WO2013037066A1

WO2013037066A1 - Ocab-based tools for screening of therapeutic agents, treating and diagnosing heart disease associated with cardiac remodeling

Info

Publication number: WO2013037066A1
Application number: PCT/CA2012/050638
Authority: WO
Inventors: Frédéric PICARD; Sophie Carter; Jacques Couet
Original assignee: UNIVERSITé LAVAL
Priority date: 2011-09-14
Filing date: 2012-09-14
Publication date: 2013-03-21

Abstract

It is shown herein that the expression of the OcaB protein is modulated, in cardiomyocytes, during cardiac remodeling (e.g., heart mypertrophy and/or fibrosis) and aging. The present application thus provides methods of characterizing an individual susceptibility to develop a heart disease associated with cardiac remodeling, methods of diagnosing a heart disease associated with cardiac remodeling in an individual, methods of characterizing the effectiveness of an agent in the treatment, prevention or alleviation of symptoms of heart disease associated with cardiac remodeling in an individual, screening methods to identify agents useful in the treatment, prevention or alleviation of symptoms of heart disease associated with cardiac remodeling based on the assessment of a parameter of an OcaB-based reagent.

Description

OCAB-BASED TOOLS FOR SCREENING OF THERAPEUTIC

AGENTS, TREATING AND DIAGNOSING HEART DISEASE ASSOCIATED WITH CARDIAC REMODELING

CROSS-REFERENCE TO RELATED APPLICATIONS AND DOCUMENTS

This application claims priority from U.S. provisional patent application 61/534,520 filed on September 14, 201 1 and incorporated herewith in its entirety.

This application contains a sequence listing submitted herewith electronically. The content of this sequence listing is incorporated by reference in this application.

The documents referred to in this patent application are incorporated herewith in their entirety.

BACKGROUND

Cardiac aging is characterized with loss of aortic elasticity, left ventricular hypertrophy and fibrosis, leading to diastolic dysfunction and heart failure, which is the most common cause for hospitalization for individuals over 65 years old. Although part of heart failure can be explained by age-associated co-morbidities, such as coronary disease, hypertension and diabetes, defects in the myocardium per se also contribute to cardiac aging. However, the molecular mechanisms that are involved in these processes are not well understood.

Changes in myocardial structures are important upon aging, as they represent long- term adaptive responses to increased hemodynamic load due to peripheral arterial stiffness. In normal conditions, such as physical training, cardiomyocyte hypertrophy normalizes the tension in cardiac wall tension when the heart is challenged, which is in part mediated by the transcription factor C/ΕΒΡβ. However, hypertrophy induced by cardiac injury (infarction) or chronic wall stress is associated with an increased risk for the development of heart failure. Not only cardiomyocytes become bigger in size, but they also feature a rearrangement in sarcomere organization and an exacerbated protein synthesis. Changes in cardiac structures can also be attributed to modifications in the ratio between cell proliferation, senescence, and apoptosis. Indeed, despite a reduction in the total number of cardiomyocytes upon aging, the weight of the heart increases, which illustrates the extent by which robust modifications in the extracellular matrix also occurs. Recent studies highlighted the fact that cardiac hypertrophy is clearly associated with profound alterations in gene expression profiles.

Many possible cardiomyocyte-dependent and -independent pathways for hypertrophy have been suggested. One of them is the calcium-stimulated calcireurin-Nuclear factor of activated T cells (NFAT) signaling pathway. Upon activation in T lymphocytes, it triggers the expression of genes involved in inflammation, such as interleukin(IL)-2, whereas in cardiomyocytes, it stimulates massive cardiac enlargement due to a reprogramming of gene expression mimicking a fetal-like status. Based on these findings, many calcireurin inhibitors are currently in development, but their use has been so far hindered by their non-specificity among tissues. Other proposed but unestablished mechanisms in development against cardiac remodeling include reduction in inflammation (notably reduction in cytokine production), modulation of the NO-cGMP-PKA pathway, and antioxidants.

Fibrosis is a hallmark of aging in many tissues such as the liver, the lung, and the kidney. Interstitial fibrosis and collagen deposition in the heart has also been shown in animal models and in humans, in which they result in cardiac stiffness and impaired relaxation, leading to diastolic dysfunction. Not surprisingly, in part due to fibrosis, left ventricular filing is altered with aging, which impairs tolerance to physical exercise. Cardiomyofibroblasts show modifications in their phenotype towards stimulated migratory, secretory and proliferative properties. In these cells, the overproduction of profibrotic growth factors such as insulin-like growth factor (IGF)-1 and TGFp, a validated marker of cardiac fibrosis, contributes in large parts to an increase in the turnover of cardiac extracellular matrix. The origins of these modifications are not well understood. Fibroblasts are involved in cardiac repair and remodeling after infarction and in the development of cardiac fibrosis. One of their possible roles in thickening of the extracellular matrix around hypertrophied cardiomyocytes is the modulation of nutrient supply, which could trigger cell death. This would in turn stimulate an intense inflammatory reaction, including overproduction of IL-4 and IL-13, and possibly MCP-1 , which would further exacerbate fibrosis. Indeed, inflammation now appears as a key contributor that leads to cardiac dysfunction upon aging.

In addition, advanced age is associated with defects in several aspects of the immunity response, including cell types, number of cells, function of cells, and activation. B cells infiltrate the vascular system upon hypertension. However, there is very few information about lymphocytes in the myocardium during the life span of an individual. Clues in this area are suggested by the established cardiomyopathies associated with acquired immunodeficiency. Patients with human immunodeficiency virus (HIV) have diffused left ventricular hypokinesis and decreased fractional shortening, left ventricular diastolic impairment. Thus, in both aging and immunodeficiency, reduced immunity response appears to directly affect heart function.

Peroxisome proliferator-activated receptors (PPAR) are a subgroup of nuclear receptors that have pleiotropic biological activities. Ligand binding induces changes in PPAR structural conformation, which facilitates the exchange of cofactors required for proper modulation of transcription. All activated PPAR form heterodimers with the rexinoid X receptor (RXR) to modulate transcription. The PPAR/RXR/cofactor complex controls the expression of target genes that contain direct repeats of the consensus AGGTCA sequence, interspaced with one nucleotide, called PPAR response elements (PPRE). Three PPAR isoforms have been identified so far: PPARa, PPARv (isoforms 1 and 2, the latter being exclusive to adipocytes) and PPARp/δ. Early reports showed that PPARvl is highly expressed in adipose tissue, large intestine, spleen and hematopoietic cells, which pointed to a role in the immune system, and moderately in the heart. Indeed, PPARv is now recognized as the master regulator of lipid metabolism in adipocytes and hematopoietic cells. PPARv increases the expression of genes that promote differentiation of new fat cells (adipocytes) and fatty acid storage, such as fatty acid binding protein (or aP2), lipoprotein lipase, acyl-CoA synthetase and phosphoenol pyruvate carboxykinase. PPARv stimulates gene expression of insulin- sensitizing adipokines, such as adiponectin, by directly binding to specific PPRE in their respective promoters. PPARv can be slightly activated by fatty acids and their derivatives and strongly by synthetic anti-diabetic thiazolidinediones (TZD).

The reduction in insulin sensitivity upon aging is related to the accumulation of fat. Aging is associated with increased synthesis and uptake of fatty acids, whereas fatty acid oxidation in muscle is reduced, leading to lipid accumulation not only targeting adipose tissue but non-adipose tissues as well, including bone marrow and the heart. It has been shown that, in adipocytes, increased fat accretion is due to an enhanced PPARv activity. However, the molecular mechanisms responsible for age-induced adipogenesis, fat accumulation and insulin resistance are not fully determined, especially in middle-aged individuals in which cardiometabolic diseases are developing. It has also been shown that PPARY is expressed in mouse and human B lymphocytes. Mice heterozygous for PPARy (+/-) have exacerbated B cell proliferation and reduced apoptosis compared to that of wild-type littermates. This suggests that PPARy and B cell activity are modulated in an opposite manner. Although this issue is controversial, several reports have shown that activation of PPARy activity by synthetic agonists induce cardiac hypertrophy in mice and in humans. This effect could be due to increased drug-induced fluid retention, which would exacerbate volume stress on the heart. However, direct impacts of PPARy agonists have been demonstrated in cardiomyocytes, since transgenic mice expressing PPARy, specifically in these cells through cardiac-a-myosin heavy chain (a-MHC), developed dilated cardiomyopathy associated with increased lipid uptake and storage. On the other hand, deletion of cardiac PPARy by targeted gene knockout also leads to cardiac hypertrophy, which is possibly caused by increased NFkB-induced inflammation and oxidative stress. This dual effect of PPARy (overexpression versus absence) may be related to the distorted impact on cell proliferation and apoptosis when deleted, which results in an overall change in tissue phenotype that affects subsequent responses, versus an altered energy metabolism when overexpressed in the setting of normal tissue composition. However, other pathways could be involved in the effects of PPARy in the heart, including PPARy-stimulated formation of adipocytes and adipose tissue. Myo-, epi-, and pericardiac fat have indeed been identified as major contributors of heart dysfunction.

It would be highly desirable to be provided with a novel therapeutic target associated with heart disease. This therapeutic target could be used to design novel therapeutic approach to prevent, treat and/or alleviate the symptoms of heart disease. Such novel therapeutic target could be used to assess heart disease onset or progression in an individual. Such assessment can be useful to engage early treatment to prevent/delay the onset of heart disease.

SUMMARY

The present application identifies a marker, OcaB, whose expression is downregulated before or during heart disease. This marker can be used in various diagnostic methods as well as in screening assays. The modulation of expression of this marker can also provide therapeutic effects. According to a first aspect, the present application provides a method of preventing, treating and/or alleviating the symptoms of a heart disease associated with cardiac remodeling in an individual in need thereof, said method comprising administering to the individual an effective amount of an agent capable of increasing the expression of an ocab nucleic acid and/or the activity of an OcaB polypeptide, thereby preventing, treating and/or alleviating the symptoms associated with the heart disease in the individual. In an embodiment, the individual is a human. In another embodiment, the agent is a nucleotide encoding an OcaB polypeptide. In still another embodiment, the agent is the OcaB polypeptide. In a further embodiment, the agent is administered to a cardiomyocyte. In yet another embodiment, the heart disease is associated with a heart hypertrophy and/or a heart fibrosis.

According to a second aspect, the present application provides an agent capable of increasing the expression of an OcaB nucleotide and/or the activity of an OcaB polypeptide for the prevention, the treatment and/or the alleviation of symptoms of a heart disease associated with cardiac remodeling in an individual. In an embodiment, the individual is a human. In another embodiment, the agent is a nucleotide encoding an OcaB polypeptide. In still another embodiment, the agent is the OcaB polypeptide. In a further embodiment, the agent is for administration to a cardiomyocyte. In yet another embodiment, the heart disease is associated with a heart hypertrophy and/or a heart fibrosis.

According to a third aspect, the present application provides a method of characterizing an agent's ability to prevent, treat and/or alleviate the symptoms of a heart disease associated with cardiac remodeling. Broadly, the method comprises combining the agent with an OcaB-based reagent; measuring a parameter of the OcaB-based reagent in the presence of the agent to provide a test value and comparing the test value with a control value to determine if the test value is higher than, equal to or lower than the control value, wherein the control value is associated with a lack of prevention, treatment and/or alleviation of the symptoms of the heart disease. The agent is then characterized as having the ability to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is higher than the control value; and lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is lower than or equal to the control value. In an embodiment, the control value is at least one of: the parameter of the OcaB-based reagent in the absence of the agent, the parameter of the OcaB-based reagent in the presence of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value. In another embodiment, the OcaB-based reagent is an OcaB polypeptide. In still another embodiment, the OcaB-based reagent is the level of expression of the OcaB polypeptide. In another embodiment, the parameter of the OcaB-based reagent is the level of activity of the OcaB polypeptide and, in still another embodiment, the level of activity is a measure of the level of formation of a complex between the OcaB polypeptide and at least one of the following partners: Oct-1 , Oct-2, SRC-1 , RXR and PPARv. In still a further embodiment, the level of activity is a measure of the level of expression of at least one of the following genes: aP2, LPL, PPARv, Glut4, ATGL, adiponectin, leptin, C/EBPa, perilipin, PEPCK, resistin, PELP1 , E2F1 , HSL, SREBPI c, C/ΕΡΒβ, skeletal actin, β-myosin heavy chain, SPTLC1 , MCAD and/or TGFp. In another embodiment, the OcaB-based reagent is a polynucleotide encoding an OcaB polypeptide. In yet another embodiment, the parameter of the OcaB-based reagent is the level of expression of the polynucleotide encoding the OcaB polypeptide. In a further embodiment, the OcaB-based reagent is in a cell, such as, for example, cardiomyocyte. In yet another embodiment, the heart disease is associated with a heart hypertrophy and/or a heart fibrosis.

According to a fourth aspect, there is provided a software product embodied on a computer readable medium and comprising instructions for characterizing an agent's ability to prevent, treat and/or alleviate the symptoms of a heart disease associated with cardiac remodeling. The product comprises a receiving module for receiving a test value of a parameter of an OcaB-based reagent in the presence of the agent; a comparison module for determining if the test value is lower than, equal to or higher than a control value and generating a corresponding output, wherein the control value is associated with a lack of prevention, treatment and/or alleviation of the symptoms of the heart disease; and a characterization module receiving the corresponding output from the comparison module and adapted to determine the ability of the agent to prevent, treat and/or alleviate the symptoms of the heart disease. The agent is characterized as able to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is higher than the control value. Alternatively, the agent is characterized as lacking ability to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is equal to or lower than the control value. In an embodiment, the control value is at least one of: the parameter of the OcaB-based reagent in the absence of the agent, the parameter of the OcaB-based reagent in the presence of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value. Various embodiments of the OcaB-based reagent and the parameters of the OcaB-based reagent are disclosed herein and can be applied in this software product. Various embodiments of the heart disease are disclosed herein and can be applied in this software product.

According to a fifth aspect, there is provided a screening system for characterizing an agent's ability to prevent, treat and/or alleviate the symptoms of a heart disease associated with cardiac remodeling. The screening system comprises a reaction vessel adapted to receive an OcaB-based reagent and the agent; the OcaB-based reagent; a processor in a computer system; a memory accessible by the processor; and at least one application coupled to the processor. The application(s) is (are) configured for receiving a test value of a parameter of the OcaB-based reagent in the presence of the agent; comparing the test value with a control value to determine if the test value is lower than, equal to or higher than the control value, wherein the control value is associated with a lack of prevention, treatment and/or alleviation of the symptoms of the heart disease; and characterizing the agent as being able to prevent, treat and/or alleviate symptoms of the heart disease if the test value is higher than the control value; and as lacking ability to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is equal to or lower than the control value. In an embodiment, the control value is at least one of: the parameter of the OcaB-based reagent in the absence of the agent, the parameter of the OcaB-based reagent in the presence of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value. Various embodiments of the OcaB-based reagent and the parameters of the OcaB-based reagent are disclosed herein and can be applied in this system. Various embodiments of the heart disease are disclosed herein and can be applied in this system. According to a sixth aspect, the present application provides a prognostic method of characterizing an individual's susceptibility to develop a heart disease associated with cardiac remodeling. Broadly, the method comprising: measuring a parameter of an OcaB-based reagent in a biological sample from the individual to provide a test value; comparing the test value to a control value to determine if the test value is higher than, equal to or lower than the control value, wherein the control value is associated with a lack of susceptibility to develop the heart disease; and characterizing. The individual is characterized as being susceptible to develop the heart disease if the test value is lower than the control value; and as lacking susceptibility to develop the heart disease if the test value is equal to or higher than the control value. In an embodiment, the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of a control individual lacking susceptibility to develop the heart disease and a pre-determined value. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB-based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this method.

According to a seventh aspect, the present application provides a software product embodied on a computer readable medium and comprising instructions for characterizing an individual's susceptibility to develop a heart disease associated with cardiac remodeling. The product comprises a receiving module for receiving a test value of a parameter of an OcaB-based reagent in a biological sample of the individual; a comparison module for determining if the test value is lower than, equal to or higher than a control value and generating a corresponding output, wherein the control value is associated with a lack of susceptibility to develop the heart disease; and a characterization module receiving the corresponding output from the comparison module and adapted to determine the individual's susceptibility to the heart disease. The individual is characterized as susceptible to develop the heart disease if the test value is lower than the control value. Alternatively, the individual is characterized as lacking susceptibility to develop the heart disease if the test value is equal to or higher than the control value. In an embodiment, the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of an individual lacking susceptibility to develop the heart disease and a pre-determined value. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB-based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this product. According to an eighth aspect, there is provided a prognostic system for characterizing an individual's susceptibility to develop a heart disease associated with cardiac remodeling. The prognostic system comprises a reaction vessel adapted to receive a biological sample from the individual; a processor in a computer system; a memory accessible by the processor; and at least one application coupled to the processor. The application(s) is (are) configured for receiving a test value of a parameter of an OcaB- based reagent in the biological sample; comparing the test value with a control value to determine if the test value is lower than, equal to or higher than the control value, wherein the control value is associated with a lack of susceptibility to develop the heart disease; and characterizing the individual as susceptible to develop a heart disease if the test value is lower than the control value; and as lacking susceptibility to develop the heart disease if the test value is equal to or higher than the control value. In an embodiment, the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of an individual lacking susceptibility to develop the heart disease and a pre-determined value. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB-based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this system.

According to a ninth aspect, the present application provides a method of diagnosing a heart disease associated with cardiac remodeling in an individual. The method comprises measuring a parameter of an OcaB-based reagent in a biological sample from the individual to provide a test value; comparing the test value to a control value to determine if the test value is higher than, equal to or lower than the control value, wherein the control value is associated with the absence of the heart disease; and characterizing the individual as having the heart disease if the test value is lower than the control value; or as lacking the heart disease if the test value is equal to or higher than the control value. In an embodiment, the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of a control individual lacking heart disease and a pre-determined value. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB-based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this method.

According to a tenth aspect, there is provided a software product embodied on a computer readable medium and comprising instructions for diagnosing a heart disease associated with cardiac remodeling in an individual. The product comprises a receiving module for receiving a test value of a parameter of an OcaB-based reagent in a biological sample of the individual; a comparison module for determining if the test value is lower than, equal to or higher than a control value and generating a corresponding output, wherein the control value is associated with the absence of the heart disease; and a characterization module receiving the corresponding output from the comparison module and adapted to determine the presence or absence of the heart disease in the individual. The heart disease is considered present in the individual if the test value is lower than the control value. Alternatively, the heart disease is considered absent in the individual if the test value is equal to or higher than the control value. In an embodiment, control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of a control individual lacking the heart disease and a pre-determined value. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB-based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this product. According to an eleventh aspect, there is provided a diagnostic system for diagnosing a heart disease associated with cardiac remodeling in an individual. The diagnostic system comprises a reaction vessel adapted to receive a biological sample from the individual; a processor in a computer system; a memory accessible by the processor; and at least one application coupled to the processor. The application(s) is (are) configured for receiving a test value of a parameter of an OcaB-based reagent in the biological sample; comparing the test value with a control value to determine if the test value is lower than, equal to or higher than the control value, wherein the control value is associated with the absence of the heart disease; and characterizing the heart disease as present in the individual if the test value is lower than the control value; and as absent from the individual if the test value is equal to or higher than the control value. In an embodiment, the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of a control individual lacking the heart disease and a pre-determined value. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB-based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this system.

According to a twelfth aspect, there is provided a method of characterizing the effectiveness of an agent for the prevention, treatment and/or the alleviation of symptoms of a heart disease associated with cardiac remodeling in an individual. The method comprises measuring a parameter of an OcaB-based reagent in a biological sample from the individual to provide a test value; comparing the test value to a control value to determine if the test value is higher than, equal to or lower than the control value, wherein the control value is associated with a lack of effectiveness to prevent, treat and/or alleviate the symptoms of the heart disease; and characterizing the agent. The agent is characterized has being effective for the prevention, treatment and/or the alleviation of symptoms of the heart disease if the test value is higher than the control value. Alternatively, the agent is characterized as lacking effectiveness for the prevention, treatment and/or the alleviation of symptoms of the heart disease if the test value is equal to or lower than the control value. In an embodiment, the method further comprises administering the agent to the individual prior to measuring the parameter. In an embodiment, the control value is at least one of: a level of the parameter of the OcaB-based reagent obtained from the individual prior to the administration of the agent, the parameter of the OcaB-based reagent of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB-based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this method.

According to a thirteenth aspect, the present application provides a software product embodied on a computer readable medium and comprising instructions for characterizing the effectiveness of an agent for the prevention, treatment and/or the alleviation of symptoms of a heart disease associated with cardiac remodeling in an individual. The product comprises a receiving module for receiving a test value of a parameter of an OcaB-based reagent in a biological sample of the individual; a comparison module for determining if the test value is lower than, equal to or higher than a control value and generating a corresponding output, wherein the control value is associated with a lack of effectiveness to prevent, treat and/or alleviate the symptoms of the heart disease; and a characterization module receiving the corresponding output from the comparison module and adapted to determine the effectiveness of an agent for the prevention, treatment and/or the alleviation of symptoms of a heart disease. The agent is characterized as effective to prevent, treat and/or alleviate the symptoms of the heart disease in the individual if the test value is higher than the control value. Alternatively, the agent is characterized as lacking effectiveness to prevent, treat and/or alleviate the symptoms of the heart disease in the individual if the test value is equal to or lower than the control value. In an embodiment, the control value is at least one of: a level of the parameter of the OcaB-based reagent obtained from the individual prior to the administration of the agent, the parameter of the OcaB-based reagent of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value. In another embodiment, the test value is a level of the parameter of the OcaB-based reagent obtained from the individual after the administration of the agent. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB- based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this product.

According to a fourteenth aspect, there is provided a system for characterizing the effectiveness of an agent for the prevention, treatment and/or the alleviation of symptoms of a heart disease associated with cardiac remodeling in an individual. The diagnostic system comprises a reaction vessel adapted to receive a biological sample from the individual; a processor in a computer system; a memory accessible by the processor; and at least one application coupled to the processor. The application(s) is (are) configured for receiving a test value of a parameter of an OcaB-based reagent in the biological sample; comparing the test value with a control value to determine if the test value is lower than, equal to or higher than the control value, wherein the control value is associated with a lack of effectiveness to prevent, treat and/or alleviate the symptoms of the heart disease; and characterizing the agent as effective in the prevention, treatment and/or alleviation of symptoms of the heart disease if the test value is higher than the control value; and as lacking effectiveness in the prevention, treatment and/or alleviation of symptoms of heart disease if the test value is equal to or lower than the control value. In an embodiment, the control value is at least one of: a level of the parameter of the OcaB-based reagent obtained from the individual prior to the administration of the agent, the parameter of the OcaB-based reagent of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value. In another embodiment, the test value is a level of the parameter of the OcaB-based reagent obtained from the individual after the administration of the agent. In an embodiment, the biological sample comprises a cardiomyocyte. Various embodiments of the OcaB-based reagent, the parameter of the OcaB-based reagent, and the heart disease are disclosed herein and can be applied to this system.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 illustrates a non-binding working concept. Expression levels of the nuclear cofactor OcaB decrease upon aging, which allows an increase in the transcriptional activity of PPARy, previously shown to induce heart remodeling. It is suggested that the heart from OcaB null mice will show premature aging characteristics such as left ventricular hypertrophy and fibrosis because of overstimulated PPARy transactivation potential. Figure 2 illustrates that OcaB binds and represses PPARy activity. (A) Total protein extracts from 3T3-L1 cultured adipocytes were incubated in the presence of anti-OcaB or anti-PPARy antibodies to immunoprecipitate (IP) specific complexes. The presence of OcaB in these complexes was then revealed by western blotting. Experiments repeated twice using independent cell preparations IP with IgG is shown as negative control. (B) Total protein extracts from subcutaneous WAT of lean women were incubated in the presence of an anti-PPARY antibody to immunoprecipitate (IP) specific complexes. The presence of OcaB in these complexes was then revealed by western blotting. IP with IgG is shown as negative control. (C) OcaB represses the transcriptional activity of PPARy. Gene reporter assays on the J3 and PEPCK promoter constructs in 293T cells contransfected with PPARy and increasing amount of OcaB. Experiments repeated twice using independent cell preparations * p<0.05. (D) OcaB represses PPARv-induced adipogenesis. Left: Oil Red O staining of differentiated mouse embryonic fibroblasts (MEFs) isolated from +/+ and -/- embryos. Staining was performed on day 6 of the differentiation process. Magnification is 10X. Right: mRNA levels of PPARy target genes measured in MEFs isolated from +/+ (white bars) and -/- (grey bars) embryos. * p<0.05.

Figure 3 illustrates the modulation of OcaB levels in the heart upon aging. The expression levels of the nuclear cofactor OcaB was quantified by western immunoblotting in the heart of 4-month, 12-month and 24-month old mice. (A) Representative western on three animals per group. (B) Quantification of western signal intensity in groups of eight animals * indicates p < 0.05 compared to 4 mo old,† indicates p <0.05 compared to 12 mo old.

Figure 4 illustrates the effect of OcaB deletion in the heart in mice. (A) Results show that, compared to their wild-type littermates (WT), OcaB null mice (ko) have more pericardial fat (34%, p = 0.04) (OcaB -/- = grey bar, OcaB +/+ = white bar). (B) Echocardiograms indicate that OcaB null mice (OcaB -/-, grey bar) have a higher left ventricular diameter upon systole (+19%, p = 0.03), a lower E/A ratio (-18%, p = 0.04), and a faster LVOT-Vmax (+16%, p = 0.047) than wild-type animals (OcaB +/+, white bar). Two months old wild-type and OcaB-/- mice were used (n=8 per group). * indicates p < 0.05 compared to wild-type mice.

Figure 5 illustrates the effect of OcaB deletion on gene reprogramming in the heart. The heart of two months old wild-type and OcaB-/- mice were used (n = 8 per groups). Results were obtained by qPCR. Data was corrected by the mRNA levels of 36B4 used as a house-keeking gene. Relative mRNA expression is provided in function of various genes (ANP: atrial natriuretic peptide; a skeletal actin; βΜΗΟ: β-myosin heavy chain; SMPD1 : sphingomyelin phosphodiesterase 1 , acid lysosomal; SPTLC1 : Serine palmitoyl-transferase; MCAD: Medium-chain acylCoA dehydrogenase; TGFp: transforming growth factor β; angiotensin 2; BNP: b-type natriuretic peptide; irx3: iroquois homeobox 3; tbx3: T-box 3; ANP/BNP: ratio of atrial natriuretic peptide to brain natriuretic peptide). * indicates p < 0.05 compared to wild-type mice.

Figure 6 illustrates the effect of OcaB deletion on PPARv mRNA expression in the heart. The heart of two months old wild-type and OcaB-/- mice were used (n = 8 per groups). Results were obtained by qPCR. Data was corrected by the mRNA levels of 36B4 used as a house-keeking gene. Relative mRNA expression is provided in function of PPARv mRNA relative expression in wild-type (white bar) and OcaB-/- (black bar) ** indicates p < 0.01 compared to wild-type mice.

Figure 7 illustrates the effect of OcaB deletion on the heart's morphology. Compared to their wild-type littermates (having a relative size of 1 , indicated by the dashed line on the histogram), the heart of OcaB-/- mice has a larger septum, an increased left ventricle end-diastolic diameter (LVED) and an increased left ventricle end-systolic diameter (LVESD). Even though the posterior wall (PW) of OcaB-/- mice seems larger than those of their wild-type littermates, this difference is not statistically significant. * indicates p < 0.05 compared to wild-type mice. ** indicates p < 0.01 compared to wild- type mice.

Figure 8 illustrates that the OcaB polypeptide is expressed in cardiomyocytes. The presence of the nuclear cofactor OcaB was quantified in mouse HL-1 cardiomyocytes by western immunoblotting. γ-tubulin was used as a control. DETAILED DESCRIPTION

In accordance with the present application, there is provided the use of an OcaB-based reagent as a biomarker for heart disease (associated or not with aging). There is also provided the use of an OcaB-based reagent as a screening tool to determine if a therapeutic agent can be useful in the treatment, prevention and/or alleviations of the symptoms associated with heart disease. There is further provided the use of the ocab gene or the OcaB polypeptide as a therapeutic target for the treatment, prevention and/or alleviations of the symptoms associated with heart disease.

OcaB is a nuclear cofactor that has been shown to participate in B cell function. However, the role of OcaB on energy metabolism is not known, even less so in relation with aging. The process of immune cell infiltration in tissues has been described to contribute to the chronic low-inflammatory state that is characteristic of conditions such as aging, insulin resistance and obesity. In an effort to determine how OcaB impacts on metabolism in target tissues upon aging, a colony of mice with a germline mutation in the OcaB gene, resulting in complete gene invalidation, was generated. As shown herein, preliminary findings indicate that compared to their wild-type littermates, the heart of OcaB null (OcaB-/-) mice shows impaired left ventricular function, hypertrophy and fibrosis. The results thus indicate that the presence of OcaB is important to restore or maintain cardiac function and limit pathological cardiac remodeling.

As indicated above, PPARy is involved in heart function and remodeling. As shown herein, it is suggested that the binding of OcaB to PPARy (which induces a modulation in PPARy transcriptional activity) upon specific conditions represents a key regulatory mechanism in heart disease, especially in heart remodeling events. The specific coregulators recruited to the receptor depend on the structural changes induced by the particular ligand bound, and also on the promoter and cellular context. It has previously been shown that the nuclear cofactors SRC-1 and TIF2 have different effects on the PPARy-mediated transcriptional program, despite having similar patterns of physical interactions with PPARy. SRC-1 docking favors insulin sensitization but not adipogenesis. Moreover, SRC-1 deficient mice develop massive obesity on a high-fat diet, whereas TIF2-/- mice are lean and more insulin sensitive than their littermates on a similar dietary regimen. This concept is relevant in adipocytes upon aging. It was also found that SRC-1 docking to PPARy in white adipose tissue (WAT) is impaired during aging in mice and humans, thereby increasing PPARy activity on promoters of genes such as aP2 and LPL. As shown herein, OcaB is also unexpectedly associated with PPARy in the heart and its expression is modulated (e.g. , decreased) upon aging.

OcaB (also termed POU2AF1 , Bob.1 and OBF.1) is a 34 kDa nuclear cofactor and transcriptional regulator that is essential for several steps in the development of B cells. By virtue of its binding to Oct-1 and Oct-2 transcription factors, it is thought that OcaB, because of its strong expression in B cells, is a key factor that induced a specific B cell immunoglobulin response upon an immune challenge. OcaB docking to Oct-1 activates sets of genes that possess in their promoter the octamer with the consensus sequence ATGCAAAT (SEQ ID NO: 1), which is the case for most mammalian immunoglobulin promoters. It is still unclear whether OcaB requires other nuclear cofactors to perform its function properly (e.g. , TATA binding factors, SMRT or histone remodeling factors). Docking of OcaB to other transcription factors is also not fully described to date, but interestingly, Oct-1 binds to the PPARy partner RXR, suggesting complex crosstalk between these molecular regulators. Mice with targeted disruption of OcaB are homozygous for the OcaB deletion (classic germline targeting), are viable and fertile and do not display any gross physical or behavioral abnormalities at a young age. However, they show abnormal B cell differentiation, decreased B cell number, loss of marginal-zone B cells, impaired antigen-dependent maturation of B cells and deficiency in the production of IgA, IgE, IgM, lgG1 , lgG2a, lgG2b and lgG3. They also show an expected impairment of their immune response to infection by Leishmania major but an increased Th1 response.

As it will be shown herein, the expression of OcaB as a nuclear cofactor has a positive impact in the heart. Without wishing to be bound to theory, it is proposed that OcaB represses PPARv transcriptional stimulation of genes involved in cardiac remodeling (Fig. 1). Loss of OcaB (for example upon aging) is likely to allow PPARv to be more active, mimicking the phenotype observed upon PPARv stimulation by TZD drugs or by genetic overexpression of PPARv. A further exacerbation is also observed upon genetic invalidation of OcaB, which allegedly results in premature cardiac aging (Fig. 1). It is thus suggested that increasing OcaB's expression would limit PPARv's biological activity and, in return, limit the heart's pathological remodeling and ultimately, heart disease. It is also believed that the inhibition of PPARv's biological activity in a context of OcaB deficiency should restore normal cardiac morphology and function, at least in some parts. Definitions

Throughout this application, various terms are used and some of them are more precisely defined herein.

Agonist. This term, as used herein, refers to an agent that mimics or upregulates (e.g., increases, potentiates or supplements) the expression and/or activity of an OcaB protein. An agonist can be a wild-type protein or variant thereof having at least one biological activity of the wild-type protein. An agonist can also be a compound that upregulates expression of an OcaB gene or which increases at least one activity of an OcaB protein. An agonist can also be a compound which increases the biological activity of the OcaB protein via direct interaction, e.g., a binding partner. Heart disease associated with cardiac remodeling. As shown herein, OcaB's biological activity, through the inhibition of PPARv, impedes cardiac remodeling and ultimately, limits cardiac fibrosis and/or cardiac hypertrophy. Cardiac remodeling is associated to fibrosis, inflammation, the NO-cGMP pathway, oxidative injury as well as other signaling pathways (such as, for example, protein kinase C and class II histones deacetylase). Cardiac remodeling is usually caused by an injury such as, for example, an acute myocardial infarction (usually transmural or ST segment elevation infarction), an increased pressure or volume overload on the heart, chronic hypertension, congenital heart disease (with intracardiac shunting), and/or valvular heart disease. After the injury occurs, a series of histopathological and structural changes occur, particularly in the left ventricular myocardium, that lead to progressive decline in left ventricular performance. Ultimately, ventricular remodeling may result in diminished contractile (systolic) function and reduced stroke volume. As used herein, a "heart disease associated with cardiac remodeling" (also referred to a heart disease associated with ventricular remodeling) refers to a group of conditions characterized by pathological changes in the structure and function of the components of the heart, which can range from the myocyte to the extracellular matrix arrangement, as well as the entire cardiac chamber size and shape. These conditions include, but are not limited to, heart failure, left ventricular hypertrophy, left ventricular fibrosis, left ventricular stiffness, diastolic dysfunction, loss of aortic elasticity, arrythmias (due, in part, to the disruption of electrotonic connectivity between cardiomyocytes), myocardial ischemia, contractile dysfunction, valvular regurgitation, and valvular stiffness. In the present invention, auricular fibrillation and congenital cardiopathy are not considered to be encompassed in the heart disease associated with cardiac remodeling.

Biological sample. A biological sample is a sample of an individual's bodily fluid, cells or tissues. In this present invention, the biological sample is preferably derived from a heart tissue and may even comprise a cardiomyocyte. The biological sample can be used without prior modification in the various methods described herein. Optionally, the biological sample can be treated (mechanically, enzymatically, etc.) prior to the assay to optimize the measurement of the OcaB-based reagent.

OcaB-based reagent. As used herein, the OcaB-based reagent is a biological entity that is derived from the OcaB polypeptide or its encoding polynucleotide. The OcaB- based reagent may be derived from various sources, such as, for example, human (GenBank Accession No. NP_006226.2), mouse (GenBank Accession No. NPJD35266) and C. elegans (GenBank Accession No. NP_871687.1 or NP_497667.1).

As shown herein, the expression and/or activity of OcaB is decreased during the development or onset of heart disease. This modulation in expression and consequently, in activity, is observed in non-immune cells, particularly in cells from the heart tissue (e.g., cardiomyocytes). As used herein, the OcaB-based reagent refers to a polypeptide derived from OcaB as well as polynucleotides encoding them which are found in non-immune cells (such as cardiomyocytes). OcaB-encoding polynucleotides and related products. In the assay provided herewith, a full-length nucleotide molecule encoding the OcaB polypeptide or a fragment thereof can be used. In an embodiement, a "fragment" of an OcaB-encoding nucleotide molecule that encodes a biologically active portion (e.g., that retains OcaB's specific transcription modulation activity and/or ability to bind to its partners) of OcaB protein will encode at least 15, 25, 30, 50, 75, 100, 125, 150, 175, 200, 225, 250 or 255 contiguous amino acids, or up to the total number of amino acids present in a full- length OcaB polypeptide. In another embodiment, a "fragment" of an OcaB-encoding nucleotide molecule that is a smaller than the full-length nucleotide molecule. Such "fragment" can be useful as specific hybridization probes and/or as specific PCR primers and generally do not need to encode a biologically active portion of the OcaB polypeptide.

Nucleic acid molecules that are variants of the wild-type OcaB-encoding nucleotide molecules disclosed herein can also be used. "Variants" of OcaB-encoding nucleotide molecules include those molecules that encode OcaB proteins that differ conservatively because of the degeneracy of the genetic code. These naturally occurring allelic variants can be identified with the use of well-known molecular biology techniques, such as polymerase chain reaction (PCR) and hybridization techniques. "Variant" nucleotide molecules also include synthetically derived nucleotide molecules that have been generated, for example, by using site-directed mutagenesis but which still encode the biologically active OcaB proteins. Generally, nucleotide molecule variants of the invention will have at least 45%, 55%, 65%, 75%, 85%, 95%, or 98% identity to a particular nucleotide molecule disclosed herein. A "variant" OcaB-encoding nucleotide molecule can encode an OcaB protein that has an amino acid molecule having at least 45%, 55%, 65%, 75%, 85%, 95%, or 98% identity to the amino acid sequence of OcaB protein disclosed herein. It will be appreciated by those skilled in the art that DNA polymorphisms that lead to changes in the amino acid sequences of OcaB proteins may exist within a population (e.g., the human population). Such genetic polymorphism in the ocab gene may exist among individuals within a population due to natural allelic variation. Any and all of such nucleotide variations and resulting amino acid polymorphisms or variations in the ocab gene that are the result of natural allelic variation and that do not alter significantly the biological activity of OcaB proteins are intended to be used herein as "variant" nucleotide molecules.

In addition to naturally-occurring allelic variants of OcaB-encoding nucleotide molecules that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide molecules described herein (leading or not to changes in the amino acid sequence of the encoded OcaB proteins), without altering significantly the biological activity of the OcaB proteins. Such mutations can be created by introducing one or more nucleotide substitutions, additions, or deletions into the corresponding nucleotide molecule disclosed herein. Such modifications, which can lead to one or more amino acid substitutions, additions or deletions, are introduced into the encoded OcaB protein. Mutations can be introduced by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. Such variant nucleotide molecules are also encompassed. A "conservative amino acid substitution" is one in which the amino acid residue is replaced by an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

In the methods provided herewith, it is also possible to use the promoter of the ocab gene operably linked to a reporter gene as an OcaB-based reagent. The reporter gene can encode a protein that can be detected in the reaction vessel. The reporter gene can be, for example, the ocab gene itself or any other gene encoding a protein that can be detected in the reaction vessel (for example the yellow fluorescent protein or the β- galactosidase protein).

OcaB polypeptide and related products. The OcaB-reagent may be the full-length OcaB polypeptide or a biologically active fragment of the OcaB polypeptide that retains its characteristic transcription modulation activity. "Fragments" or "biologically active portions" of the OcaB polypeptide include polypeptide fragments comprising amino acid sequences sufficiently identical to or derived from the amino acid sequence of the OcaB polypeptide and exhibiting at least one biological activity of the OcaB polypeptide, but which include fewer amino acids than the full-length OcaB polypeptide. Typically, biologically active portions comprise a domain or motif associated with at least one activity of the OcaB polypeptide. A biologically active portion of the OcaB polypeptide can be a polypeptide that is, for example, 10, 25, 50, 100, 150, 200 or 250 or more amino acids in length. Such biologically active portions can be prepared by recombinant techniques and evaluated for one or more of the functional activities of a native OcaB polypeptide.

Biological activity of the OcaB polypeptide. The OcaB polypeptide is a transcription factor that binds to regulatory sequence(s) of various genes and modulate their expression. As shown herein, the OcaB polypeptide downregulates the expression of at least one gene associated with heart tissue remodeling, such as, for example, PPARy, heart skeletal genes (such as skeletal actin, β-myosin heavy chain, etc.), genes associated with lipid metabolism (such as serine palmitoyl-transferase, medium- chain acyl CoA dehydrogenase, etc.) and genes associated with fibrosis (for example transforming growth factor β). In an embodiment, the OcaB polypeptide can dowregulate the expression of more than one of the genes listed below. In order to mediate its transcription factor activity, OcaB can bind directly or indirectly (e.g., in the form of a complex with other binding partners) to its target gene sequence(s). When OcaB is part of a larger complex, it can be associated with at least one binding partners such as, for example, Oct-1 , Oct-2, RXR and PPARy. In an embodiment, OcaB can form a complex with more than one of its binding partner. In the methods disclosed herein, it is possible to use the wild-type OcaB polypeptide or a variant thereof which retains the biological activity associated with the wild-type (wt) OcaB polypeptide. Such variant/fragments should be able to modulate the transcription of the genes in a fashion similar to wt OcaB and/or associated with the binding partners usually associated with wt OcaB.

The methods described herein can also rely on a OcaB polypeptide chimeric or fusion proteins as an OcaB-based reagent. As used herein, the "chimeric protein" or "fusion protein" comprises the OcaB polypeptide operably linked to a non-OcaB polypeptide. A "non-OcaB polypeptide" is intended to refer to a polypeptide having an amino acid sequence corresponding to a protein that is not substantially identical to the OcaB polypeptide, e.g., a protein that is different from the OcaB polypeptide. The non-OcaB polypeptide can derive from the same or a different organism/species with respect to the OcaB polypeptide. Within the OcaB polypeptide fusion protein, the OcaB polypeptide can correspond to the entirety or a portion of the OcaB polypeptide. The non-OcaB polypeptide can be fused to the N-terminus or C-terminus of the OcaB polypeptide. In an embodiment, the non-OcaB polypeptide provides a flag which can facilitate the measurement of the level of expression and/or activity of the OcaB polypeptide. Pharmaceutically effective amount or therapeutically effective amount. These expressions refer to an amount (dose) effective in mediating a therapeutic benefit to a patient (for example prevention, treatment and/or alleviation of symptoms of heart disease). It is also to be understood herein that a "pharmaceutically effective amount" may be interpreted as an amount giving a desired therapeutic effect, either taken in one dose or in any dosage or route, taken alone or in combination with other therapeutic agents.

Pharmaceutically acceptable salt. This expression refers to conventional acid-addition salts or base-addition salts that retain the biological effectiveness and properties of the therapeutic agent described herein. They are formed from suitable non-toxic organic or inorganic acids or organic or inorganic bases. Sample acid-addition salts include those derived from inorganic acids such as hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, sulfamic acid, phosphoric acid and nitric acid, and those derived from organic acids such as p-toluenesulfonic acid, salicylic acid, methanesulfonic acid, oxalic acid, succinic acid, citric acid, malic acid, lactic acid, fumaric acid, and the like. Sample base-addition salts include those derived from ammonium, potassium, sodium and quaternary ammonium hydroxides, such as e.g., tetramethylammonium hydroxide. The chemical modification of an agent into a salt is a well known technique which is used in attempting to improve properties involving physical or chemical stability, e.g., hygroscopicity, flowability or solubility of compounds. Reaction vessel. The reaction vessel, where the agent is combined with the OcaB- based reagent, can be an in vitro or in vivo environment. When an agent is being screened, the contact between the agent and the OcaB-based reagent must be made under conditions suitable and for a sufficient period of time, enable the agent to interact with the OcaB-based reagent and possibly modify at least one of its parameters. Suitable in vitro environments can include, for example, a cell-free environment where a OcaB polypeptide, a biologically active variant thereof or a fusion protein comprising the OcaB polypeptide is combined in a reaction media comprising the appropriate reagents to enable the assessment of the biological activity of the OcaB polypeptide or variants thereof (buffers, substrates, additives, etc.). When a biological sample is being assayed, it is placed in the reaction vessel and measurements of the OcaB-based reagent are performed. In these instances, care must be taken to limit variations of the OcaB-based reagent in the biological sample in order to obtain a valid measurement. Prevention, treatment and alleviation of symptoms. These expressions refer to the ability of a method or an agent to limit the development, progression and/or symptomology of a heart disease. Symptoms associated with heart disease include, but are not limited to: increased pulmonary pressure, pulmonary edema, impaired conductibility, angina, exacerbated fatigue upon physical exercise, stenosis, coronary occlusion, valvular dysfunction and/or ischemia.

Diagnostic, prognostic and screening methods

The diagnostic, prognostic and screening methods described herein are designed to capture the relationship between OcaB's expression and/or activity and heart disease to generate valuable information about the individual that is being tested or the agent that is being screened.

In addition, since the expression of OcaB is known to be downregulated during adipogenesis, insulin resistance and glucose intolerance, the agents identified by the screening methods provided herewith are also likely to have the advantage of limiting adipogenesis, insulin resistance and/or glucose intolerance as well as ameliorating the heart condition.

In diagnostic/prognostic applications, a biological sample (for example a cardiomyocyte) of an individual is placed in a reaction vessel and is supplemented with an exogenous reagent (such as a quantifier) capable of detecting the presence/level of the OcaB-based reagent. For diagnostic/prognostic applications, the biological sample already comprises a native OcaB-based reagent. For screening applications, the OcaB-based reagent is supplied to the reaction vessel. In the assays described herein, the reaction vessel can be any type of container that can accommodate the measurement of an OcaB-based reagent's parameter (through the quantifier).

In screening applications, an agent to be screened is placed in a reaction vessel and is supplemented with an OcaB-based reagent and a reagent (such as a quantifier) capable of detecting/quantifying the presence/level of the OcaB-based reagent (or one its biological parameters) in the presence of the agent. In the screening assays, the reaction vessel can be any type of container that can accommodate the measurement of an OcaB-based reagent's parameter. For screening applications, a suitable in vitro environment for the screening assay described herewith can be a cultured cell, such as, for example a cultured cardio myocyte. Such cell should be able to maintain viability in culture. The cultured cell(s) should (i) express a polynucleotide encoding OcaB or biologically active variant thereof (ii) express a OcaB-encoding polynucleotide or variant thereof or related chimeric protein and/or (iii) comprise the OcaB promoter region. The cell is preferably derived from a heart tissue (primary cell culture or cell line) and even more preferably, the cell is a cardiomyocyte. If a primary cell culture is used, the cell may be isolated or remain in a tissue-like structure. In some embodiments, the cell that is being used is not a blood cell such as a lymphocyte B. A further suitable environment is a non-human model, such as an animal model. If the characterization of the agent occurs in a non-human model, then the model (such as a rodent or a worm) is administered with the agent. Various dosage and modes of administration may be used to fully characterize the agent's ability to prevent, treat and/or alleviate the symptoms of a heart disease.

Once the biological sample or the agent has been placed in the reaction vessel with the OcaB-based reagent, a measurement or value of a parameter of the OcaB-based reagent is made. This assessment may be made directly in the reaction vessel (by using a probe) or on a sample of such reaction vessel. The measurement of the parameter of the OcaB-based reagent (through the quantifier) can be made either at the DNA level, the RNA level and/or the polypeptide level.

The measuring step can rely on the addition of a quantifier specific to the parameter to be assessed to the reaction vessel or a sample thereof. The quantifier can specifically bind to a parameter of a OcaB-based reagent that is being assessed, such as, for example, a nucleotide product encoding OcaB (a probe for example) or a OcaB polypeptide (an antibody for example). In those instances, the amount of the quantifier that specifically bound (or that did not bind) to the OcaB-based reagent can be determined to provide a measurement of the parameter of the OcaB-based reagent. In another embodiment, the quantifier can be modified by a parameter of the OcaB-based reagent, such as, for example, the OcaB transcription factor activity (a mRNA level of an OcaB target gene for example). In this specific instance, the amount of modified (or unmodified) quantifier will be determined to provide a measurement of the parameter of the OcaB-based reagent. ln an embodiment, the signal of the quantifier can be provided by a label that is either directly or indirectly linked to a quantifier.

Various parameters of the OcaB-based reagent can be measured. For example, when the OcaB-based reagent is a OcaB polypeptide or fragment thereof, the parameter that is measured can be the polypeptide transcription factor activity, the polypeptide quantity and/or stability. When the OcaB-based reagent is a nucleotide encoding a OcaB polypeptide or fragment thereof, the parameter can be the level of expression and/or stability of the OcaB-encoding nucleotide, the level of association (or dissociation) with at least one of its binding partners, the level of affinity for its target sequences, etc. Even though a single parameter is required to enable the characterization of the individual or the agent, it is also provided that more than one parameter of the OcaB-based reagent may be measured and even that more than one OcaB-based reagents may be used.

If the measurement of the parameter is performed at the nucleotide level, then the transcription activity of the promoter associated with the OcaB gene can be assessed. This assessment can be made, for example, by using a reporter vector. Such reporter vectors can include, but are not limited to, the promoter region of the OcaB gene (or fragment thereof) operably linked to a nucleotide encoding a reporter polypeptide (such as, for example, OcaB, β-galactosidase, green-fluorescent protein, yellow-fluorescent protein, etc.). Alternative reporter vectors can include a gene promoter (or a portion thereof) containing an OcaB target sequence. The assessment can also be made by detecting or quantifying the expression levels of OcaB's target genes. Upon the addition of the biological sample or the agent in the reaction vessel, the promotion of transcription from the reporter vector or from OcaB's target genes promoter can be measured. In this particular embodiment, the quantifier is the reporter polypeptide or the target gene transcript.

Alternatively or complementarily, the stability and/or the expression level of the OcaB- encoding nucleotide can be assessed by quantifying the amount of a OcaB-encoding nucleotide (for example using qPCR or real-time PCR) or the stability of such nucleotide.

In one assay format, the expression of OcaB in a cell or tissue sample is monitored. In one assay format, an antibody-based technique can be used to visualize/quantify the level of the OcaB protein. In a further assay format, OcaB can be detected by hybridization to the nucleic acids specific for OcaB. In another assay format, cell lines or tissues can be exposed to the agent to be tested under appropriate conditions and time, and total RNA or mRNA or total protein isolated, optionally amplified, and quantified. If the measurement of the parameter is performed at the polypeptide level, an assessment of the OcaB level of expression can be performed. In an embodiment, the level of expression of the OcaB polypeptide is measured by, for example, an antibody- based technique (such as an ELISA, flow cytometry, immunoprecipitation, gel- eletrophoretic mobility assay, etc.), a micro-array, spectrometry, etc. In one embodiment, this assay is performed utilizing antibodies (or antibody products related thereto) specific to OcaB or its binding partner(s) but which do not interfere with the binding of the OcaB to its partner(s). Such antibodies can be derivatized to the surface, and unbound target or the OcaB-based reagent trapped on the surface by antibody conjugation. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the OcaB-based reagent or target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the OcaB-based reagent or target molecule.

In addition, an assessment of OcaB biological activity can be performed. OcaB is a transcription factor that downregulates and/or inhibits at least one heart tissue remodeling gene. As such, one of OcaB's biological activity is to bind to other transcription regulators (also referred to as binding partners) as well as to bind to its target sequences. Such evaluation can be made in vitro. The reaction mixture can include, e.g., a co-factor, a substrate or other binding partner or potentially interacting fragment thereof. Exemplary binding partners include Oct-1 , Oct-2, SRC-1 , RXR and PPARv, or interacting fragments thereof. Preferably, the binding partner is a direct binding partner. This type of assay can be accomplished, for example, by coupling one of the components, with a label such that binding of the labeled component to the other can be determined by detecting the labeled compound in a complex. A component can be labeled with ²⁵l, ³⁵S, ⁴C, or ³H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting. Alternatively, a component can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product. Competition assays can also be used to evaluate a physical interaction between a test compound and a target. ln another assay format, OcaB's biological activity can be indirectly measured by quantifying the expression levels of its target genes, whose expression is modulated by the presence and activity of OcaB. OcaB is usually considered a transcriptional activator of immunoglobulin genes. However, in adipocytes, OcaB is considered to repress the transcription of genes and therefore, it is expected that the expression of its target genes is downregulated in the presence of OcaB. Therefore, OcaB's activity is negatively associated with the expression of its target genes. Such targets include, but are not limited to, aP2, LPL, PPARv, Glut4, ATGL, adiponectin, leptin, C/EBPa, perilipin, PEPCK, resistin, PELP1 , E2F1 , HSL, SREBPI c, C/ΕΡΒβ, actin (skeletal), β- myosin heavy chain, serine palmitoyl-transferase (SPTLC1), medium-chain acyl CoA dehydrogenase (MCAD), transformating growth factor β, runt related transcription factor 2 (Runx2), tumor necrosis factor (ligand) superfamily, member 1 1 (Rank-L or TNFSF1 1), osteopontin or secreted phosphoprotein 1 (SPP1), osteocalcin or bone gamma-carboxyglutamate (gla) protein (Bglap), alkaline phosphatase (ALP), osteoprotegerin or tumor necrosis factor receptor superfamily, member 1 1 b (TNFRSF1 1 B) and/or collagen type 1. In some embodiments, its targets gene are aP2, LPL, PPARv, Glut4, ATGL, Adiponectin, Leptin, C/ΕΒΡα, Perilipin and/or HSL. In other embodiments, its target genes are actin (skeletal), β-myosin heavy chain, serine palmitoyl-transferase (SPTLC1), medium-chain acyl CoA dehydrogenase (MCAD), transformating growth factor β, runt related transcription factor 2 (Runx2), tumor necrosis factor (ligand) superfamily, member 1 1 (Rank-L or TNFSF1 1), osteopontin or secreted phosphoprotein 1 (SPP1), osteocalcin or bone gamma-carboxyglutamate (gla) protein (Bglap), alkaline phosphatase (ALP) , osteoprotegerin or tumor necrosis factor receptor superfamily, member 1 1 b (TNFRSF1 1 B) and/or collagen type 1. Some of its target genes are associated with the cytoskeleton (such as, for example, actin (skeletal) and β-myosin heavy chain), other are associated with the metabolism of lipids (such as, for example, serine palmitoyl-transferase (SPTLC1), medium-chain acyl CoA dehydrogenase (MCAD)), others are associated with fibrosis (such as, for example, transformating growth factor β), whereas others are associated with calcification (runt related transcription factor 2 (Runx2), tumor necrosis factor (ligand) superfamily, member 1 1 (Rank-L or TNFSFH), osteopontin or secreted phosphoprotein 1 (SPP1), osteocalcin or bone gamma-carboxyglutamate (gla) protein (Bglap), alkaline phosphatase (ALP) , osteoprotegerin or tumor necrosis factor receptor superfamily, member 1 1 b (TNFRSF1 1 B) and/or collagen type 1). In an embodiment, OcaB's activity is measured indirectly by quantifying the activity of PPARv or by quantifying the levels of β-myosin heavy chain, serine palmitoyl-transferase (SPTLC1), medium-chain acyl CoA dehydrogenase (MCAD), runt related transcription factor 2 (Runx2), tumor necrosis factor (ligand) superfamily, member 1 1 (Rank-L or TNFSF1 1), osteopontin or secreted phosphoprotein 1 (SPP1), osteocalcin or bone gamma-carboxyglutamate (gla) protein (Bglap), alkaline phosphatase (ALP) , osteoprotegerin or tumor necrosis factor receptor superfamily, member 1 1 b (TNFRSF1 1 B) and/or collagen type 1. In another embodiment, OcaB's activity is measured indirectly by measuring the expression of at least one gene associated with the metabolism of lipids. In another embodiment, OcaB's activity is measured indirectly by measuring the expression of at least one gene associated with at least one class of genes associated with the cytoskeleton, the metabolism of lipids, fibrosis and calcification. In another embodiment, OcaB's activity is measured indirectly by measuring the expression of at least two genes (or at least three or at least four gene) associated with at least one class of genes associated with the cytoskeleton, the metabolism of lipids, fibrosis and calcification. In another embodiment, OcaB's activity is measured indirectly by measuring the expression of at least two genes associated with at least two (different) classes of genes associated with the cytoskeleton, the metabolism of lipids, fibrosis and calcification. In yet another embodiment, OcaB's activity is measured indirectly by measuring the expression of at least three genes associated with at least three (different) classes of genes associated with the cytoskeleton, the metabolism of lipids, fibrosis and calcification. In still another embodiment, OcaB's activity is measured indirectly by measuring the expression of at least four genes associated with at least four (different) classes of genes associated with the cytoskeleton, the metabolism of lipids, fibrosis and calcification. Cell-free screening assays usually involve preparing a reaction mixture of the OcaB protein and the test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex that can be removed and/or detected.

The interaction between two molecules can also be detected, e.g., using a fluorescence assay in which at least one molecule is fluorescently labeled. One example of such an assay includes fluorescence energy transfer (FET or FRET for fluorescence resonance energy transfer). A fluorophore label on the first "donor" molecule is selected such that its emitted fluorescent energy will be absorbed by a fluorescent label on a second "acceptor" molecule, which in turn is able to fluoresce due to the absorbed energy. Alternately, the "donor" protein molecule may simply utilize the natural fluorescent energy of tryptophan residues. Labels are chosen that emit different wavelengths of light, such that the "acceptor" molecule label may be differentiated from that of the "donor". Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed. In a situation in which binding occurs between the molecules, the fluorescent emission of the "acceptor" molecule label in the assay should be maximal. A FET binding event can be conveniently measured through standard fluorometric detection means well known in the art (e.g. , using a fluorimeter).

Another example of a fluorescence assay is fluorescence polarization (FP). For FP, only one component needs to be labeled. A binding interaction is detected by a change in molecular size of the labeled component. The size change alters the tumbling rate of the component in solution and is detected as a change in FP.

In another embodiment, the measuring step can rely on the use of real-time Biomolecular Interaction Analysis (BIA). "Surface plasmon resonance" or "BIA" detects biospecific interactions in real time, without labeling any of the interactants (e.g. , BIAcore). Changes in the mass at the binding surface (indicative of a binding event) result in alterations of the refractive index of light near the surface (the optical phenomenon of surface plasmon resonance (SPR)), resulting in a detectable signal which can be used as an indication of real-time reactions between biological molecules.

In one embodiment for the screening applications, the OcaB-reagent is anchored onto a solid phase. The OcaB-based reagent-related complexes anchored on the solid phase can be detected at the end of the reaction, e.g. , the binding reaction. For example, the OcaB-based reagent can be anchored onto a solid surface, and the test compound, (which is not anchored), can be labeled, either directly or indirectly, with detectable labels discussed herein. Examples of such solid phase include microtiter plates, test tubes, array slides, beads and micro-centrifuge tubes. In one embodiment, a OcaB chimeric protein can be provided which adds a domain that allows one or both of the proteins to be bound to a matrix. Following incubation, the vessels are washed to remove any unbound components, the matrix immobilized in the case of beads, complex determined either directly or indirectly, for example, as described above. Alternatively, the complexes can be dissociated from the matrix, and the level of OcaB binding or activity determined using standard techniques. ln order to conduct the assay, the non-immobilized component (agent or biological agent) is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e.g. , by washing) under conditions such that any complexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously non-immobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the previously non-immobilized component is not pre- labeled, an indirect label can be used to detect complexes anchored on the surface, e.g. , using a labeled antibody specific for the immobilized component (the antibody, in turn, can be directly labeled or indirectly labeled with, e.g. , a labeled anti-lg antibody).

Alternatively, cell free assays can be conducted in a liquid phase. In such an assay, the reaction products are separated from unreacted components, by any of a number of standard techniques, including but not limited to: differential centrifugation, chromatography (gel filtration chromatography, ion-exchange chromatography) and/or electrophoresis. Such resins and chromatographic techniques are known to one skilled in the art. Further, fluorescence energy transfer may also be conveniently utilized, as described herein, to detect binding without further purification of the complex from solution. To identify agents that facilitate with the interaction between the OcaB and its binding partner(s), for example, a reaction mixture containing the OcaB-based reagent and the binding partner is prepared, under conditions and for a time sufficient, to allow the two products to form complex. In order to test if an agent which facilitates the interaction between OcaB and its binding partner, the reaction mixture can be provided in the presence and absence of the test agent. The test agent can be initially included in the reaction mixture, or can be added at a time subsequent to the addition of the target and its cellular or extracellular binding partner. Control reaction mixtures are incubated without the test agent or with vehicle. The formation of any complexes between the target product and the cellular or extracellular binding partner is then detected. The formation of a complex in the reaction mixture containing the test compound, but not in the control reaction, indicates that the test agent facilitates the interaction of the OcaB- based reagent and the interactive binding partner. In an embodiment, it is possible to detect the formation of the OcaB-based complex indirectly by measuring the level of expression of a reporter gene whose expression is modulated by the presence (or absence) of the complex. These assays can be conducted in a heterogeneous or homogeneous format. Heterogeneous assays involve anchoring either the OcaB-based reagent or the binding partner onto a solid phase, and detecting complexes anchored on the solid phase at the end of the reaction. In homogeneous assays, the entire reaction is carried out in a liquid phase. In either approach, the order of addition of reactants can be varied to obtain different information about the agents being tested. For example, test agents that interfere with the interaction between the OcaB-based reagent and the binding partners, e.g. , by competition, can be identified by conducting the reaction in the presence of the test substance. Alternatively, test agents that facilitate preformed complexes, can be tested by adding the test compound to the reaction mixture prior to complexes have been formed. The various formats are briefly described below.

In a heterogeneous assay system, either the OcaB-based reagent or the binding partner, is anchored onto a solid surface (e.g. , a microtiter plate), while the non- anchored species is labeled, either directly or indirectly. The anchored species can be immobilized by non-covalent or covalent attachments. Alternatively, an immobilized antibody specific for the species to be anchored can be used to anchor the species to the solid surface.

In order to conduct the assay, the partner of the immobilized species is exposed to the coated surface with or without the agent. After the reaction is complete, unreacted components are removed (e.g. , by washing) and any complexes formed will remain immobilized on the solid surface. Where the non-immobilized species is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed. Where the non-immobilized species is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g. , using a labeled antibody specific for the initially non-immobilized species (the antibody, in turn, can be directly labeled or indirectly labeled with, e.g. , a labeled anti-lg antibody). Depending upon the order of addition of reaction components, agents that enable complex formation or that promote the stability of preformed complexes can be detected.

Alternatively, the reaction can be conducted in a liquid phase in the presence or absence of the agent, the reaction products separated from unreacted components, and complexes detected; e.g. , using an immobilized antibody specific for one of the binding components to anchor any complexes formed in solution, and a labeled antibody specific for the other partner to detect anchored complexes. Again, depending upon the order of addition of reactants to the liquid phase, test compounds that enable complex or that promote the stability of preformed complexes can be identified.

In an alternate embodiment, a homogeneous assay can be used. For example, a preformed complex of the OcaB-based reagent and the interactive cellular or extracellular binding partner product is prepared in that either the target products or their binding partners are labeled, but the signal generated by the label is quenched due to complex formation. The addition of agent that favors the formation of the complex will result in the generation of a signal below the control value. In this way, agents that promote OcaB-binding partner interaction can be identified. In yet another aspect, the OcaB-based reagent can be used as "bait proteins" in a two- hybrid assay or three-hybrid assay, to identify other proteins, which bind to or interact with OcaB binding proteins and are involved in OcaB activity. Such binding partners can be activators or inhibitors of signals or transcriptional control.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. In one construct, the gene that codes for a OcaB binding partner is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g. , GAL-4). In the other construct, a DNA molecule, from a library of DNA molecules, that encodes an unidentified protein ("prey" or "sample") is fused to a gene that codes for the activation domain of the known transcription factor. Alternatively, the OcaB can be fused to the activator domain. If the "bait" and the "prey" proteins are able to interact, in vivo, forming a OcaB dependent complex, the DNA- binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g. , lacZ) which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the protein which interacts with the OcaB. In another embodiment, the two- hybrid assays are used to monitor an interaction between two components. The two hybrid assays can also be conducted in the presence of an agent to be screened, and the assay is used to determine whether the agent enhances or diminishes the interaction between the components. ln another embodiment, the assay for selecting compounds which interact with OcaB can be a cell-based assay. Useful assays include assays in which a parameter of OcaB function (e.g. , a marker of cardiomyocyte function) is measured. The cell-based assay can include contacting a cell expressing a OcaB-based reagent with an agent and determining the ability of the test compound to modulate (e.g. , stimulate or inhibit) the activity of a OcaB, and/or determine the ability of the agent to modulate expression of a OcaB, by detecting, for example, OcaB-encoding nucleic acids (e.g. , mRNA) or related proteins in the cell. Determining the ability of the agent to modulate OcaB activity can be accomplished, for example, by determining the ability of the OcaB to bind to or interact with the agent, and by determining the ability of the agent to modulate heart remodeling/heart disease.

In one embodiment, a cell (for example a cardiomyocyte) can be used to determine the ability of a therapeutic agent to restore higher levels of expression of OcaB and ultimately, provide therapeutic benefits. In an embodiment, the cell expresses an reduced amount of OcaB, with respect to a wild-type cell. In order to determine the ability of the agent to modulate, OcaB activity can also be accomplished at the DNA level, the RNA level, the protein level (as described above) or at the cellular level. In the latter embodiment, the ability of the agent to limit or prevent the onset or maintenance of morphological/biological modifications observed in a cell which expresses a reduced amount of OcaB. Such morphological modifications include, but are not limited to, increase in size, perimeter, diameter, volume, contractility, as well as structural modifications to the cytoskeleton and/or the nucleus. Such biological modifications include, but are not limited to, increase in TGFp secretion and modulation in uptake/oxidation/accumulation of glucose and fatty acids. Cell-based systems can be used to identify compounds that increase the expression and/or activity and/or effect of OcaB. Such cells can be recombinant or non- recombinant, such as cell lines that express the ocab gene. In some embodiments, the cells can be recombinant or non-recombinant cells which express a OcaB-binding partner. Exemplary systems include mammalian or yeast cells that express a OcaB (for example from a recombinant nucleic acid). In some embodiments such cells are also capable of expressing at a higher level OcaB. In utilizing such systems, cells are exposed to agents suspected of increasing expression and/or activity of a OcaB. After exposure, the cells are assayed, for example, for OcaB expression or activity. A cell can from a stable cell line or a primary culture obtained from an organism (for example an organism treated with the agent). ln addition to cell-based and in vitro assay systems, non-human organisms, e.g. , transgenic non-human organisms or a model organism, can also be used. A transgenic organism is one in which a heterologous DNA molecule is chromosomally integrated into the germ cells of the animal. A transgenic organism will also have the transgene integrated into the chromosomes of its somatic cells. Organisms of any species, including, but not limited to: yeast, worms, flies, fish, reptiles, birds, mammals (e.g. , mice, rats, rabbits, guinea pigs, pigs, micro-pigs, and goats), and non-human primates (e.g. , baboons, monkeys, chimpanzees) may be used in the methods described herein.

A transgenic cell or animal used in the methods described herein can include a transgene that encodes, e.g. , an OcaB polypeptide, fragment or variant. The transgene can encode a protein that is normally exogenous to the transgenic cell or animal, including a human protein, e.g. , a human OcaB or one of its biding partner. The transgene can be linked to a heterologous or a native promoter. Methods of making transgenic cells and animals are known in the art. In another assay format, the specific activity of OcaB, normalized to a standard unit, may be assayed in a cell-free system, a cell line, a cell population or an animal model that has been exposed to the agent to be tested and compared to an unexposed control cell-free system, cell line, cell population or animal model. The specific activity of an OcaB-activating reagent can also be assessed using OcaB-deficient systems (OcaB knockout cells or animals).

Once the measurement has been made, it is extracted from the reaction vessel, and the value of the parameter of the OcaB-based reagent is compared to a control value. In a diagnostic/prognostic application, it must be determined if the measured parameter OcaB's expression and/or activity differs from a control value. In an embodiment, the control value is associated with a lack of heart disease or heart remodeling and as such, an individual is either at risk of developing a heart disease, has a heart disease or receives an agent that is not useful in the treatment of a heart disease if the measured parameter is lower than the control value. In this embodiment, an individual is either not at risk of developing a heart disease, does not have a heart disease or receives an agent that is useful in the treatment of a heart disease if the measured parameter is equal to or higher than the control value. In another embodiment, the control value is associated with a heart disease or heart remodeling and as such, an individual is either at risk of developing a heart disease, has a heart disease or receives an agent that is not useful in the treatment of a heart disease if the measured parameter is equal to or lower than the control value. In such embodiment, an individual is either not at risk of developing a heart disease, does not a heart disease or receives an agent that useful in the treatment of a heart disease if the measured parameter is higher than the control value. In screening application, the effect of the agent on OcaB's expression and/or activity is compared to a control value. In an embodiment, the control value is associated with a lack of prevention, treatment and/or alleviation of symptoms of the heart disease or heart remodeling and as such, agents useful in the prevention, treatment and/or alleviation of symptoms of the heart disease are capable of increasing the measured parameter above the control value. In this embodiment, the measured parameter for agents which are not considered useful in the prevention, treatment and/or alleviation of symptoms of heart disease is equal to or lower than the control value. In another embodiment, the control value is associated with prevention, treatment and/or alleviation of symptoms of the heart disease or heart remodeling and as such, the measured parameter associated agents useful in the prevention, treatment and/or alleviation of symptoms of the heart disease or heart remodeling is equal to or higher than the control value. In such embodiment, the measured parameter associated agents that are not useful in the prevention, treatment and/or alleviation of symptoms of the heart disease or heart remodeling are lower than the control value. In an embodiment, the comparison can be made by an individual. In another embodiment, the comparison can be made in a comparison module. Such comparison module may comprise a processor and a memory card to perform an application. The processor may access the memory to retrieve data. The processor may be any device that can perform operations on data. Examples are a central processing unit (CPU), a front-end processor, a microprocessor, a graphics processing unit (PPU/VPU), a physics processing unit (PPU), a digital signal processor and a network processor. The application is coupled to the processor and configured to determine the effect of the agent on the parameter of the OcaB-based reagent with respect to the control value. An output of this comparison may be transmitted to a display device. The memory, accessible by the processor receives and stores data such as measured parameters of the OcaB-based reagent or any other information generated or used. The memory may be a main memory (such as a high speed Random Access Memory or RAM) or an auxiliary storage unit (such as a hard disk, a floppy disk or a magnetic tape drive). The memory may be any other type of memory (such as a Read-Only Memory or ROM) or optical storage media (such as a videodisc or a compact disc). Once the comparison between the parameter of the OcaB-based reagent and the control value is made, then it is possible to characterize the individual or the agent. This characterization is possible because, as shown herein, (i) OcaB is downregulated in individuals susceptible to and/or afflicted by heart remodeling and/or heart disease, (ii) the downregulation of OcaB causes heart remodeling and/or heart aging and (iii) the overexpression of OcaB limits heart remodeling.

In an embodiment, the characterization can be made by an individual. In another embodiment, the characterization can be made with a processor and a memory card to perform an application. The processor may access the memory to retrieve data. The processor may be any device that can perform operations on data. Examples are a central processing unit (CPU), a front-end processor, a microprocessor, a graphics processing unit (PPU/VPU), a physics processing unit (PPU), a digital signal processor and a network processor. The application is coupled to the processor and configured to characterize the individual or the agent being screened. An output of this characterization may be transmitted to a display device. The memory, accessible by the processor receives and stores data such as measured parameters of the OcaB- based reagent or any other information generated or used. The memory may be a main memory (such as a high speed Random Access Memory or RAM) or an auxiliary storage unit (such as a hard disk, a floppy disk or a magnetic tape drive). The memory may be any other type of memory (such as a Read-Only Memory or ROM) or optical storage media (such as a videodisc or a compact disc).

The diagnostic/prognostic methods described herein can be used to determine an individual's susceptibility to develop a heart disease. The premise behind these methods is that OcaB's activity and/or expression is downregulated prior to the onset of heart remodeling and/or heart disease. As such, by assessing if a downregulation of OcaB is observed in the individual, it can be linked to a susceptibility to develop heart remodeling and/or a heart disease. In this particular embodiment, a value for a measured parameter of the OcaB-based reagent is compared to a control value. Such control value can be, for example, a parameter of the OcaB-based reagent in a biological sample of a control individual (or a group of control individuals) lacking susceptibility to develop heart disease. Alternatively, the control value can also be a pre-determined value associated with a lack of susceptibility to develop the heart disease. Once the comparison has been made, the susceptibility of the individual to develop the heart is characterized. The individual is characterized as susceptible to develop a heart disease if the value of the OcaB-based reagent parameter is lower than the control value. On the other hand, the individual is characterized as not being susceptible to develop a heart disease if the value of the OcaB-based reagent parameter is equal to or higher than the control value.

The diagnostic methods described herein can be used to determine the presence of a heart disease in an individual. The premise behind this diagnostic method is that OcaB activity or expression is downregulated during heart remodeling, which eventually leads to heart disease. As such, by assessing if a downregulation is observed in the individual, it can be linked to presence/absence of heart disease. In this particular embodiment, a value for a parameter of the OcaB-based reagent is compared to a control value. Such control value can be, for example, a parameter of the OcaB-based reagent in a biological sample of a control individual (or a group of control individuals) that is (are) not afflicted by a heart disease. Alternatively, the control value can also be a pre-determined value associated with a lack of affliction to a heart disease. Once the comparison has been made, the presence of the heart disease can be determined. The individual is characterized as being afflicted by a heart disease if the value of the OcaB-based reagent parameter is lower than the control value. On the other hand, the individual is characterized as not being afflicted by a heart disease when the value of the OcaB-based reagent parameter is equal to or higher than the control value.

The methods described herein can be used to determine the effectiveness of a therapy for preventing, treating or alleviating the symptoms of a heart disease. The premise behind this diagnostic method is that OcaB activity or expression is downregulated during heart disease and that the upregulation of OcaB restores impedes heart remodeling and promotes healing. As such, to determine the efficiency of a therapy, an assessment of the modulation of OcaB activity or expression is made and can be linked to treatment efficiency. In this particular embodiment, a value for a parameter of the OcaB-based reagent is compared to a control value. Such control value can be, for example, the parameter of the OcaB-based reagent in a biological sample from the same individual but obtained during an earlier phase of the treatment. In another embodiment, the control value can also be the parameter of the OcaB-based reagent in the individual prior to treatment. In a further embodiment, the control value can also be derived from another individual treated with a placebo (e.g. , a control agent that does not have the ability to prevent, treat and/or alleviate the symptoms of adipogenesis a heart disease). In still another embodiment, the control value can be a pre-determined value associated with a lack of ability to prevent, treat and/or alleviate the symptoms of heart disease. Once the comparison has been made, the effectiveness of the therapy can be determined. The treatment is characterized as not being efficient if the value of the OcaB-based reagent parameter is lower than or equal to the control value. On the other hand, the treatment is characterized as being efficient when the value of the OcaB-based reagent parameter is higher than the control value. The screening methods described herein can be used to determine an agent's ability to prevent, treat or alleviate the symptoms of a heart disease. The premise behind this screening method is that OcaB activity or expression is downregulated during heart remodeling and eventually, heart disease. As such, by assessing if an upregulation of OcaB's activity or expression made by the agent, it can be linked to its ability to prevent, treat or alleviate the symptoms of a heart disease. In these methods, the control value may be the parameter of the OcaB-based reagent in the absence of the agent. In this particular embodiment, the parameter of the OcaB-reagent can be measured prior to the combination of the agent with the OcaB-based reagent or in two replicates of the same reaction vessel, where one of the screening system does not comprise the agent. The control value can also be the parameter of the OcaB-based reagent in the presence of a control agent that is known not to limit heart remodeling or prevent/treat/alleviate the symptoms of a heart disease. Such control agent may be, for example, a pharmaceutically inert excipient. The control value can also be the parameter of the OcaB-based reagent obtained from a reaction vessel comprising cells or tissues from a healthy subject that is not afflicted by a heart disease. The control value can also be a pre-determined value associated with a lack heart disease. The ability of the agent is determined based on the comparison of the value of the parameter of the OcaB-based reagent with respect to the control value. The agent is characterized as being able to prevent, treat or alleviate the symptoms of a heart disease when the value of the parameter of the OcaB-based reagent is higher than the control value. On the other hand, the agent is characterized as lacking the ability to prevent, treat or alleviate the symptoms of a heart disease when the measurement of the parameter of the OcaB-based reagent is lower than or equal to the control value.

The present application also provides diagnostic, prognostic and screening systems for performing the characterizations and methods described herein. These systems comprise a reaction vessel for placing the biological sample (diagnostic, prognostic system) or the agent (screening system) and the OcaB-based reagent, a processor in a computer system, a memory accessible by the processor and an application coupled to the processor. The application or group of applications is (are) configured for receiving a test value of a level of an OcaB-based reagent in the presence of the agent; comparing the test value to a control value and/or characterizing the individual and/or agent in function of this comparison.

The present application also provides a software product embodied on a computer readable medium. This software product comprises instructions for characterizing the individual or the agent according to the methods described herein. The software product comprises a receiving module for receiving a test value of a level of an OcaB- based reagent from a biological sampled or in the presence of an agent; a comparison module receiving input from the measuring module for determining if the test value is lower than, equal to or higher than a control value; a characterization module receiving input from the comparison module for performing the characterization based on the comparison.

In an embodiment, an application found in the computer system of the system is used in the comparison module. A measuring module extracts/receives information from the reaction vessel with respect to the level of the OcaB-based reagent. The receiving module is coupled to a comparison module, which receives the value(s) of the level of the OcaB-based reagent and determines if this value is lower than, equal to or higher than a control value. The comparison module can be coupled to a characterization module.

In another embodiment, an application found in the computer system of the system is used in the characterization module. The comparison module is coupled to the characterization module which receives the comparison and performs the characterization based on this comparison.

In a further embodiment, the receiving module, comparison module and characterization module are organized into a single discrete system. In another embodiment, each module is organized into different discrete systems. In still a further embodiment, at least two modules are organized into a single discrete system.

Therapeutic applications

The present application also provides methods and agents useful in the prevention, treatment or the alleviation of symptoms of heart disease in an individual in need thereof. In this particular embodiment, an effective amount of an agent or a pharmaceutically acceptable salt thereof that agonizes OcaB's biological activity is administered via any of the usual and acceptable methods known in the art, either singly or in combination. The intake of the agent upregulates the expression and/or activity of OcaB (either directly or indirectly) to prevent, treat or alleviate the symptoms of heart disease in the individual.

In addition, since the expression of OcaB is known to be down-regulated during adipogenesis, insulin resistance and glucose intolerance, the agents administered by the therapeutic methods provided herewith are also likely to have the advantage of limiting adipogenesis, insulin resistance and/or glucose intolerance as well as ameliorating the heart disease.

As shown herein, genetics means (such as a nucleic acid encoding OcaB) can be used to elevate OcaB expression levels and in return provide valuable therapeutic effects. In another embodiment, the OcaB polypeptide can be directly administered to the individual to augment OcaB activity. In some embodiments, the agent is formulated to facilitate its transport to the nucleus where it can mediate some of its therapeutic actions. In yet another embodiment, the agent can further be formulated to be targeted preferably or solely to cardiomyocytes.

Thus, the method described herein is practiced when relief of symptoms is specifically required or perhaps imminent. Alternatively, the method can be effectively practiced as continuous or prophylactic treatment. The agent can be administered via various administration routes and in the form of solid, liquid or gaseous dosages, including tablets and suspensions. The administration can be conducted in a single unit dosage form with continuous therapy or in a single dose therapy ad libitum. The agent can also be in the form of an oil emulsion or dispersion in conjunction with a lipophilic salt, such as palmoic acid, or in the form of a biodegradable sustained-release composition for subcutaneous or intramuscular administration. The dose of the agent depends on a number of factors, such as, e.g., the manner of administration, the age and the body weight of the subject, and the condition of the subject to be treated, and ultimately, will be decided by the attending physician or veterinarian.

Useful agents may be administered with a pharmaceutically-acceptable diluent, carrier, or excipient, in unit dosage form. Conventional pharmaceutical practice may be employed to provide suitable formulations or compositions to administer such compositions to patients. Any appropriate route of administration may be employed, for example, anal, intraarterial, intravenous, perenteral, subcutaneous, intramuscular, intracranial, intraorbital, ophthalmic, intraventricular, intracapsular, intraspinal, intrathecal, epidural, intracisternal, intraperitoneal, intranasal, oral administration or aerosol administration. Therapeutic formulations may be in the form of liquid solutions or suspension; for oral administration, formulations may be in the form of tablets or capsules; and for intranasal formulations, in the form of powders, nasal drops, or aerosols.

Methods for making formulations are found and well known in the art. Formulations for parenteral administration may, for example, contain excipients, sterile water, or saline, polyalkylene glycols such as polyethylene glycol, oils of vegetable origin, or hydrogenated napthalenes. Biocompatible, biodegradable lactide polymer, lactide/glycolide copolymer, or polyoxyethylene-polyoxypropylene copolymers may be used to control the release of the compounds. Other potentially useful parenteral delivery systems for agonists of the invention include ethylenevinyl acetate copolymer particles, osmotic pumps, implantable infusion systems, and liposomes. Formulations for inhalation may contain excipients, (e.g. , lactose) or may be aqueous solutions containing, for example, polyoxyethylene-9-lauryl ether, glycocholate and deoxycholate, or may be oily solutions for administration in the form of nasal drops, or as a gel.

Useful pharmaceutical carriers for the preparation of the agent can be solids, liquids or gases; thus, the compositions can take the form of tablets, pills, capsules, suppositories, powders, enterically coated or other protected formulations (e.g. , binding on ion-exchange resins or packaging in lipid-protein vesicles), sustained release formulations, solutions, suspensions, elixirs, aerosols, and the like. The carrier can be selected from the various oils including those of petroleum, animal, vegetable or synthetic origin, e.g. , peanut oil, soybean oil, mineral oil, sesame oil, and the like. Water, saline, aqueous dextrose, and glycols are preferred liquid carriers, particularly (when isotonic with the blood) for injectable solutions. For example, formulations for intravenous administration comprise sterile aqueous solutions of the active ingredient(s) (e.g. , comprising the agent), which are prepared by dissolving solid active ingredient(s) in water to produce an aqueous solution, and rendering the solution sterile.

Suitable pharmaceutical excipients include starch, cellulose, talc, glucose, lactose, gelatin, malt, rice, flour, chalk, silica, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol, and the like. The compositions may be subjected to conventional pharmaceutical additives such as preservatives, stabilizing agents, wetting or emulsifying agents, salts for adjusting osmotic pressure, buffers and the like. Suitable pharmaceutical carriers and their formulation are described in Remington's Pharmaceutical Sciences by E. W. Martin. Such compositions will, in any event, contain an effective amount of the active compound together with a suitable carrier so as to prepare the proper dosage form for proper administration to the recipient.

The agents that can be administered for the prevention, treatment or alleviations of symptoms of heart disease include, but are not limited to, small molecules, peptides, antibodies, nucleic acids, analogs thereof, multimers thereof, fragments thereof, derivatives thereof and combinations thereof. In an embodiment, the agent is a nucleic acid encoding a OcaB polypeptide (or variant thereof) and capable of upregulating the expression or activity of OcaB. This also includes agents that are capable or increasing OcaB activity or levels by inhibiting proteins (or pathways) that normally blunt OcaB mRNA or protein expression and/or activity. These nucleic acids can be inserted into any of a number of well-known vectors for their introduction in target cells (such as adipocytes) and individuals as described herein. The nucleic acids are introduced into cells, ex vivo or in vivo, through the interaction of the vector and the target cell.

Genetic means for the therapeutic applications provided herewith can be oligonucleotides. Oligonucleotide refers to naturally-occurring species or synthetic species formed from naturally-occurring subunits or their close homologs. The term may also refer to moieties that function similarly to oligonucleotides, but have non- naturally-occurring portions. Thus, oligonucleotides may have altered sugar moieties or inter-sugar linkages. Exemplary among these are phosphorothioate and other sulfur containing species which are known in the art. In preferred embodiments, at least one of the phosphodiester bonds of the oligonucleotide has been substituted with a structure that functions to enhance the ability of the compositions to penetrate into the region of cells where the RNA, whose activity is to be modulated, is located. It is preferred that such substitutions comprise phosphorothioate bonds, methyl phosphonate bonds, or short chain alkyl or cycloalkyl structures. In accordance with other preferred embodiments, the phosphodiester bonds are substituted with structures which are, at once, substantially non-ionic and non-chiral, or with structures which are chiral and enantiomerically specific. Persons of ordinary skill in the art will be able to select other linkages for use in the practice of the invention. Oligonucleotides may also include species that include at least some modified base forms. Thus, purines and pyrimidines other than those normally found in nature may be so employed. Similarly, modifications on the furanosyl portions of the nucleotide subunits may also be affected. Examples of such modifications are 2'-0-alkyl- and 2'-halogen-substituted nucleotides. Some non-limiting examples of modifications at the 2' position of sugar moieties which are useful in the present invention include OH, SH, SCH₃, F, OCH₃, OCN, 0(CH₂), NH₂ and 0(CH₂)nCH₃, where n is from 1 to about 10. Such oligonucleotides are functionally interchangeable with natural oligonucleotides or synthesized oligonucleotides, which have one or more differences from the natural structure.

Alternatively, expression vectors derived from retroviruses, adenovirus, herpes or vaccinia viruses or from various bacterial plasmids may be used for delivery of genetic means to the targeted individual, organ, tissue (such as the heart) or cell population (such as cardiomyocytes). Methods which are well known to those skilled in the art can be used to construct recombinant vectors which will express a nucleic acid molecule that is complementary to the nucleic acid molecule encoding OcaB.

Delivery of the genetic means into the cell is the first step in gene therapy treatment of heart disease. A large number of delivery methods are well known to those of skill in the art. Preferably, the nucleic acids are administered for in vivo or ex vivo gene therapy uses. Non-viral vector delivery systems include DNA plasmids, naked nucleic acid, and nucleic acid complexed with a delivery vehicle such as a liposome. Viral vector delivery systems include DNA and RNA viruses, which have either episomal or integrated genomes after delivery to the cell.

The use of RNA or DNA based viral systems for the delivery of nucleic acids take advantage of highly evolved processes for targeting a virus to specific cells in the body and trafficking the viral payload to the nucleus. Viral vectors can be administered directly to patients (in vivo) or can be used to treat cells in vitro and the modified cells then administered to patients (ex vivo). Conventional viral based systems for the delivery of nucleic acids could include retroviral, lentiviral, adenoviral, adeno- associated and herpes simplex virus vectors for gene transfer. Viral vectors are currently the most efficient and versatile method of gene transfer in target cells and tissues. Integration in the host genome is possible with the retrovirus, lentivirus, and adeno-associated virus gene transfer methods, often resulting in long term expression of the inserted transgene. Additionally, high transduction efficiencies have been observed in many different cell types and target tissues. ln applications where transient expression of the nucleic acid is preferred, adenoviral based systems are typically used. Adenoviral based vectors are capable of very high transduction efficiency in many cell types and do not require cell division. With such vectors, high titer and levels of expression have been obtained. This vector can be produced in large quantities in a relatively simple system. Adeno-associated virus ("AAV") vectors are also used to transduce cells with target nucleic acids, e.g., in the in vitro production of nucleic acids and peptides, and for in vivo and ex vivo gene therapy procedures.

In particular, numerous viral vector approaches are currently available for gene transfer in clinical trials with retroviral vectors, by far the most frequently used system. All of these viral vectors utilize approaches that involve complementation of defective vectors by genes inserted into helper cell lines to generate the transducing agent. pLASN and MFG-S are examples of retroviral vectors that have been used in clinical trials.

Recombinant adeno-associated virus vectors (rAAV) are a promising alternative gene delivery systems based on the defective and nonpathogenic parvovirus adeno- associated type 2 virus. All vectors are derived from a plasmid that retains only the AAV 145 bp inverted terminal repeats flanking the transgene expression cassette. Efficient gene transfer and stable transgene delivery due to integration into the genomes of the transduced cell are key features for this vector system. Replication-deficient recombinant adenoviral vectors (Ad) are predominantly used in transient expression gene therapy because they can be produced at high titer and they readily infect a number of different cell types. Most adenovirus vectors are engineered such that a transgene replaces the Ad E1 a, E1 b, and E3 genes; subsequently, the replication defective vector is propagated in human 293 cells that supply the deleted gene function in trans. Ad vectors can transduce multiple types of tissues in vivo, including non-dividing, differentiated cells such as those found in the liver, kidney and muscle tissues. Conventional Ad vectors have a large carrying capacity.

In many gene therapy applications, it is desirable that the gene therapy vector be delivered with a high degree of specificity to a particular tissue type. A viral vector is typically modified to have specificity for a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the viruses outer surface. The ligand is chosen to have affinity for a receptor known to be present on the cell type of interest. Gene therapy vectors can be delivered in vivo by administration to an individual subject, typically by systemic administration (e.g., intravenous, intraperitoneal, intramuscular, subdermal, or intracranial infusion) or topical application. Alternatively, vectors can be delivered to cells ex vivo, such as cells explanted from an individual patient (e.g., lymphocytes, bone marrow aspirates, and tissue biopsy) or universal donor hematopoietic stem cells, followed by re-implantation of the cells into the subject, usually after selection for cells which have incorporated the vector.

The present invention will be more readily understood by referring to the following examples which are given to illustrate the invention rather than to limit its scope. EXAMPLE I - MATERIAL AND METHODS

Materials and oligonuclotides. All chemicals, except when specified, were purchased from Sigma (Oakville, ON). The oligonucleotide sequences used for various experiments are set forth in the following Table. Table 1. Nucleotide sequences of oligonucleotides used

Genes Oligonucleotides

aP2 TGA TGC CTT TGT GGG AAC CT (SEQ ID NO:2)

GCT TGT CAC CAT CTC GTT TT (SEQ ID NO:3)

PPARy GGG CTG AG G AG AAG TC AC AC (SEQ ID NO:4)

GTCAGGCTGTTGGTCTCACA (SEQ ID NO:5)

CD36 GGG CTC GAT ATT GAT GGA GA (SEQ ID NO:6)

GGA AGC ATG TCT GGG AGG TA (SEQ ID NO:7)

AAGAAGGACAAGGCCGTTCTCTT (SEQ ID NO:8)

Adiponectin (Acrp)

GCTATGGGTAGTTGCAGTCAGTT (SEQ ID NO:9) a-skeletal actin (sk GCATGCAGAAGGAGATCACA (SEQ ID NO:10)

actin) TTGTCGATTGTCGTCCTGAG (SEQ ID NO:1 1)

β-myosin heavy chain CTTCCAGAAGCCTCGAAATG (SEQ ID NO: 12)

(MHC) CTTTCTTTGCCTTGCCTTTG (SEQ ID NO: 13)

Serine palmitoyl CCAGATGCCTCCGAAAAATA (SEQ ID NO: 14)

transferase (SPTLC1) GGTTCACATGAACGCACATC (SEQ ID NO: 15)

Medium chain acyl AGGGTTTAGTTTTGAGTTGACGG (SEQ ID NO: 16)

CoA dehydrogenase

(MCAD) CCCCGCT I I I GTCATATTCCG (SEQ ID NO:17)

Transforming growth TGCGCTTG C AG AG ATTAAAA (SEQ ID NO: 18)

factor β (TGF beta) CTGCCGTACAACTCCAGTGA (SEQ ID NO: 19)

Atrial natriuretic ATCTGCCCTCTTGAAAAGCA (SEQ ID NO:20) Genes Oligonucleotides peptide (ANP) GGATCTTTTGCGATCTGCTC (SEQ ID NO:21)

Sphingomyelin CAGTTCTTTGGCCACACTCA (SEQ ID NO:22)

phosphodiesterase 1 ,

acid lysosomal

(SMPD1 ) ATGAGAGCTTCCGGGGTAGT (SEQ ID NO:23)

GGCTTCCGCATGTACAAGAT (SEQ ID NO:24)

Angiotensin 2

GCAGTCTCCCTCCTTCACAG (SEQ ID NO:25)

B-type natriuretic TAGCCAGTCTCCAGAGCAATTC (SEQ ID NO:26)

peptide (BNP) TTGGTCCTTCAAGAGCTGTCTC (SEQ ID NO:27)

Iroquois homeobox 3 TG G ACG CTG CTCTG GTCTTAT (SEQ ID NO:28)

(irx3) GACATGCTTGCAACTCGTCAC (SEQ ID NO:29)

TGTCTGGGAGGGAGCACTAAA (SEQ ID NO:30)

T-box 3 (tbx3)

CAAC AG CAGCCTG GTTACAC A (SEQ ID NO:31)

Adipogenesis. 3T3-L1 cells (ATCC), freshly isolated pre-adipocytes from mouse adipose tissue and MEFs were grown in Dulbecco's modified Eagle's medium high glucose with 10% fetal bovine serum supplemented with 4 mM and 2 mM, respectively, of glutamine in a 5% C0₂ environment. Cells were differentiated, two days after confluence (DO), in the same medium complemented with 10 μg/ml insulin, 0.25 mM 3- isobutyl-1 -methyl-xanthine and 1 μΜ dexamethasone. After two days (D2), medium was supplemented with only 10 μg/ml insulin and replaced every two days until terminal differentiation (D10). Quantitative real-time PCR assays were performed as described in Miard et al. (2009). All studies were approved by the institutional ethics committees. Data is presented as mean ± S.E.M. Statistical differences were analyzed by ANOVA and Fisher's t test (ad hoc) when appropriate. A p value < 0.05 was considered significant.

Retroviral infection. 293T cells were transfected with either pBABE or pBabe-OcaB using Lipofectamine™ (Invitrogen). After 48 hours of transfection, the medium containing retroviruses was collected, filtered, treated with polybrene (1 μg/mL) and transferred to 3T3-L1 target cells. Infected cells were selected with puromycin (2.5 μg/mL) for 7 days.

Animals and treatments. Male and female C57BL/6 mice (aged 4, 12, and 24 months, kindly provided by NIA, USA) were cared for and handled in conformance with the Canadian Guide for the Care and Use of Laboratory Animals, and protocols were approved by our institutional animal care committee. Mice were sacrificed by ketamine- xylazine injection one week after their arrival. In all experiments, adipose tissue samples were immediately harvested and snap frozen in liquid nitrogen.

Subcutaneous WAT from lean women were obtained under local anesthesia. All tissues were quickly snap-frozen in liquid nitrogen and stored at -80°C until further processing. Lean women (BMI: 24 ± 3) had no metabolic or endocrine complications. Approval was obtained from the medical ethics committee of the lUCPQ. All subjects provided written informed consent before their inclusion in the study.

Quantitative PCR. Expression of selected genes was measured by quantitative realtime PCR on Rotorgene 3000™ (Corbett Research) using different sets of primers as described in Table 1 . All reactions were performed in duplicate and data was corrected by the expression of a housekeeping gene (36B4) whose expression remained unchanged upon obesity or aging.

Nuclear protein extraction. For nuclear extracts, cells were homogenized in ice-cold buffer A (10 mM HEPES pH 7.9, 10 mM KCI, 2 mM MgCI₂, 0.1 mM EDTA, 1 mM DTT, and diluted 1 : 1000 Protease Inhibitor Cocktail (PIC)). The homogenates were centrifuged 1 min at 1000 g at 4°C to eliminate unbroken tissues. After 20 min on ice, 0.1 volume of 10% NP40 was added and the supernatants were vortexed for 30 sec. The supernatants were then centrifuged for 1 min at 7500 g. The nuclear pellet was suspended in 50 μΙ_ in ice-cold buffer B (20 mM HEPES pH 7.9, 420 mM NaCI, 1 .5 mM MgCI₂, 0.1 mM EDTA, 1 mM DTT, 1 : 1000 PIC and 25% glycerol), incubated for 30 min at 4°C with high shaking, and centrifuged for 15 min at 16,000 g at 4°C. The supernatants were collected and protein concentrations were determined with the Bradford assay.

Luciferase reporter assays. This assay was performed exactly as described in Picard et al. (2002). The plasmidd used were J3-TK-Luc (Miard et al. , 2009) and PEPCK-TK-Luc, pCMV-PPARy (Miard et al. , 2009) and pEV-OBF-l (OcaB).

Echocardiography analysis. These analyses were performed under ketamine/xylazine anesthesia using a 12 MHz phased-array transducer coupled to a Sonos 5500™ echocardiography ultrasound (Philips Medical Imaging, Andover, MA) as previously described (Plante et al. , 2004) Stroke volume was calculated by pulsed Doppler in the left ventricular outflow tract. Ejection fraction was calculated as previously described (Quinones et al. , 1981). Diastolic filling pattern was evaluated from the E wave to A wave (E/A) ratio of the mitral pulsed Doppler flow at the tip of mitral leaflets. Relative wall thickness was calculated as the ratio of the sum of diastolic septal and posterior wall thicknesses to left ventricular end-diastolic diameter.

LV ejection time (ET) was measured from the beginning to end of the aortic flow wave. Mitral flow was recorded at the tip of the mitral valve from an apical view using Doppler. Maximal velocity and velocity-time integral (VTI) of the E wave were measured and the isovolumic relaxation time (IVRT) was measured as the interval between aortic closure and the start of mitral flow.

Coimmunoprecipitation assay. Cells or tissues were lysed in IP buffer (150 mM NaCI, 1 % NP40, 50 mM Tris pH 8.0, 1 :1000 PIC), and an aliquot was taken as input. Cells lysates were precleared with protein A-sepharose beads (GEhealthcare) for 1 hour at 4°C and then centrifuged 5 min at 2300 g. Supernatants were immunoprecipitated with adequate antibody overnight at 4°C, and mouse IgG were used as negative control. Immunoprecipitates were washed once with IP buffer, twice with WB (0.25M KCI in PBS) and then subjected to SDS-PAGE electrophoresis. Heart morphology assessment. Doppler and M-mode echocardiography exams were performed under isoflurane-induced anesthesia in wild-type and OcaB-/- mice. Number of animals per group and age of the animals are indicated in the examples. Echocardiography is operator-dependent and is therefore prone to high variability. However, variability was minimized since the same operator has performed the echography assessments in a group-blinded manner.

Cell culture and western blot. Murine HL-1 cardiomyocytes were first described in Calycomb et al., 1998 and have been extensively studied. HL-1 cells show the characteristic beating and energy metabolism of cardiomyocytes and represent the best in vitro model aside primary isolated neonatal rat cardiomyocytes. The cells were cultured exactly as described in Claycomb et al., 1998. Nuclear protein extracts and immunoblotting were performed as described in Miard & Picard , 2009).

EXAMPLE II - CHARACTERIZATION OF OCAB EXPRESSION DURING AGING

AND IN HEART TISSUE

Material and methods used in this Example are presented in Example I. As shown in Figures 2A and 2B, an immune complex between OcaB and PPARv has been detected in 3T3-L1 adipocytes and human subcutaneous white adipose tissue. As also shown in Figure 2C, the transcriptional activity of PPARv is reduced in the presence of OcaB. In addition, as shown on Figure 2D, cells from OcaB-/- mouse embryos differentiate more rapidly into adipocytes (left panel) and express more PPARv-associated genes (right panel).

In fat cells from mice (Fig. 2A) and humans (Fig. 2B), co-immunoprecipitation assays showed that OcaB physically binds to PPARv. This binding robustly diminishes PPARv transcriptional activity as evidenced by gene reporter assays using both a synthetic promoter containing 3 x PPRE, as well as a known PPARv-target gene, PEPCK (Fig. 2C). To evaluate the impact of OcaB on PPARv function, mouse embryonic fibroblasts (MEFs) were isolated from wild-type and OcaB null mice and differentiated into adipocytes using an established method (Rochi et a/., 2001). Compared to wild- type cells, OcaB null MEFs showed increased adipogenic potential (Fig. 2D) and much higher expression levels of PPARv and several of its target genes, including aP2 and CD36 (Fig. 2D). These findings indicate that OcaB represses PPARv activity in fat cells. In the heart, it was found that protein levels of OcaB were robustly lower in 12 and 24 months old mice compared to those in 4 months old mice (Fig. 3).

It has also been shown that OcaB null animals have more pericardial fat than their wild- type littermates (a mean of 34% increase, p = 0.04) (Fig. 4A). Furthermore, echocardiograms indicated that OcaB null mice have a higher left ventricular diameter upon systole (a mean of +19% increase, p = 0.03), a lower E/A ratio (a mean of 18% decrease, p = 0.04), and a faster LVOT-Vmax (a mean of 16% increase, p = 0.047) (Fig. 4B).

These findings clearly show that absence of OcaB causes heart dysfunction and that presence of OcaB limits heart fibrosis and hypertrophy. These results are consistent with an earlier finding that suggested, but not statistically or experimentally demonstrated, an association between heart failure in a genetic rat model of spontaneous hypertension and reduced OcaB levels (NCBI, GEO profile # GDS3661).

Real-time quantitative PCR was performed on samples from the heart of OcaB null animals to determine the expression levels of several genes involved in cardiac remodeling. The mRNA levels of skeletal actin, β-myosin heavy chain, serine palmitoyltransferase, medium-chain acyl CoA dehydrogenase and transforming growth factor β were all significantly higher in OcaB-/- hearts compared to wild-type hearts (Fig. 5). Real-time quantitative PCR was also performed on samples from the heart of OcaB null animals to determine the expression levels of PPARY in cardiac remodeling. The mRNA levels of PPARY was significantly higher in OcaB-/- hearts compared to wild- type hearts (Fig. 6). Taken together, these findings indicate that OcaB null mice have cardiac dysfunction associated with gene reprogramming towards hypertrophy and fibrosis.

To determine the effects of OcaB on the heart's morphology, various parameters of two month-old OcaB null mice and their wild-type littermates were measured and compared. As shown in Figure 7, the heart of OcaB-/- mice has a larger septum, an increased left ventricle end-diastolic diameter (LVED) and an increased left ventricle end-systolic diameter (LVESD). Even though the posterior wall (PW) of OcaB-/- mice seems larger than those of their wild-type littermates, this difference is not statistically significant.

To determine if OcaB is expressed in cardiomyocytes, HL1 cells have been cultured and their OcaB content has been probed by Western blot, γ-tubulin was also detected as a control. As shown on Figure 8, HL1 cells express OcaB in culture which strongly suggests that OcaB's biological actions are mediated in the heart through cardiomyocytes at least in part (and not solely through infiltrating lymphocytes).

REFERENCES Claycomb WC, Lanson NA Jr, Stallworth BS, Egeland DB, Delcarpio JB, Bahinski A, Izzo NJ Jr. HL-1 cells: a cardiac muscle cell line that contracts and retains phenotypic characteristics of the adult cardiomyocyte. Proc Natl Acad Sci U S A. 1998; 95(6):2979- 84.

Miard S., Dombrowski L, Carter S., Boivin L. and Picard F.: Aging Alters PPARgamma in Rodent and Human Adipose Tissue by Modulating the Balance in Steroid Receptor Coactivator-1. Aging Cell 2009; 8:449-459.

Plante E., Lachance D., Gaudreau M., Drolet M.C., Roussel E., Arsenault M. and Couet J.: Effectiveness of Beta-Blockade in Experimental Chronic Aortic Regurgitation. Circulation 2004; 1 10:1477-1483. Picard F., Gehin M., Annicotte J.S., Rocchi S., Champy M.F., O'Malley B., Chambon P. and Auwerx J.: SRC-1 and TIF2 Control Energy Fluxes between White and Brown Adipose Tissues. Cell 2002; 1 1 1 :931-941.

Quinones M.A., Waggoner A.D., Reduto L.A., Nelson J.G., Young J.B., Winters Jr W.L. and Miller R.R.: A New, Simplified and Accurate Method for Determining Ejection Fraction with Two-Dimensional Echocardiography. Circulation 1981 ; 64:744-753.

Rocchi S., Picard F., Vamecq J., Gelman L, Potier N., Zeyer D., Dubuquoy L, Bac P., Champy M.F., Plunket K.D., Leesnitzer L.M., Blanchard S.G., Desreumaux P., Moras D., Renaud J. P. and Auwerx J.: A Unique PPARgamma Ligand with Potent Insulin-Sensitizing yet Weak Adipogenic Activity. Mol. Cell. 2001 ; 8:737-747.

While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains, as may be applied to the essential features set forth hereinbefore, and as follows in the scope of the appended claims.

Claims

WHAT IS CLAIMED IS:

1. A method of characterizing an agent's ability to prevent, treat and/or alleviate the symptoms of a heart disease associated with cardiac remodeling, said method comprising:

• combining the agent with an OcaB-based reagent;

• measuring a parameter of the OcaB-based reagent in the presence of the agent to provide a test value;

• comparing the test value with a control value to determine if the test value is higher than, equal to or lower than the control value, wherein the control value is associated with a lack of prevention, treatment and/or alleviation of the symptoms of the heart disease;

• characterizing the agent as: o having the ability to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is higher than the control value; and o lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is lower than or equal to the control value.

The method of claim 1 , wherein the control value is at least one of: the parameter of the OcaB-based reagent in the absence of the agent, the parameter of the OcaB-based reagent in the presence of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value.

The method of claim 1 or 2, wherein the OcaB-based reagent is an OcaB polypeptide.

4. The method of claim 3, wherein the parameter of the OcaB-based reagent is the level of expression of the OcaB polypeptide

5. The method of claim 3, wherein the parameter of the OcaB-based reagent is the level of activity of the OcaB polypeptide.

6. The method of claim 5, wherein the level of activity is a measure of the level of formation of a complex between the OcaB polypeptide and at least one of the following partners: Oct-1 , Oct-2, SRC-1 , RXR and PPARv.

7. The method of claim 5, wherein the level of activity is a measure of the level of expression of at least one of the following genes: aP2, LPL, PPARv, Glut4, ATGL, adiponectin, leptin, C/EBPa, perilipin, PEPCK, resistin, PELP1 , E2F1 , HSL, SREBPI c, C/ΕΡΒβ, skeletal actin, β-myosin heavy chain, SPTLC1 , MCAD and TGFp.

8. The method of claim 1 or 2, wherein the OcaB-based reagent is a polynucleotide molecule encoding an OcaB polypeptide.

9. The method of claim 8, wherein the parameter of the OcaB-based reagent is the level of expression of the polynucleotide molecule encoding the OcaB polypeptide.

10. The method of any one of claims 1 to 9, wherein the OcaB-based reagent is in a cell.

1 1. The method of claim 10, wherein the cell is a cardio myocyte.

12. The method of any one of claims 1 to 1 1 , wherein the heart disease is associated with a heart hypertrophy.

13. The method of any one of claims 1 to 12, wherein the heart disease is associated with a heart fibrosis.

14. A software product embodied on a computer readable medium and comprising instructions for characterizing an agent's ability to prevent, treat and/or alleviate the symptoms of a heart disease associated with cardiac remodeling, said product comprising:

• a receiving module for receiving a test value of a parameter of an OcaB-based reagent in the presence of the agent;

• a comparison module for determining if the test value is lower than, equal to or higher than a control value and generating a corresponding output, wherein the control value is associated with a lack of prevention, treatment and/or alleviation of the symptoms of the heart disease; and

• a characterization module receiving the corresponding output from the comparison module and adapted to determine the ability of the agent to prevent, treat and/or alleviate the symptoms of the heart disease, wherein: o the agent is characterized as able to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is higher than the control value; and o the agent is characterized as lacking ability to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is equal to or lower than the control value.

15. The software product of claim 14, wherein the control value is at least one of: the parameter of the OcaB-based reagent in the absence of the agent, the parameter of the OcaB-based reagent in the presence of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value.

16. The software product of claim 14 or 15, wherein the OcaB-based reagent is an OcaB polypeptide.

17. The software product of claim 16, wherein the parameter of the OcaB-based reagent is the level of expression of the OcaB polypeptide.

18. The software product of claim 16, wherein the parameter of the OcaB-based reagent is the level of activity of the OcaB polypeptide.

19. The software product of claim 18, wherein the level of activity is a measure of the level of formation of a complex between the OcaB polypeptide and at least one of the following partners: Oct-1 , Oct-2, SRC-1 , RXR and PPARv.

20. The software product of claim 18, wherein the level of activity is a measure of the level of expression of at least one of the following genes: aP2, LPL, PPARv, Glut4, ATGL, adiponectin, leptin, C/EBPa, perilipin, PEPCK, resistin, PELP1 , E2F1 , HSL, SREBPI c, C/ΕΡΒβ, skeletal actin, β-myosin heavy chain, SPTLC1 , MCAD and TGFp.

21. The software product of claim 14 or 15, wherein the OcaB-based reagent is a polynucleotide molecule encoding an OcaB polypeptide.

22. The software product of claim 21 , wherein the parameter of the OcaB-based reagent is the level of expression of the polynucleotide molecule encoding the OcaB polypeptide.

23. The software product of any one of claims 14 to 22, wherein the OcaB-based reagent is in a cell.

24. The software product of claim 23, wherein the cell is a cardio myocyte.

25. The software product of any one of claims 14 to 24, wherein the heart disease is associated with a heart hypertrophy.

26. The software product of any one of claims 14 to 25, wherein the heart disease is associated with a heart fibrosis.

27. A screening system for characterizing an agent's ability to prevent, treat and/or alleviate the symptoms of a heart disease associated with cardiac remodeling, said screening system comprising: • a reaction vessel adapted to receive an OcaB-based reagent and the agent;

• a processor in a computer system;

• a memory accessible by the processor; and

• at least one application coupled to the processor and configured for: o receiving a test value of a parameter of the OcaB-based reagent in the presence of the agent; o comparing the test value with a control value to determine if the test value is lower than, equal to or higher than the control value, wherein the control value is associated with a lack of prevention, treatment and/or alleviation of the symptoms of the heart disease; and o characterizing the agent as able to prevent, treat and/or alleviate symptoms of the heart disease if the test value is higher than the control value; and as lacking ability to prevent, treat and/or alleviate the symptoms of the heart disease if the test value is equal to or lower than the control value.

28. The screening system of claim 27, wherein the control value is at least one of: the parameter of the OcaB-based reagent in the absence of the agent, the parameter of the OcaB-based reagent in the presence of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value.

29. The screening system of claim 27 or 28, wherein the OcaB-based reagent is an OcaB polypeptide.

30. The screening system of claim 29, wherein the parameter of the OcaB-based reagent is the level of expression of the OcaB polypeptide.

31. The screening system of claim 29, wherein the parameter of the OcaB-based reagent is the level of activity of the OcaB polypeptide.

32. The screening system of claim 31 , wherein the level of activity is a measure of the level of formation of a complex between the OcaB polypeptide and at least one of the following partners: Oct-1 , Oct-2, SRC-1 , RXR and PPARv.

33. The screening system of claim 31 , wherein the activity is a measure of the level of expression of at least one of the following genes: aP2, LPL, PPARv, Glut4, ATGL, adiponectin, leptin, C/EBPa, perilipin, PEPCK, resistin, PELP1 , E2F1 , HSL, SREBPI c, C/ΕΡΒβ, skeletal actin, β-myosin heavy chain, SPTLC1 , MCAD and TGFp.

34. The screening system of claim 27 or 28, wherein the OcaB-based reagent is a polynucleotide molecule encoding an OcaB polypeptide.

35. The screening system of claim 34, wherein the parameter of the OcaB-based reagent is the level of expression of the polynucleotide molecule encoding the OcaB polypeptide.

36. The screening system of any one of claims 27 to 35, wherein the OcaB-based reagent is in a cell.

37. The screening system of claim 36, wherein the cell is a cardiomyocyte.

38. The screening system of any one of claims 27 to 37, wherein the heart disease is associated with a heart hypertrophy.

39. The screening system of any one of claims 27 to 38, wherein the heart disease is associated with a heart fibrosis.

40. A method of preventing, treating and/or alleviating the symptoms of a heart disease associated with cardiac remodeling in an individual in need thereof, said method comprising administering to the individual an effective amount of an agent capable of increasing the expression of a polynucleotide molecule encoding an OcaB polypeptide and/or the activity of the OcaB polypeptide thereby preventing, treating and/or alleviating the symptoms associated with the heart disease in the individual.

41. The method of claim 40, wherein the individual is a human.

42. The method of claim 41 or 42, wherein the agent is the polynucleotide molecule encoding the OcaB polypeptide.

43. The method of claim 41 or 42, wherein the agent is the OcaB polypeptide.

44. The method of any one of claims 40 to 43, wherein the agent is administered to a cardiomyocyte.

45. The method of any one of claims 40 to 44, wherein the heart disease is associated with a heart hypertrophy.

46. The method of any one of claims 40 to 45, wherein the heart disease is associated with a heart fibrosis.

47. An agent capable of increasing the expression of a polynucleotide molecule encoding an OcaB polypeptide and/or the activity of the OcaB polypeptide for the prevention, the treatment and/or the alleviation of symptoms of a heart disease associated with cardiac remodeling in an individual.

48. The agent of claim 47, wherein the individual is a human.

49. The agent of claim 47 or 48, wherein the agent is the polynucleotide molecule encoding the OcaB polypeptide.

50. The agent of claim 47 or 48, wherein the agent is the OcaB polypeptide.

51. The agent of any one of claims 47 to 50, wherein the agent is for administration to a cardiomyocyte.

52. The agent of any one of claims 47 to 51 , wherein the heart disease is associated with a heart hypertrophy.

53. The agent of any one of claims 47 to 52, wherein the heart disease is associated with a heart fibrosis.

54. A method of characterizing an individual's susceptibility to develop a heart disease associated with cardiac remodeling, said method comprising:

• measuring a parameter of an OcaB-based reagent in a biological sample from the individual to provide a test value;

• comparing the test value to a control value to determine if the test value is higher than, equal to or lower than the control value, wherein the control value is associated with a lack of susceptibility to develop the heart disease;

• characterizing the individual as: o being susceptible to develop the heart disease if the test value is lower than the control value; and o lacking susceptibility to develop the heart disease if the test value is equal to or higher than the control value.

55. The method of claim 54, wherein the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of a control individual lacking susceptibility to develop the heart disease and a predetermined value.

56. The method of claim 54 or 55, wherein the biological sample comprises a cardiomyocyte.

57. A software product embodied on a computer readable medium and comprising instructions for characterizing an individual's susceptibility to develop a heart disease associated with cardiac remodeling, said product comprising:

• a receiving module for receiving a test value of a parameter of an OcaB-based reagent in a biological sample of the individual; • a comparison module for determining if the test value is lower than, equal to or higher than a control value and generating a corresponding output, wherein the control value is associated with a lack of susceptibility to develop the heart disease; and

• a characterization module receiving the corresponding output from the comparison module and adapted to determine the individual's susceptibility to the heart disease, wherein: o the individual is characterized as susceptible to develop the heart disease if the test value is lower than the control value; and o the individual is characterized as lacking susceptibility to develop the heart disease if the test value is equal to or higher than the control value.

The software product of claim 57, wherein the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of an individual lacking susceptibility to develop the heart disease and a predetermined value.

The software product of claim 57 or 58, wherein the biological sample comprises a cardiomyocyte.

A system for characterizing an individual's susceptibility to develop a heart disease associated with cardiac remodeling, said prognostic system comprising:

• a reaction vessel adapted to receive a biological sample from the individual;

• a processor in a computer system;

• a memory accessible by the processor; and • at least one application coupled to the processor and configured for: o receiving a test value of a parameter of an OcaB-based reagent in the biological sample; o comparing the test value with a control value to determine if the test value is lower than, equal to or higher than the control value, wherein the control value is associated with a lack of susceptibility to develop the heart disease; and o characterizing the individual as susceptible to develop a heart disease if the test value is lower than the control value; and as lacking susceptibility to develop the heart disease if the test value is equal to or higher than the control value.

61. The system of claim 60, wherein the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of an individual lacking susceptibility to develop the heart disease and a pre-determined value.

62. The system of claim 60 or 61 , wherein the biological sample comprises a cardiomyocyte.

63. A method of diagnosing a heart disease associated with cardiac remodeling in an individual, said method comprising:

• comparing the test value to a control value to determine if the test value is higher than, equal to or lower than the control value, wherein the control value is associated with the absence of the heart disease;

• characterizing the individual as : o having the heart disease if the test value is lower than the control value; or o lacking the heart disease if the test value is equal to or higher than the control value.

64. The method of claim 63, wherein the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of a control individual lacking heart disease and a pre-determined value.

65. The method of claim 63 or 64, wherein the biological sample comprises a cardiomyocyte.

66. A software product embodied on a computer readable medium and comprising instructions for diagnosing a heart disease associated with cardiac remodeling in an individual, said product comprising:

• a receiving module for receiving a test value of a parameter of an OcaB-based reagent in a biological sample of the individual;

• a comparison module for determining if the test value is lower than, equal to or higher than a control value and generating a corresponding output, wherein the control value is associated with the absence of the heart disease; and

• a characterization module receiving the corresponding output from the comparison module and adapted to determine the presence or absence of the heart disease in the individual, wherein: o the heart disease is considered present in the individual if the test value is lower than the control value; and o the heart disease is considered absent in the individual if the test value is equal to or higher than the control value.

67. The software product of claim 66, wherein the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of a control individual lacking the heart disease and a pre-determined value.

68. The software product of claim 66 or 67, wherein the biological sample comprises a cardiomyocyte.

69. A system for diagnosing a heart disease associated with cardiac remodeling in an individual, said diagnostic system comprising:

• a processor in a computer system;

• a memory accessible by the processor; and

• at least one application coupled to the processor and configured for: o receiving a test value of a parameter of an OcaB-based reagent in the biological sample; o comparing the test value with a control value to determine if the test value is lower than, equal to or higher than the control value, wherein the control value is associated with the absence of the heart disease; and o characterizing the heart disease as present in the individual if the test value is lower than the control value; and as absent from the individual if the test value is equal to or higher than the control value.

70. The system of claim 69, wherein the control value is at least one of: the parameter of the OcaB-based reagent in a biological sample of a control individual lacking the heart disease and a pre-determined value.

71. The system of claim 69 or 70, wherein the biological sample comprises a cardiomyocyte.

72. A method of characterizing the effectiveness of an agent for the prevention, treatment and/or the alleviation of symptoms of a heart disease associated with cardiac remodeling in an individual, such method comprising:

• comparing the test value to a control value to determine if the test value is higher than, equal to or lower than the control value, wherein the control value is associated with a lack of effectiveness to prevent, treat and/or alleviate the symptoms of the heart disease;

• characterizing the agent as: o being effective for the prevention, treatment and/or the alleviation of symptoms of the heart disease if the test value is higher than the control value; or o lacking effectiveness for the prevention, treatment and/or the alleviation of symptoms of the heart disease if the test value is equal to or lower than the control value.

73. The method of claim 72, further comprising administering the agent to the individual prior to measuring the parameter.

74. The method of claim 72 or 73, wherein the control value is at least one of: a level of the parameter of the OcaB-based reagent obtained from the individual prior to the administration of the agent, the parameter of the OcaB-based reagent of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value.

75. The method of any one of claims 72 to 74, wherein the biological sample comprises a cardiomyocyte.

76. A software product embodied on a computer readable medium and comprising instructions for characterizing the effectiveness of an agent for the prevention, treatment and/or the alleviation of symptoms of a heart disease associated with cardiac remodeling in an individual, said product comprising:

• a comparison module for determining if the test value is lower than, equal to or higher than a control value and generating a corresponding output, wherein the control value is associated with a lack of effectiveness to prevent, treat and/or alleviate the symptoms of the heart disease; and

• a characterization module receiving the corresponding output from the comparison module and adapted to determine the effectiveness of an agent for the prevention, treatment and/or the alleviation of symptoms of a heart disease wherein: o the agent is characterized as effective to prevent, treat and/or alleviate the symptoms of the heart disease in the individual if the test value is higher than the control value; and o the agent is characterized as lacking effectiveness to prevent, treat and/or alleviate the symptoms of the heart disease in the individual if the test value is equal to or lower than the control value.

77. The software product of claim 76, wherein the control value is at least one of: a level of the parameter of the OcaB-based reagent obtained from the individual prior to the administration of the agent, the parameter of the OcaB- based reagent of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value.

78. The software product of claim 76 or 77, wherein the biological sample comprises a cardiomyocyte.

79. A system for characterizing the effectiveness of an agent for the prevention, treatment and/or the alleviation of symptoms of a heart disease associated with cardiac remodeling in an individual, said diagnostic system comprising:

• a processor in a computer system;

• a memory accessible by the processor; and

• at least one application coupled to the processor and configured for: o receiving a test value of a parameter of an OcaB-based reagent in the biological sample; o comparing the test value with a control value to determine if the test value is lower than, equal to or higher than the control value, wherein the control value is associated with a lack of effectiveness to prevent, treat and/or alleviate the symptoms of the heart disease; and o characterizing the agent as effective in the prevention, treatment and/or alleviation of symptoms of the heart disease if the test value is higher than the control value; and as lacking effectiveness in the prevention, treatment and/or alleviation of symptoms of heart disease if the test value is equal to or lower than the control value.

80. The system of claim 79, wherein the control value is at least one of: a level of the parameter of the OcaB-based reagent obtained from the individual prior to the administration of the agent, the parameter of the OcaB-based reagent of a control agent lacking the ability to prevent, treat and/or alleviate the symptoms of the heart disease and a pre-determined value. The system of claim 79 or 80, wherein the biological sample comprises cardiomyocyte.