WO2013036101A1

WO2013036101A1 - Rubber allergenic proteins and immunoassay derived thereof

Info

Publication number: WO2013036101A1
Application number: PCT/MY2012/000224
Authority: WO
Inventors: Maqsudul Alam; Mohd Nazalan Mohd NAJIMUDIN; Jennifer Ann SAITO; Jayasekaran KANDAKUMAR
Original assignee: Universiti Sains Malaysia
Priority date: 2011-09-05
Filing date: 2012-08-03
Publication date: 2013-03-14
Also published as: WO2013036101A9; MY170526A

Abstract

A method of detecting presence of a primary antibody reactive against rubber allergenic polypeptides in a serum sample comprises the steps of providing a platform fixed with rubber allergenic polypeptides having at 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10. SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16; bringing into contact the serum with the fixed rubber allergenic polypeptides to feasible binding of the primary antibody available in the serum onto the rubber allergenic polypeptides; reacting a secondary antibody towards any bound primary antibody upon washing off the serum, wherein the secondary antibody is capable of binding onto the primary antibody and anchored with a detectable moiety; and detecting presence of the detectable moiety to confirm available of the primary antibody in serum upon removal of the unreacted secondary antibody.

Description

RUBBER ALLERGENIC PROTEINS AND IMMUNOASSAY DERIVED

THEREOF

FIELD OF INVENTION

he present invention relates to rubber allergenic proteins and genes encoding for these proteins. Specifically, the present invention discloses amino acid Sequences of these proteins and facilitates development of various immunoassays thereof using these proteins. BACKGROUND OF THE INVENTION

Prevalence of the allergic reaction pertaining use of latex products such as gloves is increasing every year. In normal cases, the sensitized subject develops type I hypersensitivity particularly contact urticaria upon wearing or using the latex products. While, in some rare cases, anaphylactic reaction may happen to the subject and such reactions can be life-tlireatening. Occurrence of the allergy, besides owing to genetic makeup of the sensitized users themselves, can be largely attributed to the presence of various proteins residues' on the latex product after the manufacturing process. These proteins residues mainly derive from proteins found in natural rubber latex and being degraded along the manufacturing process. Though there are hundreds of proteins suspended in the natural rubber latex, only small amount of these proteins cause allergy to the user of latex product.

Considering the potential threat posed to the product user especially health care workers, product manufacturer addresses this problem by carrying out additional treatment to reduce the amount of total proteins in the collected latex. Generally, the latex protein removal treatment involves either en2ymatic protein degradation or SEQuential dilution. Apart from reducing the protein content, no information about the amount of allergenic rubber proteins still present in the treated latex. The total protein content in the treated latex may be reduced, yet significant amount of allergenic proteins is likely retained in the latex especially when there exits condition^' prompting extreme raise in allergenic protein synthesis in rubber tree. Such extreme raise can be stimulated by both extrinsic and intrinsic factors like chemical stimulants, tapping frequency, season, disease state, clone type and the like. Thus, it is desired to have a reliable assay or platform to assist for accurately assessing allergenic proteins present in the treated or non-treated latex or products manufactured thereof. Ideally, the mentioned assaying platform adapts immuno-based technology to attain qualitative or quantitative assessment on rubber allergenic proteins. To realize and commercialize the mentioned assay or platform, stable supply on various rubber allergenic proteins and related antibodies are needed. With the advance in technology, in vitro production of these proteins or partial peptides through genetic approaches is one of the possible ways to realize the immunoassay-based platform.

SUMMARY OF THE INVENTION

One of the objects of the present invention aims to provide gene Sequences encoding for various rubber allergenic proteins. These Sequences allow mass production of the encoded proteins for commercialization of immunoassays to qualitative and/or quantitative identify presence of antibodies reactive against these proteins in a subject.

Another object of the present invention is to disclose amino acid Sequences of the various rubber allergenic proteins which can be used for production of antibodies via immunizing a suitable host. The produced antibodies in turn are utilized for qualitative and/or quantitative determination of the allergen level in a latex product or latex used for manufacturing the product.

Further object of the present invention is to provide an immunoassay for determining allergy in a subject towards the mentioned rubber allergenic proteins. More preferably, the disclosed immunoassays also offer identification of the specific type of rubber allergenic proteins inducing the allergy. Preferably, the immunoassay kit

At least one of the preceding objects is met, in whole or in part, by the present invention, in which one of the embodiments of the present invention includes isolated polynucleotides encoding for allergenic polypeptide found in latex of the plant Hevea brasiliensis comprising nucleotide Sequence as setting forth in SEQ ID No. 1, SEQ

SUBSTITUTE SHEET ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 1 1, SEQ ID No. 13, or SEQ ID No. 15.

In another aspect, the present invention also discloses an isolated allergenic polypeptide derived from the plant Hevea brasiliensis comprising amino acid Sequence as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16.

To facilitate in vitro production of the allergenic polypeptide, the present invention includes as well an expression construct capable of expressing polypeptide containing at least 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16. Preferably, the expression construct has inserted DNA or cDNA with SEQuential nucleotide as setting forth in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 1 1, SEQ ID No. 13, or SEQ ID No. 15 to respectively express polypeptides of SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16

Still, another embodiment of the present invention pertaining to a method of detecting presence of a primary antibody reactive against rubber allergenic polypeptides in a serum sample comprising the steps of providing a platform fixed with rubber allergenic polypeptides having at 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16; bringing into contact the serum with the fixed rubber allergenic polypeptides to feasible binding of the primary antibody available in the serum onto the rubber allergenic polypeptides; reacting a secondary antibody towards any bound primary antibody upon washing off the serum, wherein the secondary antibody is capable of binding onto the primary antibody and anchored with a detectable moiety; and detecting presence of the detectable moiety to confirm available of the primary antibody in serum upon removal of the unreacted secondary antibody. Preferably, in another embodiment, an immunoassay kit is disclosed. It comprises a platform having a plurality of discrete spots that each spot is anchored with polypeptide probes readily to bind with a reactive antibody in a sample to form a bound construct upon performing the binding in a predetermined condition; and a conjugating solution containing a reporter moiety for attaching onto the bound construct through the reactive antibody that the reporter moiety is able to emit a detectable signal with or without reacting with a substrate; wherein the polypeptide probes containing at least 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16. A pretreatment solution for pre-treating the sample prior to the binding maybe provided in another embodiment.

In another aspect, the present invention discloses a monoclonal antibody against allergenic polypeptide derived from the plant Hevea brasiliensis comprising amino acid sequence as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows polynucleotide Sequence SEQ ID No.l encoding one of the homologues of the Hev b 3 and the SEQ ID No.2 is the corresponding encoded polypeptides;

Figure 2 shows polynucleotide Sequence SEQ ID No.3 encoding one of the homologues of the Hev b 7 and the SEQ ED No.4 is the corresponding encoded polypeptides;

Figure 3 shows polynucleotide Sequence SEQ ID No.5 encoding one of the homologues of the Hev b 8 and the SEQ ID No.6 is the corresponding encoded polypeptides; Figure 4 shows polynucleotide Sequence SEQ ID No.7 encoding one of the homologues of the Hev b 9 (Enloase) and the SEQ ID No.8 is the corresponding encoded polypeptides; Figure 5 shows polynucleotide Sequence SEQ ID No.9 encoding one of the homologues of the Hev b 10 (Mn-superoxide dismutase) and the SEQ ID No.10 is the corresponding encoded polypeptides;

Figure 6 shows polynucleotide Sequence SEQ ID No.11 encoding one of the homologues of the chitinase and the SEQ ID No.12 is the corresponding encoded polypeptides;

Figure 7 shows polynucleotide Sequence SEQ ID No.13 encoding one of the homologues of the Pseudo-hevein and the SEQ ID No.14 is the corresponding encoded polypeptides;

Figure 8 shows polynucleotide Sequence SEQ ID No.15 encoding one of the homologues of the Ig-E binding protein and the SEQ ID No.16 is the corresponding encoded polypeptides;

Figure 9 is the electrophoresed agarose gel image showing the PCR amplification result of Hev b 7 in which Lane 1 is Hevb 3, Lane 2 is positive control and 3 is negative control and Lane M- is lkbp DNA ladder Marker (Promega);

Figure 10 is the electrophoresed agarose gel image showing the PCR amplification result of the Profilin (Hev b 8) in which Lane 1 is Profilin (Hev b 8), Lane 2 is positive control and 3 is negative control and Lane M- is lkbp DNA ladder Marker (Promega);

Figure 11 is the electrophoresed agarose gel image showing the PCR amplification result of the Enolase (Hev b 9) in which Lane 1 is Profilin (Hev b 8), Lane 2 is positive control and 3 is negative control and Lane M- is lkbp DNA ladder Marker (Promega); is the electrophoresed agarose gel image showing the PCR amplification result of the Mn-superoxide dismutase (Hev b 10) in which Lane 1 is Mn-superoxide dismutase (Hev b 10), Lane 2 is positive control and 3 is negative control and Lane M- is lkbp DNA ladder Marker (Promega); is the electrophoresed agarose gel image showing the PCR amplification result of the Chitinase in which Lane 1 is Chitinase, Lane 2 is positive control and 3 is negative control and Lane M- is lkbp DNA ladder Marker (Promega); is the electrophoresed agarose gel image showing the PCR amplification result of the Pseudo-hevein in which Lane 1 is Pseudo- hevein, Lane 2 is positive control and 3 is negative control and Lane M- is lkbp DNA ladder Marker (Promega); and Figure 15 is the electrophoresed agarose gel image showing the PCR amplification result of the IgE-binding protein in which Lane 1 is IgE- binding protein, Lane 2 is positive control and 3 is negative control and Lane M- is lkbp DNA ladder Marker (Promega). DETAILED DESCRIPTION OF THE INVENTION

One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The embodiment describes herein is not intended as limitations on the scope of the invention.

The term "gene" is defined as the genomic Sequence of the plant Hevea brasiliensis particularly polynucleotide Sequences encoding polypeptide Sequences of the rubber allergenic proteins Hev b 3 , Hev b 7, Profilin (Hev b 8), Enolase Hev b (9), Mn- superoxide dismutase (Hev b 10), Chitinase (Hev b 11), Pseudo-hevein or IgE- binding protein. The term "polynucleotide", as used herein, is a nucleic acid containing a Sequence that is greater than about 100 nucleotides in length.

The term "isolated polynucleotide" or "isolated nucleotide Sequence" used herein refers to polymer of RNA or DNA acquired from biological sample or produced chemically via any known method in the art. The polymer can be single- or double- stranded.

The term "oligonucleotide", as used herein, is a short polynucleotide or a portion of polynucleotide which preferably comprises from about 8 to 35 nucleotides. In respect to the embodiment of the present invention, nucleotides contained within the oligonucleotides can be analogs or derivatives of naturally occurring nucleotides.

The abbreviation used throughout the specification to refer to nucleic acids comprising nucleotide Sequences are the conventional one-letter abbreviations. Thus, when included in a nucleic acid, the naturally occurring encoding nucleotides are abbreviated as follows: adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Also, unless otherwise specified, nucleic acid Sequences that are presented as a series of one-letter abbreviations are presented in the 5 3 'direction. As used herein, the term "complementary" and derivatives thereof are used in reference to pairing of nucleic acids by the well-known rules that A pairs with T or U and C pairs with G. Complement can be "partial" or "complete". In partial complement, only some of the nucleic acid bases are matched according to the base pairing rules; while in complete or total complement, all the bases are matched according to the paring rule. The degree of complement between the nucleic acid strands may have significant effects on the efficiency and strength of hybridization between nucleic acid strands as well known in the art. This may be of particular in detection method that depends upon binding between nucleic acids.

As in setting forth, one embodiment of the present invention is an isolated polynucleotides encoding for allergenic polypeptide found in latex of the plant Hevea brasiliensis comprising nucleotide sequence as setting forth in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9, SEQ ID No. 1 1, SEQ ID No. 13, or SEQ ED No. 15. Correspondingly, the respective allergenic polypeptide encoded by these nucleotide Sequences shall possess amino acid Sequence as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16.

In one embodiment, the 615 -bp-long polynucleotides depicted in SEQ ID No.l is the full-length cDNA clone encoded Hev b 3 protein exhibiting an open reading frame encoding a 204-amino acid polypeptide, as in SEQ ID No.2, with a predicted molecular mass of 22.3 kD. Through SMART analysis of SEQ ID No.l, it reveals presence of a Pfam domain in the Sequence that the Pfam domain is commonly found in 'REF' (rubber elongation factor). The protein family with the Pfam domain consists of the highly related rubber elongation factor (REF), small rubber particle protein (SRPP) and stress-related protein (SRP). REF and SRPP are released from the rubber particle membrane into the cytosol during osmotic lysis of the sedimentable organelles (lutoids). The exact function of this family is unknown. Further, the Hev b 3 forms an integral part of the small rubber particles of 70 nm or less. This protein showed strong IgE binding activity in sera from patients with latex allergy and spina bifida.

Preferably, the 1167bp-long polynulceotides shown in SEQ ID No.3 is a full-length cDNA clone encoded for Hev b 7 protein exhibiting an open reading frame encoding a 388-amino acid polypeptide, as shown in SEQ ID No.4, with a predicted molecular mass of 42.8 kD. Similarly, in SMART analysis, the SEQ ID No.3 reveal the presence of another Pfam domain, namely patatin. Patatin domain is structurally and functionally related to the animal cytosolic phospholipase A2 (PLA2; EC 3.1.1.4) . This domain is found in the patatin glycoproteins from the total soluble protein in potato tubers. Patatin is a storage protein but it also has the enzymatic activity of lipid acyl hydrolase, catalysing the cleavage of fatty acids from membrane lipids. The active site includes an oxyanion hole with a conserved GGxR motif; it is found in 'almost all the members of this family. The catalytic dyad is formed by a serine and an aspartate. Patatin belongs to the alpha-beta hydrolase family which is identified by a characteristic nucleophile elbow with a consensus Sequence of Sm-X-Nu-Sm (Sm = small residue, X = any residue, and Nu = nucleophile). In another aspect, polynucleotides encoding for Profilin or Hev b 8 has about 396bp as illustrated in SEQ ID No.5 while the encoded protein is a 131-amino acid polypeptide with a predicted molecular mass of 14 kD as depicted in SEQ ID No.6. The SEQ ID No.5 preserves a Pfam domain, namely 'PROF'. Overall Sequence Similarity among profilin from organisms which belong to different phyla (ranging from fungi to mammals) is low, but the N-terminal region is relatively well conserved. That region is thought to be involved in the binding to actin.

Further, rubber allergenic protein Enolase or Hev b 9 is encoded in the 1221 -bp-lbng SEQ ID No.7 which exhibits an open reading frame encoding a 406-amino acid polypeptide, shown in SEQ ED No.8, with a predicted molecular mass of 43.3 kD. Pfam domain is found in SEQ ED No.7 also. Enolases are homodimeric enzymes that catalyse the reversible dehydration of 2-phospho-D-glycerate to phosphoenolpyruvate as part of the glycolytic and gluconeogenesis pathways. The reaction is facilitated by the presence of metal ions.

Still, in another aspect, the 621 -bp-long SEQ ED No.9 encodes for Mn- superoxide dismutase or Hev b 10 protein of Hevea brasiliensis. The corresponding encoded polypeptides is constituted of 206 amino acid with a predicted molecular mass of 22.5 kD having amino acid sequence as illustrated in SEQ ED No.10. Superoxide dismutases (SODs) catalyse the conversion of superoxide radicals to molecular oxygen in Hevea brasiliensis to destroy the radicals which are normally produced within cells and being toxic to biological systems. Still, in another aspect, the 936 -bp-long SEQ ID No.11 encodes for Chitinase which is composed of 310 amino acids, shown in SEQ ID No.12, with a predicted molecular mass of 33.6 kD and a preserved Pfam domain akin to O-Glycosyl hydrolases. O- Glycosyl hydrolases are a widespread group of enzymes that hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non- carbohydrate moiety. A classification system for glycosyl hydrolases, based on Sequence similarity, has led to the definition of 85 different families. Another rubber allergenic protein, Pseudo-hevein, is encoded in the 288 -bp-long SEQ ID No.13 which is a full-length cDNA clone encoded exhibiting an open reading frame encoding a 95-amino acid polypeptide, shown in SEQ ID No.14, with a predicted molecular mass of 10.5 kD as illustrated in SEQ ID No.15. SMART analyses of SEQ ID No.13 reveal the presence of a Pfam domains

Further, a 546-bp-long polynucleotides as shown in SEQ ED No.15 encodes IgE- binding protein exhibiting an open reading frame encoding a 182-amino acid polypeptide, shown in SEQ ID No.16, with a predicted molecular mass of 20.4 kD. SMART analyses of SEQ ED No.15 reveal the presence of a Pfam domains, i.e., 'Sod_Fe'.

In order to employ the above described polynucleotide sequence for expressing the corresponding encoded polypeptides, the present invention disclosed an expression construct capable of expressing polypeptide containing at least 70% sequential amino acids as setting forth in SEQ ED No. 2, SEQ ED No. 4, SEQ ED No. 6, SEQ ID No. 8, SEQ ED No. 10, SEQ ID No. 12, SEQ ED No. 14, or SEQ ED No. 16. It is important to be noted that the encoded proteins or polypeptides are not necessarily expressed in full length for carrying out the desired implications such as immunoassay. In view of this, some embodiments pertaining the disclosed expression construct may thus only contains facilitate expression of a polypeptides with at least 70% sequential amino acids of the mentioned proteins. The expression construct described herein shall refer to expression vector imparted with promoter region. In another embodiment, the disclosed invention provides a method of detecting presence of a primary antibody reactive against rubber allergenic polypeptides in a serum sample comprising the steps of providing a platform fixed with rubber allergenic polypeptides having at 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ED No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16; bringing into contact the serum with the fixed rubber allergenic polypeptides to feasible binding of the primary antibody available in the serum onto the rubber allergenic polypeptides; reacting a secondary antibody towards any bound primary antibody upon washing off the serum, wherein the secondary antibody is capable of binding onto the primary antibody and anchored with a detectable moiety; and detecting presence of the detectable moiety to confirm available of the primary antibody in serum upon removal of the unreacted secondary antibody. The primary antibody is naturally presented in the serum of a subject allergic to the corresponding rubber allergenic protein, while the secondary antibody are anti-antibody of the primary antibody which can be monoclonal or polyclonal derived.

One skilled in the art shall appreciate the fact that the allergenic polypeptides may possess various epitopes to be bound by the reactive antibodies therefore other polypeptides with partial sequence, preferably with at least 70% sequential amino acids identical to the sequence setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ED No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16 are capable of carrying out the mentioned method. Truncated polypeptides containing recognizable epitopes shall be included in the disclosed method as well. Platform in the disclosed method shall refer to any chemically inert articles facilitating anchorage of the disclosed allergenic polypeptides such as polystyrene plate or nitrocellulose membrane. In further embodiment, the detectable moiety is a flurophore or catalytic conjugate that the detectable moiety alone or in combination with other components emit a signal to reveal its presence upon successfully binding onto the polypeptides fixed on the platform. The catalytic conjugate is preferably an enzyme such as horseradish peroxidase. Preferably, in another embodiment, an immunoassay kit is disclosed using the immunoassay described above. It comprises An immunoassay kit comprising a platform having a plurality of discrete spots that each spot is anchored with polypeptide probes readily to bind with a reactive antibody in a sample to form a bound construct upon performing the binding in a predetermined condition; and a conjugating solution containing a reporter moiety for attaching onto the bound construct through the reactive antibody that the reporter moiety is able to emit a detectable signal with or without reacting with a substrate; wherein the polypeptide probes containing at least 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16. Preferably, the disclosed immunoassay kit employs a dot-blot approach for detecting presence of reactive antibody in a serum sample. A pretreatment solution for pre-treating the sample prior to the binding maybe provided in another embodiment.

According to another preferred embodiment, the present invention also discloses monoclonal antibody reactive against allergenic polypeptide derived from the plant Hevea brasiliensis, wherein the allergenic polypeptides comprises amino acid sequence as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16. The derived monoclonal antibodies are useful tools for detecting presence the allergenic protein in the produced latex. Moreover, qualitative assessment to know precise amount or concentration of the mentioned allergenic polypeptides in the latex can be performed probably through titration and the like. The following example is intended to further illustrate the invention, without any intent for the invention to be limited to the specific embodiments described therein.

Example 1

PCR amplification, Cloning and Sequencing of allergen genes, Hev b 3 , Hev b 7, Profilin (Hev b 8), Enolase Hev b (9), Mn-superoxide dismutase (Hev b 10), Chitinase (Hev b 11), Pseudo-hevein and IgE-binding protein, from Hevea brasiliensis RRIM 600.

Total RNA was isolated from the young/tender leaves of 8 months old Hevea brasiliensis cultivar RRIM 600 using QIAGEN- RNeasy Mini Kit according to the manufacturer's instructions. The quality or the integrity of the RNA was checked by agarose gel electrophoresis and was quantified using Thermo Scientific Nano Drop 2000 as per standard procedures taking. cDNA first strand was synthesised using Superscript® VILO™ cDNA Synthesis Kit (Invitrogen) following the manufacturer's instructions. The gene was amplified from the cDNA by PCR using the gene specific primers for Hev b 3 , Hev b 7, Profilin (Hev b 8), Enolase Hev b (9), Mn-superoxide dismutase (Hev b 10), Chitinase (Hev b 11), Pseudo-hevein and IgE-binding protein, respectively. The PCR reaction (50 xL) contained 1 μΐ. of cDNA, 20 pmoles of each primers, 5 μΐ, of 10X Pfu Buffer, 5 μΐ, of 2.5 mM dNTP mix and 1.0 unit of PfuTurbo® DNA polymerase (Stratagene). PCR was carried out in Veriti™ Thermal Cycler (Applied Biosystems) using the following conditions. Initial denaturation for 5 min at 95°C followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 54-55°C for 30 sec and extension at 72°C for 1 to 2.0 min depending on the length of the targeted gene, with a final extension at 72°C for 7 min. The PCR product was analysed by 1% agarose gel using IX TAE buffer and the amplicon was eluted from the gel using GENECLEAN® TURBO Gel band elution kit (MP Biomedicals) following the manufacturer's instructions. The purified PCR product was ligated into pCR® 4 Blunt TOPO® Vector (Invitrogen) / Clone JET PCR cloning Kit and transformed into One Shot® Machl™-T1R Chemically Competent E. coli cells (Invitrogen). Plasmids were isolated from putative colonies using QIAprep Spin® Miniprep Kit (Qiagen) following the manufacturer's instructions. The presence of the insert was checked by using using the gene specific primers and positive plasmids were subjected to SEQuencing. Actin gene used as a positive control.

Oligonucleotides Sequences used as primers for PCR. SI. Annealing No. temp used

Gene

Primer Sequence

in PCR

1. Hev b3 Forward ATGGCTGAAGAGGTGGAGG 54°C

Reverse TTATGATGCCTCATCTCCAAAC

2. Hev b7 Forward ATGGCTACTGGTAGTACTAC 52°C

Reverse TCATTTGAGTTGACGGAGCTT

3. Profilin Forward ATGTCGTGGCAAACGTACGT 52°C

(Hev b 8) Reverse CTACAGGCCTTGATCAAGGAG

4. Enolase Forward ATGGCGACTACCATCGTCT 52°C

(Hev b 9) Reverse CTAATAGGGTTCGACAGGTGTG

5. Mn-superoxide Forward ATGGCTCTGCGATCTCTAGTG 52°C

dismutase

(Hev b 10) Reverse TTAAAGACAGAAGTTCACCTG

6. Chitinase Forward ATGGCCAAAAGAACCCAAG 52°C

Reverse TCAAAGTACTGTCATACAC

7. Pseudo-hevein Forward ATGTATGGCTGGACTGC ATTC 52°C

Reverse TTAATTAATGTACTGATGATC

8. IgE-binding Forward ATGCAGCTTCATCACCAGAAAC 52°C

protein Reverse CTAAGATGAAGGGCATTCTTTCG

*Positive control Actin gene Forward: CAGTGGTCGACAACTGGTAT

Reverse: TCCTCCAATCCAGACACTGT Example 2

Analysis of the Sequence

The nucleotide Sequence and the aminoacid Sequences were analysed by BLASTN and BLASTP programmes respectively. Phylogenetic analysis was carried out using the Neighbour Joining (NJ)

Claims

1. An isolated polynucleotides encoding for allergenic polypeptide found in latex of the plant Hevea brasiliensis comprising nucleotide Sequence as setting forth in SEQ ID No. 1, SEQ ID No. 3, SEQ ID No. 5, SEQ ID No. 7, SEQ ID No. 9,

SEQ ID No. 11, SEQ ID No. 13, or SEQ ID No. 15.

2. An isolated allergenic polypeptide derived from the plant Hevea brasiliensis comprising amino acid Sequence as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ED No. 12, SEQ ID

No. 14, or SEQ ID No. 16.

3. An expression construct capable of expressing polypeptide containing at least 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ED No.

14, or SEQ ID No. 16.

4. A method of detecting presence of a primary antibody reactive against rubber allergenic polypeptides in a serum sample comprising the steps of

providing a platform fixed with rubber allergenic polypeptides having at 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16;

bringing into contact the serum with the fixed rubber allergenic polypeptides to feasible binding of the primary antibody available in the serum onto the rubber allergenic polypeptides;

reacting a secondary antibody towards any bound primary antibody upon washing off the serum, wherein the secondary antibody is capable of binding onto the primary antibody and anchored with a detectable moiety; and detecting presence of the detectable moiety to confirm available of the primary antibody in serum upon removal of the unreacted secondary antibody.

5. A method of claim 4, wherein the detacable moiety is a flurophore or catalytic conjugate.

6. A method of claim 4 further comprising the step of reacting a substrate with the detectable moiety, wherein the detectable moiety is an enzyme.

7. An immunoassay kit comprising

a platform having a plurality of discrete spots that each spot is anchored with polypeptide probes readily to bind with a reactive antibody in a sample to form a bound construct upon performing the binding in a predetermined condition; and

a conjugating solution containing a reporter moiety for attaching onto the bound construct through the reactive antibody that the reporter moiety is able to emit a detectable signal with or without reacting with a substrate;

wherein the polypeptide probes containing at least 70% sequential amino acids as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16.

8. A immunoassay kit of claim 7 further comprising a pretreatment solution for pre-treating the sample prior to the binding.

9. A monoclonal antibody reactive against allergenic polypeptide derived from the plant Hevea brasiliensis, wherein the allergenic polypeptide comprises amino acid sequence as setting forth in SEQ ID No. 2, SEQ ID No. 4, SEQ ID No. 6, SEQ ID No. 8, SEQ ID No. 10, SEQ ID No. 12, SEQ ID No. 14, or SEQ ID No. 16.