WO2013038016A2

WO2013038016A2 - Monoclonal antibodies for detection of high-risk human papillomavirus oncoprotein e7

Info

Publication number: WO2013038016A2
Application number: PCT/EP2012/068271
Authority: WO
Inventors: Olle Nilsson; Christian FERMÉR; Maria LIDQVIST
Original assignee: Fujirebio Diagnostics Ab
Priority date: 2011-09-16
Filing date: 2012-09-17
Publication date: 2013-03-21
Also published as: WO2013038016A3

Abstract

Disclosed herein are monoclonal antibodies for an improved detection of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer. Furthermore, methods and uses of the monoclonal antibodies for the detection, diagnosis and/or prognosis HPV-associated pre-malignant lesions, malignant lesions and invasive cancer are disclosed.

Description

MONOCLONAL ANTIBODIES FOR DETECTION OF HIGH-RISK HUMAN

PAPILLOMAVIRUS ONCOPROTEIN E7

TECHNICAL FIELD OF THE INVENTION

The present invention relates to the field of HPV-associated pre-malignant lesions.

Particularly it relates to monoclonal antibodies for an improved detection of HPV- associated pre-malignant lesions, malignant lesions and invasive cancer, methods and uses thereof to detect -associated pre-malignant lesions, as well as its diagnostic and/or prognostic uses.

BACKGROUND OF THE INVENTION

Cervical cancer is the second most common cancer in the world among women, with half a million new cases and 270 000 deaths from the disease every year. The causative agent for cervical cancer is high-risk types of human papillomavirus (HPV); viral DNA can be found in nearly all cervical cancer tumours. To date, 120 HPV types have been identified, and among these, about 40 infect the genital tract. Twelve genital HPV types are considered high-risk, known to cause cervical cancer. Geographical variations have been found, but HPV16 and 18 are the two most common types in all regions, being present in about 70 % of all cases, followed by HPV45, 33, 31 , 52, 58, 35, 39, 51 , 59 and 56 in the world-wide distribution. HPV16, 18 and 45 are often also considered more aggressive, since they are present in a larger proportion of invasive squamous cell carcinoma (SCC) than in high-grade lesions, compared to other HPV-types. Invasive cancer caused by HPV16, 18 and 45 is in addition diagnosed at a younger mean age Type-specific detection of e.g. HPV16 or HPV18 can therefore be used to identify high- risk disease.

Infection with a high-risk virus is a prerequisite for cervical cancer, but for transformation to occur, the infection must become persistent (often for several years). A majority of all women are infected with genital HPV during their lifetime and the overall prevalence of genital HPV infection is as high as 10.4 % worldwide. Most infections are cleared by the immune system, often within one to two years, and even infections that persist and progress to cervical neoplasia regress spontaneously. However, approximately 20% of low-grade (CINI) lesions will progress to high-grade (CI Nil) lesions, and if left untreated, 30% of those will progress to more severe neoplasia. The two HPV oncogenes, E6 and E7, play a crucial role in the transformation process and are expressed early in the cervical carcinogenesis. The genes are expressed at increasing level during cancer development, often due to integration of the viral DNA into the host genome and loss of expression control, and are then abundantly expressed in high-grade cervical dysplasia and cervical cancer cells. In high-grade lesions and cervical cancer, the E7 protein is expressed throughout the epithelia. This makes the E7 protein a suitable marker for high-grade lesions and cervical cancer.

In countries with effective cytology screening programmes, the incidence and mortality rates of cervical cancer have been reduced dramatically. Most population-based cervical cancer screening programmes use the Pap smear test, by which the morphology of cells from the cervix is examined. The Pap test is partly subjective and relatively insensitive, and the test has to be repeated frequently to be effective. In some programmes, the Pap smear has been replaced by liquid-based cytology (LBC), which allows automated screening, provides residual cellular material for analysis of HPV infection and enables the preparation of monolayer slides. The cytology can be complemented by an HPV DNA test to detect the presence of high-risk viruses. Although HPV DNA tests have greater sensitivity than the Pap smear, they cannot distinguish a transient infection from a persistent one, a prerequisite for cervical cancer. Therefore, sensitive and specific tests are needed to identify malignant progression without detecting transient infections in for example HPV infected cervical samples and Atypical Squamous Cells of Undetermined Significance (ASCUS) samples.

Advantageously, such a test should contain antibodies that detect markers for early malignant transformation, e.g. oncoproteins E6 and E7, and be performed either after additional sampling (e.g. biopsies or cytology samples) or on e.g. residual LBC samples without the need of additional sampling. Today no immunoreagents for detection of E6/E7 protein have been proven to work on clinical LBC samples, and none of the existing E7 antibodies presented to this day has, to our knowledge, been proven useful in clinical studies (e.g. Ressler et al, Clin Cancer Res (2007) 13 p 7067-7072, Schweizer et al, J Clin Microbiol (2010) 48 p 4646-4648). Thus, to our knowledge the antibodies disclosed herein are the only antibodies available that can detect the E7 oncoprotein in pre-malignant/malignant cells with liquid-based cytology (LBC). Simple, reliable tests are also needed for use in countries with less experienced cytologists Tests for the detection of HPV oncoprotein mRNA and secondary biomarkers (e.g. Ki-67 and p16) are already available. According to the current invention, specific and sensitive methods for diagnosis of HPV- induced pre-cancer and cancer can be performed through determination of the E7 oncoprotein. Such determination is made by means of antibodies specific for high-risk HPV E7 oncoprotein, without cross reactivity to low risk strains or cellular proteins.

According to the invention the antibodies of the invention are useful for diagnosis of cervical cancer by detection of high-risk HPV E7 in tissues, cells, cell lysates or body fluids using immunocytochemistry (ICC), immunohistochemistry (IHC), Western blot, Flow cytometry and/or immunoassays,

The antibodies can, depending on the composition of the test, be used for the detection of one or several of the high-risk HPV-types 16, 18, 35 and 45.

SUMMARY OF THE INVENTION

One aspect of the invention relates to a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 , or antigen binding fragments thereof, wherein said antibodies are capable of specific binding to one or more epitopes located within the N-terminal fragments of human high-risk Human papillomavirus (HPV) E7 proteins comprising amino acid residues 1 to 13 from HPV16 E7 protein (SEQ ID NO:3) , and/or 22-53 from HPV18 E7 protein (SEQ ID NO:4).

The monoclonal antibody (mAb) E716-41 :5, or antigen binding fragments thereof is capable of specific binding to an epitope comprising 3 or more amino acid residues of the amino acid sequence HEYM (SEQ ID NO:5); the mAbs E716-81 :3, or antigen binding fragments thereof is capable of specific binding to an epitope comprising 3 or more amino acid residues of the amino acid sequence TPTLHEYM (SEQ ID NO:6); and the mAbE718-79:1 , or antigen binding fragment thereof is capable of specific binding to an epitope comprising three or more amino acid residues of amino acid sequence

PVDLLCHEQLSDSE (SEQ ID NO:7); and the monoclonal antibody (mAb) E718-68:1 , or antigen binding fragment thereof is capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence EEENDEIDGVNHQHLPARR (SEQ ID NO:8).

The composition may comprise the monoclonal antibody (mAb) E716-41 :5 or antigen binding fragment or recombinant protein thereof capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence HEYM (SEQ ID NO:5). The composition may comprise the monoclonal antibody (mAb) E716-81 :3 or antigen binding fragment or recombinant protein thereof capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence TPTLHEYM (SEQ ID NO:6).

The composition may comprise the monoclonal antibody (mAb) E718-79:1 or antigen binding fragment or recombinant protein thereof is capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence

PVDLLCHEQLSDSE (SEQ ID NO:7).

The composition may comprise the monoclonal antibody (mAb) E718-68:1 or antigen binding fragment or recombinant protein thereof capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence

EEENDEIDGVNHQHLPARR (SEQ ID NO:8).

The composition may comprises hybridomas producing said monoclonal antibodies (mAb) that have been deposited on 21 July, 201 1 at Health Protection Agency Culture Collections, Porton Down, Salisbury SP4 0JG, United Kingdom wherein E716-41 :5 has Deposit reference 1 1072101 ; E716-81 :3 has Deposit reference 1 1072102; E718-68:1 has Deposit reference 1 1072103; and E718-79:1 has Deposit reference 1 1072104.

A further aspect of the invention relates to a method for in vitro detection of a high-risk HPV E7 protein in a biological sample, said method comprising the steps of

a) contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk E7 protein or fragment thereof present in the biological sample forming an antigen-antibody complex between the high-risk E7 protein or fragment thereof and said one or more antibodies or fragments thereof, and

b) detecting said antigen-antibody complex; and

c) comparing the amount of antigen-antibody complexes detected to a positive and/or negative control, thereby detecting a high-risk HPV E7 protein.

The positive control may comprise a high-risk HPV E7 protein.

The negative control may not comprise a high-risk HPV E7 protein.

A further aspect of the invention relates to a method for in vitro detection of HPV- associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample, said method comprising the steps of

a) contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7 protein or fragment thereof present in the biological sample, thereby forming an antigen-antibody complex between the a high-risk HPV E7 protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

c) comparing the amount of antigen-antibody complexes detected to a positive and/or negative control, thereby detecting HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample.

A further aspect of the invention relates to a method for in vitro diagnosing and/or prognosing HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample, said method comprising the steps of

a) contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7protein or fragment thereof present in the biological sample, thereby forming an antigen-antibody complex between the high-risk HPV E7protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

c) comparing the amount of antigen-antibody complexes detected to a positive and/or negative control, thereby, diagnosing and/or prognosing HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in the biological sample.

A further aspect of the invention relates to an in vitro method for predicting outcome of treatment in a subject diagnosed with HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, said method comprising the steps of

a) providing a biological sample from a subject having HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, and contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7protein or fragment thereof present in the biological sample, thereby forming an antigen-antibody complex between the high-risk HPV E7protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

c) comparing the amount of antigen-antibody complexes detected to a positive and/or negative control, thereby predicting outcome of treatment in a subject diagnosed with HPV-associated pre-malignant lesions, malignant lesions and invasive cancer.

A further aspect of the invention relates to an in vitro method of assessing efficacy of treatment of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject, said method comprising the steps of

a) providing a biological sample from a subject having HPV-associated pre-malignant lesions, malignant lesions and invasive cancer and contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7protein or fragment thereof present in the biological sample, thereby forming an antigen-antibody complex between the high-risk HPV E7protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

c) comparing the amount of antigen-antibody complexes detected to a positive and/or negative control; and

d) repeating steps a) - c) at one or more time points during treatment of said subject for of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, and wherein a change in the amount of antigen-antibody complexes detected over time indicates the efficacy of treatment in a subject.

A further aspect of the invention relates to a method for in vitro assessment of recurrence of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject, said method comprising the steps of

a) providing a biological sample from a subject having previously had HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, and contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7 protein or fragment thereof present in the biological sample, thereby forming an antigen-antibody complex between the high-risk HPV E7 protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

d) optionally, repeating steps a) - c) over time, and wherein a change in the amount of antigen-antibody complexes detected over time indicates recurrence of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer. The positive control may comprise high-risk HPV E7 protein from a subject suffering from HPV-associated pre-malignant lesions, malignant lesions and/or invasive cancer.

The negative control may not comprise high-risk HPV E7 protein from a subject suffering from HPV-associated pre-malignant lesions, malignant lesions and/or invasive cancer. The HPV-associated pre-malignant lesions, malignant lesions and invasive cancer may be a cancer of the group consisting of cervix cancer, penile cancer, vulveal cancer, anal cancer, head and neck cancers, and/or breast cancer.

The HPV-associated pre-malignant lesions, malignant lesions and/or invasive cancer may be squamous cell carcinoma (SCC) or adenocarcinoma.

The squamous cell carcinoma (SCC) or adenocarcinoma may be caused by an infection by high-risk Human papillomavirus (HPV).

The high risk Human papillomavirus (HPV) may be of the group consisting of Human Papilloma viruses types 16, 18, 35 and 45.

The biological sample may be a tissue, tissue sample, or cell sample, and/or a biopsy sample.

The biological sample may be an aspiration biopsy, a brush biopsy, a surface biopsy, a needle biopsy, a punch biopsy, an excision biopsy, an open biopsy, an incision biopsy or an endoscopic biopsy, tumor, and/or tumor sample,

The biological sample may be a bodily fluid, lysates of cells or tissue, cervical washing fluids, cervical secretions, cervical lavage exfoliated cells blood, and/or serum.

The detecting step may comprise detection by means of an immunochemical detection method.

The immunochemical detection method may be of the group consisting of ELISA, immunohistochemistry, immunoprecipitation, Western blots, chromatography and flow cytometry.

The hybridomas producing said monoclonal antibodies (mAb) have been deposited on 21 July, 201 1 at Health Protection Agency Culture Collections, Porton Down, Salisbury SP4 0JG, United Kingdom wherein E716-41 :5 has Deposit reference 1 1072101 ; E716-81 :3 has Deposit reference 1 1072102; E718-68:1 has Deposit reference 1 1072103; and E718- 79:1 has Deposit reference 1 1072104.

One aspect of the invention relates to the use of a composition according to the invention, for the in vitro detection of a high-risk HPV E7 protein in a biological sample. One aspect of the invention relates to the use of a composition according to the invention, for the in vitro detection of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample

One aspect of the invention relates to the use of a composition according to the invention, for the in vitro diagnosing and/or prognosing HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample

One aspect of the invention relates to the use of a composition according to the invention, for the in vitro method for predicting outcome of treatment in a subject diagnosed with HPV-associated pre-malignant lesions, malignant lesions and invasive cancer

One aspect of the invention relates to the use of a composition according to the invention, for the in vitro assessment of the efficacy of treatment of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject

One aspect of the invention relates to the use of a composition according to the invention, for the in vitro assessment of recurrence of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject

One aspect of the invention relates to a kit for in vitro diagnosing and/or prognosing cancer in a biological sample, said kit comprising means for detecting an antigen- antibody complex between an high-risk HPV E7 protein or fragment thereof present in the biological sample and said one or more antibodies or fragments thereof of the

composition according to any one of claims 1 -7.

The kit may further comprise a positive and/or a negative control.

The kit may further comprise comprising instructions to the methods according to any the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows the specificity of the mAbs in ELISA

Figure 2 shows a Western blot analysis using the antibodies of the invention. Staining with a) E716-41 :5 b) E716-81 :3 c) E718-68:1 and d) E718-79:1

Figure 3 shows the epitope mapping using overlapping peptides displayed on phage particles.

Figure 4 shows the staining of HPV E7 expressing target cells in a background of HPV negative C33A cells. Figure 5 shows the staining of cervical cancer sections in IHC with mAb a) E716-41 :5, b) E716-81 :3, c) E718-68:1 and d) E718-79:1

Figure 6 shows that E718-68:1 and E718-79:1 bind to different epitopes and can thus form an EIA pair.

Figure 7 shows a dose response for the HPV16 mAbs E716-41 :5 and E716-9:1 .

Figure 8 shows the specificity of the HPV16 EIA with catcher E716-41 :5 and tracer E716- 9:1 . A strong signal was detected for HPV16 E7 positive CaSki cells while HPV18 positive HeLa cells and HPV negative C33A cells were negative.

Figure 9 shows the amino acid sequences of HPV16 E7 and HPV18 E7 proteins

Figure 10 shows the staining of a) single HeLa cells stained with the E718-79:1 mAb in a background of normal epithelial cells b) an HPV16 positive cytology sample from a patient with histology verified CINII, stained with the E716-41 :5 mAb.

Figure 1 1 shows the detection of HeLa cells in a background of HPV-negative C33A cells in FACS using mAb E718-79:1 .

DETAILED DESCRIPTION OF THE INVENTION

Before the present invention is described, it is to be understood that this invention is not limited to the particular embodiments described, as such methods, devices, and formulations may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims. It must be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise, and includes reference to equivalent steps and methods known to those skilled in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the specific methods and/or materials in connection with which the publications are cited.

The term "subject" includes, but is not limited to, humans, nonhuman primates such as chimpanzees and other apes and monkey species, farm animals such as cattle, sheep, pigs, goats and horses, domestic mammals such as dogs and cats, laboratory animals including rodents such as mice, rats and guinea pigs, and the like. The term does not denote a particular age or sex. Thus, adult and newborn subjects, as well as fetuses, whether male or female, are intended to be covered. In preferred embodiments, the subject is a mammal, including humans and non-human mammals. In the most preferred embodiment, the subject is a human.

"At least one" as used herein means one or more, i.e. 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 etc. "Detection", "detect", "detecting" as used herein includes qualitative and/or quantitative detection (measuring levels) with or without reference to a control, and further refers to the identification of the presence, absence, or quantity of a given protein, specifically the protein high-risk Human Papillomavirus (HPV) E7 protein.

"Diagnosis" as used herein encompasses the identification of the nature of a disease.

"Prognosis" as used herein encompasses a forecast as to the probable outcome of a disease, the prospects as to recovery from a disease as indicated by the nature and symptoms of a disease.

"True positives (TP)" refers to those subjects having localized or metastasized HPV- associated pre-malignant lesions, malignant lesions or invasive cancer, i.e. sick people correctly diagnosed as sick.

"False negatives (FN)" refers to those subjects having either a localized or metastasized HPV-associated pre-malignant lesions, malignant lesions or invasive cancer and are not categorized as such by a diagnostic assay, i.e. sick people incorrectly identified as healthy.

"True negatives (TN)" refers to those subjects who do not have a localized or

metastasized HPV-associated pre-malignant lesions, malignant lesions or invasive cancer and who are categorized as such by a diagnostic assay, i.e. healthy people correctly identified as healthy.

"False positives (FP)" refers to those subjects who do not have a localized or

metastasized HPV-associated pre-malignant lesions, malignant lesions or invasive cancer but are categorized by a conventional diagnostic assay as having a localized or metastasized HPV-associated pre-malignant lesions, malignant lesions or invasive cancer.

Depending on context, the term "false positives" may also refer to those subjects who do not have HPV-associated pre-malignant lesions, malignant lesions or invasive cancer but are categorized by a diagnostic assay as having HPV-associated pre-malignant lesions, malignant lesions or invasive cancer or a non-malignant disease, i.e. healthy people incorrectly identified as sick.

"Sensitivity", as used herein in the context of its application to diagnostic assays, refers to the proportion of all subjects with localized or metastasized HPV-associated pre- malignant lesions, malignant lesions or invasive cancer that are correctly identified as such (that is, the number of true positives divided by the sum of the number of true positives and false negatives, i.e. TP/(TP + FN).

"Specificity" of a diagnostic assay, as used herein in the context of its application to diagnostic assays, refers to the proportion of all subjects with neither localized or metastasized HPV-associated pre-malignant lesions, malignant lesions or invasive cancer that are correctly identified as such (that is, the number of true negatives divided by the sum of the number of true negatives and false positives, i.e. TN/(TN + FP).

The terms "neoplasm" or "tumor" may be used interchangeably and refer to an abnormal mass of tissue wherein the growth of the mass surpasses and is not coordinated with the growth of normal tissue. A neoplasm or tumor may be defined as "benign" or "malignant" depending on the following characteristics: degree of cellular differentiation including morphology and functionality, rate of growth, local invasion and metastasis. A "benign" neoplasm is generally well differentiated, has characteristically slower growth than a malignant neoplasm and remains localized to the site of origin. In addition a benign neoplasm does not have the capacity to infiltrate, invade or metastasize to distant sites.

A "malignant" neoplasm is generally poorly differentiated (anaplasia), has

characteristically rapid growth accompanied by progressive infiltration, invasion, and destruction of the surrounding tissue. Furthermore, a malignant neoplasm has the capacity to metastasize to distant sites. The term "metastasis" refers to the spread or migration of cancerous cells from a primary (original) tumor to another organ or tissue, and is typically identifiable by the presence of a "secondary tumor" or "secondary cell mass" of the tissue type of the primary (original) tumour and not of that of the organ or tissue in which the secondary (metastatic) tumour is located.

"Healthy" refers to a subject possessing good health. Such a subject demonstrates an absence of any malignant or non-malignant HPV-associated pre-malignant lesions, malignant lesions or invasive cancer, In the context of this application, a "healthy individual" is only healthy in that they have an absence of any malignant or non-malignant HPV-associated pre-malignant lesions, malignant lesions or invasive cancer; a "healthy individual" may have other diseases or conditions that would normally not be considered "healthy". "Monoclonal antibody" or "mAb" as used herein refers to an antibody of a single amino acid composition, that is directed against a specific antigen and that is produced by a single clone of B cells or hybridoma.

"Polyclonal antibody" as used herein refers to an antibody that is directed against a specific antigen and that is derived from different B-cell lines.

"Fab" as used herein refers to an antibody fragment having a molecular weight of about 50,000 Da and antigen binding activity, in which about a half of the N-terminal side of H chain and the entire L chain, among fragments obtained by treating IgG with a protease, for example papain, pepsin, bromelain and ficin,, are bound together through a disulfide bond.

"F(ab')2" as used herein refers to an antibody fragment having a molecular weight of about 100,000 Da and antigen binding activity, which is slightly larger than the Fab bound via a disulfide bond of the hinge region, among fragments obtained by treating IgG with a protease, for example papain, pepsin, bromelain and ficin

"Fab¹ " as used herein refers to an antibody fragment having a molecular weight of about 50,000 Da and antigen binding activity, which is obtained by cutting a disulfide bond of the hinge region of the F(ab')2. As used herein, a single chain Fv ("scFv") polypeptide is a covalently linked VH::VL heterodimer which is usually expressed from a gene fusion including VH and VL encoding genes linked by a peptide-encoding linker. The mouse scFv fragment of the invention includes CDRs that are held in appropriate conformation, preferably by using gene recombination techniques.

"Hybridoma" as used herein denotes a cell, which is obtained by subjecting a B cell prepared by immunizing a non-human mammal with an antigen to cell fusion with a myeloma cell derived from a mouse or the like and which produces a desired monoclonal antibody having antigen specificity.

As used herein a "biological sample" encompasses a variety of sample types obtained from any subject having or not having HPV-associated pre-malignant lesions, malignant lesions or invasive cancer. A typical subject is any human that has HPV-associated pre- malignant lesions, malignant lesions and may develop cancer which can serve as a source of a biological sample useful in a disclosed method. Exemplary biological samples useful in the disclosed methods include but are not limited to biological samples disclosed herein e.g. solid tissue samples such as a biopsy specimen or tissue cultures or cells derived there from, and the progeny thereof. For example, biological samples include cells obtained from a tissue sample collected from an individual suspected of having HPV-associated pre-malignant lesions, malignant lesions or invasive cancer. Therefore, biological samples encompass clinical samples, cells in culture, cell supernatants, cell lysates, and tissue samples or cell samples (e.g., a tissue biopsy, for example, an aspiration biopsy, a brush biopsy, a surface biopsy, a needle biopsy, a punch biopsy, an excision biopsy, an open biopsy, an incision biopsy or an endoscopic biopsy), tumor, tumor sample, or biological fluid (e.g., blood, serum, lymph, spinal fluid).

As used herein, a "tissue sample" refers to a portion, piece, part, segment, or fraction of a tissue which is obtained or removed from an intact tissue of a subject, preferably a human subject. Samples may be fresh or processed post-collection (e.g., for archiving purposes). In some examples, processed samples may be fixed (e.g., formalin-fixed) and/or wax- (e.g., paraffin-) embedded. Fixatives for mounted cell and tissue preparations are well known in the art and include, without limitation, 95% alcoholic Bouin's fixative; 95% alcohol fixative; B5 fixative, Bouin's fixative, formalin fixative, Karnovsky's fixative (glutaraldehyde), Hartman's fixative, Hollande's fixative, Orth's solution (dichromate fixative), and Zenker's fixative (see, e.g., Carson, Histotechology: A Self-Instructional

Text, Chicago: ASCP Press, 1997). In some examples, the sample (or a fraction thereof) is present on a solid support. Exemplary supports include microscope slides (e.g., glass microscope slides or plastic microscope slides), coverslips (e.g., glass coverslips or plastic coverslips), tissue culture dishes, multi-well plates, membranes (e.g., nitrocellulose or polyvinylidene fluoride (PVDF)) or BIACORE^(R); chips.

"Treatment" as used herein is defined as the management of a subject through medical or surgical means. The treatment improves or alleviates at least one symptom of a medical condition or disease and is required to provide a cure. The term "treatment outcome" or "outcome of treatment" as used herein is the physical effect upon the subject of the treatment.

Immunohistochemistry (IHC) is one exemplary technique useful for detecting protein expression of human high-risk Human papillomavirus (HPV) E7 protein in the disclosed methods and uses. Antibodies (e.g., monoclonal and/or polyclonal antibodies) specific for the protein expression marker are used to detect the expression. The composition of the invention thus provides antibodies binding to human high-risk Human papillomavirus

(HPV) E7 protein. The antibodies can be detected, as further described herein, by direct labelling of the antibodies themselves, for example, with radioactive labels, fluorescent labels, hapten labels such as, biotin, or an enzyme such as horseradish peroxidase or alkaline phosphatase. Alternatively, an indirect labelling is used where unlabeled primary antibody is used in conjunction with a labelled secondary antibody, comprising e.g. antiserum, polyclonal antiserum or a monoclonal antibody specific for the primary antibody

Another preferred method for detecting protein expression of human high-risk Human papillomavirus (HPV) E7 protein in the biological sample is Fluorescence-activated cell sorting (FACS). It provides a method for sorting a heterogeneous mixture of biological cells into two or more containers, one cell at a time, based upon the specific light scattering and fluorescent characteristics of each cell. It is a useful scientific instrument, as it provides fast, objective and quantitative recording of fluorescent signals from individual cells as well as physical separation of cells of particular interest.

As revealed above, the present invention provides methods for improved sensitivity and specificity in the detection of HPV-associated pre-malignant lesions, malignant lesions or invasive cancer for the diagnosis and/or prognosis of said conditions. More specifically, the present invention provides a composition that better sensitivity for detection of Human papillomavirus (HPV) E7 protein so as to improve the detection of Human papillomavirus (HPV) E7 protein in IHC, thereby giving a more consistent and reliable result when performing diagnosis and/or prognosis of HPV-associated pre-malignant lesions, malignant lesions or invasive cancer in subjects.

The present invention encompasses a composition comprising one or more of the monoclonal antibodies (mAb) or fragments thereof, wherein said antibodies are capable of specific binding to one or more epitopes located within the N-terminal fragment of high- risk Human papillomavirus (HPV) 16 E7 protein and/or high-risk Human Papillomavirus (HPV) 18 E7 protein.

Human papillomavirus (HPV) is a member of the papillomavirus family of viruses that is capable of infecting humans. Like all papillomaviruses, HPVs establish productive infections only in keratinocytes of the skin or mucous membranes. While the majority of the over 120 known types of HPV cause no symptoms in most people, some types can cause warts (verrucae), while others can - in a minority of cases - lead to cancers of the cervix, vulva, vagina, and anus in women or cancers of the anus and penis in men. It can also cause cancers of the head and neck (tongue, tonsils and throat).

More than 30 to 40 types of HPV are typically transmitted through sexual contact and infect the anogenital region. Persistent infection with "high-risk" HPV types— different from the ones that cause skin warts— may progress to precancerous lesions and invasive cancer. HPV infection is a cause of nearly all cases of cervical cancer. However, most infections with these types do not cause disease. Over 120 HPV types have been identified and are referred to by number. Types 16, 18, 31 , 33, 35, 39, 45, 51 , 52, 56, 58, and 59 are "high-risk" sexually transmitted HPVs and may lead to the development of cervical intraepithelial neoplasia (CIN), vulvar

intraepithelial neoplasia (VIN), penile intraepithelial neoplasia (PIN), and/or anal intraepithelial neoplasia (AIN). The HPV genome is composed of eight genes encoding six early (E1 , E2E4, E5, E6, and E7) and two late (L1 and L2) proteins. After the host cell is infected, E1 and E2 are expressed first. High E2 levels repress expression of the E6 and E7 proteins. When the host and HPV genomes integrate, the E2 gene is normally disrupted, preventing repression of E6/E7 expression. The E6/E7 proteins inactivate two tumor suppressor proteins, p53 (inactivated by E6) and pRb (inactivated by E7). The viral oncogenes E6 and E7 are thought to modify the cell cycle so as to retain the

differentiating host keratinocyte in a state that is favorable to the amplification of viral genome replication and consequent late gene expression. In the upper layers of the host epithelium, the late genes L1 and L2 are transcribed/translated and serve as structural proteins that encapsidate the amplified viral genomes. Once the genome is encapsidated, the capsid appears to undergo a redox-dependent assembly/maturation event, which is tied to a natural redox gradient that spans both suprabasal and cornified epithelial tissue layers. This assembly/maturation event stabilizes virions, and increases their specific infectivity. Virions can then be sloughed off in the dead squames of the host epithelium and the viral lifecycle continues.

Primary HPV infection is limited to the basal cells of stratified epithelium, the only tissue in which they replicate. The virus infects epithelial tissues through micro-abrasions or other epithelial trauma that exposes basal cells.

Structurally, both high-risk and low-risk E7 proteins can be divided into three regions: conserved region 1 (CR1 , corresponding to amino acids 2-15 of HPV16 E7), CR2 (amino acids 16-37 of HPV16 E7), and the C-terminal region containing a zink-binding fold (from amino acid 58).

HPV infection is the cause of CIN (all grades), SCC, adenocarcinoma in situ and cervical adenocarcinoma.

A persistent infection with a high-risk HPV virus is necessary for malignant transformation of cervical epithelial cells. HPV types that are found preferentially in cervical and other anogenital cancers have been designated "high-risk" types. HPV types only rarely detected in malignant lesions are considered as low-risk types.

Only E6 and E7 of high-risk strains are able to immortalize human cells in culture. The association of E7 with the pocket proteins Rb, p107 and p130 contribute to the ability of E7 to stimulate cell proliferation, with the high-risk E7 proteins binding Rb more efficiently than the E7 protein of the low-risk HPV types. The high-risk E7 proteins are also capable of mediating Rb degradation through a proteosome-dependent mechanism which is important for E7-mediated cell transformation.

High-risk human Human papillomavirus (HPV)16 E7 protein has the following amino acid sequence M H GDTPTLH EYM LDLQPETTDLYCYEQLN DSSEE EDE I DG PAGQAE PDRAHYN IVTFCCKCDSTLRLCVQSTHVDI RTL EDLLMGTLGIVCPI CSQKP (SEQ ID NO: 1).

Human papillomavirus (HPV)18 E7 protein has the following amino acid sequence: M H GP KATLQDIVLH LEPQN EI PVDLLCH EQLSDS EEE N DE I DGVN HQH LPARRAE PQRHTM LCMCCKCEARI ELVVESSADDLRAF QQLFLKTLSFVCPWCASQQ (SEQ ID NO: 2). Both sequences can be seen in Figure 9.

One aspect of the invention relates to a composition comprising one or more of monoclonal antibodies (mAb) E716-41:5, E716-81:3, E718-79:1 or E718-68:1, or antigen binding fragments thereof, wherein said antibodies are capable of specific binding to one or more epitopes located within the N-terminal fragments of human high-risk Human papillomavirus (HPV) E7 proteins comprising amino acid residues 1 to 13 from HPV16 E7 protein (SEQ ID NO:3) , and/or 22-53 from HPV18 E7 protein (SEQ ID NO:4).

By "reacting specifically with" as used herein it is intended to equal "capable of binding selectively" or "binding specifically to". As used herein the expressions are intended to mean that the antibody or antigen-binding fragment, or variant, fusion or derivative thereof, including any anti-body derived binding moiety, which is capable of binding to an antigen of a molecule and further which binds at least 10-fold more strongly the Human papillomavirus (HPV) E7 proteins than to another proteins for example at least 50-fold more strongly or at least 100- fold more strongly. The binding moiety may be capable of binding selectively to the protein under physiological conditions, e.g. in vivo. Suitable methods for measuring relative binding strengths include, immunoassays of the type mentioned above.

The term "antibody" as used herein refers to an immunoglobulin molecule or a fragment thereof having the ability to specifically bind to a particular antigen. A typical

immunoglobulin has four polypeptide chains, containing an antigen binding region known as a variable region and a non-varying region known as the constant region. The antibody may be an anti-marker protein antibody specific for the protein used in the assay. Thus, the antibody may be capable of specifically binding the protein marker as the antigen. Antibodies and methods for their manufacture are well known in the art of immunology. The antibody may be produced, for example, by hybridoma cell lines, in which case the antibody will be capable of specific binding to a single specific site on the antigen termed "epitope", and the antibody characterized by this feature is termed

"monoclonal antibody", or by immunization to elicit a polyclonal antibody response, which means that an antibody capable of recognizing multiple sites, epitopes, on the antigen is produced, or by recombinant host cells that have been transformed with a recombinant DNA expression vector that encodes the antibody. Depending on the amino acid sequences of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are at least five (5) major classes of

immunoglobulins: IgA, IgD, IgE, IgG and IgM, and several of these may be further divided into subclasses (isotypes), e.g. lgG-1 , lgG-2, lgG-3 and lgG-4; lgA-1 and lgA-2.

Antibodies include but are not limited to immunoglobulin molecules of any isotype (IgA, IgG, IgE, IgD, IgM), and active fragments including Fab, Fab', F(ab')2, Facb, Fv, ScFv, Fd, VH and VL. Examples of antibodies include but are not limited to single chain antibodies, chimeric antibodies, mutants, fusion proteins, humanized antibodies and any other modified configuration of an immunoglobulin molecule that comprises an antigen recognition site of the required specificity. The invention relates to any type of antibody molecule or a fragment thereof which is suitable for use in the methods disclosed herein. Thus, the invention relates to antibody fragments which retain the capability of the corresponding antibody to specifically bind to the antigen. The invention relates to both primary and secondary antibodies. The "primary antibody" is an antibody which is specific for a particular antigen. By "secondary antibody" is meant an antibody which is capable of specifically recognizing an immunoglobulin molecule. Thus, the secondary antibody may be defined as an antibody against the primary antibody.

The term "antigen binding fragment" refers to an antibody fragment or portion of a full- length antibody, generally the variable region that is capable of binding the Human Papillomavirus (HPV) E7 protein. Examples of antigen binding fragments of an antibody include Fab, Fab', F(ab') 2 and Fv fragments. Additional fragments can include diabodies, linear antibodies, single-chain antibody molecules, and multispecific antibodies formed from anti- body fragments. As used herein, "antigen binding fragment" with respect to antibodies, refers to Fv, F(ab) and F(ab')2 fragments. Antigen binding fragments of the invention may be as small as 3 amino acids, 4 amino acids, 5 amino acids, 6 amino acids, 7 amino acids, 8 amino acids, 9 amino acids, about 12 amino acids, about 15 amino acids, about 18 amino acids or more. In general, an antibody fragment of the invention can have any upper size limit so long as it is has similar or immunological properties relative to antibody that specifically binds to an epitope comprising at least three amino acid residues of the target antigenic site. The preparation of monoclonal antibodies is conventional. See, for example, Kohler & Milstein, Nature, 256:495-7 (1975); Coligan, et al., sections 2.5.1 - 2.6.7; and Harlow, et al., in: Antibodies: A

Laboratory Manual, page 726, Cold Spring Harbor Pub. (1988). Monoclonal antibodies can be isolated and purified from hybridoma cultures by a variety of well-established techniques.

The antigen molecule of the invention is the human high-risk HPV E7 protein which is a small (approximately 10,000 Mw), Zn-binding phosphoprotein that has oncogenic properties, likely due to its ability inactivate members of the pRb family of tumor suppressor proteins. Together with E6, E7 serves to prevent cell death (apoptosis) and promote cell cycle progression, thus priming the cell for replication of the viral DNA.

An antigen molecule (in the present context means human high-risk HPV E7 protein) may contain a number of the same or different antigenic determinants to which individual antibodies are made and bind to. The smallest unit (antigenic determinant) to which an antibody can be made is about three to six amino acid residues. This smallest antigenic determinant is termed "epitope". Antibodies can bind to conformational epitopes

(conformational epitopes are interchangeably termed herein as non-linear epitopes) formed due to folding of the protein molecule or linear epitopes represented by linear amino acid sequences which are fragments of the protein molecule.

The monoclonal antibodies (mAbs) E716-41 :5 and E716-81 :3 only reacted to fragment of amino acids 1 -25 of HPV 16 E7, mapping the epitopes of both mAbs to the N-terminal of HPV16 E7. Since no binding was seen for the other fragments, including amino acids 13- 37, the epitope is located to approximately amino acids 1 -13 (SEQ ID NO:3). The mimotope of E716-41 :5 was mapped to HEY corresponding to aa 9-1 1 of the HPV16 E7 sequence, using a random peptide library. E718-68:1 only reacted with fragment 35-64 of HPV18 E7, and not with the overlapping peptide amino acids 53-78 or any other fragments. This locates the epitope to amino acids 35-53, i.e. to the sequence

EEENDEIDGVNHQHLPARR (SEQ ID NO:8). E718-79:1 only bound the amino acid 1 1 - 35 fragment. Since no binding was detected with amino acids 1 -22, most of the epitope of the mAb is located within amino acids 22-35, i.e. the sequence PVDLLCHEQLSDSE (SEQ ID NO:7).

In particular the composition comprises one or more of monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 , or antigen binding fragments thereof, that are capable of specific binding to an epitope corresponding to the amino acid residues 1 to 13 from HPV16 E7 protein, i.e. the amino acid sequence

MHGDTPTLHEYML (SEQ ID NO:3) and/or to an epitope corresponding to the amino acid residues 22 to 53 from HPV18 E7 protein, i.e. the amino acid sequence

PVDLLCHEQLSDSEEENDEIDGVNHQHLPARR (SEQ ID NO:4).

More specifically the monoclonal antibodies (mAbs) E716-41 :5 and E716-81 :3, or antigen binding fragments thereof in the composition of the invention are capable of specific binding to an epitope comprising amino acid residues of the amino acid sequence MHGDTPTLHEYML (SEQ ID NO:3); the monoclonal antibody (mAb) E718-79:1 , or antigen binding fragment thereof is capable of specific binding to an epitope comprising amino acid residues of amino acid sequence PVDLLCHEQLSDSE (SEQ ID NO:7); and the monoclonal antibody (mAb) E718-68:1 , or antigen binding fragment thereof is capable of specific binding to an epitope comprising amino acid residues of amino acid sequence EEENDEIDGVNHQHLPARR (SEQ ID NO:8).

More specifically the one or more of the monoclonal antibodies of the invented composition are capable of binding to one or more epitopes comprising at least three amino acid residues of the amino acid sequences SEQ ID NO:3, SEQ ID NO: 7, and/or SEQ ID NO: 8. The at least tree amino acid residues may be any amino acid residues of this amino acid sequence. The term "at least" means that an epitope to which the antibody of the invention is capable to binds to may consist of three or more amino acid residues. For example, an epitope of the invention may comprise from 3 to 18 amino acid residues, such as from 3 to 17, 16 15, 14, 13, 12, 1 1 , 10, 9, 8, 7, 6, 5 or to 4 amino acids. The amino acid residues making up an epitope of the invention may be consecutive residues, scattered or partly scattered within the sequences of SEQ ID NO: 3, 7 and/or 8. Thus, a further aspect of the invention relates to a composition comprising the mAb E716-41 :5 or antigen binding fragments thereof, wherein said antibody is capable of specific binding to an epitope of the HPV 16 E7 protein comprising 3 or more amino acid residues of the amino acid sequence HEYM (SEQ ID NO:5).

Still a further aspect of the invention relates to a composition comprising the mAb E718- 79:1 or antigen binding fragments thereof, wherein said antibody is capable of specific binding to an epitope of the HPV 18 E7 protein comprising 3 or more amino acid residues of the amino acid sequence PVDLLCHEQLSDSE (SEQ ID NO:7).

Four hybridomas producing monoclonal antibodies (mAbs) of the invention were deposited on 21 July, 201 1 at Health Protection Agency Culture Collections, Porton Down, Salisbury SP4 0JG, United Kingdom. The deposited material was given the following identification: E716-41 :5 (Deposit reference 1 1072101 ), E716-81 :3 (Deposit reference 1 1072102), E718-68:1 (Deposit reference 1 1072103) and E718-79:1 (Deposit reference 1 1072104).

The composition described herein may be lyophilized for storage and reconstituted in a suitable carrier prior to use. A suitable lyophilisation method may be e.g. spray drying, cake drying and thereafter reconstitution techniques can be employed. The person skilled in the art is aware that lyophilisation and reconstitution can lead to varying degrees of antibody activity loss (e.g. with conventional immunoglobulins, IgM antibodies tend to have greater activity loss than IgG antibodies) and that use levels may have to be adjusted upward to compensate.

Further it is contemplated that the antibodies or fragments thereof of the invention may be labelled directly or indirectly, with a detectable moiety. By directly labeled is meant that the detectable moiety is attached to the antibody. By indirect labeled it is meant that the detectable moiety is attached to a linker, such as, for example, a secondary or tertiary antibody. The detectable moiety may be any moiety or marker known to those skilled in the art, such as e.g. radionuclides, enzymes, substrates, cofactors, inhibitors, fluorescent agents, chemiluminescent agents, magnetic particles and the like, and as being such a moiety being capable of generating a signal that allows the direct or indirect quantitative or relative measurement of a molecule to which it is attached.

Use of the composition comprising antibodies of the invention

The composition or the individual antibodies of the invention may be advantageously used in different research, diagnostic, and therapeutic applications. Some non-limited embodiments of use of the antibodies are described below.

As discussed above, infection with a high-risk virus is a prerequisite for cervical cancer, but for transformation to occur, the infection must become persistent (often for several years). A majority of all women are infected with genital HPV during their life, but most infections are cleared by the immune system, often within one to two years, and even infections that persist and progress to cervical neoplasia regress spontaneously.

However, approximately 20% of low-grade (CINI) lesions will progress to high-grade

(CI Nil) lesions, and if left untreated, 30% of those will progress to more severe neoplasia.

Therefore, sensitive and specific tests are needed to identify malignant progression without detecting transient infections in for example HPV infected cervical samples and Atypical Squamous Cells of Undetermined Significance (ASC-US) samples. Within the disclosed methods and uses of the invention there are provided sensitive and specific tests that allow malignant progression to be identified without detecting transient infections, since the E7 protein is expressed at increasing levels during carcinogenesis, from low in transient infections to levels detectable with immunoassays in high-grade dysplasia.

Generally the methods and uses comprises obtaining a biological sample isolated from a subject, contacting said sample with the composition disclosed herein , said composition being capable of specific interaction with the high-risk Human papillomavirus (HPV) E7 protein, detecting an interaction between the antibodies and the high-risk Human papillomavirus (HPV) E7 protein, wherein the detection of an interaction indicates the presence or absence of the high-risk Human papillomavirus (HPV) E7 protein in the biological sample, thereby allowing for e.g. detection of the high-risk Human

papillomavirus (HPV) E7 protein, detection of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample, diagnosis, prognosis etc. according to any of the methods disclosed herein, the results of which one may determine if a subject is healthy, or is having HPV-associated pre-malignant lesions, malignant lesions and invasive cancer.

As used herein, the term "isolated", when used in the context of a biological sample, is intended to indicate that the biological sample has been removed from the subject. In one embodiment, a biological sample comprises a sample which has been isolated from a subject and is subjected to a method of the present invention without further processing or manipulation subsequent to its isolation. In another embodiment, the biological sample can be processed or manipulated subsequent to being isolated and prior to being subjected to a method of the invention. For example, a sample can be refrigerated (e.g., stored at 4° C), frozen (e.g., stored at -20° C, stored at -135° C. frozen in liquid nitrogen, or cryopreserved using any one of many standard cryopreservation techniques known in the art). Furthermore, a sample can be purified subsequent to isolation from a subject and prior to subjecting it to a method of the present invention. As used herein, the term "purified" when used in the context of a biological sample, is intended to indicate that at least one component of the isolated biological sample has been removed from the biological sample such that fewer components, and consequently, purer components, remain following purification.

Concerning tissue or tumor samples (termed generally "histological samples"), the samples can in general be divided in two categories: (a) preparations comprising fresh tissues and/or cells, which generally are not fixed with aldehyde-based fixatives, and (b) fixed and, optionally, paraffin embedded tissue specimens, often archived material.

Immunochemical evaluation of high-risk HPV E7 protein expression in a biological sample may be advantageously used for diagnostic applications. Examples of

immunochemical detection methods include, but are not limited to ELISA,

immunohistochemistry, immunoprecipitation, Western blots, chromatography and flow cytometry .Thus in one embodiment diagnostic methods of the present invention may involve a quantitative determination of the level of expression of high-risk HPV E7 protein in the sample, i.e. measuring the amount of high-risk HPV E7 protein in the sample, or a qualitative determination i.e. determining the presence versus the absence of high-risk HPV E7 protein in the sample. Diagnostic methods of the present invention may also involve comparing the level of high-risk HPV E7 protein in the sample with the level of high-risk HPV E7 protein in a control sample, i.e. obtained from a subject who is not having the disease in question. As used herein, the phrase "comparing the level" includes evaluating, balancing or contrasting the amount or presence of high-risk HPV E7 protein in a first sample (e.g., a test sample) with the amount or presence of high-risk HPV E7 protein in a second sample (e.g., a control sample). In yet another embodiment, the diagnostic methods may further include the step of forming a prognosis or forming a diagnosis and stratifying subjects for appropriate therapy.

Therefore in one embodiment the invention relates to a method of diagnosing and/or prognosing HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in the biological sample, said method comprising a step a) contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7 protein or fragment thereof present in the biological sample forming an antigen-antibody complex in the biological sample between the a high-risk HPV E7 protein or fragment thereof and the sample; and

b) detecting said antigen-antibody complex; and

c) comparing the amount of antigen-antibody complexes detected to a positive and/or negative control, thereby diagnosing and/or prognosing HPV-associated pre-malignant lesions, malignant lesions and invasive cancer.

Another embodiment of the invention relates to an in vitro method for predicting outcome of treatment in a subject diagnosed with HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, said method comprising the steps of a) providing a biological sample from a subject having HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, and contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7protein or fragment thereof present in the biological sample forming an antigen-antibody complex between the high-risk HPV E7protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

Yet another embodiment of the invention relates to an in vitro method for predicting outcome of treatment in a subject diagnosed with HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, said method comprising the steps of

a) providing a biological sample from a subject having HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, and contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7protein or fragment thereof present in the biological sample forming an antigen-antibody complex between the high-risk HPV E7protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

Yet another embodiment of the invention relates to an in vitro method of assessing efficacy of treatment of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject, said method comprising the steps of

a) providing a biological sample from a subject having HPV-associated pre-malignant lesions, malignant lesions and invasive cancer and contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7protein or fragment thereof present in the biological sample forming an antigen-antibody complex between the high-risk HPV E7protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

Still another embodiment of the invention relates to a method for in vitro assessment of recurrence of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject, said method comprising the steps of

a) providing a biological sample from a subject having previously had HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, and contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7 protein or fragment thereof present in the biological sample forming an antigen- antibody complex between the high-risk HPV E7 protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

d) optionally, repeating steps a) - c) over time, and wherein a change in the amount of antigen-antibody complexes detected over time indicates recurrence of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer.

Diagnostic methods of the present invention may also involve comparing the level of high-risk HPV E7 protein in the sample with the level of high-risk HPV E7 protein in a control sample, i.e. obtained from a subject who is not having the disease in question. As used herein, the phrase "comparing the level" includes evaluating, balancing or contrasting the amount or presence of high-risk HPV E7 protein in a first sample (e.g., a test sample) with the amount or presence of high-risk HPV E7 protein in a second sample (e.g., a control sample).

Accordingly, differential presence of high-risk HPV E7 protein found in a given biological sample provides useful information regarding a probability of whether a subject being tested has HPV-associated pre-malignant lesions, malignant lesions or invasive cancer or is healthy. A probability that a subject being tested has HPV-associated pre-malignant lesions, malignant lesions and invasive cancer or is healthy depends on whether the quantity of the high-risk HPV E7 protein in a test sample taken from said subject is statistically significant from a quantity the high-risk HPV E7 protein in a biological sample taken from healthy subjects or a control level known to exist in health subjects.

A difference in one of the high-risk HPV E7 proteins found in a given biological sample may also be used to determine whether a subject known to have HPV-associated pre- malignant lesions, malignant lesions or invasive cancer is responding to a therapeutic treatment being administered. A quantity of the high-risk HPV E7 protein detected in a sample taken at time of therapy is compared to a quantity of the high-risk HPV E7 protein detected in a sample taken prior to an administration of treatment. In addition, a quantity of the high-risk HPV E7 protein detected in a sample taken at time of therapy is compared to a reference of the high-risk HPV E7 protein indicative of a healthy subject. Based on a comparison, one can determine whether said subject is responding to a therapeutic treatment, and to what degree the response is.

Furthermore, a difference in presence of the high-risk HPV E7 protein found in a given biological sample may also be used to determine whether a subject known to have HPV- associated pre-malignant lesions, malignant lesions or invasive cancer will respond to a given therapeutic treatment. A quantity of the high-risk HPV E7 protein detected in a sample taken from a subject diagnosed as having HPV-associated pre-malignant lesions, malignant lesions or invasive cancer is compared to reference panels of the high-risk HPV E7 protein taken from subjects with similar diagnoses that have undergone different forms of treatment. Reference panels of the high-risk HPV E7 protein generated from samples taken from subjects exposed to a given treatment, wherein the treatment resulted in a positive outcome are considered to indicate that the given treatment had a positive effect on the subject and therefore would be deemed successful. Reference panels of the high-risk HPV E7 protein generated from samples taken from subjects exposed to a given treatment, wherein the treatment resulted in a neutral outcome are considered to indicate that the given treatment had no therapeutic effect on the subject and would therefore be deemed unsuccessful. Reference panels of the high-risk HPV E7 protein generated from samples taken from subjects exposed to a given treatment, wherein the treatment resulted in a negative outcome are considered to indicate that the given treatment had no therapeutic effect on the subject and would be deemed unsuccessful. Based on the comparison, one skilled in the art would be able to administer the best mode of treatment for said subject. The presence of "HPV-associated pre-malignant lesions" is a condition or precancerous condition induced by a HPV infection. It is a disease, syndrome, or finding that, if left untreated, may lead to cancer. It is a generalized state associated with a significantly increased risk of cancer. Premalignant lesion is a morphologically altered tissue in which cancer is more likely to occur than its apparently normal counterpart. An example of such HPV-associated pre-malignant condition is Cervical intraepithelial neoplasia (CIN), also known as cervical dysplasia and cervical interstitial neoplasia, is the potentially premalignant transformation and abnormal growth (dysplasia) of squamous cells on the surface of the cervix. CIN is not cancer, and is usually curable. Most cases of CIN remain stable, or are eliminated by the host's immune system without intervention. However a small percentage of cases progress to become cervical cancer, usually cervical squamous cell carcinoma (SCC), if left untreated. Another type of HPV-associated cervical malignancy is Adenocarcinoma in situ (AIS), the precursor of invasive adenocarcinoma. The major cause of CIN and AIS is chronic infection of the cervix with the sexually transmitted human papillomavirus (HPV), especially the high-risk HPV types 16 or 18. Over 120 types of HPV have been identified. About a dozen of these types appear to cause cervical dysplasia and may lead to the development of cervical cancer. Other types cause warts.

"Malignancy" is the tendency of a medical condition, especially tumors, to become progressively worse and to potentially result in death. Malignancy in cancers is characterized by anaplasia, invasiveness, and metastasis. Malignant is a medical term used to describe a severe and progressively worsening disease.

"Invasive cancer" is a large, heterogeneous class of diseases in which a group of cells display uncontrolled growth, invasion that intrudes upon and destroys adjacent tissues, and often metastasizes, wherein the tumor cells spread to other locations in the body via the lymphatic system or through the bloodstream. These three malignant properties of cancer differentiate malignant tumors from benign tumors, which do not grow

uncontrollably, directly invade locally, or metastasize to regional lymph nodes or distant body sites like brain, bone, liver, or other organs. Examples of invasive cancers induced by HPV infections may be cervix cancer, other genital cancers, such as penile cancer, vulveal cancer, anal cancer, head and neck cancers, and/or breast cancer.

One cancer form that is caused by high-risk Human papillomavirus (HPV) infections is cancers of the squamous epithelium including squamous cell carcinoma. Squamous epithelium is an epithelium characterized by its most superficial layer consisting of flat, scale-like cells called squamous epithelial cells. Squamous cell carcinoma (SCC or SqCC), is a histologically distinct form of cancer. It arises from the uncontrolled multiplication of malignant cells deriving from epithelium, or showing particular cytological or tissue architectural characteristics of squamous cell differentiation, such as the presence of keratin.

Squamous cell carcinoma is one of the most common cancers in humans and other animals, and usually arises from mutated ectodermal or endodermal cells lining body cavities. It may develop in a large number of organs and tissues, including the skin, lips, mouth, esophagus, urinary bladder, prostate, lung, vagina, and cervix, among others.

Thus the antibodies of the invention may be used in a method of diagnosing HPV- induced cancers of the epithelium including squamous cell carcinoma and

adenocarcinoma, in a subject. Accordingly, in one embodiment the invention relates to a method of diagnosing cancers of the epithelium including squamous cell carcinoma, and/or adenocarcinoma in a subject, wherein said method comprises a step of immunological detection of high-risk HPV E7 protein expression in vitro in a biological sample obtained from said patient by using a composition comprising one or more antibodies of the invention. Said composition of the invention may be useful for diagnosis and/or prognosis of a cancer of the squamous epithelium including squamous cell carcinoma, and/or adenocarcinoma. Said squamous cell carcinoma, and/or

adenocarcinoma is caused by an infection by a Human papillomavirus (HPV), and especially when the infection is caused by a high risk Human papillomavirus (HPV). The composition of the invention is particularly useful for the for diagnosis and/or prognosis when the infection is caused by a high risk Human papillomavirus (HPV) of the group consisting of Human papillomaviruses types 16, 18, 31 , 33, 35, 39, 45, 51 , 52, 56, 58, and 59, and especially infections caused by Human Papilloma viruses types 16, 18, 35 and/or 45.

In one specific embodiment of the invention the methods and uses as described herein may be used for the specific detection of HPV-16 induced malignancy. Such methods and uses comprises obtaining a biological sample isolated from a subject, contacting said sample with a composition comprising the mAb E716-41 :5, said composition being capable of specific interaction with the high-risk Human papillomavirus (HPV) 16 E7 protein, detecting an interaction between the antibody mAb E716-41 :5 and the high-risk Human papillomavirus (HPV) 16 E7 protein, wherein the detection of an interaction indicates the presence or absence of the high-risk Human papillomavirus (HPV)16 E7 protein in the biological sample, thereby allowing for e.g. detection of the high-risk Human papillomavirus (HPV) 16 E7 protein, detection of HPV-16 associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample, diagnosis, prognosis etc. according to any of the methods disclosed herein, the results of which one may determine if a subject is healthy, or is having HPV-16 associated pre-malignant lesions, malignant lesions and invasive cancer.

In one further embodiment of the invention the methods and uses as described herein may be used for the specific detection of HPV-18 induced malignancy. Such methods and uses comprises obtaining a biological sample isolated from a subject, contacting said sample with a composition comprising the mAb E718-79:1 , said composition being capable of specific interaction with the high-risk Human papillomavirus (HPV) 18 E7 protein, detecting an interaction between the antibody mAb E718-79:1 and the high-risk Human papillomavirus (HPV) 18 E7 protein, wherein the detection of an interaction indicates the presence or absence of the high-risk Human papillomavirus (HPV)18 E7 protein in the biological sample, thereby allowing for e.g. detection of the high-risk Human papillomavirus (HPV) 18 E7 protein, detection of HPV-16 associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample, diagnosis, prognosis etc. according to any of the methods disclosed herein, the results of which one may determine if a subject is healthy, or is having HPV-18 associated pre-malignant lesions, malignant lesions and invasive cancer.

Further aspects of the invention encompass a kit for in vitro diagnosing and/or prognosing cancer in a biological sample, said kit comprising:

i) means for detecting an antigen-antibody complex between a high-risk HPV E7 protein or fragment thereof present in the biological sample and said one or more antibodies or fragments thereof of the composition according to the invention

ii) instructions to use said means for detecting an antigen-antibody complex between an high-risk HPV E7 protein or fragment thereof present in the biological sample and said one or more antibodies or fragments thereof of the composition of the invention according to any of the methods described herein.

Thus, a further aspect of the invention provides a kit comprising means for detecting an antigen-antibody complex between a high-risk HPV E7 protein or fragment thereof present in the biological sample and said one or more antibodies or fragments thereof of the composition according to the invention.

Further, said kit may include positive or negative controls and control samples, such as biopsy material, blood, serum, urine, saliva, bone marrow, and cell population samples known to be diseased or healthy of the species to be analysed,. Further, said kit may include instructional materials disclosing, for example, use of the means for detecting an antigen-antibody complex between an high-risk HPV E7 protein or fragment thereof present in the biological sample and said one or more antibodies or fragments thereof of the composition according to the invention, or means of use for a particular reagent. The instructional materials may be written, in an electronic form (e.g., computer diskette or compact disk) or may be visual (e.g., video files). The kit may also include additional components to facilitate the particular application for which the kit is designed. Thus, for example, the kit can include buffers and other reagents routinely used for the practice of a particular disclosed method. Such kits and appropriate contents are well known to those of skill in the art.

The kit may further comprise, in an amount sufficient for at least one assay, the means for detecting an antigen-antibody complex between an high-risk HPV E7 protein or fragment thereof present in the biological sample and said one or more antibodies or fragments thereof of the composition according to the invention as described herein as a separately packaged reagent, as well as separate instructions for its use to selectively recognize an antigen-antibody complex between an high-risk HPV E7 protein or fragment thereof present in the biological sample and said one or more antibodies or fragments thereof of the composition according to the invention.

Instructions for use of the packaged reagent are also typically included. Such instructions typically include a tangible expression describing reagent concentrations and/or at least one assay method parameter such as the relative amounts of reagent and sample to be mixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions and the like.

Said kit may further include a carrier means, such as a box, a bag, a satchel, plastic carton (such as moulded plastic or other clear packaging), wrapper (such as, a sealed or sealable plastic, paper, or metallic wrapper), or other container.

In some examples, kit components will be enclosed in a single packaging unit, such as a box or other container, which packaging unit may have compartments into which one or more components of the kit can be placed. In other examples, a kit includes one or more containers, for instance vials, tubes, and the like that can retain, for example, one or more biological samples to be tested.

Other kit embodiments include, for instance, syringes, cotton swabs, or latex gloves, which may be useful for handling, collecting and/or processing a biological sample. Kits may also optionally contain implements useful for moving a biological sample from one location to another, including, for example, droppers, syringes, and the like. Still said kit may include disposal means for discarding used or no longer needed items (such as subject samples, etc.)- Such disposal means can include, without limitation, containers that are capable of containing leakage from discarded materials, such as plastic, metal or other impermeable bags, boxes or containers.

EXAMPLES

Example 1 : Cloning and expression of the HPV 1 , 6, 1 1 , 16, 18, 31 , 33, 35 and 45 E7 oncoproteins for mAb production, selection and characterization

Procedures for cloning and expression of a panel of high- and low-risk HPV E7 proteins, to be used for establishment and characterization of HPV E7 antibodies are described below. There are additional methods for expression of recombinant protein known to those skilled in the art and the invention is not restricted to the precise methods as disclosed herein.

Construction of GST E7 expression vectors

Complementary DNA (First-strand cDNA synthesis kit, GE Healthcare) prepared from mRNA (Quick prep micro mRNA purification kit, GE Healthcare) from cell lines Ca Ski (ATCC number CRL-1550) and HeLa (ATCC number CCL-2) was used as template for amplification of the coding region of the E7 genes of HPV 16 and 18 respectively using the primers listed below.

The forward (fwd) primers included a BamHI site and the reverse (Rev) primers included a EcoRI site. Approximately 100 ng of each cDNA, was used as template in a reaction mixture containing 0.5 μΜ of each primer, 75 mM Tris-HCI (pH 8.8 at 25°C), 20 mM (NH₄)₂S0₄, 0.1 % (v/v) Tween 20, 1 ,5 mM MgCI₂, 0.02 u/μΙ Taq-polymerase (Abgene,) and 0.1 mM of each deoxynucleotide in a final volume of 50 μΙ with the following temperature cycle repeated 30 times: 1 minute incubations at 95°C, 55°C and 72°C. The size and purity of the PCR products were checked by separation of 5 μΙ PCR product on 1 % agarose gel. PCR products were purified from primers and deoxynucleotides using QIA quick PCR purification kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturers instruction. The entire reading frames of HPV1 , 6, 1 1 , 31 , 33, 35 and 45 E7, flanked with BamHI/EcoRI restriction sites, were synthesized by GenScript

(Piscataway, NJ, US).

Purified PCR products and the expression vector pGEX-6P-3 (GE Helthcare) were digested with the restriction enzymes BamHI and EcoRI (GE Helthcare) and precipitated and ligated together according to standard procedures. The E7 ORFs were inserted in fusion with glutathione-S-transferase (GST) and the ligated DNA was transformed into £. coli BL21 (DE3)pl_ysS (Promega). Plasmid DNA was prepared using Wizard Plus

Minipreps DNA Purification System (Promega) and sequence verified clones were used for protein expression.

Expression and purification of recombinant E7 proteins

Clones expressing GST E7 protein were grown to OD600 = 0.8 were induced for 3 hours by the addition of isopropyl β-D-thiogalactoside (IPTG) to a final concentration of 0.1 M. Harvested bacteria were disrupted with lysozyme and the supernatant filtered through 0.2 μηη sterile filter (Millex GV, Millipore, Billerica, MA, USA). The recombinant E7-GST fusion proteins were bound to glutathione sepharose (Amersham Biosciences), washed and eluted with glutathione elution buffer (Amersham Biosciences). Prior to immunization, the GST tag was removed with PreScission protease (GE Healthcare) according to manufacturer's instructions. The concentration and purity of all protein preparations were determined by measuring the absorbance at 280 nm and by SDS PAGE (Invitrogen). All preparations gave a predominant band of the expected size (appox 38 kDa) in SDS PAGE, with only trace amounts of other proteins.

Establishment of hybridomas and monoclonal antibodies specific for high-risk HPV E7 oncoprotein

Monoclonal antibodies, mAbs, against high-risk HPV E7 were established by fusing B lymphocytes from immunized mice with a mouse myeloma cell line. High-risk specific antibodies were then selected by ELISA using a panel of high- and low-risk HPV E7 proteins. There are other methods known to those skilled in the art and the invention is not limited to the methods shown herein. Immunization of mice

Twelve-week-old female Balb/c mice (B&K Universal) were immunized with 25 μg recombinant HPV16 or HPV18 E7 oncoprotein in 100 μΙ of saline solution and 100 μΙ of Ribi Adjuvant (Corixa) by intraperitoneal injection followed by additional injections of 10 μg antigen together with adjuvant, every 3 - 4 weeks for two to five months. Serum antibody titres against rHPV E7 were continuously measured by ELISA. All animal experiments were performed in accordance with the Animal Welfare Ordinance and the Animal Welfare Act of Sweden and were approved by an animal experiments ethics committee (approval no. 310-2005 and 445-2008).

Fusion and cloning

B-lymphocytes from mice with high anti-E7 serum antibody titres were fused with mouse myeloma cell line P3X63Ag8.653 (ATCC: CRL-1580) essentially as described (de StGroth & Scheidegger, 1980). Hybridomas producing antibodies with reactivity to rHPV16 or 18 E7 proteins were selected by ELISA. The medium from individual hybridomas was incubated overnight in micro-titre wells coated with goat anti-mouse IgG (Jackson Immunoresearch Laboratories Inc.). After washing, the wells were then incubated with GST HPV16 E7 or GST HPV18 E7 protein for 2 h. An unrelated GST fusion protein was used as a negative control to exclude antibodies with reactivity to GST or the GST linker. Antigen binding was detected by incubations with, first, rabbit anti-GST (Z-5, Santa Cruz Biotechnology, Inc.) for 1 h and, finally, with HRP-conjugated swine anti- rabbit IgG (Dako) for 1 h. Following each incubation, the plates were washed three times in 5 mM Tris-HCI pH 7.8, 150 mM NaCI, 0.005 % Tween 20. Reactivity was measured at 450 nm after visualization with o-Phenylenediamine substrate (Sigma-Aldrich).

Hybridomas with reactivity to HPV16 or 18 E7 but not GST were saved.

The antibodies were cloned by limiting dilution and produced by in vitro cultivation in DMEM, 5% fetal bovine serum and 1 % DMEM supplement and purified by Protein A chromatography. This resulted in the monoclonal antibodies (mAb) that were deposited on 21 July, 201 1 at Health Protection Agency Culture Collections, Porton Down,

Salisbury SP4 0JG, United Kingdom and were given the following identification information: E716-41 :5 (Deposit reference 1 1072101 ), E716-81 :3 (Deposit reference

1 1072102), E718-68:1 (Deposit reference 1 1072103) and E718-79:1 (Deposit reference 1 1072104). Specificity in ELISA

The specificity of the mAbs was studied by ELISA against a panel of high-risk (HPV16, 18, 31 , 33, 35 and 45) and low-risk (HPV1 , 6 and 1 1 ) E7 proteins. The results are presented in figure 1 . mAb E716-41 :5 is specific to HPV16 E7, mAb E716-81 :3 reacts with both HPV16 and HPV35 E7. mAb E718-68:1 reacts with both HPV18 and HPV45 E7. mAb E718-79:1 is specific to HPV18 E7. Depending on the choice of antibodies the test can therefore detect only one or several of the HPV types 16, 18, 35 and/or 45.

Specificity in Western blot

The reactivity of the mAbs to the different HPV E7-types was further confirmed by Western blot analysis. Recombinant GST HPV E7 protein (1 ng/well) from HPV1 , 6, 1 1 , 16, 18, 31 , 33, 35 and 45 was prepared as described, separated on NuPAGE Bis-Tris and transferred to PVDF membranes (Bio-Rad) according to the manufacturer's instruction. After blocking the membranes overnight in 5 % non-fat dry milk, the E7- antibodies, also pre-incubated in 5 % non-fat dry milk, were added to the membrane at a concentration of 1-2 μg ml^"1 and incubated for 1 h. After three 15 min washes with TBS 0.2 % Tween 20, the secondary antibody, HRP-conjugated rabbit anti-mouse

immunoglobulin (Dako), was incubated with the membranes for 1 h. After another wash, antibody binding was visualized using chemiluminescent detection (ECL+, GE

Healthcare) according to the manufactures instruction. Control experiments with mouse anti-HPV16 E7 (TVG7104, Santa Cruz Biotechnology), goat anti-HPV18 E7 (N-19, Santa Cruz Biotechnology) and rabbit anti-GST (Z-5, Santa Cruz Biotechnology) were included to ensure protein content in the lanes. HRP-conjugated donkey anti-goat (Promega) and HRP-conjugated swine anti-rabbit (Dako) were used as secondary antibodies to the polyclonal antibodies.

MAb E716-41 :5 and E716-81 :3 stain HPV16 E7 strongly and HPV35 E7 weakly, and none of the other HPV E7 types. MAb E718-68:1 stains both HPV18 E7 and the closely related HPV45 E7 intensely. MAb E718-79:1 stains HPV18 E7 strong and HPV45 E7 weaker. None of the mAbs cross reacted with the GST tag or any of the low-risk strains (Figure 2).

Isotyping

Determination of isotypes (G1 , G2a, G2b, G3, M, A) was performed in an ELISA. MAb's were traced using isotype specific HRP-conjugated Polyclonal Ab's (Zymed

Laboratories). The isotyopes of the individual mAbs are presented in the table below. E716-41 :5 lgG1

E716-81 :3 lgG1

E718-68:1 lgG2a

E718-79:1 lgG2a

Example 2: Epitope mapping of the HPV E7 mAbs

The epitopes of the individual mAbs were identified by measuring the reactivity to overlapping fragments of HPV 16 and 18 E7 proteins displayed on phage particles in ELISA.

Cloning of fragments of HPV 16 and 18 E7 oncoprotein for display on phage particles

Fragments of HPV16 and 18 E7 were amplified from the constructed pGEX-6P-3 HPV E7 plasmid clones, using the primers given below. Approximately 10 ng of each cDNA, cloned into the expression vector pGEX-6P-3, was used as template in a reaction mixture containing 0.5 μΜ of each primer, 75 mM Tris-HCI (pH 8.8 at 25°C), 20 mM (NH₄)₂S0₄, 0.1 % (v/v) Tween 20, 1 ,5 mM MgCI₂, 0.02 u/μΙ Taq-polymerase (Abgene,) and 0.1 mM of each deoxynucleotide in a final volume of 50 μΙ with the following temperature cycle repeated 30 times: 1 minute incubations at 95°C, 55°C and 72°C. The size and purity of the PCR products were checked by separation of 5 μΙ PCR product on 2% agarose gel. PCR products were purified from primers and deoxynucleotides using QIA quick PCR purification kit (Qiagen, GmbH, Hilden, Germany) according to the manufacturers instruction. The fragments were cloned into one of three vectors: phage display vector f88-4 kindly provided by Professor G. P. Smith (University of Missouri, Columbia, US), vector M13KE (New England Biolabs) or, together with a recombinant phage gene pVIII, into the arabinose regulated vector pBAD/Myc-HisA (Invitrogen). The constructs were sequence verified according to standard techniques. Phage particles were amplified according to standard techniques and prepared with double polyethylene glycol precipitation. Phage particle concentration was calculated from the absorbance at 269 nm using the formula:

. . . (A26 -A320) x 6 x 10¹⁶ x dilution factor

Phage particles per ml = , _T . -————— :—

Number 01 nucleotides in the phage genome Primers for amplification of HPV16 E7 fragments

Primer Restriction E7

Sequence (5' to 3')

pair site fragment

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

1 ATGCATGGAGATACACCTACA

aa 1 -25

Rev aa

Eagl

25 CATG I I I CGGCCGA ATAACAGTAGAGATCAGTTG

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

13 TTAGA I I I G C AAC C AG AG AC A

aa 13-37

Rev aa

Eagl

37 CATG I I I CGGCCGA TTCATCCTCCTCCTCTGAGC

Fwd aa

CATAAGC I I I G CCTTAAATGACAG CTCAG AG GAG Hindlll

28

aa 28-47

Rev aa

G ATCTG CAG GTTCTG CTTGTC CAG CTG G AC Pstl

46

Fwd aa

CATAAGC I I I GCCGAAATAGATGGTCCAGCTG Hindlll

37

aa 37-53

Rev aa

GATCTGCAGTATTGTAATGGGCTCTGTCCG Pstl

53

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

38 ATAGATGGTCCAGCTGGACAA

aa 38-74

Rev aa CATG I I I CGGCCGA

Eagl

74 TACGTGTGTGC I I I GTACGCA

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

63 TCTACGCTTCGGTTGTGCGTA

aa 63-87

Rev aa CATG I I I CGGCCGA

Eagl

87 TAGTGTGCCCATTAACAGGTC

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

75 GACATTCGTAC I I I GGAAGAC

aa 75-98

Rev aa CATG I I I CGGCCGA

Eagl

98 TGG I I I CTGAGAACAGATGGG Primers for amplification of HPV18 E7 fragments

Primer Restriction E7

Sequence (5' to 3')

pair site fragment

Fwd aa

CATAAGC I I I GCCATGCATGGACCTAAGGCAAC Hindlll

1

aa 1 -22

Rev aa

G ATCTG CAG CCG G AATTTCATTTTG AGG CTC Pstl

22

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

1 1 ATTGTATTGCA I I I AGAGCC

aa 1 1 -35

Rev aa

Eagl

35 CATG I I I CGGCCGA CTCTGAGTCGCTTAATTGCTC

Fwd aa

GATAAGC I I I G C C GAG G AAG AAAAC G ATG AAATAG Hindlll

35

aa 35-64

Rev aa

G CG CTG CAG ACATACAC AACATTGTGTGACG Pstl

64

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

53 C GAG C C G AAC C AC AAC GTC AC

aa 53-78

Rev aa

Eagl

78 CATGTTTCGGCCGA GCTTTCTACTACTAGCTCAA

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

61 ATGTTGTGTATGTGTTGTAAG

aa 61 -87

Rev aa

Eagl

87 CATG I I I CGGCCGA CTGGAATGCTCGAAGGTCGTC

Fwd aa

CATAAGC I I I GCCGCTAGAATTGAGCTAGTAG Hindlll

70

aa 70-95

Rev aa

GATCTGCAGACGACAGGG I I I I CAGAAAC Pstl

95

Fwd aa CATGCCCGGGTACC I I I CTATTCTCACTCT

Kpnl

79 TCAGCAGACGACCTTCGAGCA

aa 79-105

Rev aa

Eagl

105 CATG I I I CGGCCGA CTGCTGGGATGCACACCACGG Phage ELISA

Maxisorp wells (Nunc A S) coated with goat anti-mouse IgG were incubated overnight with antibody-containing growth medium from individual hybridomas, followed by incubation with the phage clones displaying overlapping fragments of the E7 protein (Fig. 1 ). Bound phage particles were detected with a rabbit anti-M13 antibody (raised against M13 phage particles at Fujirebio Diagnostics AB) and HRP-conjugated swine anti-rabbit IgG (Dako). All incubations were followed by three washes in 5 mM Tris-HCI pH 7.8, 150 mM NaCI, 0.005 % Tween 20. Phage binding was visualized with HRP substrate Enhance K-Blue (Neogen) and the binding pattern for each mAb was used to determine the approximate epitopes of the mAbs. The fragments and the antibody binding are illustrated in figure 3.

MAbs E716-41 :5 and E716-81 :3 only reacted to fragment aa 1 -25 of HPV 16 E7, mapping the epitopes of both mAbs to the N-terminal of HPV16 E7. Since no binding was seen for the other fragments, including aa 13-37, the epitope is located to approximately aa 1 -13.

E718-68:1 only reacted with fragment 35-64 of HPV18 E7, and not with the overlapping peptide aa 53-78 or any other fragments. This locates the epitope to aa 35-53. E718-79:1 only bound the aa 1 1 -35 fragment. Since no binding was detected with aa 1 -22, most of the epitope of the mAb is located within aa 22-35.

Example 3: Epitope mapping using 12-mer overlapping HPV16 E7 peptides.

The entire ORF of HPV16 E7 was displayed, as 12-mers, overlapping by 8 aa, in fusion with Glutathione S-transferase and was used to map the epitopes of antibodies E716- 41 :5 and E716-81 :3. Epitope mapping of the monoclonal antibodies was done using libraries generated in the pEPX1 vector in which the peptides were expressed as extensions of Sj26GST. Colonies from a frozen stock were diluted in fresh LB broth supplemented with ampicillin

(100 μgm ¹) and plated out onto an LB agar plate to obtain single colonies. All plates in the subsequent procedure contained 100 μgm ¹ ampicillin. 135 of the colonies obtained were streaked onto duplicate 14 cm LB agar plates in a grid pattern and allowed to grow at 37° C overnight. A sterile nitrocellulose filter that had been cut to the appropriate size and moistened was placed onto one of the two plates. After two minutes the filter was carefully lifted and placed colony side up on a fresh LB agar plate supplemented with IPTG to a final concentration of 1 mM. Two colony lifts were performed from a single plate. The cells on the nitrocellulose filters were grown overnight at 37° C. The filters were then treated according to standard methods for lysis of the cells and preparation for detection of clones binding to the monoclonal antibodies. The filters were incubated first with the monoclonal antibody and then with a secondary goat anti-mouse IgG conjugated to horseradish peroxidase. Positive clones were then visualized using 2-chloronaphthol and hydrogen peroxide.

Clones giving a clear signal were picked from the duplicate plate and plasmids were prepared. The sequences of the inserts in the individual plasmids were determined by sequencing from the 26SjGST gene using the primer sequence 5'-

CATGGCCTTTGCAGGGCTGGC-3'.For monoclonal antibodyE716- 41 :5 three sequences were isolated all of which contained the consensus HEYM, corresponding to aa 9-12 of the HPV16 E7 sequence, identifying this sequence as that recognized by the antibody. Two sequences were isolated for E716-81 :3, both containing the sequence TPTLHEYM corresponding to aa 5-12 of the HPV16 E7 sequence.

Example 4: Mimotope identification using a random peptide library displayed on phage

The epitope of mAb E716-41 :5 was further characterized using a random 7-mer peptide library displayed on phage particles. By selecting and sequencing phage clones with high affinity to the antibodies, amino acids essential for binding were identified , and thereby revealing the antibody mimotope. Using sequence analysis, the data could be used to verify the epitope mapping and specificity of the antibodies.

E716-41 :5, captured by incubation overnight in Maxisorp plates (Nunc) coated with goat anti-mouse IgG (Jackson Immunoresearch Laboratories), was panned against a randomized 7-mer peptide library displayed on phage (Ph. D.-7 phage peptide library, New England Biolabs, Beverly, MA, US). We preincubated 10 μΙ (containing 4 10¹⁰ phage particles) of the original library diluted in 100 μΙ of TBS (50 mM Tris-HCI pH 7.5, 150 mM NaCI) 0.1 % Tween 20 in Maxisorp plates coated with goat anti-mouse IgG for negative selection which was added to the E7 antibody-coated wells. After gentle rocking for 1 h the wells were washed 10 times with TBS 0.1 % Tween 20. Bound phage particles were eluted with 0.2 M glycine-HCI, 1 mg/ml BSA (pH 2.2) and amplified in E.coli ER2738 according to the manufacturer's instructions. Approximately 1 -2 ^χ 10¹¹ of amplified phage were used in subsequent rounds of panning. Four rounds of biopanning of the randomized phage library against the mAbs were sufficient for selection of phage clones with high affinity for each antibody. Nine phage clones selected to bind each mAb were amplified in E.coli and ssDNA was prepared and sequenced according to standard techniques.

The consensus sequences was HE Y/F corresponding to aa 9 to 1 1 of the HPV16 E7 amino acid sequence, confirming the previous epitope mapping results (examples 2 and 3). This sequence is unique for the HPV16 E7 and not present in other HPV-types, thereby confirming the specificity results (example 1 ).

Example 5: Detection of high-risk E7 by Western blot analysis

The mAbs of the invention detect the endogenous E7 protein without cross-reactivity to other cellular proteins

Cervical cancer cell lines CaSki, HeLa and C33A were lysed by freeze-thawing in PBS containing 1 % Triton X-100, 1 mM DTT, 0.2 mM PMSF, 1 mM NaF and Complete EDTA- free protease inhibitor cocktail (Roche Diagnostics). Cell debris was removed by centrifugation and the protein concentration of the supernatants was determined by the Bio-Rad protein assay kit I (Bio-Rad).

Cell lysates (50 μg protein/lane) were separated on NuPAGE Bis-Tris and transferred to PVDF membranes (Bio-Rad) according to the manufacturer's instruction. After blocking the membranes overnight in 5 % non-fat dry milk, the E7-antibodies, also pre-incubated in 5 % non-fat dry milk, were added to the membrane at a concentration of 1-2 μg ml^"1 and incubated for 1 h. After three 15 min washes with TBS 0.2 % Tween 20, the secondary antibody, HRP-conjugated rabbit anti-mouse immunoglobulin (Dako), was incubated with the membranes for 1 h. After another wash, antibody binding was visualized using chemiluminescent detection (ECL+, GE Healthcare) according to the manufactures instruction. Control experiments with mouse anti-HPV16 E7 (TVG7104, Santa Cruz Biotechnology) and goat anti-HPV18 E7 (N-19, Santa Cruz Biotechnology) were included. HRP-conjugated donkey anti-goat (Promega) was used as secondary antibody to the polyclonal antibody.

MAbs E716-41 :5 and E716-81 :3 stain a protein of the expected size (10.9 kDa) in lysate of HPV16 E7-expressing CaSki cells, with no or weak cross reactivity to cellular proteins or HPV18 E7 in the HeLa lysate. MAbs E718-68:1 and E718-79:1 stain a protein of the expected size (1 1.7 kDa) in lysate of HPV18 E7 expressing HeLa cells with no cross reactivity to other cellular proteins or HPV16 E7 in CaSki cell lysate (Figure 2) proving that the antibodies are E7 specific and recognize the denatured endogenous E7 protein. Example 6: Detection of high-risk E7 by Immunocytochemistry

The mAbs E716-41 :5, E716-81 :3, E718-68:1 and E718-79:1 detect the E7 protein in immunocytochemistry on formalin fixed cells and cells stored in Thinprep Liquid Based Cytology (LBC) fluid. The mAbs were carefully evaluated against cervical cancer cell lines CaSki, HeLa and C-33A.

The cells were either fixed for 10 minutes in 10% Neutral buffered formalin on the slide or stored in Thinprep LBC solution (Cytyc) prior to mounting on slides. The slides were treated with 0.3 % Triton X-100 in TBS for 15 min and endogenous peroxidases were blocked with 1 % hydrogen peroxide in TBS 0.05 % Tween 20 for 5 min. The slides were incubated with the mAbs diluted in antibody diluent (Dako), for 1 h. Antibody binding was visualized by the REAL EnVision Detection system and diaminobenzidine (Dako). Cells were counterstained with Mayer's hematoxylin (Dako) to facilitate identification of cell morphology. All incubations were done at room temperature.

The mAbs E716-41 :5, E716-81 :3, E718-68:1 and E718-79:1 stain target cells without cross reactivity to HPV negative control cells. The cells can be stored in LBC media for at least 6 month without loss of signal or adding background. To mimic a clinical sample with only a proportion of HPV infected cells, HeLa and CaSki cells were mixed with HPV negative cervical cancer cells. The antibodies according to the invention were capable of detecting single cervical cancer cells in a background of uninfected C33A cells (Figure 4). Since the antibodies detect cervical cancer cells of both adenocarcinoma cell lines e.g. HeLa and cell lines of squamous origin e.g. CaSki, the antibodies have the potential to be used for the detection of malignancies of both squamous and glandular origin.

The mAbs E716-41 :5 and E718-79:1 detect abnormal cells in clinical samples from patients diagnosed with different severity of CIN, while normal epithelial cells in both normal and CIN patient samples are unstained. Figurel O.

Example 7: Detection of high-risk HPV E7 by immunohistochemistry

Protocols for the use of the mAbs in Immunohistochemistry (IHC) were evaluated, first against formalin fixed paraffin embedded (FFPE) cell clots and then against cervical cancer tissue arrays.

The IHC protocols were optimized using FFPE fibrin cell clots prepared from cervical cancer cell lines, to mimic HPV positive and negative cervical cancer tissue samples. Cells were mixed with human plasma (Sigma-Aldrich) and clotted for 10 min by adding thrombin from bovine plasma (Sigma-Aldrich). The cell clot was fixed in 10 % NBF at room temperature for 4 h and washed in PBS. The fixed clot was dehydrated, paraffin embedded and cut according to standard procedures (HistoCenter, Vastra Frolunda, Sweden).

The FFPE sections and cervical cancer tissue arrays (Biomax) were deparaffinized in xylene and absolute ethanol and rehydrated in 95 % ethanol, 70 % ethanol and distilled water. The slides were boiled for 10 minutes in 10 mM Citrate pH6.0 in a microwave oven. Immunostaining was done as described above. Endogenous peroxidases were blocked with 3 % hydrogen peroxide in TBS 0.05 % Tween 20 for 5 min.

The mAbs established and characterized according to the methods disclosed in the current invention showed specific staining of HPV E7 in cervical cancer sections of both adenocarcinoma and SCC (Figure 5).

Example 8: Detection of high-risk HPV E7 in cell lysates or body fluids using sandwich immunoassays

Identification of ELISA pairs

The HPV18 E7 antibodies were evaluated in sandwich ELISA with mAb E718-38:2 a mAb reacting with aa 35-53 of HPV18 E7. As expected from the mapping results, E718- 68:1 and E718-38:2 cannot bind the HPV18 E7 protein at the same time and form an EIA pair. E718-79:1 can be used in an ELISA with either E718-38:2 or E718-68:1 (Figure 6).

Design of sandwich immunoassays

The sandwich immunoassays for determination of HPVE7 were designed as described below. The catcher antibodies were biotinylated with 5-molar excess of biotin-N- succinimide caproate ester in 0.1 M NaHC0₃, pH 8.5 for two hours. The tracer antibodies were horse radish peroxidase (HRP) conjugated. HRP type VI was activated with Nal0₄ and incubated with the antibodies for two hours. After stabilization with NaBH₄, the antibodies were purified on gel chromatography.

Streptavidin coated wells were incubated with the sample (25 μΙ) in duplicates together with biotinylated catcher antibody (100 μΙ) for 2 h. The plates were washed 3 times and incubated with HRP conjugated tracer antibody (100 μΙ) for 1 h. The plates were washed six times and HRP substrate (Enhance K-blue, Neogen) was added for 30 min. 100 μΙ 0.12 M hydrochloric acid was added to the wells and the optical density at 450 nm was determined in a Vmax microplate reader (Molecular devices).

A linear dose response was seen with recombinant E7 protein (Figure 7) Specificity of the HPV E7 immunoassays.

The assays detected high-risk E7 in HPV-positive cell lines without reactivity to HPV negative cells (C33A). MAb E716-41 :5 in combination with mAb E716-9:1 , established at Fujirebio Diagnostics against aa 44-48 of HPV16 E7 protein, in shown in figure 8. Example 9: Detection of high-risk HPV E7-expressing cells using flow cytometry

The mAbs detect E7-expressing cells in flow cytometry.

Cervical cancer cell lines CaSki, HeLa and C33A and exfoliated cervical cells were fixed in Thinprep LBC fluid. To mimic a clinical samples with only a small proportion of HPV- infected cells, HPV E7-expressing cellines were mixed with HPV negative cervical cancer cellines or cervical scrapes from healthy individuals. The cells were permeabilized using Fix/Perm buffer (eBioscience, CA, US) and incubated with the biotinylated HPV16 or 18 mAb and APC-streptavidin (BD, NJ, US). In flow cytometry, down to 0.1 % of HPV E7 positive cells can be detected using the mAbs. (Figure 1 1 )

Claims

1 . A composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 , or antigen binding fragments thereof, wherein said antibodies are capable of specific binding to one or more epitopes located within the N- terminal fragments of human high-risk Human papillomavirus (HPV) E7 proteins comprising amino acid residues 1 to 13 from HPV16 E7 protein (SEQ ID NO:3) , and/or 22-53 from HPV18 E7 protein (SEQ ID NO:4).

2. The composition according to claim 1 , wherein the monoclonal antibodies (mAbs) E716-41 :5 and E716-81 :3, or antigen binding fragments thereof are capable of specific binding to an epitope comprising 3 or more amino acid residues of the amino acid sequence MHGDTPTLHEYML (SEQ ID NO:3); and the monoclonal antibody (mAb) E718-79:1 , or antigen binding fragment thereof is capable of specific binding to an epitope comprising three or more amino acid residues of amino acid sequence

3. The composition according to claim 1 , comprising the monoclonal antibody (mAb) E716-41 :5 or antigen binding fragment or recombinant protein thereof is capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence HEYM (SEQ ID NO:5).

4. The composition according to claim 1 , comprising the monoclonal antibody (mAb) E716-81 :3 or antigen binding fragment or recombinant protein thereof is capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence TPTLHEYML (SEQ ID NO:6).

5. The composition according to claim 1 , comprising the monoclonal antibody (mAb) E718-79:1 or antigen binding fragment or recombinant protein thereof is capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence PVDLLCHEQLSDSE (SEQ ID NO:7).

6. The composition according to claiml , comprising the monoclonal antibody (mAb) E718-68:1 or antigen binding fragment or recombinant protein thereof is capable of specific binding to an epitope comprising 3 or more amino acid residues of amino acid sequence EEENDEIDGVNHQHLPARR (SEQ ID NO:8).

7. The composition according to any one of claims 1 -6, wherein hybridomas producing said monoclonal antibodies (mAb) have been deposited on 21 July, 201 1 at Health Protection Agency Culture Collections, Porton Down, Salisbury SP4 OJG, United

Kingdom wherein E716-41 :5 has Deposit reference 1 1072101 ; E716-81 :3 has Deposit reference 1 1072102; E718-68:1 has Deposit reference 1 1072103; and E718-79:1 has Deposit reference 1 1072104.

8. A method for in vitro detection of a high-risk HPV E7 protein in a biological sample, said method comprising the steps of

b) detecting said antigen-antibody complex; and

9. The method of claim 8, wherein the positive control comprises a high-risk HPV E7 protein.

10. The method of claim 8, wherein the negative control does not comprise a high-risk HPV E7 protein.

1 1. A method for in vitro detection of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample, said method comprising the steps of a) contacting a composition comprising one or more of the monoclonal antibodies (mAb) E716-41 :5, E716-81 :3, E718-79:1 or E718-68:1 or fragments thereof with the biological sample, wherein one or more of the antibodies or fragments thereof bind specifically to a high-risk HPV E7 protein or fragment thereof present in the biological sample, thereby forming an antigen-antibody complex between the a high-risk HPV E7 protein or fragment thereof and said one or more antibodies or fragments thereof; and

b) detecting said antigen-antibody complex; and

12. A method for in vitro diagnosing and/or prognosing HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample, said method comprising the steps of

b) detecting said antigen-antibody complex; and

13. An in vitro method for predicting outcome of treatment in a subject diagnosed with HPV-associated pre-malignant lesions, malignant lesions and invasive cancer, said method comprising the steps of

b) detecting said antigen-antibody complex; and

14. An in vitro method of assessing efficacy of treatment of HPV-associated pre- malignant lesions, malignant lesions and invasive cancer in a subject, said method comprising the steps of

b) detecting said antigen-antibody complex; and

15. A method for in vitro assessment of recurrence of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject, said method comprising the steps of

b) detecting said antigen-antibody complex; and

16. The method according to any one of claimsl 1 -15, wherein the positive control comprises high-risk HPV E7 protein from a subject suffering from HPV-associated pre- malignant lesions, malignant lesions and/or invasive cancer.

17. The method according to any one of claims 1 1-15, wherein the negative control does not comprise high-risk HPV E7 protein from a subject suffering from HPV-associated pre- malignant lesions, malignant lesions and/or invasive cancer.

18. The method according to any one of claims 1 1- 17, wherein HPV-associated pre- malignant lesions, malignant lesions and invasive cancer is a cancer of the group consisting of cervix cancer, penile cancer, vulveal cancer, anal cancer, head and neck cancers, and/or breast cancer.

19. The method according to any one of claims 1 1-18, wherein HPV-associated pre- malignant lesions, malignant lesions and/or invasive cancer are squamous cell carcinoma (SCC) or adenocarcinoma.

20. The method according to claim 19, wherein the squamous cell carcinoma (SCC) or adenocarcinoma is caused by an infection by high-risk Human papillomavirus (HPV).

21. The method according to claim 20, wherein the high risk an Human papillomavirus (HPV) is of the group consisting of Human Papilloma viruses types 16, 18, 35 and 45.

22. The method according to any one of claims 8-21 , wherein the biological sample is a tissue, tissue sample, or cell sample, and/or a biopsy sample.

23. The method according to any one of claims 8-22, wherein the biological sample is a aspiration biopsy, a brush biopsy, a surface biopsy, a needle biopsy, a punch biopsy, an excision biopsy, an open biopsy, an incision biopsy or an endoscopic biopsy, tumor, and/or tumor sample,

24. The method according to any one of claims 8-23, wherein the biological sample is a bodily fluid, lysates of cells or tissue, cervical washing fluids, cervical secretions, cervical lavage exfoliated cells blood, and/or serum .

25. The method according to any one of claims 8-24, wherein the detecting step comprises detection by means of an immunochemical detection method.

26. The method according to any one of claims 8- 24, wherein the immunochemical detection method is of the group consisting of ELISA, immunocytochemistry,

immunohistochemistry, immunoprecipitation, Western blots, chromatography and flow cytometry.

27. The method according to any one of claims 8-26, wherein hybridomas producing said monoclonal antibodies (mAb) have been deposited on 21 July, 201 1 at Health Protection Agency Culture Collections, Porton Down, Salisbury SP4 OJG, United Kingdom wherein E716-41 :5 has Deposit reference 1 1072101 ; E716-81 :3 has Deposit reference

1 1072102; E718-68:1 has Deposit reference 1 1072103; and E718-79:1 has Deposit reference 1 1072104.

28. Use of a composition according to claims 1 -7, for the in vitro detecting a high-risk HPV E7 protein in a biological sample.

29. Use of a composition according to claims 1 -7, for the in vitro detection of HPV- associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample

30. Use of a composition according to claims 1 -7, for the in vitro diagnosing and/or prognosing HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a biological sample

31. Use of a composition according to claims 1 -7, for the in vitro method for predicting outcome of treatment in a subject diagnosed with HPV-associated pre-malignant lesions, malignant lesions and invasive cancer

32. Use of a composition according to claims 1 -7, for the in vitro assessment of the efficacy of treatment of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject

33. Use of a composition according to claims 1 -7, for the in vitro assessment of recurrence of HPV-associated pre-malignant lesions, malignant lesions and invasive cancer in a subject

34. A kit for in vitro diagnosing and/or prognosing cancer in a biological sample, said kit comprising means for detecting an antigen-antibody complex between an high-risk HPV

E7 protein or fragment thereof present in the biological sample and said one or more antibodies or fragments thereof of the composition according to any one of claims 1 -7.

35. The kit of claim 33, further comprising a positive and/or a negative control.

36. The kit according to any of claims 34-35, further comprising instructions to the method according to any of claims 8-27.