WO2013032905A1 - Modulating wnt activity by targeting gpr177 - Google Patents

Abstract

Provided herein are methods of decreasing Wnt signaling in a cell, comprising contacting the cell with a GPR177 inhibitor. Further provided are methods for increasing Wnt signaling in a cell, comprising contacting a cell with a GPR177 agonist. Methods for identifying GPR177 inhibitors and GPR177 agonists are also provided.

Description

MODULATING WNT ACTIVITY BY TARGETING GPR177

FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

The invention was made with government support under grant numbers CA 106308 and DEO 15654 awarded by the National Institutes of Health and grant number W81XH-07- 1-0405 awarded by the USAMRMC Breast Cancer Research Program. The government has certain rights in the invention.

BACKGROUND

Wingless-int (Wnt) proteins are important secreted signaling molecules that regulate numerous interactions in the cell and affect diverse biological processes from embryogenesis to cancer. These proteins are involved in the Wnt signaling pathway. Aberrant regulation of the Wnt signaling pathway is linked to cancer and other diseases.

SUMMARY

Provided herein is a method of decreasing Wnt signaling in a cell, comprising contacting the cell with a GPR177 inhibitor, wherein the cell has increased Wnt signaling. The cell can have increased Wnt signaling as compared to a control. Further provided is a method of increasing Wnt signaling in a cell, comprising contacting a cell with a GPR177 agonist, wherein the cell has decreased Wnt signaling. The cell can have decreased Wnt signaling as compared to a control. Further provided is a method of treating a Wnt signaling disorder in a subject, comprising administering to the subject a GPR177 inhibitor. Also provided is a method of treating a Wnt signaling disorder in a subject, comprising administering to the subject a GPR177 agonist. Further provided are methods of identifying a GPR177 inhibitor and methods of identifying a GPR177 agonist.

DESCRIPTION OF THE DRAWINGS

Figure 1 shows that Gprl77 is dynamically expressed in mammary development. The expression of Gprl77 in the luminal and basal/myoepithelial cells was analyzed by

coimmunostaining with K18 (A-D, I-L) and SMA (E-H, M-P), respectively. Sections of the virgin 1 month (vlM; A-H) and 2 month (v2M; I-P) mammary gland were coimmunostained with Gprl77 (green) and cell type-specific marker (red) and counterstained with DAPI (blue). Scale bars, 50 μιη (A-P).

Figure 2 shows that MMTV-Cre transgene induces site-specific recombination in mammary development, β-gal staining in whole mounts (A-F) and sections (G-I) demonstrates the efficacy of Cre- mediated recombination mediated by MMTV-Cre at P0 (A), P7 (B, G), P14 (C), v3W (D), vlM (E, H) and v2M (F, I). Double labeling with β-gal staining and

immunostaining of the cellular marker in black indicates that the Cre activity is detected in mammary cells positive for K18 (J, M), K14 (K, N) and SMA (L, O). Scale bars, 500 μιη (A-F); 100 μιη (G); 50 μιη (H-O).

Figure 3 shows that Gprl77 is essential for mammary morphogenesis. Whole mount staining of the number four mammary glands reveals severe developmental defects associated with inactivation of GprlW by MMTV-Cre (Gprl77^MMTV) at vlM (A-C) and v2M (D-F).

Asterisks and bracket indicate the residual epithelial components detected in the Gprl 77™™ mutant. Arrows indicate the presence of TEB in the vlM control littermates. Enlargements of the insets (A- F) are shown in A'-F'. LN, lymph node. The average number of TEB (G) and branching (H), as well as the percentage of ductal occupancy (I), were examined in control (genotype: MMTV-Cre;

Gpr 177Fx/+, Gpr 177Fx/Fx or Gprl 77Fx/+) and Gpr 177"" for quantitative analysis (n=3). Scale bars, 2 mm (A-F).

Figure 4 shows that the loss of Gprl 77 impairs mammary cell proliferation and differentiation. Cells undergoing mitotic division are detected by immunostaining of Ki67 (A, B) and pHH3 (C, D) in the mammary gland at one month. Sections were immunostained with the antibody (black) and counterstained with Hematoxylin. Arrows indicate cells positive for immunostaining. Immunostaining of K14 (E, F), Cadherin (G, H), K14 (I, J) SMA (K, L) and Gpr77 (M,N) characterizes the effect of the Gprl 77 deletion on specification of mammary cell types. Scale bars, 100 μιη (A, B); 50 μιη (C-L).

Figure 5 shows that Gprl77 regulates Wnt production and signaling essential for mammary development. (A) RT-PCR analyzes the Wnt transcripts present in the primary mammary epithelial cells (MEC) isolated from the P21 control and Gprl77^MMTV glands.

Immunostaining of WntlOa (B, C) and an activated form of β-catenin (Act. β-cat, D, E) reveals that Wnt signaling, but not Wnt expression, is affected by Gprl 77 deficiency. (F-I) Wnt production and signaling are analyzed by the use of mouse L (-) and L-Wnt3a (Wnt3a) cell lines. (F) Immunoblot analysis reveals that the secretion of Wnt is prohibited by the knockdown of Gprl 77 in the signal-producing cells. (G) Relative luciferase activity (RLA) analysis of the signal -receiving cells, harboring the TOPFlash reporter, detects the presence of canonical Wnt proteins in the signal producing cell media. (H) Immunoblot analysis shows the transient expression of the myc tagged Wntl (MT-Wntl) and endogenous (Gprl 77) and myc-tagged Gprl 77 (MTGprl77) in the signal-producing cells, and the level of activated β-catenin (Act. β- cat) in the signal-receiving cells. The level of actin and total β-catenin (β-cat) is used as loading control. (I) RLA analysis of TOPFlash examines the canonical Wnt signal present in the condition media. Scale bars, 50 μιη (B-E). Figure 6 shows that Gprl77 is essential for Wnt-mediated self-renewal and proliferation of mammary stem cells. (A) Statistical analysis shows the percentage of mitotic cells positive for immunostaining of Ki67 in the control, MMTV-Wntl, MMTV-Wntl; Gprl77^MMTV mammary gland. (B) Mammosphere analysis examines the self-renewing and proliferation abilities of MaSCs in primary (1°) and secondary (2°) cultures of control, MMTV-Wntl and MMTV-Wntl; Gprl77^MMTV. The effect of IWP-2 on the Wnt-mediated stem cell self-renewal and proliferation is also investigated by mammosphere analysis. Data represent the mean + SEM in three independent experiments. Asterisks indicate the p value (lo: *, < 0.0062, **, < 0.0022, ***, < 0.0283 and 2o: *, < 0.0004, **, < 0.0024, < 0.0076). (C) Diagram illustrates the average size of spheres is not significantly different in the control (131.9 + 6.9), MMTV-Wntl (124.8 + 3.2), MMTV-Wntl ; Gprl77MMTV (124.2 + 4.3), MMTV-Wntl +IWP-2 (151.5 + 6.4) cultures.

Figure 7 shows that Gprl77-mediated Wnt production is essential for Wnt-induced mammary hyperplasia. (A-F) Whole mammary gland staining of the v2M control (A, D;

genotype: Gprl77Fx/+), MMTV-Wntl (B, E; genotypes: MMTV-Wntl; Gprl77Fx/+,

MMTVWntl ; Gprl 77Fx/Fx or MMTV-Wntl ; MMTV-Cre; Gpr 177Fx/+), MMTV-Wntl ;

Gprl77^MMTV (C, F; genotypes: MMTV-Wntl; MMTV-Cre; Gprl77Fx/Fx) littermates reveals that inactivation of Gprl77 prohibits mammary hyperplasia caused by Wntl overexpression. (G) Whole mount staining of the number four mammary glands shows evidence of mammary hyperplasia in the MMTV-Wntl, but not control, mice at vlM and v2M. Injection of IWP-2 (250 nmol) once every three days for 30 days is able to ameliorate the hyperplastic phenotype caused by aberrant expression of Wntl (n=5/6). LN, lymph node. Scale bar, 2 mm (A-C); 500 μιη (D- G).

Figure 8 shows that Gprl77 deficiency alleviates the abnormalities of mammary cell types caused by aberrant Wnt expression. (A-R) Sections of the v2M control (A, D, G, J, M, P), MMTV-Wntl (B, E, H, K, N, Q; genotype: MMTV-Wnt or MMTV-Wntl ; MMTV-Cre;

Gprl77Fx/+), MMTV-Wntl ; Gprl77^MMTV (C, F, I, L, O, R) are analyzed by H&E staining (A- C) and immunostaining of Gprl77 (D-F), K6 (G-I), K14 (J-L), K18 (M-O), SMA (P-R). Scale bar, 50 μιη (A-R).

Figure 9 shows that inactivation of Gprl 77 abolishes mammary tumorigenesis induced by Wnt. The graph represents the analysis of tumor development in mice, carrying MMTV-Wntl transgene in Gprl 77+/+ (n=19), Gprl77+/- (n=15), MMTV-Cre; Gprl77Fx/+ (n=10) and MMTV- Cre; Gprl77Fx/Fx (Gprl77MMTv; n=l 1) backgrounds in a nine-month observation period.

Figure 10 shows that Gprl77 is essential for development of the skeleton. (A-F) Skeletal staining of the E15.5 Gprl77^Dermo1 (D), Gprl77°^sx (E) and Gprl77^Co11 (F) embryos, and their littermate controls (A-C) reveals that the presence of GprlW in the mesenchymal but not the osteoprogenitor cells is required for development of the craniofacial skeleton mediated by intramembranous ossification. Arrowheads and asterisks indicate impaired development of the calvarial bones (F, frontal; P, parietal) and the maxilla and mandible, respectively. Skeletal staining of the E15.5 Gprl77^Dermo1 (J-L) and Gprl77^Co12 (P-R) embryos, and their littermate controls (G-I, M-O) shows the requirement of Gprl77 in the mesenchymal and chondrocytes for development of the body skeleton mediated by endochondral ossification. Arrows indicate defective development of the forelimb and hindlimb. Fe, Femur; Fi, Fibula; H, Humerus; R, Radius; Ti, Tibia; U, Ulna. Scale bars, 1 mm (A-F); 2 mm (G, J, M, P); 500 μηι (H, I, K, L, N, O, Q, R).

Figure 11 shows frontal bone mineralization, as assessed by von Kossa staining (A-F), in the El 5.5 Gprl77^Dermo1 (B), Gprl77°^sx (D), Gprl77^Co11 (F) embryos and their littermate controls (A, C, E). Arrow indicates impaired development of the frontal bone. Sections of the El 5.5 control (G, I, K, M), Gprl77^Dermo1 (H, J) and Gprl77^Co12 (L, N) forelimbs were stained by von Kossa (G, H, K, L) and alcian blue (I, J, M, N) to examine development of the humerus. Scale bars, 500 μιη (A-F); 200 μιη (G-N).

Figure 12 shows that the loss of Gprl77 impairs osteoblastogenesis. Coronal sections of the E15.5 control (A-D) and Gprl77^Dermo1 (E-H) frontal bones were analyzed by immunostaining of Runx2 (A, E) and Osterix (Osx; B, F), and in situ hybridization of Coll al (C, G) and

Osteocalcin (OC; D, H). Frontal bone formation occurs in the skeletogenic mesenchyme extending apically from the skull base to the midline in the controls (brackets), but absent in the mutants. Scale bars, 500 μηι (A-H).

Figure 13 shows that expansion of osteoblast precursors is affected by the Gprl77 ablation.

Coronal sections of the El 5.5 control (A-C) and Gprl77^Dermo1 (D-F) frontal bones were double labeled with Ki67 (A, C, D, F) and Runx2 (B, C, E, F) to detect cells undergoing mitotic division and osteoprogenitors, respectively. (G) Graphs illustrate the percentage of mitotic cells positive for Ki67 that are Runx2 negative (undifferentiated mesenchymal cells) or

Runx2 positive (committed osteoprogenitors) affected by the deletion of Gprl77 (*, Rvalue <0.005, n=3). Br, brain; SM, skeletogenic mesenchyme; Sk, skin. Scale bars, 100 μιη (A-F).

Figure 14 shows that Gprl77 is required for Wnt production and signaling in

osteoblastogenesis. Coronal sections of the E15.5 control (A, D, G, J), Gprl77^Dermo1 (B, E, H, K) and Gprl77°^sx (C, F, I, L) frontal bones were analyzed by immunostaining of activated β- catenin (ABC) (A-F) and β-gal staining (G-L). Immunostaining of ABC examines the signaling activity of the canonical Wnt pathway (A-F). Embryos heterozygous for the Axin2iacz (Ax2iacz) allele examine the expression of Axin2, a direct downstream target of Wnt/p-catenin signaling, in the control (G, I) and mutants (H, I, K, L). Enlargements of the insets in panels, A-C and G-I, are shown in D-F and J- L, respectively. Broken lines define the skeletogenic mesenchyme in the calvaria. (M- ) Coronal sections of the E15.5 frontal bone were analyzed by double labeling of Gprl77 and Osx. Osx- positive osteoprogenitors are localized to the skeletogenic mesenchyme extending apically from the skull base to the midline (M, O). Gprl77 is uniformly expressed in the skeletogenic mesenchyme (N, O). Brackets indicate the skeletogenic region positive for staining. Br, brain; Sk, skin; SM, skeletogenic mesenchyme. Higher power images (P-R) show the expression of Gprl77 in Osx- negative mesenchymal cells and Osx-positive osteoprogenitors (arrowheads). Coronal sections of the El 5.5 frontal bone heterozygous for Axin2iacz were used for expression analysis of Axin2 and Osx by β-gal staining (T, U) and fluorescent imaging (S, U), respectively. Broken lines define the skeletogenic mesenchyme in the calvaria. Scale bars, 500 μιη (A-C, G-I); 50 μιη (D-F, J-L); 100 μιη (M-O, S-U); 10 nm (P-R).

Figure 15 shows that the deletion of Gprl77 in the mesenchymal cells and chondrocytes affects chondrocyte proliferation. Sections of the El 5.5 control (A), Gprl77^Co12 (B) and Gprl77^Dermo1 (C) humeruses were immunostained with Ki67. (D) Graph represents the average percentage of Ki67 positive cells in epiphysis and columnar zones of the growth plate. Data showed the average with S.E.M. of measurements made in three nonadjacent sections from three different embryos per genotype.

Figure 16 shows that deletion of Gprl 77 in the skeletogenic mesenchyme disrupts endochondral ossification. Sections of the E15.5 control (A-E, K-O) and Gprl77^Dermo1 (F-J, P-T) forelimbs were analyzed by in situ hybridization of Col2al (A, F), IHH (B, G), CollOal (C, H), MMP9 (D, I), MMP13 (E, J), Runx2 (L, Q), Osx (M, R), Collal (N, S) and OC (Osteocalcin; O, T), and immunostaining of PEC AM- 1 (K, P). Arrows, arrowheads and asterisk indicate collar bone, perichondrium and primary spongiosa, respectively. H, hypertrophic chondrocytes; M, marrow cavity. Scale bars, 200 μιη (A-T).

Figure 17 shows that the presence of Gprl77 in the chondrocytes is necessary for endochondral ossification. Sections of the E15.5 control (A-E, K-O) and Gprl77Col2 (F-J, P-T) forelimbs were analyzed by in situ hybridization of Col2al (A, F), IHH (B, G), CollOal (C, H), MMP9 (D, I), MMP13 (E, J), Runx2 (L, Q), Osx (M, R), Collal (N, S) and OC (O, T), and immunostaining of PECAM-1 (K, P). Insets in panels B and G show prehypertrophic and hypertrophic chondrocytes, respectively. Bars denote the Ihh-expressing zone. Scale bars, 200 μηι (A-T).

Figure 18 shows that the deletion of Gprl 77 in the chondrocytes affects endochondral ossification. Sections of the El 7.5 control (A-F, M-R) and Gprl 77coi2 (G-L, S-X) forelimbs were analyzed by von Kossa (A, B, G, H) and alcian blue (C, I) staining, and in situ hybridization of Col2 (D, J), IHH (E, K), CollO (F, L), MMP9 (M, S), MMP13 (N, T), Runx2 (O, U), Osx (P, V), Coll (Q, W) and OC (R, X). Arrows denote the lack of collar bone in the mutants. Enlargements of the insets in panels, A and G, are shown in B and H, respectively. Scale bars, 200 μηι (A, C-F, G, I-X); 50 μηι (B, H).

Figure 19 shows that the canonical Wnt pathway is altered by the loss of Gprl77 during chondrogenesis. Sections of the E15.5 control (A-F, G, J, M), Gprl77^{Dermo1 (}H, K, N) and Gprl77^Co12 (I, L, O) humeruses were analyzed by immunostaining of Gprl77 (A-C, G-I) and ABC (D-F, J-L), and β-gal staining of the Axin2iacz allele (Ax2iacz; M-O). (P) Diagram illustrates the model for osteogenesis and chondrogenesis mediated by Wnt production and signaling. In osteoblast development, mesenchymal production of Wnt is essential for activation of β-catenin signaling in the mesenchymal cells and osteoprogenitors through inter- and intra-cellular mechanisms, respectively. In contrast, although Wnt produced in the mesenchymal cells plays an indispensable role, chondrocyte production of Wnt is mainly required for chondrogenesis. Scale bars, 50 μηι (A, C, D, F); 100 μηι (B, E, J-L); 200 μηι (G-I, M-O).

Figure 20 shows that Gprl77 is expressed in hair follicle development. Immunostaining of the El 1.5 (A) and E13.5 (B) skins shows the expression of Gprl77 in the epithelium and underlying mesenchyme. A restricted elevation is found in the epidermal basal cells and hair follicular cells at E15.5 (C) and E17.5 (D), respectively. Double labeling of Gprl77 (E-L) with AE3, a marker for the entire epidermis (E, G, I, K), or K14, a marker for the epidermal basal layer (F, H, J, L), identifies the Gprl77-expressing cells at El 4.5 (E, F, I, J) and El 7.5 (G, H, K, L). Scale bars, 50 μηι (A-L).

Figure 21 shows that epidermal deletion of Gprl77 abrogates the induction of hair follicles. β-gal staining of the E13.5 (A) and E14.5 K5-Cre; R26R embryos analyzes the effectiveness of Cre recombination in the epidermis and hair placode. Sections of the control (C, E, G, I, K, M, O) and

K.5

Gprm^{^} (D, F, H, J, L, N, P) embryos were analyzed by co immunostaining of Gprl77 and K14 (C, D) and hematoxylin/eosin staining (E-H) at E14.5 (C-F) and E17.5 (G, H). Whole mount in situ

K5

hybridization of the control (I, K, M, O) and Gprl 77 (J, L, N, P) embryos reveals the expression of Edar (I, J), Bmp2 (K, L), Bmp4 (M, N) and Shh (O, P) at E14.5. Genotype -Control: Gprl77Fx/Fx or K5-Cre; Gprl77Fx/+ and Gprl77^K5: K5-Cre; Gprl77Fx/Fx. Scale bars, 50 μηι (A-H); 200 μηι (I- P).

Figure 22 shows that multiple members of the Wnt family are expressed in developing embryonic skin. RTPCR analysis detects the transcript of Writs 2, 3, 4, 5 a, 6, 7a, 7b, 10a, 10b, 11 and 16, but not Writs 1, 2b, 3a, 5b, 8a, 8b, 9a and 9b in the E14.5 skins.

Figure 23 shows that Wnt expression and signaling are affected by the epidermal deletion of Gprl77. In situ hybridization in sections shows the expression of Wnt genes in the E14.5 control (A- K) and Gprl77^K5 (Α'-Κ') skins. Sections of control (L-O) and Gprl77^K5 (L'-O') skins examine the signaling activity of Wnt by immunostaining of an activated form of β-catenin (ABC) and β-gal staining of the Axin2i_acz allele at E13.5 (N, N'), E14.5 (L, L', O, O') and E17.5 (M, M'). In situ hybridization analyzes the expression of Wnt downstream targets, Lefl (P, P') and Dkk4 (Q, Q') in the E14.5 control (P, Q) and Gprl77 5 (Ρ', Q') skins. Genotype - Control: Gprl77Fx/Fx or K5-Cre; Gprl77Fx/+ and Gprl77 5: K5-Cre; Gprl77Fx/Fx. Scale bars, 50 μηι (A-Q, A'-Q').

Figure 24 shows that epidermal cell proliferation is affected by Gprl77 deficiency. Using BrdU incorporation assay, cells undergoing mitotic division are identified by immunostaining of

K5

BrdU in the E14.5 control (A) and Gprl77 (B) skins. Graph shows the percentage of proliferating cells positive for BrdU in the epidermis and dermis (C). Asterisk indicates that the reduction in the

K5 epidermis caused by the epidermal deletion of Gprl 77 is statistically significant (Gprl 77 :

23.91±0.01% and control: 34.03±0.03%; p value <0.01, n=3). TUNEL staining (D-F) and immunostaining of activated caspase3 (G-I) detect apoptotic cells in the skins (D, E, G, H) and dorsal root ganglia (DRG; F, I) of control (D, F, G, I) and Gprl77 5 (E, H) at El 4.5. Broken lines indicate the epidermal-dermal junction and the DRG. Genotype - Control: Gprl77Fx/Fx or K5-Cre;

Gprl77Fx/+ and Gprl77 5: K5-Cre; Gprl77Fx/Fx. Scale bars, 50 μιη (A, B, D-I).

Figure 25 shows that epidermal stimulation of β-catenin alleviates the hair follicle defects of Gprl77^K5. Sections of the control (A, D, G, J, M, P, S), Gprl77^K5 (B, E, H, K, N, Q, T) and

K5 K5

Gprl 77 ; sPcat (C, F, I, L, O, R, U) are analyzed by hematoxylin and eosin staining (A-C), immunostaining of Gprl 77 (D-F) and ABC (G-I), in situ hybridization of Edar (J-L) and Shh (M-O), and double labeling of CD133 and AE3 (P-R) or Sox2 and AE3 (S-U) at E14.5 (J-Q, S, T) and E15.5 (A-I, R, U). Arrowhead indicates the dermal activation of β-catenin in the control (G), but not in the

K5 K5 K5

Gprl 77 and Gprl 77 ; sPcat mutants (H, I). Asterisks indicate the dermal papilla markers,

K5 K5

CD 133 and Sox2, are detected in the control (P, S), but absent in the Gprl 77 ; sPcat mutants (Q, R, T, U). Broken lines indicate the junction of epidermis and dermis. Genotype - (1) Control:

Gprl77Fx/Fx or K5-Cre; Gprl77Fx/+, (2) Gprl77^K5: K5-Cre; Gprl77Fx/Fx, (3) Gprl77^K5; spcat^K5: K5-Cre; Gprl77Fx/Fx; p-catAEx3Fx/+. Scale bars, 50 μιη (A-U).

Figure 26 shows that the Gprl 77-mediated regulation of Wnt in the dermis is dispensable for early phases of hair follicle development, β-gal staining of the El 4.5 control (A) and Gprl77^Dermo1 (B) skins carrying the R26R reporter allele shows the effectiveness of the Dermol-Cre transgene in the dermis. Sections of the control (C, E, G, I, K, M, O, Q, S U, W) and Gprl 77Dermoi (D, F, H, J, L, N, P, R, T, V, X) skins are analyzed by double labeling of Gprl77 and K14 (C-F), hematoxylin and eosin staining (G, H), immunostaining of Cadherin proteins (I-L) and ABC (S, T) and ,in situ hybridization of Edar (M, N) and Shh (O, P), double labeling of CD133 and AE3 (Q, R), and β-gal staining of the Axin2i_acz allele (U-X) at E13.5 (U, V), E14.5 (C-F, I, J, M-P, W, X) and E15.5 (G, H, K, L, Q-T). Genotype - Control: Gprl77Fx/Fx or Dermol-Cre; Gprl77Fx/+ and Gprl77^uermo1: Dermol-Cre; Gprl77Fx/Fx.Scale bars, 50 μτη (A-X).

Figure 27 shows that deletion of Gprl 77 in the dermis causes dermal abnormalities. Using BrdU incorporation assay, cells undergoing mitotic division are identified by immunostaining of BrdU in the E14.5 control (A) and Gprl77^Dermo1 (B) skins. Graph shows the percentage of proliferating cells positive for BrdU in the epidermis and dermis (C). An asterisk indicates that the reduction in the dermis caused by the dermal deletion of Gprl 77 is statistically significant

(Gprl77^Dermo1: 19.01±0.03% and control: 32.21±0.03%; p value <0.01, n=3). TUNEL staining (D-F) and immunostaining of activated caspase3 (G-I) detect apoptotic cells in the skins (D, E, G, H) and DRG (F, I) of control (D, F, G, I) and Gprl77^Dermo1 (E, H) skins at E14.5. Sections of the E15.5 control (J, L, N) and Gprl77^Dermo1 (K, M, O) skins are analyzed by immunostaining of Collagen I (Col 1; J, K), smooth muscle actin (SMA; L, M) and adiponectin (AdipoNT; N, O). Graph shows the percentage of cells positive for the differentiation markers in the dermis (P). Asterisks indicate that the alterations of differentiation caused by the dermal deletion of Gprl 77 are statistically significant (*, p value <0.01 ; **,p value <0.05; n=3). Broken lines indicate the epidermal-dermal junction and the DRG. Genotype - Control: Gprl77Fx/Fx or Dermol-Cre; Gprl77Fx/+ and

G_{pr l 77}Dermoi . _{Dermo l}._Cre; Gprl77Fx/Fx. Scale bars, 50 μιη (A, B, D-O).

Figure 28 shows that Wnt secretion is impaired in the Gprl77^Dermo1 mutants. (A) Primary dermal cells isolated from the E14.5 control and Gprl77^Dermo1 skins as the signal-producing cells were cocultured with the signal-receiving cells harboring the TOPFLASH reporter. Relative luciferase activity (RLA) determined activation of the β-catenin and Lef/Tcf-dependent transcription. The addition of canonical Wnt3a and noncanonical Wnt5a in the media were used as the positive and negative controls, respectively. Asterisk indicates the statistical significance of reduction (p value <0.013, n=3). (B) Immunoblot analysis of Dvl2, phosphorylated Dvl2 (pDvl2), phosphorylated GSK3, activated β-catenin (ABC), β-catenin (β-cat) determined the canonical Wnt signaling activity in the E14.5 epidermis and dermis, and the primary dermal cells of control and Gprl77^Dermo1 in vivo and ex vivo, respectively. The level of pDvl2, pGSK3 and ABC is elevated upon stimulation of Wnt signaling. The dermal deletion of Gprl 77 causes either a slight reduction or no obvious effects on activation of Dvl2, GSK3 and β-catenin most likely due to the presence of epidermal Wnt in vivo. However, activation of canonical Wnt signaling was significantly reduced in the Gprl77^Dermo1 dermal cells free of epidermal cells in the ex vivo culture. Actin level was used as a loading control.

Figure 29 shows that epidermal Wnt orchestrates signaling interactions between the epidermis and dermis during hair follicle development. The diagram illustrates the model for hair follicle induction mediated by Wnt production and signaling in the epidermis and dermis. DETAILED DESCRIPTION

Provided herein is a method of decreasing Wnt signaling in a cell, comprising contacting the cell with a GPR177 inhibitor, wherein the cell has increased Wnt signaling. The cell can have increased Wnt signaling as compared to a control. The method can further comprise selecting a cell with increased Wnt signaling as compared to a control. As utilized throughout, Wnt signaling refers to signaling via one or more Wnt proteins involved in the Wnt signaling pathway. The Wnt proteins can be selected from the group consisting of Wntl, Wnt2,

Wnt2b/13, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b,

Wnt9a/14, Wnt9b/15, WntlOa, WntlOb, Wntl 1, Wntl6. Wnt proteins can bind to cell-surface receptors of the Frizzled family, causing the receptors to activate Dishevelled family proteins and effect a change in the amount of β-catenin that reaches the nucleus. Dishevelled (DSH) is a component of a membrane-associated Wnt receptor complex, which, when activated by Wnt binding, inhibits a second complex of proteins that includes axin, GSK-3, and the protein APC. The axin/GSK-3/APC complex normally promotes the proteolytic degradation of the β-catenin intracellular signaling molecule. After this β-catenin destruction complex is inhibited, a pool of cytoplasmic β-catenin stabilizes, and β-catenin is able to enter the nucleus and interact with TCF/LEF family transcription factors to promote expression of a variety of genes. Examples of genes that are regulated by the Wnt signaling pathway include, but are not limited to Axin-2, LEF1, c-myc, n-myc, Cyclin Dl, TCF-1, PPAR delta, c-jun, fra-1, uPAR, MMP-7, BMP4, claudin-1, VEGF, Hathl, Met, FGF20, endothelin- 1 , FGF9 and CD44.

Numerous methods of measuring Wnt signaling are available to those of skill in the art. For example, antibodies are available to detect β-catenin in cells via histochemical analysis or Western blot. See, for example, van Noort et al. "Wnt signaling controls the phosphorylation status of beta-catenin," J. Biol. Chem. 277(20); 17901-5 (2002). Immunofluoresence assays can also be utilized to detect β-catenin. See, for example, Borchert et al. "High-content screening assay for activators of the Wnt/Fzd pathway in primary human cells," Assay Drug Dev. Technol. 3(2): 133-41 (2005); and Borchert et al. "Screening for activators of the wingless type/Frizzled pathway by automated fluorescent microscopy," Methods Enzymol. 414: 140-50 (2006). As described in the Examples, a TOP-Flash assay can be utilized to assess β-catenin induced transciptional activity. See, for example, Molenaar et al. "XT-cf-3 transcription factor mediates beta-catenin-induced axis formation in Xenopus embryos," Cell 86(3): 391-9 (1996). Wnt signaling can also be assessed by measuring expression of one or more transcriptional targets of Wnt proteins, now known or identified in the future. These include, but are not limited to, Axin- 2, LEF1, c-myc, n-myc, Cyclin Dl, TCF-1, PPAR delta, c-jun, fra-1, uPAR, MMP-7, BMP4, claudin-1, VEGF, Hathl, Met, FGF20, endothelin-1, FGF9 and CD44. These genes are merely exemplary as the target gene(s) can vary depending on the cell type and the Wnt proteins involved. Wnt signaling can also be measured by assessing the phosphorylation state of Dishevelled or LDL receptor related proteins 5 and 6 (LRP5/6). See, for example, Tamai et al. "A mechanism for Wnt coreceptor activation," Mol. Cell. 13(1): 149-56.

The cell can be any cell wherein the Wnt signal transduction pathway can be activated. Activation can occur by exposure to one or more exogenous Wnt proteins and/or by exposure to one or more Wnt proteins endogenously produced by the cell. The cell can also comprise a constitutively activated Wnt signaling pathway. Wnt signaling can also be activated by exposure of the cell to a Wnt signaling agonist such as 2-amino-4-[3,4-(methylenedioxy)benzyl-amino]-6- (3-methoxyphenyl)pyrimidine or a GSK3 inhibitor. The cell can also be a cell comprising a nucleic acid encoding one or more Wnt proteins under the control of a constitutive or regulatable promoter. The cell can be a stem cell, an endothelial cell, a basal cell, a skin cell, a hair follicle cell, an epithelial cell, a myocyte, a macrophage, an osteoblast, an osteoclast, an osteocyte, neutrophil, a neural cell, an eosinophil, a dendrite cell, an endothelial cell, a keratinocyte, to name a few. The cell can be from any tissue, for example, from breast, kidney, liver, heart, skin, brain, lung, prostate, intestine, or colon tissue, to name a few. The cell can be from a mammal, such as a primate, e.g. a human, or a non-human primate. The cell can also be a nonmammalian cell, for example, a cell from Drosophila melanogaster, a fish or an amphibian. The cell can be a cancerous or a noncancerous cell. Populations of cells are also provided. The cell can be in vitro, in vivo or ex vivo.

As used throughout, the cell can have increased Wnt signaling as compared to a control. This can be, for example, increased Wnt signaling in a cancerous cell when compared to a noncancerous cell of the same cell type. For example, and not to be limiting, one of skill in the art can compare β-catenin levels in a cancerous cell with β-catenin levels in a non cancerous cell. If β-catenin levels are higher in the cancerous cell, the cancerous cell has increased Wnt signaling as compared to the noncancerous cell. One of skill in the art can also measure β-catenin-induced transcriptional activity. If β-catenin-induced transcriptional activity is higher in the cancerous cell as compared to the noncancerous cell, the cancerous cell has increased Wnt signaling. In another example, Wnt signaling can be increased in a cell that overexpresses one or more Wnt proteins, for example, by inducing expression of an exogenous nucleic acid encoding one or more Wnt proteins in the cell, as compared to a cell that does not comprise an inducible exogenous nucleic acid encoding one or more Wnt proteins. A cell having increased Wnt signaling can also be a cell exposed to one or more exogenous Wnt proteins as compared to a cell that is not exposed to one or more exogenous Wnt proteins. A cell having increased Wnt signaling can also be a cell exposed to more endogeous and/or exogenous Wnt protein(s) as compared to another cell. In another example, a diseased or injured cell can have increased Wnt signaling as compared to a non-diseased or non-injured cell.

GPR177, also known as Wntless (Wis), Evi and Srt, encodes a receptor for Wnt proteins that serves to regulate Wnt secretion in a variety of tissue types. See, for example, Jin et al. "Expression of GPR177 (Wntless/Evi/Sprinter), a highly conserved Wnt-transport protein, in rat tissues, zebrafish embryos, and cultured human cells," Dev. Dyn. 239(9): 2426-34 (2010).

GenBank Accession No. NP_079187.3 provides a protein sequence for human GPR177 that is encoded by the nucleotide sequence set forth under GenBank Accession No. NM_024911.6. As shown in the Examples, inhibition of GPR177 decreases Wnt signaling and Wnt protein secretion. Inhibition of GPR177 may or may not decrease the amount of Wnt protein mRNA or Wnt protein expression. Inhibition of GPR177 can also interfere with Wnt protein sorting in the presence or absence of reduced Wnt protein expresion. Methods for measuring Wnt protein secretion are known in the art. For example, after exposure to the GPR177 inhibitor, an antibody against a Wnt protein, can be utilized to measure the amount of the Wnt protein secreted by the treated cells, for example, by ELISA, Western blot or other immunohistochemical techniques. Similarly, an antibody against any of Wntl, Wnt2, Wnt2b/13, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a/14, Wnt9b/15, WntlOa, WntlOb, Wntl 1 or Wntl6 can be utilized to measure secretion of one or more Wnt proteins. The amount of Wnt protein secreted can be compared to the amount of Wnt protein secreted in a cell that was not exposed to the GPR177 inhibitor. The cell can be the same type of cell or a different type of cell.

As utilized throughout, a GPR177 inhibitor can be, but is not limited to, a chemical, a small or large molecule (organic or inorganic), a drug, a polypeptide, a cDNA, an antibody, an aptamer, a morpholino, a triple helix molecule, an siRNA, a shRNA, an miRNA, an antisense RNA, a ribozyme or any other compound now known or identified in the future that inhibits at least one function of GPR177, for example, Wnt secretion. For example, the inhibitor can be one or more siRNAs selected from the group consisting of AUGAAAGAGUACCACGGAA (SEQ ID NO: 1), CCUUUUAAACAUCCGGCUG (SEQ ID NO: 2),

GGAUCAGCACGAGCGGAAC (SEQ ID NO: 3) and UCUACAAGUUGACCCGCAA (SEQ ID NO: 4).

The decrease in Wnt signaling does not have to be complete as this can be any dectectable decrease. For example, the decrease can be about a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between as compared to Wnt signaling in a control cell. The control cell can be the same cell prior to contacting the cell with a GPR177 inhibitor or a reference cell with an established level of Wnt signaling. The control cell can also be a non- diseased or non-injured cell.

Further provided is a method of increasing Wnt signaling in a cell, comprising contacting a cell with a GPR177 agonist, wherein the cell has decreased Wnt signaling as compared to a control. The method can further comprise selecting a cell with decreased Wnt signaling as compared to a control.

As set forth above, the cell can have decreased Wnt signaling as compared to a control. This can be, for example, decreased Wnt signaling in a diseased or injured cell when compared to a non-diseased or non-injured cell of the same cell type. For example, and not to be limiting, one of skill in the art can compare β-catenin levels in a diseased or injured cell with β-catenin levels in a non-diseased or non-injured cell. If β-catenin levels are lower in the diseased or injured cell, the diseased or injured cell has decreased Wnt signaling as compared to the non- diseased or non-injured cell. One of skill in the art can also measure β-catenin-induced transcriptional activity. If β-catenin-induced transcriptional activity is lower in the diseased or injured cell as compared to the non-diseased or non-injured cell, the diseased or injured cell has decreased Wnt signaling. In another example, Wnt signaling can be decreased in a cell for example, by inducing expression of an inhibitory nucleotide sequence (for example, anti-Wnt siR A or antisense) in the cell that reduces or eliminates expression of one or more Wnt proteins, as compared to a cell that does not comprise an exogenous inhibitory nucleotide sequence in the cell that reduces or eliminates expression of one or more Wnt proteins. A cell having decreased Wnt signaling can also be a cell that produces or secretes less endogeous Wnt protein(s) as compared to another cell. A cell having decreased Wnt signaling can also be a cell exposed to less endogeous and/or exogenous Wnt protein(s) as compared to another cell. The cell can be in vitro, in vivo or ex vivo.

The increase in Wnt signaling can be any increase. For example, the increase can be about a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, 200%, 300%, 400%, 500% or greater as compared to Wnt signaling in a control cell. The control cell can be the same cell prior to contacting the cell with a GPR177 agonist or a reference cell with an established level of Wnt signaling. The control cell can also be a non-diseased or non-injured cell.

As utilized throughout, a GPR177 agonist is an agent that mimics or enhances at least one function of GPR177, for example, Wnt secretion. The agonist can be, but is not limited to, a chemical, a small or large molecule (organic or inorganic), a drug, a protein, a peptide, a cDNA, an antibody, an aptamer, a morpholino, a triple helix molecule, an siRNA, a shRNA, an miRNA, an antisense RNA, a ribozyme or any other compound now known or identified in the future that mimics or enhances at least one function of GPR177, for example, Wnt secretion.

Further provided is a method of treating a Wnt signaling disorder in a subject, comprising administering to the subject a GPR177 inhibitor. The Wnt signaling disorder can be a disorder wherein the subject has increased Wnt signaling as compared to a control. This can be, for example, increased Wnt signaling in a subject with cancer as compared to a subject without cancer. For example, and not to be limiting, one of skill in the art can compare β-catenin levels in a cancerous tissue sample or a cancerous cell from the subject with β-catenin levels in a noncancerous tissue sample or noncancerous cell, from the same or a different subject. If β- catenin levels are higher in the cancerous tissue sample or cancerous cell, the cancerous tissue sample or cancerous cell has increased Wnt signaling as compared to the noncancerous tissue sample or noncanerous cell. One of skill in the art can also measure β-catenin-induced transcriptional activity. If β-catenin-induced transcriptional activity is higher in the cancerous tissue sample or canerous cell as compared to the noncancerous tissue sample or noncancerous cell, the cancerous tissue sample or canerous cell has increased Wnt signaling activity. In another example, a diseased or injured subject can have increased Wnt signaling as compared to a non-diseased or non-injured subject. In this method, administration of a GPR177 inhibitor can decrease Wnt signaling and/or secretion of one or more Wnt proteins.

Throughout this application, by treating is meant a method of reducing or delaying one or more effects or symptoms of a disease. Treatment can also refer to a method of reducing the underlying pathology rather than just the symptoms. The treatment can be any reduction and can be, but is not limited to, the complete ablation of the disease or the symptoms of the disease. Treatment can include the complete amelioration of a disease as detected by art-known techniques. For example, a disclosed method is considered to be a treatment if there is about a 10% reduction in one or more symptoms of the disease in a subject when compared to the subject prior to treatment or control subjects. Thus, the reduction can be about a 10, 20, 30, 40, 50, 60, 70, 80, 90, 100%, or any amount of reduction in between.

As used throughout, by subject is meant an individual. Preferably, the subject is a mammal such as a primate, and, more preferably, a human. Non-human primates are subjects as well. Thus, veterinary uses and medical formulations are contemplated herein.

Wnt signaling disorders characterized by increased Wnt signaling include, but are not limited to, cancer, a respiratory disorder, osteoarthritis, skeletal dysplasia, diabetes and obesity. Cancers that can be treated include, but are not limited to, skin cancer, colon cancer, breast cancer, prostate cancer, esophageal cancer, rectal cancer, throat cancer, lung cancer, stomach cancer, leukemia, lymphoma, liver cancer, endometrial cancer, ovarian cancer, and prostate cancer. Inhibition of metastasis is also contemplated.

Further provided is a method of treating a Wnt signaling disorder in a subject, comprising administering to the subject a GPR177 agonist. The Wnt signaling disorder can be a disorder wherein the subject has decreased Wnt signaling as compared to a control. This can be, for example, decreased Wnt signaling in a subject with a disorder as compared to a subject without the disorder. For example, and not to be limiting, one of skill in the art can compare β-catenin levels in a diseased tissue sample or cells from the subject with a Wnt disorder with β-catenin levels in a non-diseased tissue sample or cells, from the same or a different subject. If β-catenin levels are lower in the diseased tissue sample or cells, the diseased tissue sample has decreased Wnt signaling as compared to the nondiseased tissue sample. One of skill in the art can also measure β-catenin-induced transcriptional activity. If β-catenin-induced transcriptional activity is lower in the diseased tissue sample or cells as compared to the non-diseased tissue sample or cells, the diseased tissue sample or cell has decreased Wnt signaling activity. In this method, administration of a GPR177 agonist can increase Wnt signaling and/or secretion of one or more Wnt proteins.

Wnt signaling disorders characterized by decreased Wnt signaling include, but are not limited to, a neurological disorder (for example, amyotrophic lateral sclerosis (ALS),

Parkinsons's disease, multiple sclerosis (MS), Alzheimer's disease, and the like), osteoporosis, bone fracture healing, hair loss or hair graying, diabetes, obesity, tissue impairment caused by aging and tissue degeneration.

The agents described herein can be provided in a pharmaceutical composition.

Depending on the intended mode of administration, the pharmaceutical composition can be in the form of solid, semi-solid or liquid dosage forms, such as, for example, tablets, suppositories, pills, capsules, powders, liquids, or suspensions, preferably in unit dosage form suitable for single administration of a precise dosage. The compositions will include a therapeutically effective amount of the agent described herein or derivatives thereof in combination with a pharmaceutically acceptable carrier and, in addition, may include other medicinal agents, pharmaceutical agents, carriers, or diluents. By pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, which can be administered to an individual along with the selected agent without causing unacceptable biological effects or interacting in a deleterious manner with the other components of the pharmaceutical composition in which it is contained. As used herein, the term carrier encompasses any excipient, diluent, filler, salt, buffer, stabilizer, solubilizer, lipid, stabilizer, or other material well known in the art for use in pharmaceutical formulations. The choice of a carrier for use in a composition will depend upon the intended route of administration for the composition. The preparation of pharmaceutically acceptable carriers and formulations containing these materials is described in, e.g., Remington's Pharmaceutical Sciences, 21st Edition, ed. University of the Sciences in Philadelphia, Lippincott, Williams & Wilkins, Philadelphia Pa., 2005. Examples of physiologically acceptable carriers include buffers such as phosphate buffers, citrate buffer, and buffers with other organic acids; antioxidants including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; salt-forming counterions such as sodium; and/or nonionic surfactants such as TWEEN^® (ICI, Inc.; Bridgewater, New Jersey), polyethylene glycol (PEG), and PLURONICS™ (BASF; Florham Park, NJ).

Compositions containing the agent(s) described herein suitable for parenteral injection may comprise physiologically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, and sterile powders for reconstitution into sterile injectable solutions or dispersions. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (propyleneglycol, polyethyleneglycol, glycerol, and the like), suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants.

These compositions may also contain adjuvants such as preserving, wetting, emulsifying, and dispensing agents. Prevention of the action of microorganisms can be promoted by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. Isotonic agents, for example, sugars, sodium chloride, and the like may also be included. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monostearate and gelatin.

Solid dosage forms for oral administration of the compounds described herein or derivatives thereof include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the compounds described herein or derivatives thereof is admixed with at least one inert customary excipient (or carrier) such as sodium citrate or dicalcium phosphate or (a) fillers or extenders, as for example, starches, lactose, sucrose, glucose, mannitol, and silicic acid, (b) binders, as for example, carboxymethylcellulose, alignates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, (c) humectants, as for example, glycerol, (d) disintegrating agents, as for example, agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain complex silicates, and sodium carbonate, (e) solution retarders, as for example, paraffin, (f) absorption accelerators, as for example, quaternary ammonium compounds, (g) wetting agents, as for example, cetyl alcohol, and glycerol monostearate, (h) adsorbents, as for example, kaolin and bentonite, and (i) lubricants, as for example, talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, or mixtures thereof. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents.

Solid compositions of a similar type may also be employed as fillers in soft and hard- filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethyleneglycols, and the like.

Solid dosage forms such as tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells, such as enteric coatings and others known in the art. They may contain opacifying agents and can also be of such composition that they release the active compound or compounds in a certain part of the intestinal tract in a delayed manner. Examples of embedding compositions that can be used are polymeric substances and waxes. The active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.

Liquid dosage forms for oral administration of the compounds described herein or derivatives thereof include pharmaceutically acceptable emulsions, solutions, suspensions, syrups, and elixirs. In addition to the active compounds, the liquid dosage forms may contain inert diluents commonly used in the art, such as water or other solvents, solubilizing agents, and emulsifiers, as for example, ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propyleneglycol, 1,3-butyleneglycol, dimethylformamide, oils, in particular, cottonseed oil, groundnut oil, corn germ oil, olive oil, castor oil, sesame oil, glycerol, tetrahydrofurfuryl alcohol, polyethyleneglycols, and fatty acid esters of sorbitan, or mixtures of these substances, and the like.

Besides such inert diluents, the composition can also include additional agents, such as wetting, emulsifying, suspending, sweetening, flavoring, or perfuming agents.

Administration can be carried out using therapeutically effective amounts of the agents described herein for periods of time effective to treat or reduce recurrence of prostate cancer The effective amount may be determined by one of ordinary skill in the art and includes exemplary dosage amounts for a mammal of from about 0.5 to about 200mg/kg of body weight of active compound per day, which may be administered in a single dose or in the form of individual divided doses, such as from 1 to 4 times per day. Alternatively, the dosage amount can be from about 0.5 to about 150mg/kg of body weight of active compound per day, about 0.5 to lOOmg/kg of body weight of active compound per day, about 0.5 to about 75mg/kg of body weight of active compound per day, about 0.5 to about 50mg/kg of body weight of active compound per day, about 0.5 to about 25mg/kg of body weight of active compound per day, about 1 to about 20mg/kg of body weight of active compound per day, about 1 to about lOmg/kg of body weight of active compound per day, about 20mg/kg of body weight of active compound per day, about lOmg/kg of body weight of active compound per day, or about 5mg/kg of body weight of active compound per day.

According to the methods taught herein, the subject is administered an effective amount of the agent. The terms effective amount and effective dosage are used interchangeably. The term effective amount is defined as any amount necessary to produce a desired physiologic response. Effective amounts and schedules for administering the agent may be determined empirically, and making such determinations is within the skill in the art. The dosage ranges for administration are those large enough to produce the desired effect in which one or more symptoms of the disease or disorder are affected (e.g., reduced or delayed). The dosage should not be so large as to cause substantial adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like. Generally, the dosage will vary with the activity of the specific compound employed, the metabolic stability and length of action of that compound, the species, age, body weight, general health, sex and diet of the subject, the mode and time of administration, rate of excretion, drug combination, and severity of the particular condition and can be determined by one of skill in the art. The dosage can be adjusted by the individual physician in the event of any contraindications. Dosages can vary and can be administered in one or more dose administrations daily, for one or several days. Guidance can be found in the literature for appropriate dosages for given classes of pharmaceutical products.

Any appropriate route of administration may be employed, for example, parenteral, intravenous, subcutaneous, intramuscular, intraventricular, intravaginal, intracorporeal, intraperitoneal, rectal, or oral administration. Administration can be systemic or local.

Pharmaceutical compositions can be delivered locally to the area in need of treatment, for example by topical application or local injection. Multiple administrations and/or dosages can also be used. Effective doses can be extrapolated from dose-response curves derived from in vitro or animal model test systems.

The disclosure also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions.

Instructions for use of the composition can also be included.

In an example in which a nucleic acid is employed, such as a cDNA, an antisense or an siRNA molecule, the nucleic acid can be delivered intracellularly (for example by expression from a nucleic acid vector or by receptor-mediated mechanisms), or by an appropriate nucleic acid expression vector which is administered so that it becomes intracellular (for example, by use of a retroviral vector, an adenoviral vector, an adeno-associated virus (AAV 1-8) vector, a herpes vector, a lentiviral vector) or by direct injection, or by use of microparticle bombardment (such as a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox-like peptide which is known to enter the nucleus (for example Joliot et al, Proc. Natl. Acad. Sci. USA 1991, 88: 1864-8). siRNA carriers also include, polyethylene glycol (PEG), PEG-liposomes, branched carriers composed of histidine and lysine (HK polymers), chitosan-thiamine pyrophosphate carriers, surfactants (for example, Survanta and Infasurf), nanochitosan carriers, and D5W solution. The present disclosure includes all forms of nucleic acid delivery, including synthetic oligos, naked DNA, plasmid and viral delivery, whether integrated into the genome or not. Physical transduction techniques can also be used, such as liposome delivery and receptor-mediated and other endocytosis mechanisms (see, for example, Schwartzenberger et al, Blood 87:472-478, 1996) to name a few examples. These methods can be used in conjunction with any of these or other commonly used gene transfer methods.

The methods of treatment disclosed herein can optionally comprise administration of another pharmaceutical agent that can be administered prior to, concurrently with or subsequent to administration of a GPR177 inhibitor or a GPR177 agonist. For example, the methods can optionally comprise administration of a Wnt signaling pathway inhibitor, such as IWP-2, Antl.4Br/Ant 1.4C1, Niclosamide, apicularen, bafilomycin, XAV939, IWR, NSC668036, 2,4- diamino-quinazoline, Quercetin, ICG-OOlor PFKl 15-584. The methods can optionally comprise administration of a Wnt signaling pathway activator, such as WAY-316606, hetero- arylpyramides, IQ 1, QS11, DCA or 2-amino-4-[3,4-(methylenedioxy)benzyl-amino]-6-(3- methoxyphenyl)pyrimidine. The methods of treating cancer can optionally comprise another anti-cancer therapy, for example, surgery, radiation therapy or chemotherapy. Examples of chemotherapeutic agents include, but are not limited to, cisplatin, oxaliplatin, cyclophosphamide, Procarbazine, taxanes, Etoposide, to name a few. Optional anti-cancer treatments can be administered prior to, concurrently with or subsequent to administration of a GPR177 inhibitor.

Further provided is a method of identifying a GPR177 inhibitor that decreases Wnt signaling comprising contacting a cell with a test compound, wherein the cell has increased Wnt signaling; measuring GPR177 activity or expression; and measuring Wnt signaling, wherein a decrease in GPR177 activity or expression and a decrease in Wnt signaling as compared to a control indicates that the compound is a GPR177 inhibitor that decreases Wnt signaling. The method can optionally comprise measuring the level of one or more secreted Wnt proteins.

The cell can be part of an organism, or part of a cell culture, such as a culture of mammalian cells. The cell can also be in a nonhuman subject. The cell can be a diseased cell, an injured cell or cancer cell. The cell can also be a cell engineered to overexpress one or more Wnt proteins such that Wnt signaling is increased relative to a cell that does not overexpress one or more Wnt proteins.

The test compound can be a chemical, a compound library, a small or large molecule (organic or inorganic), a drug, a protein, a peptide, a cDNA, an antibody, an aptamer, a morpholino, a triple helix molecule, an siRNA, a shRNA, an miRNA, an antisense RNA, a ribozyme or any other compound.

Expression can be quantified by real time PCR using RNA isolated from cells. A variety of PCR techniques are familiar to those skilled in the art. For a review of PCR technology, see "PCR Methods and Applications" (1991, Cold Spring Harbor Laboratory Press). In each of these PCR procedures, PCR primers on either side of the nucleic acid sequences to be amplified are added to a suitably prepared nucleic acid sample along with dNTPs and a thermostable polymerase such as Taq polymerase, Pfu polymerase, or Vent polymerase. The nucleic acid in the sample is denatured and the PCR primers are specifically hybridized to complementary nucleic acid sequences in the sample. The hybridized primers are extended. Thereafter, another cycle of denaturation, hybridization, and extension is initiated. The cycles are repeated multiple times to produce an amplified fragment containing the nucleic acid sequence between the primer sites. PCR has further been described in several patents including U.S. Pat. Nos. 4,683, 195, 4,683,202 and 4,965, 188. Each of these publications is incorporated herein by reference in its entirety for PCR methods. One of skill in the art would know how to design and synthesize primers that amplify a nucleic acid sequence encoding GPR177.

A detectable label can be included in an amplification reaction. Suitable labels include fluorochromes, e.g. fluorescein isothiocyanate (FITC), rhodamine, Texas Red, phycoerythrin, allophycocyanin, 6-carboxyfluorescein (6-FAM), 2',7'-dimethoxy-4',5'-dichloro-6- carboxyfluorescein (JOE), 6-carboxy-X-rhodamine ( OX), 6-carboxy-2',4',7',4,7- hexachlorofluorescein (HEX), 5-carboxyfluorescein (5-FAM) or N,N,N',N'-tetramethyl-6- carboxyrhodamine (TAMRA), radioactive labels, e.g., ³² P, ³⁵ S, ³ H; etc. The label can be a two stage system, where the amplified DNA is conjugated to biotin, haptens, etc. having a high affinity binding partner, e.g., avidin, specific antibodies, etc., where the binding partner is conjugated to a detectable label. The label can be conjugated to one or both of the primers. Alternatively, the pool of nucleotides used in the amplification is labeled, so as to incorporate the label into the amplification product, in situ hybridization, RT-PCR, Taqman assay, Northern blotting, ELISPOT, dot blotting, etc. can also be used for quantitating the amount of a nucleic acid in a cell.

The amount of GPR177 protein in a cell, can be determined by methods standard in the art for quantitating proteins in a cell, such as Western blotting, ELISA, ELISPOT,

immunoprecipitation, immunofluorescence (e.g., FACS), immunohistochemistry,

immunocytochemistry, etc., as well as any other method now known or later developed for quantitating protein in or produced by a cell.

In the methods set forth herein, the activity or level of the GPR177 can be compared to the activity or the level of GPR177 in a control cell not contacted with the test compound. The activity or the level of GPR177 can be compared to the activity or the level of GPR177 in the same cell prior to addition of the compound. The activity or level of GPR177 can also be compared to the activity or level of GPR177 in a control cell contacted with a compound known to decrease the activity and/or the level of GPR177. Activity or function can be measured by any standard means, for example, and not to be limiting, by signal transduction assays, or binding assays that measure the binding of GPR177 to another protein such as the mu-opiod receptor or a Wnt protein, for example, Wntl, Wnt3, Wnt3a or Wnt5a.

Similarly, Wnt signaling can be compared to Wnt signaling in a control cell not contacted with the test compound. Wnt signaling can be compared to Wnt signaling in the same cell prior to addition of the compound. Wnt signaling can also be compared to Wnt signaling in a control cell contacted with a compound known to decrease or inhibit Wnt signaling. As set forth above, Wnt signaling refers to signaling via one or more Wnt proteins involved in the Wnt signaling pathway. The Wnt proteins can be selected from the group consisting of Wntl, Wnt2,

Wnt2b/13, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b,

Wnt9a/14, Wnt9b/15, WntlOa, WntlOb, Wntl 1, Wntl6. Therefore, one of skill in the art can measure Wnt signaling for example, by determining the level of β-catenin in the cell and/or by measuring expression of transcriptional targets associated with one or more Wnt proteins. In any of the methods set forth herein, a TOPFlash assay can be utilized to assess β-catenin induced transciptional activity. For example, one of skill in the art can measure downstream effects such as transcriptional activity, protein expression, binding interactions or signaling events associated with Wntl, Wnt3, Wnt3a and/or Wnt5a activity. These are merely exemplary as one of skill in the art can measure downstream effects associate with signaling via any one or more of Wntl, Wnt2, Wnt2b/13, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a/14, Wnt9b/15, WntlOa, WntlOb, Wntl 1, Wntl6.

Further provided is a method of identifying a GPR177 inhibitor that decreases Wnt activation comprising: contacting a cell with a an agent that binds GPR177, wherein the cell has increased Wnt signaling; and measuring Wnt signaling in the cell, a decrease in Wnt signaling as compared to a control indicating the agent is an GPR177 inhibitor that decreases Wnt signaling. The method can optionally comprise measuring the level of one or more secreted Wnt proteins.

As used throughout, an agent that binds GPR177 can be a chemical, a drug, a small or large molecule (organic or inorganic), a protein, a peptide or an antibody. An agent that binds GPR177 can be an agent that binds directly or indirectly to GPR177. By indirect binding is meant that the agent binds to another protein that associates with GPR177. Agents that bind GPR177 can be identified via a binding assay. The binding assay can be a cellular assay or a non-cellular assay in which GPR177 and the compound are brought into contact. For example, GPR177 can be immobilized on a column, and subsequently contacted with the agent, or vice versa. The agent can be a compound in a library. cDNA libraries can also be screened to identify proteins that bind to GPR177. Standard yeast two hybrid screens are also suitable for identifying a protein-protein interaction between GPR177 and another protein. Interactions between membrane proteins such as GPR177 and their ligands can also be measured, for example, via plasmon-waveguide resonance (PWR) spectroscopy (see, for example, Hruby and Tollin, Curr. Opin. Pharmacol. 2007 October: 7(5): 507-514; and Salamon et al. Methods

Enzymol. 2009; 461 : 123-46) or plasmon surface resonance (Alves et al. Curr Protein Pept Sci. 2005 August; 6(4): 293-312.) These techniques can be utilized to identify compounds that alter the interaction between a membrane protein and a ligand, for example, between GPR177 and a Wnt protein by quantitating changes in binding affinity and other parameters detectable by these methods.

Also provided is a method of identifying a GPR177 agonist that increases Wnt signaling comprising contacting a cell with a test compound, wherein the cell has decreased Wnt signaling; measuring GPR177 activity or expression; and measuring Wnt signaling, wherein an increase in GPR177 activity or expression and an increase in Wnt signaling as compared to a control indicates that the compound is a GPR177 agonist that increases Wnt signaling. The method can optionally comprise measuring the level of one or more secreted Wnt proteins. In this method, cells with low or non-detectable levels of Wnt signaling and/or low levels of GPR177 expression can be used. These include, but are not limited to, C3H10T1/2 cells (mesenchymal cells), MC3T3 cells (osteoblast cells), primary mouse calvarial cells, primary mouse mammary epithelial cells and primary mouse embryonic fibroblasts.

Further provided is a method of identifying a GPR177 agonist that increases Wnt signaling comprising: contacting a cell with a an agent that binds GPR177, wherein the cell has decreased Wnt signaling; and measuring Wnt signaling in the cell, an increase in Wnt signaling as compared to a control indicating the agent is an GPR177 agonist that increases Wnt signaling. The method can optionally comprise measuring the level of one or more secreted Wnt proteins.

Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed methods and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutations of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a method is disclosed and discussed and a number of modifications that can be made to a number of molecules or steps included in the method are discussed, each and every combination and permutation of the method, and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Likewise, any subset or combination of these is also specifically contemplated and disclosed. This concept applies to all aspects of this disclosure including, but not limited to, steps in methods using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed, it is understood that each of these additional steps can be performed with any specific method steps or combination of method steps of the disclosed methods, and that each such combination or subset of combinations is specifically contemplated and should be considered disclosed.

Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference in their entireties. A number of embodiments have been described. Nevertheless, it will be understood that various modifications may be made. Accordingly, other embodiments are within the scope of the following claims. EXAMPLES

Example 1

The Wnt pathway is essential for various developmental processes. By hijacking this evolutionary conserved signaling pathway, cancer cells acquire sustained proliferation ability, leading to modification of physiologic properties necessary for tumor initiation and progression. Wnt signaling in breast development and cancer has been recognized, but the cell types responsible for production of this proliferative signal operating within normal and malignant tissues are poorly understood.

Mouse models with cell type-specific disruption of Gprl77 within the mammary gland were created. As shown herein, the loss of Gprl 77 interferes with cell proliferation and differentiation, leading to severe defects in mammary morphogenesis. Therefore, Wnt production mediated by Gprl 77 is essential for mammary morphogenesis. Also disclosed is that cell type-specific autocrine Wnt signaling is required for ductal elongation and branching. Proper ramification of the mammary ductal tree also depends on paracrine signaling effects. Genetic analysis further demonstrated an essential role of Gprl77 in Wnt-induced tumorigenesis. Mice with Gprl77 deficiency are resistant to malignancy through modulation of stem cell properties. Thus, provided herein are methods of targeting of Gprl77 for treatment of human diseases with aberrant Wnt stimulation.

Mouse strains

The Gprl77Fx, MMTV-Cre, MMTV-Wntl and R26RlacZ mouse strains and genotyping methods are known in the art (See Fu et al. "Reciprocal regulation of Wnt and GPrl77/mouse Wntless is required for embryonic axis formation," PNAS 106: 18598-18603 (2009); Fu et al. "Gprl77/mouse Wntless is essential for Wnt-mediated craniofacial and brain development," Dev. Dyn. 240: 365-371 (201 1); Wagner et al. "Cre-mediated gene deletion in the mammary gland," Nucleic Acids Research 25: 4323-4330 (1997); Hsu et al. "Manipulating gene activity in Wntl -expressing precursors of neural epithelial crest cells," Dev. Dyn. 239: 338-345 (2010); Yu et al. "The role of Axin2 in calvarial morphogenesis and craniosynostosis," Development 1332: 1995-2005 (2005); and Maruyama et al. "The balance of WNT and FGF signaling influences mesenchymal stem cell fate during skeletal development," Sci Signal 3 :ra40 (2010).

For generating a Gprl77^MMTV mouse strain, the MMTV-Cre transgene was bred into the

Gprl77Fx homozygous background, respectively. To create the MMTV-Wntl ; Gprl77^MMTV mutant strain, the MMTV-Wntl; MMTV-Cre; Gprl77Fx/+ males were crossed with females homozygous for the Gprl77Fx allele. Care and use of experimental animals described in this work comply with guidelines and policies of the University Committee on Animal Resources at the University of Rochester.

Cells

The procedures for isolation of primary mammary epithelial cells are described in Fu et al. "Reciprocal regulation of Wnt and GPrlW/mouse Wntless is required for embryonic axis formation," PNAS 106: 18598-18603 (2009). For mammosphere culture, single cell suspensions of mammary epithelial cells were cultured in DMEM/F12 media containing 2% B27, 20 ng/ml of EGF, 20 ng/ml of bFGF, 5 μg/ml of insulin, 500 ng/ml of hydrocortisone, and 4 μg/ml of heparin. For inhibition of Wnt production, 5 μΜ IWP-2 (Santa Cruz, Santa Cruz, CA) was present in the culture media. The formation of spheres was analyzed after 7 days.

Mammospheres were treated with 0.25% Trypsin for 5 min at 37 °C, and physically dissociated into single cell suspension for culturing the subsequent passage. For Wnt secretion analysis, mouse L were cultured in DMEM media containing 10% fetal bovine serum. The stably transformed cell lines, L-Wnt3a and L-Wnt5a were cultured with the addition of 0.4 mg/ml and 0.6 mg/ml G418, respectively. Cells were cultured without G418 for 4 days to collect the condition media, which were harvested and filtered through a nitrocellulose membrane. To knockdown Gprl77, cells were transfected with 50 nM Gprl77 siRNA (Thermo Scientific, Fremont, CA, USA) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA). Cell culture media were then changed after 24 hours to collect the conditioned media. Plasmid DNA transfection and luciferase analysis were performed as described in Fu et al. (PNAS 106: 18598- 18603 (2009)).

Mammary staining, β-gal staining, histology, immunostaining and immunoblot

The number 4 mammary glands were dissected at the indicated times of development for whole mount staining. Briefly, the glands were hydrated and stained in carmine alum solution overnight after fixation in Carnoy's fixative for at least 4 hours at room temperature. Samples were then dehydrated and cleared in Histoclear. Details for β-gal staining in whole mounts or sections are described in Yu et al. ("Impaired neural development caused by inducible expression of Axin in transgenic mice," Mechanisms of Development 124: 146-156 (2007)). For histological evaluation, tissues were dissected, fixed in 10% buffered formalin and paraffin embedded to obtain sections which were stained with hematoxylin/eosin. Sections were subject to immunostaining with avidin:biotinylated enzyme complex. The immunological staining was visualized by enzymatic color reaction or fluorescence. Immunoblot analysis was performed as described in Jiang et al. ("SUMO-specific protease 2 in Mdm2 -mediated regulation of p53," Cell Death Differ. (2010). Bound primary antibodies were detected with horseradish peroxidase- conjugated secondary antibodies (Vector Laboratories, Burlingame, CA, USA), followed by ECL-mediated visualization (GE HealthCare, Waukesha, WI, USA) and autoradiography.

Mouse polyclonal antibody Keratin 6 (Covance, Emeryville, CA, USA); mouse monoclonal antibodies ABC (Millipore, Billerica, MA, USA), Keratin 14 (Thermo Scientific), and SMA (Thermo Scientific); rabbit polyclonal antibodies Gprl 77 and phosphorylated Histone H3 (Cell Signaling, Danvers, MA); rabbit monoclonal antibodies Ki67 (Thermo Scientific), cyclin D 1 (Thermo Scientific), Keratin 18 (Thermo Scientific), and active caspase-3 (BD Biosciences, San Jose, CA, USA); goat polyclonal antibodies Wntl (Thermo Scientific and R&D Systems, Minneapolis, MN, USA), Wnt3/3a (Santa Cruz), and Wnt5a (R&D Systems) were used as primary antibodies in these analyses. Images were taken using Nikon SMZ1500 or TS100-F microscope (Nikon, Melville, NY, USA) connected to a SOPT RT camera (Diagnostic Instruments, Sterling Heights, MI, USA), and Zeiss Axio Observer microscope and Imager (Carl Zeiss, Thornwood, NY).

Gprl77 is essential for mammary development

As disclosed herein, the reciprocal regulation of GprlW and Wnt is required for the formation of various organs, including the mammary gland. The expression of Gprl77 was examined. The specificity of the antibody against Gprl 77 has been previously demonstrated. In the developing mammary gland at one month, co-immunostaining revealed that Gprl 77 was expressed mainly in the luminal epithelial cells positive for K18 (Figure 1A-D). The expression of Gprl 77 did not colocalize well with basal/myoepithelial cells, expressing SMA (Figure 1E-H). In the mature mammary gland which has finished ramification at two months, the number of luminal epithelial cells expressing Gprl 77 and its expression level were significantly reduced. These data suggest the involvement of Gprl 77 in the rapid growth phase of mammary gland during puberty (Figure 1I-P).

Next, mouse models with conditional inactivation of Gprl 77 were created to definitively assess its requirement in mammary morphogenesis. The Gprl77Fx allele was crossed with the MMTV-Cre transgene to generate the MMTV-Cre; Gprl77Fx/+ line. Intercross between the MMTV-Cre; Gprl77Fx/+ mice and the Gprl77Fx/Fx mice obtained the MMTV-Cre;

Gprl77Fx/Fx (Gprl77MMTV) mutants. The Gprl77Fx/+, Gprl77Fx/Fx and MMTV-Cre; Gprl77Fx/+ littermates were used as experimental control. In the Gprl77MMTV mutants, Gprl 77 was inactivated by the MMTV-Cre transgene through Cre-mediated recombination.

Using the R26R reporter allele, lineage tracing analysis revealed the efficiency of Cre-mediated recombination in the developing mammary gland at postnatal stages (Figure 2A-F). Double labeling of the β-gal positive cells with K18, K14 or SMA further showed that Cre

recombination occurs in all mammary cell types (Figure 2J-0). Although it has been widely accepted that K14 and SMA are expressed in the same population, it was found that certain SMA positive cells do not express K14. This was evident at the terminal end bud (TEB) which is a specialized and highly proliferative structure, containing mammary stem cells (MaSCs) required for ductal elongation during sexual maturation. While the K14 and SMA expression patterns look similar at the mammary duct (Figure 2K, L), an outer layer of cells positive for SMA are clearly negative for K14 at the TEB (Figure 2N, O).

The Gprl77^MMTV mutants exhibited severe defects in mammary development (Figure 3 and Figure 4) At birth, the mammary gland normally ramifies into a small mammary tree with 15-20 branching ducts, remaining static until puberty. No obvious difference was shown in the newborn Gprl77^MMTV gland (Figure 4A, B; 100%, n=3). However, reduced ductal branches were often found in the mutants before the onset of puberty-dependent development at P 14 (Figure 4C, D; 88%, n=17) and P21 (Figure 4E, F; 50% n=10). At one month, no TEB and extensive ductal elongation and branching across the lymph node region were detected in some mutants (Figure 3A, A' B, B'; 55%, n=l 1). In the other ones, the number of TEB was significantly reduced with branching deficiency (Figure 3C, C; 45%, n=l 1). The loss of Gprl77 also impaired ramification of the mature mammary ductal tree, which spreads throughout the fatty stroma at two months (Figure 3D, D'). There were very few epithelial components left in the more severe mutants (Figure 3E, E'; 38%, n=8). In the less affected ones, the residual TEB was capable of mediating ductal ramification although the branching process was obviously impaired (Figure 3F, F'; 62%, n=8). Statistical analysis further indicated that the average numbers of TEB and branching were reduced from 34.5% and 37.0% in the control to 12.5% and 14.5% in the Gprl77^MMTV mutant, respectively (Figure 3G, H). The loss of Gprl77 also caused a reduction on the percentage of ductal occupancy from 72.9% in the control to 33/2% in the mutant (Figure 31).

Disruption of Gprl77 impairs cell proliferation and differentiation

To elucidate the mechanisms underlying the mammary defects of Gprl77^MMTV, cell proliferation and differentiation affected by the Gprl77 ablation was investigated. During puberty-mediated mammary ramification, mitotic division was impaired in the mutants. The loss of Gprl77 reduced the number of Ki67 and phosphorylated Histone H3 (pHH3) positive cells at one month (Figure 4A-D). Immunostaining of K14, K18 and SMA then examined the specification of mammary cell types (Figure 4E-L). The staining of K18 and cadherin indicated an impairment of luminal epithelial differentiation caused by the Gprl77 deletion (Figure 4E-H). Similarly, the differentiation of basal/myoepithelial cells positive for K14 and SMA were significantly affected (Figure 4I-L). Immunostaining of Gprl77 showed the effectiveness of the Cre- mediated deletion (Figure 4M, N). Because of the luminal expression of Gprl77 and its involvement in Wnt production, the results suggest an autocrine signal required for development of luminal epithelial cells. They also imply that luminal production of Wnt

induces specification of basal/myoepithelial cells in a paracrine manner.

The Gprl77-mediated regulation of Wnt is essential for mammary morphogenesis

Wnt production and signaling affected by the Gprl77 deletion was further investigated to elucidate the mechanism underlying mammary development. Genetic inactivation of Gprl 77 had no significant effect on the expression of Wnt mR As and proteins in the signal-producing cells, but inhibited Wnt signaling in the signal-receiving cells (Figure 5). The deletion of Gprl 77 did not alter the presence of Wnt2b, Wnt7a, WntlOa and Wntl 1 transcripts in the primary mammary epithelial cells (Figure 5A). 12 Similarly, strong expression of WntlOa protein was also detected in the control and Gprl77^MMTV mutant glands (Figure 5B, C). However, nuclear staining of mammary cells with activated β-catenin was greatly abolished in the mutants (Figure 5D, E).

As a Wnt trafficking regulator, Gprl 77 is involved in Wnt sorting and secretion during mammary morphogenesis. To determine the essential role of Gprl77 in the production of Wnt, a Wnt-secretion assay was established using mouse L and L-Wnt3a cell lines. Wnt3a was detected in the L-Wnt3a conditioned media which were used to culture the signal-receiving cells containing the TOPFlash reporter, thereby stimulating its activity (Figure 5F, G). When Gprl 77 was knocked down by RNA interference, Wnt3a was not detectable in the L-Wnt3a media (Figure 5F), leading to no stimulation of TOPFlash in the signal-receiving cells (Figure 5G). Wnt overexpression in the signal producing cells alone seemed to be sufficient to effectively induce the TOPFlash reporter in the signal-receiving cells (Figure 5H, I). This can be attributed to Gprl77, itself a transcriptional target of Wnt. High levels of Wnt were able to promote the expression of endogenous Gprl 77 in a positive feedback loop. Therefore, it is not necessary to express Gprl 77 exogenously. In cells expressing high levels of Wnt protein, the expression of Gprl 77 was elevated (Figure 5H). Electron microscopy analysis further indicated that Golgi accumulations of Gprl 77 were only found in the Wnt-producing cells. These results show that Gprl 77 plays an important role in Wnt sorting and secretion.

Gprl77 is essential for Wnt-dependent regulation of mammary stem cells

The involvement of GPR177 in cell growth and division associated with Wnt activation was investigated. In the 13 MMTV-Wntl transgenic mice, it was found that the enhanced mitotic divisions caused by aberrant Wnt expression were alleviated in the MMTV-Wntl; Gprl77^MMTV glands (Figure 6A). Gprl77 deficiency had protection against Wnt-induced proliferation, providing a means to investigate its role in MaSCs where Wnt signaling could be crucial for their developmental regulation. The number of Lin-CD29highCD24+ precursor cells was enhanced in the MMTV-Wntl transgenic mice (Shackleton et al, 2006). This population enriched with MaSCs could contribute to the neoplastic transformation induced by Wnt. To test if alterations in stem cell properties contribute to aberrant proliferation of mammary cells, the self-renewal and proliferating abilities of MaSCs modulated by the Wnt-Gprl77 regulatory pathway were investigated. Mammosphere analysis showed that Wnt overexpression drastically increased the number of spheres formed in the primary and secondary cultures (Figures 6B). However, this abnormality is alleviated by the deletion of Gprl77, thus indicating its important role in Wnt- mediated stem cell regulation. To further examine whether this phenotypic alleviation is due to the important function of Gprl77 in Wnt production, a small molecule inhibitor of Porcupine, IWP-2, was used to block lipid modification of Wnt proteins necessary for their maturation. Similar inhibitory results were obtained by the use of IWP-2 in the sphere analysis, showing that the Gprl77-mediated production of Wnt is necessary for MaSC self-renewal and proliferation (Figure 6B). Contrary to the number, the size of mammospheres was not significantly affected by alteration of Wnt signaling (Figure 6C). These in vitro analyses show that inhibition of Wnt production could be an effective therapeutic strategy.

Inhibition of Gprl77-mediated Wnt production prevents mammary hyperplasia

To further studies on the effectiveness of targeting Gprl77 as a potential treatment of diseases caused by Wnt stimulation, in vivo analysis was performed. Aberrant expression of Wnt induces mammary hyperplasia found in all MMTV-Wntl mice which provide an excellent model to test this hypothesis. To test if Gprl77 is essential for the premalignant lesions induced by elevated levels of Wnt, a genetic study was carried out by crossing MMTV-Wntl into the Gprl77^MMTV background. Intercross between the MMTV-Wntl; MMTV-Cre; Gprl77Fx/+ mice and the Gprl77Fx/Fx mice generated the control (genotype: Gprl77Fx/+); MMTV-Wntl (genotypes: MMTV-Wntl ; Gprl77Fx/+, MMTV-Wntl ; Gprl77Fx/Fx or MMTV-Wntl;

MMTV-Cre; Gprl77Fx/+) and MMTV-Wntl ; Gprl77MMTV (genotype: MMTV-Wntl ;

MMTV-Cre; Gprl77Fx/Fx) mice. Mammary hyperplasia did not occur in the MMTVWntl ; Gprl77MMTV mutants (100%, n=10), showing that the pathogenic effects initiated by Wnt is abolished by genetic inactivation oi Gprl 77 (Figure 7A-F). This phenotypic alleviation was not caused by the MMTV-Cre transgene as littermates carrying MMTV-Wntl and MMTV-Cre also developed hyperplasia. The mammary phenotype of MMTV-Wntl; Gprl77^MMTV (Figure 7C, F) was reminiscent of some of the Gprl77^MMTV mutants (Figure 3F, F') which further suggests an essential role of Gprl77 in Wnt production necessary for the hyperplastic development of MMTV-Wntl . Approximately 40% of the MMTV-Wntl mice developed mammary tumor at 5 months. However, no tumors were detected in the 5 -month old of MMTV-Wntl; GprlWMMTV mice, implying that GprlW deficiency could prohibit Wnt induced tumorigenesis.

Next, IWP-2 was utilized to examine whether inhibiting the function of GprlW in Wnt production is responsible for this phenotypic alleviation. The premalignant lesions were evident in all MMTV-Wntl at one month (Figure 7G). IWP-2 was then administered by peritoneal injection once every three days. The hyperplastic phenotype of MMTV-Wntl was ameliorated after the IWP-2 treatment for one month (Figure 7G). Inhibition of Wnt production was able to correct the premalignant lesions (83.3%, n=6), showing therapeutic potential for diseases caused by Wnt stimulation. Together with the genetic study, the findings disclosed herein show that the Gprl77-mediated production of Wnt is necessary for mammary development in health y and diseased tissue.

The loss of Gprl77 alleviates the pathogenic effects caused by Wnt stimulation

Molecular analysis then examined if the cellular architecture phenotypes of MMTV- Wntl were also ameliorated by the Gprl77 deletion (Figure 8A-C). First, the expression of Gprl77 was examined in order to assess its involvement in the Wnt- induced mammary tumorigenesis. Gprl77 was sparsely expressed at low levels in the mature mammary glands at 2 months (Figure 8D). However, strong expression of Gprl77 was detected in the premalignant mammary hyperplasia, and developed in all MMTV-Wntl mice (Figure 8E). A uniform expression pattern was also found in the mammary epithelial cells of MMTV-Wntl . However, no elevated and uniform expression of Gprl77 was detected in the MMTV-Wntl; Gprl77^MMTV mutants (Figure 8F).

The differentiation of mammary cell types was assessed next. The expression of K6 has been implicated in a subset of mammary progenitor cells which have been implicated in Wnt- induced tumorigenesis (Figure 8G, H). It has also been postulated that MMTV15 Wntl induces basal cell-like tumors because of the strong expression of K14 (Figure 8 J, K). In the MMTV-Wntl ;

Gprl77^MMTV mutants, no aberrant expression of K6 and K14 induced by MMTV-Wntl transgene (Figure 8G-L) was detected. In contrast, high levels of Wntl greatly reduced the luminal epithelial expression of K18 while its expression was comparable in the control and MMTV-Wntl ;

Gprl77^MMTVmammary glands (Figure 6M-0). Examination on the expression of SMA revealed that only a portion of cells exhibit high levels of expression in the MMTV-Wntl mutants (Figure 8Q). The lack of SMA expression associated with metastatic transformation in the MMTV-Wntl mice was also alleviated by the Gprl77 ablation (Figure 8P- ).

To definitively examine the role of Gprl77 in Wnt- induced tumorigenesis, a tumor development study was performed in a 9-month observation period (Figure 9). Within

this period, no mice carrying MMTV-Wntl transgene either in the Gprl77+/+ (0%, n=19), Gprl77+/- (0%, n=15), or MMTV-Cre; Gprl77Fx/+ (10%, n=10) background was tumor free with one exception. However, no tumors were detected in the 9-month olds of MMTV- Wntl ; Gprl77^MMTV mice (100%, n=l 1), implying that Gprl77 deficiency prohibit Wnt-induced tumorigenesis.

As disclosed herein, Gprl77 is essential for Wnt-mediated mammary development and tumorigenesis. Using MMTV-Cre to inactivate Gprl 77, the data set forth herein show that an autocrine Wnt signal is required for ramification of the mammary ductal tree at puberty. The role of Gprl77 as a master regulator for Wnt sorting and secretion provides an excellent tool to disrupt the production of all Wnt proteins expressed in any given cell. The results provided herein demonstrate that removal of a Wnt transcriptional target, Gprl77, prevents Wnt-induced mammary tumorigenesis, thus providing an approach for cancer treatment. Targeting Gprl77 for prevention and therapy could be applicable to other human diseases.

Example 2

Osteoporosis is characterized by reduced bone mass along with micro-architectural deterioration of the skeleton increasing the risk fragility fractures. In osteoporosis, bone mineral density (BMD) is reduced due to an imbalance in bone formation and resorption.

Mouse Strains

The Gprl77Fx, Dermol-Cre, Osx-Cre, Colal-Cre and Col2al-Cre mouse strains and genotyping methods are known in the art (Fu et al. "Gprl77/mouse Wntless is essential for Wnt- mediated craniofacial and brain development," Dev. Dyn. 240: 365-371 (201 1); Liu et al.

"Expression and activity of osteoblast-targeted Cre recombinase transgenes in

murine skeletal tissues," Int JDev Biol 48(7):645-53 (2004); Ovchinnikov et al. "Col2al -directed expression of Cre recombinase in differentiating chondrocytes in transgenic mice," Genesis

26(2): 145-6 (2006); odda et al. "Distinct roles for Hedgehog and canonical Wnt signaling in specification, differentiation and maintenance of osteoblast progenitors," Development

133(16):3231-44 (2006). Care and use of experimental animals described in this work comply with guidelines and policies of the University Committee on Animal Resources at the University of Rochester.

Histology, β-gal Staining, Immunostaining, In Situ Hybridization and Skeletal Analysis

Embryos were fixed, paraffin embedded and sectioned for histological evaluation as previously described (Chiu et al. "SUMO-Specific Protease 2 Is Essential for Modulating p53- Mdm2 in Development of Trophoblast Stem Cell," Niches and Lineages. PLoS Biol 6(12):e310). Details for β-gal staining in whole mounts and sections, and for skeletal preparation and staining were described previously (Maruyama et al. "The balance of WNT and FGF signaling influences mesenchymal stem cell fate during skeletal development," Sci Signal 3:ra40 (2010); and Yu et al. "Development of a unique system for spatiotemporal and lineage-specific gene expression in mice," Proc Natl Acad Sci USA 102(24): 8615 -20 (2005)). In situ hybridization and immunostaining analyses were performed. In brief, DNA plasmids, containing Col2al, Ihh, CollOal, Collal, MMP9, MMP 13, Runx2, Osterix and Osteoclacin cDNAs, were linearized for in vitro transcription using T3 or T7 RNA polymerase (Promega, Wisconsin, WI, USA) to generate digoxigenin-labeled RNA probes for in situ hybridization. Embryos were then induced with the RNA probes, followed by recognition with an alkaline phosphatase conjugated anti-digoxigenin antibody (Roche, Indianapolis, IN, USA). To visualize the bound signals, samples were incubated with BM-purple (Roche) for 4-5 hours. For immunostaining, mouse monoclonal antibodies Runx2 (MBL International, Woburn, MA, USA), ABC (Millipore, Billerica, MA,

USA), BrdU (Thermo Fisher, Rockford, IL, USA), rabbit polyclonal antibodies Gprl 77, Osterix (Abeam, Cambridge, MA, USA), PECAM-1 (Santa Cruz, Santa Cruz, CA, USA), and rabbit monoclonal antibody Ki67 (Thermo Fisher) were used.

Gprl77 is essential for development of craniofacial and body skeletons

To determine the role of Gprl77 in skeletal development, conditional deletion was performed in various skeletogenic cell types. First, a Gprl77^Dermo1 mutant mice was generated in which Gprl77 was inactivated by the Dermol-Cre transgene in mesenchymal cells. The mesenchymal deletion of Gprl77 severely impaired development of the craniofacial skeleton at embryonic day 15.5 (E15.5). Alizarin red and alcian blue staining showed that formation of the calvarial, maxillary and mandibular bones mediated by intramembranous ossification is defective or completely missing in the Gprl77^Dermo1 embryos (Figure 10A, D). Mineralization of the frontal bone was not detected in the mutants (Figure 11 A, B). Because Dermol-Cre induces recombination in the mesenchymal cells, Gprl77 is ablated not only in the precursors but also in their osteoblast derivatives. To further the assessment on the requirement of Gprl77 in the osteoprogenitors and osteoblasts, Gprl77°^sx and Gprl77^CoU mutants were generated, in which Gprl77 were inactivated by Osx-Cre and Collal-Cre, respectively. Compared to the control littermates, no obvious defect in development and mineralization of the craniofacial bones was detected in both mutants at E15.5 (Figure 10B, C, E, F and 2C-F). As the deletion of β-catenin by Osx-Cre severely impairs calvarial development, the analysis of Gprl 77 may provide new insight into the cell type responsible for Wnt production and signaling during intramembranous ossification. Although dispensable in the osteogenic cell types, Gprl 77 plays an important role in the mesenchymal cells essential for intramembranous ossification during calvarial development.

To determine the role of Gprl 77 in endochondral ossification, formation of the appendicular long bones in the Gprl77^Dermo1 mutants was examined. The mesenchymal deletion of Gprl 77 causes severe defects in development of the body skeleton, including forelimbs and hindlimbs at E15.5 (Figure 10G-L). Mineralization occurred in the collar bones and primary spongiosa of control littermates, but is missing in the Gprl77^Dermo1 mutants (Figure 11G, H). This is also accompanied by the lack of hypertrophic chondrocytes (Figure 1 II, J). To examine whether the presence of Gprl77 in the mesenchymal cells is sufficient for chondrogenesis, Gprl77^Co12 mutants were generated where Gprl 77 was inactivated by the Col2al -Cre transgene in chondrocytes. The removal of Gpr 177 in the chondrocytes caused defects in the axial and appendicular bone formation (Figure 10M, P). In the El 5.5 Gprl77^Co12 mutants, the long bones were shortened and bone matrix formation was dramatically affected (Figure ION, O, Q, ). The chondrogenic deletion of Gprl 77 significantly reduced bone mineralization, and interfered with chondrocyte maturation (Figure 11K-N). Therefore, it is necessary to have Gprl 77 present in the mesenchymal cells and the chondrocytes for endochondral ossification.

The role of Gprl77 in osteoblast development

The development of calvarial bone plates, including the frontal and parietal bones, are mediated by intramembranous ossification. At about E12.5, the initial formation of a frontal bone primordium, which is sandwiched between the developing eye and brain, initiates osteogenesis. The osteogenic process then extends apically from the skull base to the midline within the skeletogenic mesenchyme, characterized by expression of the osteoprogenitor markers, Runx2 and Osterix (Osx), and the osteoblast marker, Collal and Osteocalcin (OC) (Figure 12A-D). In contrast, the expression of these markers was either strongly reduced or not detectable in the Gprl77^Dermo1 mutants (Figure 12E-H), suggesting that the mesenchymal expression of Gprl 77 is essential for osteoblast differentiation.

To determine if the expansion of osteoblast precursors was also affected by the Gprl 77 ablation, cells undergoing mitotic division were detected by immunostaining of Ki67 (Figure 13 A, D). Consistent with prior observation, there are two populations of precursors, Runx2 -negative and Runx2 -positive, actively expanding in the skeletogenic mesenchyme during intramembranous ossification (Figure 13A-C). However, both of these populations were drastically reduced in the Gprl77^Dermo1 mutants (Figure 13D-G). The mesenchymal expression of Gprl 77 is therefore essential for expansion of precursor cells and their differentiation into osteoblast cell types.

Gprl77 in mesenchymal but not osteoprogenitor cells is necessary for Wnt production in activation of β-catenin signaling during intramembranous ossification

The loss of Gprl 77 could affect Wnt signaling during skeletal development. To assess this question, the activation of β-catenin and its transcriptional target, Axin2, was examined by immunostaining with an anti-activated form of β-catenin (ABC) and β-gal staining of Axin2^lacZ (Ax2^lacZ) knock-in allele, respectively. Nuclear expression of β-catenin and uniform activation of Axin2 were evident in the El 5.5 skeletogenic mesenchyme (Figure 14A, D, G, J). The expression of β-catenin and Axin2 was highly diminished in the Gprl 77^uermo1 (Figure 14B, E, H, K), but not the Gprl 77osx (Figure 14C, F, I, L) mutants. In the Osx-expressing osteoprogenitors, although β-catenin is required for Wnt signal transduction, the Gprl 77-mediated production of Wnt is apparently dispensable. The mesenchymal cells are the major and essential source of Wnt in osteoblastogenesis during calvarial morphogenesis.

To examine the signal producing and receiving cells of Wnt, the expression of Gprl 77 and Axin2, respectively, was investigated. While the expression of Osx was restricted to osteoprogenitors at the osteogenic front, Gprl 77 showed a uniform expression pattern in the skeletogenic mesenchyme (Figure 14M- ). Therefore, Gprl 77 is expressed in the osteoprogenitors even though their production of Wnt is not necessary for calvarial development. In agreement with β-catenin required for both mesenchymal and osteoprogenitor cells, it was found that canonical Wnt signaling is uniformly activated in the skeletogenic mesenchyme using the Axin2^lacZ allele (Figure 14S-U). These findings indicate that mesenchymal production of Wnt activates β-catenin signaling in mesenchymal and osteoblast cell types in calvarial bone development.

Gprl 77 is required for endochondral ossification

To determine the role of Gprl 77 in development of the body skeleton, a comprehensive molecular analysis examining the key steps of endochondral ossification, including chondrocyte proliferation, chondrogenesis, extracellular matrix (ECM) remodeling, vascular invasion and osteoblast differentiation was performed. The number of cells undergoing mitotic division is significantly reduced in the columnar zone, but not epiphyses of the Gprl 77^Dermo1 _and Q^r\ - - ^c°ⁿ humeruses, suggesting that expansion of the proliferating and prehypertrophic but not the resting chondrocytes was affected by the loss of Gprl 77 (Figure 15). In the Gprl 77^Dermo1 mutants, the expression of Col2al in the chondrocytes was not affected at E15.5 (Figure 16A, F). Two expression zones of Ihh and Coll Oal separated by the marrow cavity were evident in the control littermates (Figure 16B, C). However, Ihh and CollOal just began to be expressed in center of the Gprl 77^Dermo1 humerus, suggesting severe delay in chondrocyte maturation (Figure 16G, H). The expression of MMP9 and MMP13 in the hypertrophic chondrocytes during ECM remodeling was also absent in the mutants (Figure 16D, E, I, J). Vascular invasion, characterized by immunostaining of PECAM-1, did not occur as well (Figure 16K, P). Furthermore, the Gprl 77 ablation greatly impaired osteoblast differentiation. Strong expression of Runx2 in the perichondrium, collar bone and primary spongiosa, as well as hypertrophic chondrocytes of control was diminished significantly in the mutant (Figure 16L, Q). This was accompanied by decreased expression of Osx and Collal in the collar bone and perichondrium of Gprl77Dermoi (Figure 16M, N, R, S). The expression of

Osteocalcin (OC) in the bone collar region was not detectable (Figure 160, T). These results indicate that the disruption of endochondral ossification starts at chondrocyte maturation, and the subsequent events, including ECM remodeling, vascular invasion and osteoblastogenesis, are impaired in the Gprl77^Dermo1 mutants.

Endochondral ossification requires the presence of Gprl 77 in chondrocytes

The role of Gprl 77 in the chondrocytes during long bone development was examined. A comprehensive molecular analysis was carried out to examine the key steps of endochondral ossification in the E15.5 Gprl77^Co12 embryos. Similar to those of Gprl77^Dermo1, the expression of Col2al remained unchanged while the expression of Ihh was greatly reduced in the Gprl77^Co12 mutants (Figure 17A, B, F, G). The marrow cavity and its surroundings, defined by two hypertrophic zones expressing CollOal, were significantly smaller in the Gprl77^Co12 humerus (Figure 17C, H). In addition, the expression of MMP9, MMP13 and PECAM-1 indicated that ECM remodeling and vascular invasion are defective in the Gprl 77^Co12 mutants (Figure 17D, E, K, I, J, P). The expression of Runx2, Osx and Collal showed that osteoprogenitor cells are dramatically reduced and translocation of osteoblasts from the perichondrium to the nascent primary ossification center did not occur (Figure 17L-N, Q-S). Furthermore, the mature osteoblasts expressing OC were missing in the Gprl 77^Co12 mutants (Figure 170, T). At E17.5, bone formation remained severely impaired in the humerus of Gprl77^Co12, compared to the control (Figure 18). Collar bones normally extended from diaphysis to the perichondrial region (Figure 18A, B). However, no bone collar was formed in the perichondrial region of Gprl77^Co12 although mineralization of the hypertrophic chondrocytes was evident (Figure 18G, H). In addition, chondrogenesis, ECM remodeling and osteoblastogenesis were severely defective in the mutants (Figure 18C-F, I-L, M-X), suggesting the presence of Gprl 77 in the chondrocytes is essential for endochondral ossification.

Gprl 77 regulates Wnt signaling in long bone development

The effect of Gprl 77 deficiency on the canonical Wnt pathway during limb development was studied. The expression of Gprl 77 was found in the resting, proliferating and hypertrophic chondrocytes, as well as the perichondrium in the developing limb (Figure 19A-C). Nuclear staining of the activated β-catenin was strong in the resting and proliferating chondrocytes, and in the perichondrium, but very weak in the hypertrophic chondrocytes (Figure 19D-F). Immunostaining of Gprl 77 further showed the effective ablation of Gprl 77 in the proliferating and hypertrophic chondrocytes in the Gprl77^Dermo1 and Gprl77^Co12 mutants (Figure 19G-I). The reduction of nuclear β-catenin staining further indicated that the Gprl 77 deletion disrupts canonical Wnt signaling (Figure 19J-L). Crossing of the Ax2iacz allele into the Gpr 177^Dermo1 and Gprl 77^Co12 backgrounds revealed that the expression of Axin2 is drastically reduced in the chondrocytes and perichondrium (Figure 19M-0). The data show that Gprl 77 in the mesenchymal cells and chondrocytes is necessary for activation of canonical Wnt signaling during endochondral ossification. Figure 7P illustrates that, in development of the chondrocytes, mesenchymal and chondrocyte production of Wnt are both required for chondrogenesis.

Provided herein is evidence that Gprl 77 is required for skeletogenesis. Genetic inactivation of Gprl 77 in the mesenchymal cells severely impairs intramembranous and endochondral ossifications. Gprl 77 plays an essential role in osteoblastogenesis and chondrogenesis through modulation of cell proliferation and differentiation. Thus, these studies show that GP 177 can be targeted for treatment of diseases such as osteoporosis, characterized by decreased Wnt signaling, as well as treatment of osteoarthritis, characterized by increased Wnt signaling.

Example 3

Mouse strains

The Gprl77Fx, K5-Cre, Dermol-Cre, R26R, p-catAEx3Fx and Axin21acZ mouse strains, and genotyping methods are known in the art. For generating a Gprl77K5 mouse strain, mice carrying the K5- Cre transgene was first crossed with the Gprl77Fx/Fx mice to obtain the K5- Cre; Gprl77Fx/+ strain. The K5-Cre; Gprl77Fx/+ mice were then crossed with the

Gprl77Fx/Fx mice to obtain mice carrying the Gprl77K5 (genotype: K5-Cre; Gprl77Fx/Fx). A similar breeding strategy was used to generate the Gprl77^Dermo1 (genotype: Dermol-Cre;

Gprl77Fx/Fx) mutant strain. To examine the Cre activity, K5-Cre and Dermol-Cre mice were bred into the R26R heterozygous background to obtain the K5-Cre; R26R and Dermol-Cre; R26R mice, respectively. To simultaneously delete Gprl77 and monitor the Cre-mediated recombination, Gprl77^Dermo1 mice were crossed into the R26R background to obtain the

Gprl77^Dermo1; R26R mutants. The deletion of Gprl77 and expression of lacZ reporter occurred when Cre was expressed. For detecting the Axin2 expression, K5-Cre; Gprl77Fx/+ mice were crossed with mice homozygous for Gprl77Fx and Axin21acZ to create the Gprl77K5;

Axin21acZ (genotype: K5-Cre; Gprl77Fx/Fx; Axin21acZ+/-) mice. To express the stabilized β- catenin mutant protein in the Gprl77K5 mice, the K5-Cre; Gprl77Fx/+ mice were crossed with mice carrying Gprl77Fx/Fx and -catAEx3Fx/+ to generate the Gprl77K5; s catK5 strain. Care and use of experimental animals described in this work comply with guidelines and policies of the University Committee on Animal Resources at the University of Rochester.

Cells

To isolate epidermal and dermal cells, the dorsolateral skins were dissected from the

E14.5 embryos. The skin tissues were then incubated in 0.5% Dispase (STEMCELL

Technologies Inc., Vancouver, BC, Canada) at 4°C for 2 hours. The epidermal and dermal layers were separated from each other, followed by dissociating into single cells. Primary epidermal and dermal cells were cultured in the DMEM with 10% FBS in a humidified chamber with 5% CO-2 at 37°C. For detection of Wnt secretion, 293T cells were transfected with TOPFLASH and RL-TK plasmids and co-cultured with the dermal cells for 24 hours. Relative luciferase activity was determined using a dual reporter luciferase kit (Promega, Madison, WI, USA).

Histology, 3-gal staining, immunostaining, immunoblot and TUNEL analysis

Samples were fixed in formaldehyde or paraformaldehyde and then embedded to obtain paraffin sections which were stained with hematoxylin and eosin for histology or antibodies for immunological staining with avidin:biotinlylated enzyme complex. The immunological staining was visualized by enzymatic color reaction or fluorescence according to the manufacture's specification (Vector Laboratories, Burlingame, CA, USA). Images were taken using Zeiss Axio Observer microscope (Carl Zeiss, Thornwood, NY, USA). Immunoblot analysis was performed as described (Fu et al). Bound primary antibodies were detected with horseradish peroxidase- conjugated secondary antibodies, followed by enhanced chemical luminescence-mediated visualization (GE Healthcare Biosciences, Pittsburgh, USA) and autoradiography. Mouse monoclonal antibodies ABC (Millipore, Billerica, MA, USA), AE3 (Millipore), β-catenin (BD Biosciences, San Jose, CA, USA) BrdU (Thermo Scientific, Fremont, CA, USA), Collagen I (Abeam, Cambridge, MA, USA), Keratin 14 (Thermo Scientific) and SMA (Thermo Scientific); rabbit polyclonal antibodies Adiponectin 3 (ProSci, Poway, CA, USA), CD 133 (Novus, Littleton, CO, USA), Dvl2 (Cell Signaling Technology, Danvers, MA), phosphor-GSK3 (Cell Signaling Technology) and Gprl77; rabbit monoclonal antibody active caspase-3 (BD

Biosciences) were used in these analyses. Details for β-gal staining in whole mounts or sections are described above. TUNEL staining was performed using ApopTag (Millipore) as described (Maruyama et al, 2010; Yu et al, 2007).

RT-PCR analysis

Total RNA isolated from E14.5 mouse skins was subject to the first strand cDNA synthesis using oligoT primers in 20 μΐ for 1 hour at 50°C. The cDNA was then amplified by PCR (35 cycles, 94°C for 15 seconds, 58°C for 30 seconds and 72°C for 60 seconds) in 50 μΐ buffered solution containing 1 μΐ of the diluted reverse transcription product in the presence of 20 pmoles each of the sense and antisense primers specific for the various target sequences as listed.

Wnt 1 Forward ATGAACCTTCACAACAACGAG (SEQ ID NO: 5)

Wnt 1 Reverse GGTTGCTGCCTCGGTTG (SEQ ID NO: 6)

Wnt 2 Forward CTGGCTCTGGCTCCCTCTG (SEQ ID NO: 7)

Wnt 2 Reverse GGAACTGGTGTTGGCACTCTG (SEQ ID NO: 8)

Wnt 2b Forward CGTTCGTCTATGCTATCTCGTCAG (SEQ ID NO: 9)

Wnt 2b Reverse ACACCGTAATGGATGTTGTCACTAC (SEQ ID NO: 10)

Wnt 3 Forward CAAGCACAACAATGAAGCAGGC (SEQ ID NO: 1 1)

Wnt 3 Reverse TCGGGACTCACGGTGTTTCTC (SEQ ID NO: 12)

Wnt 3a Forward CACCACCGTCAGCAACAGCC (SEQ ID NO: 13)

Wnt 3a Reverse AGGAGCGTGTCACTGCGAAAG (SEO ID NO: 14) Wnt 4 Forward GAGAAGTGTGGCTGTGACCGG (SEQ ID NO: 15)

Wnt 4 Reverse ATGTTGTCCGAGCATCCTGACC (SEQ ID NO: 16)

Wnt 5a Forward CTCCTTCGCCCAGGTTGTTATAG (SEQ ID NO: 17)

Wnt 5a Reverse TGTCTTCGCACCTTCTCCAATG (SEQ ID NO: 18)

Wnt 5b Forward ATGCCCGAGAGCGTGAGAAG (SEQ ID NO: 19)

Wnt 5b Reverse ACATTTGCAGGCGACATCAGC (SEQ ID NO: 20)

Wnt 6 Forward TGCCCGAGGCGCAAGACTG (SEQ ID NO: 21)

Wnt 6 Reverse ATTGCAAACACGAAAGCTGTCTCTC (SEQ ID NO: 22)

Wnt 7a Forward CGACTGTGGCTGCGACAAG (SEQ ID NO: 23)

Wnt 7a Reverse CTTCATGTTCTCCTCCAGGATCTTC (SEQ ID NO: 24)

Wnt 7b Forward TCTCTGCTTTGGCGTCCTCTAC (SEQ ID NO: 25)

Wnt 7b Reverse GCCAGGCCAGGAATCTTGTTG (SEQ ID NO: 26)

Wnt 8a Forward ACGGTGGAATTGTCCTGAGCATG (SEQ ID NO: 27)

Wnt 8a Reverse GATGGCAGCAGAGCGGATGG (SEQ ID NO: 28)

Wnt 8b Forward TTGGGACCGTTGGAATTGCC (SEQ ID NO: 29)

Wnt 8b Reverse AGTCATCACAGCCACAGTTGTC (SEQ ID NO: 30)

Wnt 9a Forward GCAGCAAGTTTGTCAAGGAGTTCC (SEQ ID NO: 31)

Wnt 9a Reverse GCAGGAGCCAGACACACCATG (SEQ ID NO: 32)

Wnt 9b Forward AAGTACAGCACCAAGTTCCTCAGC (SEQ ID NO: 33)

Wnt 9b Reverse GAACAGCACAGGAGCCTGACAC (SEQ ID NO: 34)

Wnt 10a Forward CCTGTTCTTCCTACTGCTGCTGG (SEQ ID NO: 35)

Wnt 10a Reverse CGATCTGGATGCCCTGGATAGC (SEQ ID NO: 36)

Wnt 10b Forward TTCTCTCGGGATTTCTTGGATTC (SEQ ID NO: 37)

Wnt 10b Reverse TGCACTTCCGCTTCAGGTTTTC (SEQ ID NO: 38)

Wnt 11 Forward CTGAATCAGACGCAACACTGTAAAC (SEQ ID NO: 39)

Wnt 11 Reverse CTCTCTCCAGGTCAAGCAGGTAG (SEQ ID NO: 40)

Wnt 16 Forward AGTAGCGGCACCAAGGAGAC (SEQ ID NO: 41)

Wnt 16 Reverse GAAACTTTCTGCTGAACCACATGC (SEQ ID NO: 42)

Shh Forward GGAACTCACCCCCAATTACA (SEQ ID NO: 43)

Shh Reverse GAAGGTGAGGAAGTCGCTGT (SEQ ID NO: 44)

Edar Forward GCCCTACATGTCCTGTGGAT (SEQ ID NO: 45)

Edar Reverse GGCCTGAGAGCTCTTTGTGA (SEQ ID NO: 46)

BMP2 Forward AGGCGAAGAAAAGCAACAGA (SEQ ID NO: 47)

BMP2 Reverse GTCTCTGCTTCAGGCCAAAC (SEQ ID NO: 48)

BMP4 Forward TGAGAGACCCCAGCCTAAGA (SEQ ID NO: 49)

BMP4 Reverse AAACTTGCTGGAAAGGCTCA (SEQ ID NO: 50)

Lefl Forward CACACATCCCGTCAGATGTC (SEQ ID NO: 51)

Lefl Reverse TGAGGCTTCACGTGCATTAG (SEQ ID NO: 52)

Dkk4 Forward GTGGAAGACACAAGGCCAGT (SEQ ID NO: 53)

Dkk4 Reverse TGGAGCAGACTTGTCCCTCT (SEQ ID NO: 54)

In situ hybridization

In situ hybridization analysis was performed as described above. In brief, embryos were incubated with digoxygenin labeled probes, followed by recognition with an alkaline phosphatase conjugated anti-digoxygenin antibody. To visualize the bound signals, samples were incubated with BM-purple for 4-5 hours. The RNA probes were generated using a PCR based methods known in the art. Briefly, T3 or T7 promoter sequences were introduced to the 5-prime end of the reverse and forward primers, enabling the synthesis of antisense and sense transcripts, respectively. PCR fragments were then amplified using gene-specific primers and purified with Quick-spin columns (Qiagen Inc., Valencia, CA, USA), followed by generation of the digoxigenin labeled probes using T3 or T7 R A polymerase.

Epidermal Wnt controls hair follicle induction by orchestrating dynamic signaling crosstalk between the epidermis and dermis

The expression of Gprl 77 was examined in order to determine the cell type responsible for the production of Wnt signals during hair follicle induction. Using an antibody specifically recognizing GprlW, immunostaining analysis revealed that GprlW is expressed in the epithelium and the underlying mesenchyme at El 1.5 and E13.5 (Fig. 20A, B). In the epithelium, the expression of Gprl was restricted to the developing hair follicles and the basal layer of epidermis after the induction of hair follicles at E13.5 (Fig. 20C, D). Co-labeling of GprlW with AE3, a marker for the entire epidermis, or K14, a marker for the epidermal basal layer, further indicated that the epidermal basal cells and the hair follicular cells express high levels of GprlW (Fig. 20E-L).

To determine the requirement of GprlW in the epidermis of skin, Gprl W^K5 mutant mice in which Gprl 77 was inactivated by the expression of Cre in Keratin 5 (K5) expressing cells were generated. Using the R26R reporter allele, β-gal staining of the El 3.5 and El 4.5 skins showed the effectiveness of Cre-mediated recombination in the epidermis and developing hair follicles (Fig. 21A, B). Immunostaining for GprlW further indicated its successful ablation in the epidermis, but not dermis, of Gprl W^K5 (Fig. 21C, D). No hair placodes and follicles were detected in the Gprl W^K5 mutants at E14.5 and E17.5, respectively, suggesting an essential role of Gprl 77 in the epidermis for hair follicle induction (Fig. 21E-H; 100%, n=15). Next, the expression of placode/follicle-specific genes affected by the loss of Gprl77 at E14.5 were examined. No expression of ectodysplasin receptor (Edar), BMP2, BMP4 and Shh was found, indicating no formation of the placodes in the Gprl77^K5 mutants (Fig. 21I-P). The results imply that the presence of Gprl 77 in the epidermis could be be involved in the regulation of Wnt which is the earliest developmental signal known to turn on the programming for hair follicle induction. Multiple members of the Wnt family were found to be expressed in distinct patterns in the developing skin with a few candidates, e.g. Wnt3, Wnt 10a and Wnt 10b, strongly implicated in hair follicle morphogenesis. The expression of all 19 mouse Wnt genes in the E14.5 skin was first examined by RT-PCR analysis. Transcripts of Wnts2, 3, 4, 5a, 6, 7a, 7b, 10a, 10b, 11 and 16 were detected and their expression patterns were further characterized during hair follicle induction (Fig. 22). In situ hybridization analysis revealed that Wnts2, 3, 7a, 7b and 10a are expressed in the epidermal cells (Fig. 23 A, B, F, G, H); Wnts5a and 11 in the dermal cells (Fig. 23D, J); Wnts4, 6, 10b and 16 both the epidermal and dermal cells (Fig. 23 C, E, I, K). Furthermore, the Wnts3, 4 and 6 transcripts were evenly distributed throughout the epidermis, including the hair placode and interfollicular epithelium (Fig. 23B, C, E). While Wnts2, 7b, 10a and 10b showed elevated expression in the hair placode (Fig. 23 A, G, H, I), Wnts7a and 16 were expressed mainly in the interfollicular epithelium (Fig. 23F, K). The inactivation oi Gprl 77 abolished the epidermal expression of Wnts2, 7a, 7b, 10a and 10b (Fig. 23A', F', G', FT, Γ). In contrast, Wnts3, 4, 6 and 16 genes remained active in the Gprl77^K5 mutants (Fig. 23B', C, Ε', K'). Furthermore, the dermal expression of Wnts5a and 11 genes was not affected by the epidermal ablation of Gprl77 (Fig. 23D', J'). Based on these data, the hair follicle-expressing Wnt genes were categorized into two groups: the first one, consisting of Wnts3, 4 and 6, was evenly expressed in the hair placode and interfollicular epithelium and the second one, consisting of Wnts2, 7b, 10a and 10b, exhibited elevated expression in the hair placode. The second, but not the first, group was affected by the epidermal deletion of Gprl77. The results imply a potential hierarchy of Wnt activation during hair follicle development. Because β-catenin signaling is required for early onset of hair follicle morphogenesis whether or not the the canonical Wnt pathway was affected by the Gprl77 deletion was examined. Immunostaining of the control and Gprl77^K5 mutant skins revealed a drastic reduction of an activated form of β-catenin (ABC) in the hair placode and the underlying mesenchyme at E14.5 (Fig. 23L, L'), and in the hair follicular epithelial and dermal cells at E17.5 (Fig. 23M, M'). The reduction of active β-catenin was also accompanied by the loss of expression of its direct transcriptional targets, Axin2 (Fig. 24N, ', O, O'), Lefl (Fig. 23P, P') and Dkk4 (Fig. 23Q, Q'), all of which are critically involved in hair follicle development.

An early activation of Wnt/ -catenin signaling in the upper dermis immediately adjacent to the epidermis occurs prior to the appearance of the placode at El 3.5 (Fig. 23N). This early activation is totally disrupted by the deletion of Gprl77 in the epidermis (Fig. 23N'), suggesting that Wnt secretion from the epidermis drives the early response of β-catenin signaling in the dermis. Subsequently, the patterned signaling activity of Wnt/ -catenin necessary for hair follicle morphogenesis is impaired. In addition to cell fate specification and differentiation, Wnt is also a key signal for cell proliferation and survival during skin organogenesis. BrdU incorporation analysis revealed that the percentage of actively proliferating cells was significantly reduced in the epidermis, but not dermis, of Gprl77^K5, compared to the littermate control (Fig. 24A-C, mutant: 23.91±0.01% and control: 34.03±0.03%; p value <0.01, n=3). In contrast, no alteration in programmed cell death was detected (Fig. 24D-I). These results indicated a detrimental effect of the GprlW deletion on the canonical Wnt pathway, suggesting a mechanism underlying the induction of hair follicles mediated through GprlW-dependent β- catenin signaling.

To definitively assess that the impairment of β-catenin signaling is responsible for the hair follicle defects, a -catAEx3Fx allele was introduced into the Gprl77^K5 mice to generate the Gprl77^K5; s catK5 model. In these mutants, a stabilized β-catenin mutant was expressed in the developing epidermis due to the Cre-mediated deletion of exon 3 of β-catenin. By restoring the signaling activity of β-catenin in the epidermal cells, whether the block in hair follicle induction caused by the Gprl77 deletion could be alleviated was examined. Hair placode-like structures were apparent in the Gprl77^K5; s catK5 skins, suggesting that induction has occurred at E15.5 (Fig. 25A-C; 100%, n=3). Immunostaining analysis further showed that epidermal activation of β-catenin takes place in the absence of Gprl77 (Fig. 25D-I). Nonetheless, dermal activation of β-catenin remained absent in the Gprl77K5; sβcatK5 skins (Fig. 25G-I). To demonstrate the proper induction of hair follicles, the expression of Edar and Shh were examined. These are evident in the control but missing in the Gprl77^K5 skins (Fig. 25J, K, M, N). However, expression of the β-catenin mutant was able to activate Edar and Shh in the placode-like structures of Gprl77^K5; sβcatK5, suggesting a restoration of placode signals (Fig. 25L,0). Therefore, β-catenin activation was able to overcome the block in hair follicle induction caused by the epidermal deletion of Gprl77.

The subsequent development of hair follicles after the initial induction was examined. The formation of hair placodes triggers a clustering of underlying mesenchymal cells to form dermal condensates, leading to the development of dermal papilla expressing CD 133. The CD133 positive dermal papilla cells were present in the control, but absent in the Gprl77^K5; sβcatK5 mutants (Fig. 25P-R). Analysis of another dermal papilla marker, Sox2, showed similar results (Fig. 25S-U). Although epidermal activation of β-catenin alleviated the defects associated with initial induction of hair follicles, it failed to induce the neighboring mesenchymal cells to form dermal condensates. These data indicate that Wnt^-catenin signaling induced by the epidermal Wnt is essential for initial induction of hair follicles within the epidermis. They also show that the subsequent development of dermal papilla requires Wnt secretion from the epithelial cells to induce Wnt signaling in the mesenchymal cells.

To investigate the requirement of Wnt production contributing to the first dermal signal essential for hair follicle induction, the Gprl77^Dermo1 model was generated. In this model, Gprl77 was inactivated in the mesenchymal cells of the developing dermis by a Dermol-Cre transgene. Using the R26R reporter allele, β-gal staining of the El 4.5 skins showed the efficiency of Cre-mediated recombination in the mesenchymal cells of developing dermis (Fig. 25A, B). Immunostaining of GprlW further showed its successful removal in the dermis, but not epidermis, of Gprl77^Dermo1 (Fig. 25C-F). The dermal deletion of GprlW had no effect on the formation of hair placodes at E15.5, suggesting that Gprl77-mediated Wnt production could be dispensable in the dermis for hair follicle initiation (Fig. 25G, H; 100%, n=8).

Immunostaining of Cadherin proteins showed that the morphology of follicular epithelial cells in the mutants is comparable to that of control (Fig. 26I-L). Although Edar and Shh were expressed in the hair placodes, we consistently detected their expression at lower levels in the mutants (Fig. 26M-P). Nonetheless, there were sufficient placode signals to promote the subsequent development in the underlying mesenchyme as the formation of the dermal condensate was not affected in the Gprl77^Dermo1 mutants (Fig. 26Q, R). Although the dermal deletion of Gprl77 had minimal effects on hair follicle induction, the dermal layer of

Gprl77^Dermo1 exhibited a loose structure with significant abnormalities (Fig. 27). The percentage of active proliferating cells was significantly reduced in the dermis, but not the epidermis, of Gprl77^Dermo1, compared to the littermate controls (Fig. 27A-C, mutant: 19.01±0.03% and control: 32.21±0.03%; p value <0.01, n=3). In contrast, no alteration in apoptosis was detected (Fig. 28D-I). The dermal deletion affected cell-type specification of mesenchymal cells into fibroblasts, smooth muscle cells and adipocytes modulated by Wnt during dermal development. An apparent shift of dermal cell identity to favor adipocytes in the Gprl77^Dermo1 mutants (Fig. 27J-P) was observed.

Analysis of ABC and Axin2 expression further indicated that there was no significant difference in the pattern of Wnt/ -catenin signaling (Fig. 26S-X). In the upper dermis of Gprl77^Dermo1, the early activation of Wnt/ -catenin signaling remained detectable prior to the appearance of hair placodes at E13.5 (Fig. 26U, V). To ensure that Gprl77 is required for Wnt production in the dermis, Wnt secretion assays were performed. Primary dermal cells isolated from the control and Gprl77^Dermo1 were used as the signal-producing cells. These cells were then co-cultured with the signal-receiving cells harboring a TOPFLASH reporter for the β- catenin and Lef/Tcf-dependent transcription. While the control dermal cells were capable of activating the TOPFLASH reporter, this activation was significantly reduced and close to the background level in the Gprl77Dermol dermal cells, suggesting an impairment of Wnt secretion (Fig. 28A). Furthermore, activation of several Wnt signaling mediators, including Dvl2, GSK3 and β- catenin, did not seem to be affected in the dermis and epidermis of Gprl77^Dermo1 most likely due to the presence of epidermal Wnt (Fig. 28B). However, using the ex vivo culture of primary cells, it was found that Wnt signaling activation is impaired in the dermal cells of GprlW"⁶™⁰¹ (Fig. 28B). These results indicate that GprlW is essential for Wnt secretion in the dermis.

As shown herein, Wnt production mediated by GprlW is essential to hair follicle induction. An intra-epidermal Wnt signal is necessary and sufficient for hair follicle initiation, but subsequent development depends on reciprocal signaling crosstalk of epidermal and dermal cells. Wnt signals within the epidermis and dermis, and crossing between the epidermis and dermis (Fig. 29), have distinct roles and specific functions in skin development. These results not only define the cell type responsible for Wnt production, but also defines the dynamic regulation of Wnt signaling at different steps of hair follicle morphogenesis.

Claims

What is claimed is:

1. A method of decreasing Wnt signaling in a cell, comprising contacting the cell with a GPR177 inhibitor, wherein the cell has increased Wnt signaling as compared to a control.

2. The method of claim 1, wherein the cell is a cancer cell.

3. The method of claim 1 or 2, wherein the GPR177 inhibitor decreases Wnt signaling.

4. The method of any of claims 1-3, wherein the GPR177 inhibitor decreases Wnt secretion

5. The method of any of claims 1-4, further comprising selecting a cell with increased Wnt signaling as compared to a control.

6. A method of increasing Wnt signaling in a cell, comprising contacting a cell with a GPR177 agonist, wherein the cell has decreased Wnt signaling as compared to a control.

7. The method of claim 6, wherein the GPR177 agonist increases Wnt signaling.

8. The method of any of claims 6-7, further comprising selecting a cell with decreased Wnt signaling as compared to a control.

9. The method of any of claims 1-8, wherein the cell is in a subject.

10. A method of treating a Wnt signaling disorder in a subject, comprising administering to the subject a GPR177 inhibitor.

1 1. The method of claim 10, wherein the subject has increased Wnt signaling as

compared to a control subject.

12. The method of claim 10, further comprising selecting a subject with increased Wnt signaling as compared to a control subject.

13. The method of claim 10 or 1 1, wherein the disorder is a cancer, osteoarthritis,

skeletal dysplasia, diabetes, obesity or a respiratory disease.

14. The method of claim 13, wherein the cancer is selected from the group consisting of skin cancer, colon cancer, breast cancer, prostate cancer, esophageal cancer, rectal cancer, throat cancer, lung cancer, stomach cancer, leukemia, lymphoma, liver cancer, endometrial cancer, ovarian cancer, and prostate cancer.

15. The method of any of claims 10-14, wherein the GPR177 inhibitor decreases Wnt signaling.

16. The method of claim 15, wherein Wnt signaling is decreased.

17. The method of any of claims 10-16, wherein the GPR177 inhibitor decreases Wnt expression.

18. A method of treating a Wnt signaling disorder in a subject, comprising administering to the subject a GPR177 agonist.

19. The method of claim 18, wherein the subject has decreased Wnt signaling as

compared to a control subject.

20. The method of claim 18, further comprising selecting a subject with decreased Wnt signaling as compared to a control subject.

21. The method of claim 18 or 20, wherein the disorder is a neurological disorder, osteoporosis, bone fracture healing, hair loss, diabetes, obesity, tissue regeneration, tissue impairment or hair graying.

22. The method of any of claims 18-21, wherein the GPR177 agonist increases Wnt signaling.

23. The method of claim 22, wherein Wnt signaling is increased.

24. The method of any of claims 18-23, wherein the GPR177 agonist increases Wnt secretion.

25. A method of identifying a GPR177 inhibitor that decreases Wnt signaling

comprising:

a) contacting a cell with a test compound, wherein the cell has increased Wnt signaling;

b) measuring GPR177 activity or expression; and

c) measuring Wnt signaling, wherein a decrease in GPR177 activity or

expression and a decrease in Wnt signaling as compared to a control indicates that the compound is a GPR177 inhibitor that decreases Wnt signaling.

26. A method of identifying a GPR177 inhibitor that decreases Wnt signaling

comprising:

a) contacting a cell with an agent that binds GPR177, wherein the cell has increased Wnt signaling; and

b) measuring Wnt signaling in the cell, a decrease in Wnt signaling as compared to a control indicating the agent is an GPR177 inhibitor that decreases Wnt signaling.

27. The method of claim 25 or 26, wherein the cell is a cancer cell.

28. The method of any of claims 25-27, wherein Wnt-1 signaling is measured.

29. The method of any of claims 25-27 ^', wherein Wnt-3,Wnt3a or Wnt5a signaling is measured.

30. A method of identifying a GPR177 agonist that increases Wnt signaling comprising: a) contacting a cell with a test compound, wherein the cell has decreased Wnt signaling;

b) measuring GPR177 activity or expression; and

c) measuring Wnt signaling, wherein an increase in GPR177 activity or

expression and an increase in Wnt signaling as compared to a control indicates that the compound is a GPR177 agonist that decreases Wnt signaling.

31. A method of identifying a GPR177 agonist that increases Wnt signaling comprising: a) contacting a cell with an agent that binds GPR177, wherein the cell has decreased Wnt signaling; and

b) measuring Wnt signaling in the cell, an increase in Wnt signaling as

compared to a control indicating the agent is an GPR177 agonist that increases Wnt signaling.

32. The method of claim 30 or 31, wherein the cell is a C3H10T1/2 cell an MC3T3 cell, a primary mouse calvarial cell, a primary mouse mammary epithelial cell or a primary mouse embryonic fibroblast.

33. The method of any of claims 30-32, wherein Wnt-1 signaling is measured.

34. The method of any of claims 30-32, wherein Wnt-3,Wnt3a or Wnt5a signaling is measured.