 of the polynucleotide encoding the enzyme MVK of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention. is the amino acid sequence SEQ ID NO. 8 of the polypeptide encoded by the SEQ ID NO. 7 of Figure 7. is the nucleotide sequence SEQ ID NO. 9 of the polynucleotide encoding the enzyme PMD of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention. is the amino acid sequence SEQ ID NO. 10 of the polypeptide encoded by the SEQ ID NO. 9 of Figure 9. is the electrophoresed agarose gel image showing the polymerase chain reaction (PCR) amplification result of AACT from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of AACT (1215 bp). shows the restriction pattern of HbAACT, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring AACT cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring AACT cDNA (~1.2 kbp insert). is the electrophoresed agarose gel image showing the PCR

amplification result of HMGCS from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of HMGCS (1395 bp). shows the restriction pattern of HMGCS, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring HMGCS cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring HMGCS cDNA (~1.4 kbp insert).

Figure 15 is the electrophoresed agarose gel image showing the PCR

amplification result of HMGR from cDNA, in which lane 1 is 1 kbp

DNA ladder marker and lane 2 is amplicon of HMGR (1728 bp).

Figure 16 shows the restriction pattern of HbHMGR, in which lane 1 is 1 kbp

DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring HMGR cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring HMGR cDNA (-1.7 kbp insert).

Figure 17 is the electrophoresed agarose gel image showing the PCR

amplification result of MVK from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of MVK (1161 kbp).

Figure 18 shows the restriction pattern of MVK, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested p JET 1.2 cloning vector harbouring MVK cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring MVK cDNA (-1.1 kbp insert).

Figure 19 is the electrophoresed agarose gel image showing the PCR

amplification result of PMD from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of PMD (1243 bp).

Figure 20 shows the restriction pattern of PMD, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring PMD cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring PMD cPMD (-1.3 kbp insert).

Figure 21 is an operative MVA pathway in cytosol of H. brasiliensis laficifer constructed using the program of Pathway Studio, showing the metabolites and enzymes including AACT, HMGCS, HMGR, MVK and PMD, as well as their roles in the biosynthesis of isoprenoids, especially IPP and DMAPP.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to the specific genes encoding for a series of enzymes involved in the cytosolic biosynthesis of isoprenoids in the plant of H. brasiliensis. More particularly, the present invention provides the polynucleotide sequences of the genes encoding for the series of enzymes involved in the cytosolic biosynthetic pathway of isoprenoids, as well as methods for regulating the cytosolic biosynthesis of isoprenoids via MVA pathway by conducting specific genetic intervention in the cytosolic pool of isoprenoids in H. brasiliensis.

Hereinafter, the invention shall be described according to the preferred embodiments of the present invention and by referring to the accompanying description and drawings. However, it is to be understood that limiting the description to the preferred embodiments of the invention and to the drawings is merely to facilitate discussion of the present invention and it is envisioned that those skilled in the art may devise various modifications without departing from the scope of the appended claim.

The following terms used throughout the specification have the indicated meanings unless expressly indicated to have a different meaning. The term "gene", as used herein, is defined as the genomic sequence of the plant H. brasiliensis, particularly polynucleotide sequence encoding pol^ypeptide of the series of enzymes involved in the cytosolic biosynthetic pathway of isoprenoids.

The term "polynucleotide", as used herein, is a nucleic acid chain containing a sequence greater than 100 nucleotides in length.

The term "polypeptide", as used herein, is a single linear chain of amino acids bonded ither by peptide bonds, and having a sequence greater than 100 amino acids in length.

The term "isolated polynucleotide", as used herein, refers to polymer of RNA or DNA acquired from biological sample or produced chemically via any known method in the art. The polymer can be single- or double-stranded.

The term "primer", as used herein, is an oligonucleotide capable of binding to a target nucleic acid sequence and priming the nucleic acid synthesis. An amplification oligonucleotide as defined herein will preferably be 10 to 50, most preferably 15 to 25 nucleotides in length. While the amplification oligonucleotides of the present invention may be chemically synthesized and such oligonucleotides are not naturally- occurring nucleic acids. The abbreviation used throughout the specification to refer to nucleic acids comprising nucleotide sequences are the conventional one-letter abbreviations. Thus, when included in a nucleic acid, the naturally occurring encoding nucleotides are abbreviated as follows: adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Also, unless otherwise specified, the nucleic acid sequences presented herein in the 5'→3'direction.

As used herein, the term "complementary" and derivatives thereof are used in reference to pairing of nucleic acids by the well-known rules that A pairs with T or U and C pairs with G. Complement can be "partial" or "complete". In partial complement, only some of the nucleic acid bases are matched according to the base pairing rules; while in complete or total complement, all the bases are matched according to the paring rule. The degree of complement between the nucleic acid strands may have significant effects on the efficiency and strength of hybridization between nucleic acid strands as well known in the art. This may be of particular in detection method that depends upon binding between nucleic acids.

The term 'host cell" or "transformed cell" used herein refers to cell received a foreign : material or a recombinant gene construct and capable of producing a products according to the genetic information presented in the foreign gene material.

The term "operably-linked", as used herein, refers to association of nucleic acid sequence on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter can be operably-linked with a coding sequence when it affects the expression of that coding sequence, i.e. that the coding sequence is under the transcriptional control of the promoter. The term "in vivo", as used herein, refers to a biological reaction or experimentation conducted in a whole, living organism within a natural setting.

As opposed to "in vivo^", the term "in vitro^", as used herein, refers to a biological reaction occurs in an artificial environment outside a living organism, which is usually conducted in a laboratory using components of an organism that have been isolated from their usual biological context in order to permit a more detailed or more convenient analysis to be performed.

The present invention discloses an isolated polynucleotide encoding an enzyme for catalyzing cytosolic biosynthesis of IPP, DMAPP or the combination thereof in the plant of H. brasiliensis, comprising nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9 or any complementary sequence thereof. According to the preferred embodiment of the present invention, the polynucleotide encoding the series of enzymes involved in the cytosolic isoprenoid biosynthetic pathway, or the MVA pathway, is isolated from the plant of H. brasiliensis clone RPJM 600. This rubber tree clone is preferably used for the production of natural rubber as it gives higher yield, more adaptable to the environment and known to be less susceptible to climatic variations.

The enzymes involved in the cytosolic isoprenoid biosynthetic pathway, or the MVA iway, include AACT,^' HMGCS, HMGR, MVK and PMD. Illustrated in Figure 1 is the nucleotide sequence of the isolated polynucleotide encoding for AACT, as set forth in SEQ ID NO. 1. The nucleotide sequence of the isolated polynucleotide encoding for HMGCS is set forth in SEQ ID NO. 3, as shown in Figure 3. Accordingly, SEQ ID NO. 5 of Figure 5 shows the nucleotide sequence of the isolated polynucleotide of HMGR; SEQ ID NO. 7 of Figure 7 shows the nucleotide sequence of the isolated polynucleotide of MVK; whereas SEQ ID NO. 9 of Figure 9 shows the nucleotide sequence of the isolated polynucleotide of PMD. The role of the series of enzymes as well as the metabolites involved in the MVA pathway for the cytosolic biosynthesis of isoprenoids, especially IPP and DMAPP, are illustrated in Figure 21. As an initial step, AACT catalyzes the condensation of the precursor, acetyl-CoA to form acetoacetyl-CoA. Next, the addition of acetyl-CoA to acetoacetyl-CoA which gives rise of HMG-CoA, is catalyzed by HMGCS as shown in Figure 21. HMG-CoA undergoes a reduction process in the subsequent step to form MVA, which is catalyzed by HMGR. This is followed by the phosphorylation of MVA to form MVA phosphate, which is catalyzed by MVK. This MVA phosphate is then further phosphorylated to form MVA diphosphate. Lastly, MVA diphosphate is decarboxylated to form the precursors or cis-polyisoprenoid (natural rubber), which are the IPP and DMAPP, and this process is catalyzed by PMD, or MVD as shown in Figure 21.

Before the genetic intervention procedure can be conducted, the gene cluster encoding the series of enzymes set forth in the preceding description can be identified and characterized, by using the existing molecular biology information of the related enzymes which were isolated from other species of plants or microorganisms. The available molecular biological database such as GenBank and Uniprot are preferably used. In accordance with the preferred embodiment of the present invention, the gene database can also be used for designing primers for PCR amplification of the target genes encoding the series of enzymes involved in the MVA pathway of H. brasiliensis. Amplification primers are preferably designed targeting the conserved region of each gene. An example of the primer designing strategy is further detailed in tuple 1.

According to the preferred embodiment of the present invention, total R A can be isolated from the plant parts, and the PCR amplification, cloning as well as sequencing process of the series of enzymes, including the AACT, HMGCS, HMGR, MVK and PMD, can be conducted using a method as detailed in Example 2. RT-PCR is preferably conducted using the cDNA obtained from the total RNA. The amplification products can then be identified and confirmed by gel electrophoresis. The exemplary amplification products are shown in Figures 11 , 13, 15, 17 and 19.

Subsequently, the purified products can be ligated in a commercially obtained cloning vector, and then be transformed into a host cell, such as the commercially available chemically competent E. coli cell. Example 3 shows an example of the plasmid isolation from the transformed cell and the restriction digestion procedure for the confirmation of clones. The restriction digestion patterns of the genes encoding the enzymes of AACT, HMGCS, HMGR, MVK and PMD are shown in Figures 12, 14, 16, 18 and 20.

In Example 4, the analysis of the sequences is disclosed, in which the nucleotide and the amino acid sequences can be analyzed and aligned by the available programs. Illustrated in Figure 21 is the operative MVA pathway which can be re-constructed by a method as shown in Example 5 using the genetic information obtained from the nucleotide and the amino acid sequences of the isolated genes or enzymes. Comparisons of the nucleic acid and protein sequences as shown in the Example 6 show that the genes encoding the series of enzymes involved in the biosynthesis of IPP, DMAPP and the combination thereof are conserved yet unique and species- specific.

Still another embodiment of the present invention is a recombinant gene construct comprising a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1 , SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, and a promoter region operably-linked to enhance expression of the polynucleotide )late; wherein the polynucleotide template is expressible in a host cell to produce an enzyme which catalyzes cj^tosolic biosynthesis of IPP, DMAPP or the combination thereof. According to the preferred embodiment of the present invention, a chimeric gene, comprising two or more gene constructs, selected from the polynucleotides having nucleotide sequence as set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 and SEQ ID NO. 9 can also be provided.

Yet another embodiment of the present invention discloses a transformant comprising a recombinant gene construct capable of overexpressing a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9 to produce an enzyme which catalyzes cytosolic biosynthesis of IPP, DMAPP or the combination thereof. More practical and illustrative examples on the synthesis of gene cassette and transformation of the plant are further detailed in Examples 7 to 9.

Apart from that, the present invention also provides a method for enhancing cytoplasmic availability and functionality of an enzyme encoded by a polynucleotide having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, comprising the steps of predicting catalytic domain, signal sequence or membrane-spanning domain of the enzyme; introducing a point mutation to the predicted catalytic domain, signal sequence or membrane- spanning domain; and expressing the mutated catalytic domain, signal sequence or membrane-spanning domain in a plant cell of Hevea brasiliensis. Accordingly, the mutated domain can also be expressed in various tissues and organs of the plant. The signaling domain of the enzyme can be a "signal peptide", involving the part of sequence responsible for organellar localization, trafficking or processing. The membrane-spanning transmembrane is also known as membrane-anchoring domain of the target protein or enzyme. Common tools to predict and identify these domains are commercially available or publicly available as web services.

A method for synthesizing such a modified enzyme, for example the enzyme of HbHMGR, is further detailed in the Example 9. According to the most preferred odiment of the present invention, prediction on catalytic domain and functionality of the gene of interest encoding the targeted enzyme can be performed, which is then followed by a site-directed point mutation process. The mutated or truncated catalytic domain can be expressed in a selected plant cell or cell lines in vitro. Biochemical assay and characterization of the mutagenized enzyme can be carried out to determine the expression and activity level of this enzyme. By introducing a genetic intervening process, such as point mutation to the catalytic domain in the polynucleotide encoding the specific enzyme, the expression or activity level of the particular enzyme can be increased.

Further embodiment of the present invention is a transgenic plant of H. brasiliensis with enhanced cytosolic biosynthesis of IPP, DMAPP or the combination thereof, comprising a recombinant gene construct having an expressible nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9. As demonstrated in the examples, the present invention also provides the possibility of the overexpression of HbHMGR towards development of a transgenic H. brasiliensis in vitro cell line accumulating higher levels of polyisoprenoids or rubber, as well as overexpression of HbPMD towards development of a transgenic H. brasiliensis R IM 600 in vitro cell line accumulating higher levels of polyisoprenoids or rubber, and synthesis of a modified HbHMGR with enhanced cytoplasmic availability and functionality.

In yet another embodiment of the present invention, an isolated polypeptide for catalyzing cj^tosolic biosynthesis of IPP, DMAPP or the combination thereof in the plant of H. brasiliensis is disclosed, wherein the isolated polypeptide comprises amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8 or SEQ ID NO. 10. As set forth in the preceding description, the polypeptide are isolated from the plant of H. brasiliensis clone RRIM 600. Figure 2, 4, 6, 8 and 10, respectively show the amino acid sequences of the isolated polypeptide of the enzymes AACT, HMGCS, HMGR, MVK and PMD. Accordingly, the amino acid sequence of AACT is set forth in SEQ ID NO. 2; HMGCS is set forth EQ ID NO. 4; HMGR is set forth in SEQ ID NO. 6; MVK is set forth in SEQ ID NO. 8; and PMD is set forth in SEQ ID NO. 10.

Another further embodiment of the present invention is a method for catalyzing the biosynthesis of TPP, DMAPP or the combination thereof for enhancing the biosynthesis of natural rubber from its precursors, comprising the step of introducing an isolated polypeptide having amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10 or SEQ ID NO. 12 into a plant cell in vivo or in intro.

The present disclosure includes as contained in the appended claims, as well as that of the foregoing description. Although this invention has been described in its preferred form with a degree of particularity, it is understood that the present disclosure of the preferred form has been made only by way of example and that numerous changes in the details of construction and the combination and arrangements of parts may be resorted to without departing from the scope of the in vention.

EXAMPLE

Examples are provided below to illustrate different aspects and embodiments of the present invention. These examples are not intended in any way to limit the disclosed invention, which is limited only by the claims. Example 1 Designing and synthesis of oligonucleotides (primers)

The primers used in the study were either designed from the manually curated "transcriptome" and the "gene models" predicted from the genomic sequences of H. brasiliensis RRIM 600, by choosing the sequences manually with complete ORFs or using databases where similar genes have been successfully isolated from other plants. Comparative and bioinformatic analyses of the nucleotide sequences obtained from transcriptome were carried out online using BLAST, including BLASTP, RPS- ^ST, BLASTX and PSI- BLAST, to identify homologues of the related genes and for the proper identification of gene. Nucleotide sequence alignments were performed using Clustal W version 1.82 whenever multiple sequences were found from the "gene pool". The alignment was then edited and gene- specific primers (both forward and reverse) were selected manually or through Primer 3 Plus Web tool through consensus from highly conserved sequences, then the primers were custom- synthesized. All oligonucleotides used in this study were synthesized and high performance liquid chromatography (HPLC)-purified by the supplier and procured from IDT. Stock solutions of 100 pmol were prepared in autoclaved ddH₂0 and stored at -20 °C, in aliquots for use. Table 1 depicts the primers designed and used as well as the rationale for their synthesis.

Table 1

Gene Primers T_m Amplic

Name Sizes (1

AACT 5'- ATGGACACCACCGGCC -3' 58.4 1215

5'- CTAAGATGCAGCTTTAGACATATCTTTG-3 ' 54

HMGCS 5'- ATGGCAAAGAATGTGGGAAT-3 ' 52.6 1395

5'- TC AATGACC ATTAGCTAGC AAGC-3 ' 55.3

HMG 5'- ATGGACACCACCGGCC-3' 58.4 1728

5'- CTAAGATGCAGCTTTAGACATATCTTTG-3 ' 54

MVK 5'- ATGGAAGTTAAAGC AAGAGCTCC-3 ' 55.3 1161

5'- TC AGGATGAACCACC AAAGC-3 ' 55.3

PMD 5'- ATGGCGGAGTCATGGGT-3 ' 56.6 1243

5'- TTATTTAGGGAGCCCAGTTTCA 53.8

Example 2 Amplification, cloning and sequencing of AACT, HMGCS, HMGR, MVK, PMK & PMD from H. brasiliensis RRIM 600 Total RNA was isolated from young leaves of matured fully grown H. brasiliensis RRIM 600 using QIAGEN-RNeasy Mini Kit following the manufacturer's instructions. The quality as well as quantity was checked by agarose gel rophoresis and Thermo Scientific Nano Drop 2000TM (Thermo Scientific- Agilent's). cDNA first strand was synthesized using Superscript® VILO™ cDNA Synthesis Kit (Invitrogen) according to the manufacturer's instructions. The genes were amplified from the cDNA by PCR using primers and conditions designated in Table 1. The PCR reaction (50 μί) contained 1μΙ_, of cDNA, 20 pmoles of each primer, 5 μΐ, of 10 X Pfu Buffer, 5 μΐ, of 2.5 mM dNTP mix and 2.5 units of wTurbo® DNA polymerase (Stratagene). PCR was carried out in Veriti™ Thermal Cycler (Applied Biosystems) using the following conditions. Initial denaturation for 5 min at 94°C followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 50°C for 30 sec and extension at 72°C for 1 min/ kbp, with a final extension at 72 °C for 7 min. The PCR product was analysed by 1% agarose gel and the amplicon was eluted from the gel using GENECLEAN® TURBO Gel band elution kit (MP Biomedicals) according to the manufacturer's instructions. Figures 11, 13, 15, 17 and 19, respectively show the electrophoresed gel images of AACT, HMGCS, HMGR, MVK and PMD with different amplicon sizes.

The purified PCR product was ligated into pJET 1.2 Blunt Vector (Fermentas) and was transformed into One Shot® Machl™-T1R Chemically Competent E. coli cells (Invitrogen). Plasmids were isolated from putative colonies using QIAprep Spin® Miniprep Kit (Qiagen) according to the manufacturer's instructions. The presence of the insert was checked by digesting the vector harbouring inserts with Bglll (Fermentas) and positive plasmids were subjected to sequencing, in triplicates.

Example 3 Plasmid isolation and restriction digestion for confirmation of clones

Recombinant colonies were cultured and small-scale preparation (mini-preps) of plasmid DNA were performed by the Qiagen Spin Miniprep kit (Qiagen) as per the protocol supplied by the manufacturer. To select positive recombinant colonies, after ligation and transformation, individual colonies were picked up with a sterile tip into 10 μί, of sterile water and heated at 95 °C for 20 min for lysis of cells and subsequent amplification of insert DNA by PCR. Presence of insert within the plasmid was nfirmed with insert flanking restriction enzymes. The presence of the insert was checked by digesting the vector, pJET 1.2 (Fermentas) harbouring inserts with Bglll (Fermentas) and positive plasmids were subjected to sequencing, in triplicates. The digested and undigested recombinant plasmids were separated on a 0.8- 1.5 % agarose gel to identify the correct inserts. Figures 12, 14, 16, 18 and 20, respectively show the restriction digestion patterns of the AACT, HMGCS, HMGR, MVK and PMD.

Clones were then sequenced using vector specific standard Ml 3/ pUC universal primers or pJET 1.2 Forward Sequencing Primer (23-mer, 5'- CGACTC ACTATAGGGAGAGCGGC-3 ' ) and pJET 1.2 Reverse Sequencing Primer (24-mer, 5'-AAGAACATCGATTTTCCATGGCAG-3'), supplied by the manufacturers (Fermentas) for sequencing. Automated dye terminator cycle sequencing was done using the ABI . BigDye™ (fluorescence-labelled dideoxynucleotide termination method) Terminator Cycle Sequencing Ready reaction kit (Applied Biosystems, USA) in an ABI 3730x1 DNA sequencer (Applied Biosystems, USA) following manufacturer's instructions. Sequences were visualized and analysed using Chromas Lite™ version 2.01 software or BioEdit Tool Version 7.0.8. Glycerol stocks [i.e., 0,5 ml of sterilized {65 % glycerol (v/ v), 0.1 M MgS04, 25 mM Tris- HC1, pH 8} and 0.75 ml of culture volume; pipette mixed] of positive clone harbouring cells from mid log phase were stored in aliquots in sterile cryovials and Eppendorf micro-centrifuge tubes in -80 °C for future use.

Example 4 Analysis of the sequence The nucleotide sequence and the amino acid sequences were analysed by BLASTN and BLASTP programs respectively. The sequences available from other plants were aligned with Clustal W.

Example 5 Pathway re-construction showcasing cytosolic isoprenoid biosynthetic routes in rubber

Automatic metabolic pathway reconstruction was done by identifying orthologs for licted rubber proteins in Arabidopsis genome and sequence orthologs. Enzymatic reactions encoded within rubber genome towards production of cytosolic isoprenoid pools were constructed out of 566 enzymatic reactions available in Resnet-Plant 3.0 database for Pathway Studio and from metabolic pathway databases (MPW). An operative MVA pathway in cytosol of H. bvasiliensis laticifer constructed using the program of Pathway Studio is shown in Figure 21, which shows the roles of AACT, HMGCS, HMGPv, MVK and PMD.

Example 6 Comparison between the isolated polynucleotide sequences with other plant sequences

The polynucleotide sequences AACT, HMGCS, HMGR, MVK and PMD isolated are shown in Figures 1 , 3, 5, 7 and 9; whereas their corresponding polypeptide sequences are shown in Figures 2, 4, 6, 8 and 10. The HbAACT has a theoretical mol. Wt. 41.424 kDa and pi of 6.95 with glycosylation and myristylation modification sites and thiolase motifs. SMART analysis reveals the presence of three consecutive Pfam domains, i.e., 'Thiolase_N' [11-274 aa, E value-4.4e-129], Thiolase_C [281-403 aa, E value-4.1e-61], and 'ACP_syn_III_C [312-402 aa, E value-9.5e-2], with pBLAST matches with PDB: 21BY: D [12-404 aa, E value-0] and SCOP: dlafwal [10- 276 aa, E- value- le-47]. The comparison shows sequence identities with AACT from H. bvasiliensis (AB294686, 100%; AB29468, 97%), Populus tvichocavpa (XM_002320492, 88%), Camellia oleifera (GU594059, 85%), Medicago sativa (GQ890698, n%), Avachis duranensis (HP002784, 81%), Bacopa monnieri (FJ947159, 81%) at the nucleotide levels. The conserved domain database (CDD) classifies the protein as a "thiolase [cond_enzymes superfamily] with characteristic active site and a dimer interface. At protein levels, HbAACT shows identities to AACT from H. bvasiliensis (BAF98276, 100%; BAF98277, 97%), Nicotiana tabacum (AAU95618, 87%), B. monnievi (ACU87560, 89%), P. tvichocavpa (EEE9884, 89%), Ricinus communis (EEF39476, 84%), Picvovhiza kuvvooa (ABC74567, 88%), C. oleifera (ADD10719, 89%), Zea mays (ACF78705, 83%) and others. HbHMGCS has a theoretical mol. Wt. 51.263 kDa and pi of 6.08 with glycosylation, myristylation and amidation modification sites and HMG-CoA synthase and leucine-zipper patterns. SMART analysis reveals the presence of three consecutive Pfam domains, i.e., 'HMG_CoA_synth_N' [1-174 aa, E value-2.1e-96], 'HMG_CoA_synth_C' [175-449 aa, E value- L ie- 172], and 'ACP_syn_III_C [298- 370 aa, E value- 1.3e-2], with pBLAST matches with PDB: 2FA3 :A [2-449 aa, E value-0] and SCOP: dlhnjal [4-175 aa, E-value- 3e-18]. The comparison shows sequence identities with HMGCS from H. brasiliensis (AY534617, 98%; AB294689, 99%; AF429389, 94%, AB294688, AF396829, 94%), R. communis (XM_002509646, 89%), Populus trichocarpa (XM_002304422, 86%), Camptotheca acuminata (EU677841 , 83%), Nicotiana langsdorffii x Nicotiana sanderae (EF636813, 80%), Medicago truncatula (DQ452574, 84%) at the nucleotide levels. The CDD classifies the protein as an "init_cond_enzymes" [cond_enzymes superfamily] with characteristic active site and a dimer interface. At protein levels. HbHMGCS shows identities to HMGCS from H. brasiliensis (AAS46245, 99%; BAF98279, 98%; AF429389, 94%; BAF98278, 94%; AAK73854, 93%), R. communis (XP_002509692, 92%), P. trichocarpa (EEE79437, ₍ 89%), C. acuminata (ACD87446, 84%), Salvia miltiorrhiza (ACV65039, 83%) and others. The HbHMGR has a theoretical mol. Wt. 61.695 kDa and pi of 6.61 with glycosylation and myristylation modification sites and three HMGCoA reductase patterns. SMART analysis reveals the presence of a Pfam domain, i.e., 'HMG_CoA_red' [172-565 aa, E value-0], and two trans-membrane domains [31-53 aa, 74-96 aa], with pBLAST matches with PDB: 1HWL: D [161-570 aa, E value-0] and SCOP: dldqaa4 [160-281 aa, E-value- 5e-40]. The comparison shows sequence identities with HMGR from H. brasiliensis (AF429388, X54659, AB294692, AY706757, AY352338, X54657, 99%), R. communis (XM_002510686, 89%), Euphorbia pekinensis (EF062569, 81%), Litchi chinensis (DQ536143, 82%), Cucumis melo (GU176320, 80%), Tilia miqueliana (DQ067558, 79%) at the nucleotide levels. The CDD classifies the protein as a HMG-CoA_reductase Class I superfamily of proteins, with well-defined catalytic residues, NADP (H) binding site, a substrate binding pocket and tetramerization interfaces. At protein levels, HbHMGR s identities to HMGR from H. brasiliensis (AAL18929, BAF98282, AAU08214, 99%), R. communis (EEF52919, 87%), E. pekinensis (AB 56831, 93%), Eucommia ulmoides (AAV54051 , 79%), L. chinensis (ABF5651, 82%), Arabidopsis lyrata (EFH63901, 80%) and others.

The HbMVK has a theoretical mol. Wt. 40.637 kDa and pi of 5.61 with glycosylation and myristylation modification sites. SMART analysis reveals the presence of two consecutive Pfam domains, i.e., 'GHMP_kinases_N' [130-211 aa, E value- 1.7e- 17], and 'GHMP_kinases_C [285-367 aa, E value- 1.4e-6], with pBLAST matches with PDB: 1KVK:A [176-380 aa, E value-0] and SCOP: dlkvkal [3-223aa, E-value- 6e- 44]. The comparison shows sequence identities with MVK from H. brasiliensis (AB294693, AF429384, 94%), R. communis (XM_002529609, 88%), TV. langsdorffii x N. sanderae (EF636814, 78%) at the nucleotide levels. The CDD classifies the protein with PLN02677 multi-domains. At protein levels, ITbMVK shows identities to MVK from H. brasiliensis (BAF98283, 91%), R. communis (EEF32742, 86%), M. truncatula (ABD32397, 75%), Arabidopsis thaliana (AAD31719, 69%), Zea mays (ACG46416, 58%) and others.

The HbPMD has a theoretical mol. Wt. 45.784 kDa and pi of 6.76 with glycosylation, amidation and myristylation modification sites. SMART analysis reveals the presence of two consecutive Pfam domains, i.e., 'GHMP_kinases_N' [112-170 aa, E value- 3.1e-12], and 'GHMP_kinases_C' [244-337 aa, E value- 4.1e-6], with pBLAST matches with PDB: 1FI4: A [6-316 aa, E value-0] and SCOP: dlfi4al [6-196 aa, E- value- 3e-79]. The comparison shows sequence identities with PMD from H. brasiliensis (AB294695, AF429386, 99%), R. communis (XM_002521126, 90%), P. trichocarpa (XM_002315405, 88%), Panax ginseng (GQ455989, 81%) at the nucleotide levels. The CDD classifies the protein as a GHMP_kinases_N superfamily protein. At protein levels, HbPMD shows identities to PMD from H. brasiliensis (BAF98285, 99%), AAL18927 (EEF41203, 90%), ^' N. langsdorffii x N. sanderae (ABV02028, 83%), Solanum lycopersicum (ABW87316, 82%), A. thaliana (NP_566995, 81%), Arnebia euchroma (ABG24207, 78%), P. ginseng (ACW83616, 78%>) and others. Example 7 Overexpression of HbHMGR towards development of a transgenic H. brasiliensis in vitro cell line accumulating higher levels of polyisoprenoids/ rubber

In order to construct a HMGR gene cassette, the full-length HMGR cDNA sequence was cut out of the vector with appropriate restriction enzymes A and B and ligated into the same restriction sites of the plant binary vector BinAR, a pBIB derivative containing the cauliflower mosaic virus 35S promoter. The transformation of H. brasiliensis RRIM 600 embryogenic calli was mediated by Agrobacterium tumefaciens by co-cultivation method. The insertion of copies of the transgene was confirmed by kanamycin resistance of regenerated explants and by genomic Southern hybridization or PCR amplification using a HMGR-specific probe and oligonucleotide primers. Northern blot and RNA analysis were then performed, in which total RNA was isolated using RNeasy Plant RNA Minikit following the manufacturer's instructions (Qiagen). Aliquots of 10 μg of RNA were blotted onto nylon membranes (Hybond N, Amersham) and hybridized with [³²P] dCTP using the nick-translation method. Hybridized filters were exposed to phosphor-imaging plates (Fuji Film, Tokyo) and analysed. Equal loading of samples was controlled by rehybridizing the RNA filter with a cDNA probe for 18S rRNA.

Subsequently, two oligonucleotide primers were designed to amplify the coding sequences of HMGR and the resultant PCR fragment was cloned into the multiple cloning sites (MCS) of the expression vector pQE 60 (Qiagen). Overexpression of recombinant HMGR protein was performed in Escherichia coli XL-1 Blue strain. The protein was purified by metal chelate affinity chromatography and used for immunization of rabbits. Antiserum was collected after triple injection of the antigen. The soluble protein fractions from Hevea tissues were quantified and 10^g protein aliquots were analysed by Western blot with the anti-HMGR antiserum using an immunoblotting kit (ECL, Amersham). The biochemical characterization of transformed He ea embryonic calli and somatic embryos is then performed. Increment in levels of critical intermediates [IPP, FPP. GPP, GGPP and others] within ell was measured by thin layer chromatography (TLC)/ HPLC analysis. Levels of accumulated rubber, towards quantification of quality (rubber particle size) and quantities (in mg/ DW g cell basis) were determined by HPLC/ ^l3C -NMR analysis. Example 8 Overexpression of HbPMD towards development of a transgenic H. brasiliensis in vitro cell line accumulating higher levels of polyisoprenoids/ rubber

Initially, a PMD gene cassette is constructed, whereby the full-length PMD cDNA sequence was cut out of the vector with appropriate restriction enzymes A and B and ligated into the same restriction sites of the plant binary vector BinAR, a pBIB derivative containing the cauliflower mosaic virus 35S promoter. The transformation of H. brasiliensis RRIM 600 embryogenic calli was mediated by Agrobacteriurn tumefaciens by co-cultivation method. The insertion of copies of the transgene was confirmed by kanamycin resistance of regenerated explants and by genomic Southern hybridization or PCR amplification using a PMD-specific probe and oligonucleotide primers. To perform the Northern blot and RNA analysis, total RNA was isolated using RNeasy Plant RNA Minikit following the manufacturer's instructions (Qiagen). Aliquots of 10 μg of RNA were blotted onto nylon membranes (Hybond N. Amersham) and hybridized with [ ²P] dCTP using the nick-translation method. Hybridized filters were exposed to phosphor- imaging plates (Fuji Film, Tokyo) and analysed Equal loading of samples was controlled by hybridizing the RNA filter with a cDNA probe for 18S rRNA. Two oligonucleotide primers were designed to amplify the coding sequences of PMD and the resultant PCR fragment was cloned into the multiple cloning sites (MCS) of the expression vector pQE 60 (Qiagen). Overexpression of recombinant PMD protein was performed in Escherichia coli XL-1 Blue strain. The protein was purified by metal chelate affinity chromatography and used for immunization of rabbits. Antiserum was collected after triple injection of the antigen. The soluble protein fractions from Hevea tissues were quantified and lO^g protein aliquots were analysed by western blot with the anti-PMD antiserum using an immunoblotting kit Amersham). Biochemical characterization of transformed Hevea embryonic calli and somatic embryos was then performed. Increment in levels of critical and 'immediate' downstream intermediates [IPP and DMAPP] within the cell was measured by TLC/ HPLC analysis. Levels of accumulated rubber, towards quantification of quality (rubber particle size) and quantities (in mg/ DW g cell basis) were determined by HPLC/ ¹³C- NMR analysis.

Example 9 Synthesis of a modified HbHMGR with enhanced cytoplasmic availabilit and functionality

Synthesis of a modified HbHMGR was initiated by prediction of catalytic domain and functionality of the target gene encoding the HMGR. The ConFunc-conserved residue function prediction server was used to predict the functionality of HbHMGR. Structural homologue was retrieved from PDB: 1HWL: Chain D (complex of the catalytic portion of human HMG-CoA reductase with rosuvastatin). The catalytic site prediction based on 1 -dimensional signatures of concurrent conservation was done as Enzyme 1-D signature prediction server, and the results from the Enzyme 1-D. ESPRIPT output for structural alignment of PDB: 1HWL: D and HbHMGR was obtained using: MultAlign linked to ESPRIPT Analysis. STRING analysis for protein function annotation is also conducted.

All point mutations were introduced to HMGR catalytic or active site within the catalytic domain constructs by using QuikChange II site-directed mutagenesis (Catalogue No 2005241, Agilent's Genomics). The two trans-membrane domains (residues 31-53 aa, and 74-96 aa) were removed, together or either of them, located at the N-terminal ends of HbHMGR to express it in E. coli, followed by expression in in vitro embryogenic cell lines of H. brasiliensis RRIM 600, leaves of N. tabaccum and in planta in A. thaliana using the endoplasmic reticulum (ER) targeting/localized signal "KDEL", in order to increase the cytoplasmic availability and solubility of the HbHMGR.

The tailor-made mutagenized cHMGR cDNA sequence was then cut out of the vector L appropriate restriction enzymes A and B and li gated into the same restriction sites of the plant binary vector BinAR, a pBIB derivative containing the cauliflower mosaic virus 35S promoter. The transformation of Hevea brasiliensis RRIM 600 embryogenic calli was mediated by Agrobacterium tumefaciens by co-cultivation method. The insertion of copies of the transgene was confirmed by kanamycin resistance of regenerated explants and by genomic Southern hybridization or PCR amplification using a

probe and oligonucleotide primers. Total RNA was isolated using RNeasy Minikit following the manufacturer's instructions (Qiagen). Aliquots of 10 μg of RNA were blotted onto nylon membranes (Hybond N, Amersham) and hybridized with [³²P] dCTP using the nick-translation method. Hybridized filters were exposed to phosphor-imaging plates (Fuji Film, Tokyo) and analysed Equal loading of samples was controlled by rehybridizing the RNA filter with a cDN A probe for 18 S rRNA. To perform a western analysis, two oligonucleotide primers were designed to amplify the coding C-terminal catalytic domain sequences of cHMGR and the resultant PCR fragment was cloned into the multiple cloning sites (MCS) of the expression vector pQE 60 (Qiagen). Overexpression of recombinant HMGR protein was performed in E. coli XL-1 Blue strain. The protein was purified by metal chelate affinity chromatography and used for immunization of rabbits. Antiserum was collected after triple injection of the antigen. The soluble protein fractions from Hevea tissues were quantified and 10^g protein aliquots were analysed by western blot with the anti- HMGR antiserum using an immunoblotting kit (ECL, Amersham). After that, biochemical assay and characterization of mutagenized HMGR were conducted. Enzyme assays using NADP- mediated spectrophotometric assays and HPLC-based assays for cHMGR crude fractions and purified proteins were performed along with the measurement of "endogenous" levels of HMG-CoA, there by indicating the flux of this critical metabolite in cytosol, after modifications to the transmembrane domains and active sites. The implications of these changes were probed, indirectly by measuring the downstream metabolite levels such as IPP, GPP, and GGPP and so on, followed by the cis-polyisoprenoid (natural rubber) levels.

Claims

AIMS

1. An isolated polynucleotide encoding an enzyme for catalyzing cytosolic biosynthesis of isopentenyl diphosphate, dimethylallyl diphosphate or the combination thereof in the plant of Hevea brasiliensis, comprising nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9 or any complementary sequence thereof.

2. An isolated polynucleotide according to claim 1 , wherein the plant of Hevea brasiliensis is clone RRIM 600.

3. A method for enhancing cytoplasmic availability and functionality of an enzyme encoded by a polynucleotide having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, comprising the steps of predicting catalytic domain, signal peptide or transmembrane domain of the enzyme; introducing a point mutation to the predicted catalytic domain, signal peptide or membrane-spanning transmembrane domain; and expressing the mutated catalytic domain, signal peptide or membrane-spanning domain in a plant cell of Hevea brasiliensis.

4. A recombinant gene construct comprising a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, and a promoter region operably-linked to enhance expression of the polynucleotide template; wherein the polynucleotide template is expressible in a host cell to produce an enzyme which catalyzes cytosolic biosynthesis of isopentenyl diphosphate, dimethylallyl diphosphate or the combination thereof.

5. A transformant comprising a recombinant gene construct capable of overexpressing a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9 to produce an enzyme which catalyzes cytosolic biosynthesis of isopentenyl diphosphate, dimethylallyl diphosphate or the combination thereof.

6. A transgenic plant of Hevea brasiliensis with enhanced cytosolic biosynthesis of isopentenyl diphosphate, dimethylallyl diphosphate or the combination thereof, comprising a recombinant gene construct having an expressible nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9.

7. An isolated polypeptide for catalyzing cytosolic biosynthesis of isopentenyl diphosphate, dimethylallyl diphosphate or the combination thereof in the plant of Hevea brasiliensis, comprising amino acid sequence set forth in SEQ ID NO. 2 SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8 or SEQ ID NO. 10.

8. An isolated polypeptide according to claim 7, wherein the plant of Hevea brasiliensis is clone RRIM 600.

9. A method for catalyzing the biosynthesis of isopentenyl diphosphate, dimethylallyl diphosphate or the combination thereof for enhancing the biosynthesis of natural rubber from its precursors, comprising the step of introducing an isolated polypeptide having amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10 or SEQ ID NO. 12 into a plant cell in vivo or in intra.